Ribozymes comprising a target binding domain

Abstract

The present application discloses a ribozyme comprising a target binding domain, the target binding domain being used to bind to a target RNA molecule. The ribozyme further comprises one or more catalytic domains and one or more releasable RNA segments flanked by two ribozyme cleavage sites, wherein activation of the catalytic domain of the target RNA molecule results in cleavage at the ribozyme cleavage site, which results in the release of the releasable RNA segment from the ribozyme. The present application further discloses the use of the ribozyme for detecting the presence of a target RNA molecule or amplifying a target RNA molecule.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to Singapore Provisional Application No. 10201903323U filed on April 12, 2019, the contents of which are incorporated herein by reference in their entirety for all purposes. Field of the Invention

[0003] The present invention relates to the field of biochemistry, in particular to the field of molecular biology. In particular, the present invention relates to ribozymes engineered to contain one or more target binding domains. Background of the Invention

[0005] Although RNA is often thought of as merely an intermediate messenger between the inherited genetic code (DNA) and its functional output (protein), it is now clear that the levels and profiles of both coding and noncoding RNA in cells and individuals reveal a wealth of information beyond their messenger function. Although physicians have traditionally relied on medical history, symptoms, biopsies, and other procedures to form a diagnosis, with the advent of advanced sequencing and personalized medicine, the detection and measurement of various types of RNA molecules are now increasingly important for guiding clinical decisions.

[0006] A class of RNA molecules of particular interest is microRNA (miRNA). MiRNA is an endogenous short non-coding RNA that binds to and downregulates target mRNA, which is dysregulated in many human diseases. The miRNA expression signature is associated with patient diagnosis, disease staging, prognosis, and response. Importantly, miRNAs are found to circulate in the blood, which allows for minimally invasive procedures to detect them. Data related to miRNA signatures of disease and treatment responses continue to increase, and more than 100 clinical trials have incorporated miRNA as biomarkers to date. Although there are clinical methods for measuring miRNA (mostly based on RT-qPCR), since the concentration of miRNA in biological samples (such as serum) is often extremely low, samples often require RNA purification and concentration before detection. These operations require reverse transcription via DNA intermediates. Therefore, tools and methods that can directly amplify target miRNAs or amplify their signals in biological samples without the use of proteases or the use of DNA intermediates can enhance our ability to perform cheap and effective RNA detection.

[0007] The ability to detect RNA molecules is also extremely important for diagnosing viral infections. There are at least 47 RNA virus families. Several RNA virus families cause diseases with significant disease burdens: severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (which causes COVID-19), Ebola, SARS, West Nile fever, hepatitis C, influenza, and measles, while other RNA virus families are associated with plant viruses that cause severe crop yield losses, such as potato virus Y (PVY). During viral disease outbreaks, sensitive, convenient, reliable, and rapid methods for diagnosis are critical for rapid containment. Current conventional methods for diagnosing RNA virus infections are mainly based on PCR (especially for new viruses; although serological tests can be developed, they are generally not widely used), and require that the RNA in the sample be first isolated and reversely transcribed into cDNA, then amplified with specific primers, and then the amplified product is detected with RT-qPCR using fluorescent dyes. This requires expensive reagents, specialized equipment, and advanced skill sets for analysis. Because samples must be sent to specialized laboratories, this slows down diagnosis during outbreaks. CRISPR-based technologies such as DETECTR (Chen et al., CRISPR-Cas12a target-binding unleashes indiscriminate single-stranded DNase activity. Science 2018) and SHERLOCK (Gootenberg, JS et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439-444, doi: 10.1126 / science.aaq0179 (2018)) show the prospect of point-of-care (POC) detection, but require the use of expensive isothermal amplification enzymes and amplification of CRISPR reagents. The main obstacle in the development of low-cost diagnostics for viral RNA is the lack of methods that can directly amplify and detect RNA without enzymes and through DNA intermediates.

[0008] In summary, there is a need to provide simple and efficient tools for amplifying and detecting target RNA molecules or their signals, which would enable rapid and efficient detection of RNA markers and viral RNA for different diagnostic applications. SUMMARY OF THE INVENTION

[0010] In one aspect, the present disclosure relates to a ribozyme comprising: a) one or more catalytic domains, the catalytic domains being capable of switching between an active state and an inactive state; b) one or more releasable RNA segments, wherein each of the releasable RNA segments is flanked by two ribozyme cleavage sites, wherein each cleavage site is cleaved by at least one of the one or more catalytic domains in the active state; c) one or more target binding domains, each of the one or more target binding domains being used to bind to a target RNA molecule; wherein each of the one or more catalytic domains is linked to one of the one or more target binding domains, wherein when the target binding domain linked to the catalytic domain does not bind to the target RNA molecule, the catalytic domain is in an inactive state, and wherein when the target binding domain linked to the catalytic domain binds to the target RNA molecule, the catalytic domain is in an active state; and wherein when both cleavage sites flanking the releasable RNA segments are cleaved by the one or more catalytic domains, the one or more releasable RNA segments are released from the ribozyme.

[0011] On the other hand, the present disclosure relates to a method for detecting the presence of a target RNA molecule in a sample, wherein the method comprises: a) incubating the sample with a ribozyme of the present disclosure at a temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme; b) incubating the sample at a temperature T2, which allows the target RNA molecule and the releasable RNA segment to be released from the ribozyme; c) detecting the release of the releasable RNA segment from the ribozyme.

[0012] In yet another aspect, a method for amplifying a target RNA molecule is also provided, wherein the method comprises: a) incubating the target RNA molecule with a ribozyme of the present disclosure at a temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme, and wherein the releasable RNA segment comprises a sequence consistent with the target RNA molecule; b) incubating the ribozyme bound to the target RNA molecule at a temperature T2, which allows the target RNA molecule and the RNA segment to be released from the ribozyme. In another embodiment, steps a) to b) are repeated one or more times, wherein the target RNA molecule and the releasable RNA segment released from step b) are used to bind another copy of the ribozyme.

[0013] In yet another aspect, a method for diagnosing a disease in a subject is provided, the method comprising: a) obtaining a sample from the subject; b) incubating the sample with a ribozyme of the present disclosure at temperature T1, which allows disease-associated target RNA molecules to bind to one or more target binding domains contained in the ribozyme; c) incubating the sample at temperature T2, which allows the target RNA molecules and releasable RNA segments to be released from the ribozyme; d) detecting the level of the releasable RNA segment from the ribozyme.

[0014] In yet another aspect, polynucleotides encoding ribozymes of the present disclosure are provided.In some embodiments in which the ribozyme consists of more than one RNA strand, the RNA strands may be encoded together by one polynucleotide or independently by several polynucleotides.

[0015] In another aspect, a kit comprising a ribozyme of the present disclosure is further provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and accompanying drawings, in which:

[0018] FIG. 1 (AI). Exemplary and non-limiting structures formed by ribozymes of the present disclosure. The motifs are labeled in accordance with the labeling of Structure IV in the Detailed Description of the Invention. (AC) Examples of ribozymes formed by one RNA strand and having one target binding domain. The ribozyme of FIG. A is characterized by forming two 4-way connectors on either side of a releasable RNA segment (motif [E]), having an extended catalytic domain (motifs [C] and [c]), an optional inhibitory domain (motifs [B] and [b]), and a target binding domain (motifs [A] and [a]) based on one of the helices of one of the 4-way connector structures. The ribozymes of FIG. B and C adopt a similar structure to FIG. A, except that the 4-way connector formed by the region between motifs [D] and motif [e] is replaced by a 3-way connector (FIG. B) or a 2-way connector (FIG. C). (DI) Examples of ribozymes formed by two RNA strands and having two target binding domains. The ribozyme of Figure D is characterized in that two 4-way connectors are formed on either side of the releasable RNA segment, and each side includes a catalytic domain, an optional inhibitory domain, and a target binding domain. Except that the 4-way connector is replaced by a 3-way connector and a 2-way connector, the ribozyme of Figure E and F adopts a structure similar to Figure D. Each ribozyme in Figure DF can be considered as a tandem ribozyme, which is connected in reverse by two "mono-ribozymes" (therefore being "tandem ribozymes connected in reverse"), and the two "mono-ribozymes" show an approximate "mirror" direction. And the ribozyme of Figure GI can also be considered as a tandem ribozyme connected by two "mono-ribozymes", and the two "mono-ribozymes" adopt the same direction (therefore being named "repeated tandem ribozymes"). The ribozyme of Figure G is characterized in that two 4-way connectors are formed on either side of the releasable RNA segment. Except that one of the 4-way connectors is replaced by a 3-way connector (Figure H) or a 2-way connector (Figure I), the ribozyme of H and I adopts a structure similar to the ribozyme of Figure G. The arrow indicates the cleavage site on the ribozyme.

[0019] Figure 2 . Working principle of the ribozyme as an RNA sensor and amplifier. The variable motif [b] connecting the motif [c] (of the catalytic domain) and the motif [a] (of the target binding domain) is designed to have complementarity with the motif [C] of the catalytic domain. Upper figure: In the absence of a target RNA molecule, the binding between [b] and [C] acts as a "toehold" to minimize self-cleavage, preventing cleavage of the cleavage site [D] and release of the releasable RNA segment. Lower figure: As the target RNA molecule binds to the target binding domain, the catalytic domain is activated, which results in cleavage at the cleavage site and the release of the releasable RNA segment (the sequence of this product can be different, and in some embodiments it exhibits loose complementarity with the ribozyme, thereby biasing cleavage rather than religation). The final cleavage product includes a releasable RNA segment flanked by 2-4 nucleotides from the cleavage site. The arrow indicates the cleavage site.

[0020] Figure 3 The working principle of the ribozyme as an RNA sensor and amplifier is as described in the specific embodiment with labeled nucleotides. In this embodiment, the release of both the RNA cleavage product and the target RNA molecule can be promoted at the melting temperature, which can be determined based on the length and degree of the complementary region. The released target RNA molecule can be combined with the uncut ribozyme (excessive presence) again in a new round of circulation. Because the ribozyme is excessive, a given copy number of the target RNA molecule can activate the self-cleavage of the ribozyme, resulting in the release of multiple cleavage products, thereby amplifying the target RNA signal.

[0021] Figure 4 . The self-cleavage of the exemplary ribozyme (with the microRNA dme-ban-5p as its target RNA molecule) directly amplifies the RNA signal by cutting off increasing levels of releasable RNA fragments (in this example, ban-3pR RNA). Increasing the number of cycles (from 3 to 5 to 10 cycles) or increasing the target RNA level (from 0 (water only) to 20nM to 50nM) leads to an increase in the amount of cleavage products, thereby amplifying the target RNA. 200nM of ribozyme was provided in each reaction.

[0022] Figure 5 Further increasing the number of cycles (from 10 to 20 to 30 cycles) or increasing the length of the cycle time (from 15 min to 30 min) resulted in a greater multiplication of the amount of cleavage product produced by the exemplary ribozyme (with microRNA dme-ban-5p as its target RNA molecule) and further amplification of the target RNA. 200 nM of ribozyme and 50 nM of target RNA molecule were provided in each reaction, i.e., the ratio of ribozyme: target was 4:1.

[0023] Figure 6 The ribozyme can amplify human microRNAs, as demonstrated herein using an exemplary ribozyme with hsa-let-7f as its target RNA molecule. The ribozyme is able to amplify the target RNA molecule by about 200-fold, which is calculated by normalizing all cleavage products based on the S2 loading control and subtracting the background cleavage in the control (water). For each reaction, 200 nM of the ribozyme and 50 nM, 10 nM, or 0.1 nM of the target miRNA were added.

[0024] Figure 7.The ribozyme with human microRNA hsa-let-7f as its target is specific for its target and is able to detect and amplify its target from a complex RNA mixture. Although the addition of hsa-let-7f activates the ribozyme more strongly than the no target (water control), the addition of 50nM of a different miRNA sequence (hsa-miR-122-5p) does not increase the cleavage activity to above background cleavage, indicating that the ribozyme is not activated. When equal concentrations of hsa-let-7f-5p and hsa-miR-122-5p are added (50nM each), the ribozyme maintains its specific cleavage of hsa-let-7f-5p. When 10, 100 or 1000 times of total RNA from Drosophila melanogaster is added to the reaction, the ribozyme is still able to detect and amplify hsa-let-7f-5p. 200nM of ribozyme is provided in each reaction.

[0025] Figure 8 The ribozyme can detect and amplify target RNA molecules of 40nt, 60nt and 80nt in length, which contain RNA sequence fragments of genes (Orf1ab and E genes) from the genome of the coronavirus SARS-CoV-2. 200nM of ribozyme and 50nM of target RNA were provided in each reaction. See Methods for additional details.

[0026] Fig. 9 . The cleavage product from the ribozyme can activate the Pandan fluorescent sensor. In this embodiment, the cleavage product is dme-ban-3p, and the target RNA molecule of the ribozyme is dme-ban-5p. Compared with the catalytic mutant that cannot be cleaved even in the presence of the target, the cleavage product can activate the Pandan fluorescent sensor for dme-ban-3p. The fluorescence test was performed in triplicate.

[0027] Figure 10 (A, B). Single catalytic domain configurations can cleave two cleavage sites to result in the release of RNA products. (A) "Single catalytic domain" design for detection and amplification of microRNA dme-ban-5p to cleave and release ban3p-reverse RNA. Two "single catalytic domain" configurations (i and ii) are shown. (B) Designs 1 and 2 both effectively release cleavage products after incubation with target RNA molecules.

[0028] Fig.11 For ribozymes targeting dme-ban-5p (target RNA molecule), melting temperatures ranging from 50°C to 90°C were tested in cleavage reactions. 200 nM ribozyme and 50 nM target RNA molecule were provided in each cleavage reaction. Ribozyme cleavage was performed at 37°C.

[0029] Fig.12 . Construction of exemplary ribozymes. The sequences and primers used to construct a specific ribozyme are mapped onto the ribozyme structure to show the design and construction methods. DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention provides ribozymes useful for sensing and amplification of RNA.

[0032] In a first aspect, the present invention relates to a ribozyme comprising: a) one or more catalytic domains, which are capable of switching between an active state and an inactive state; b) one or more releasable RNA segments, wherein each of the releasable RNA segments is flanked by two ribozyme cleavage sites, wherein each cleavage site is cleaved by at least one of the one or more catalytic domains in the active state; c) one or more target binding domains, each of the one or more target binding domains being used to bind to a target RNA molecule; wherein each of the one or more catalytic domains is connected to one of the one or more target binding domains, wherein when the target binding domain connected to the catalytic domain does not bind to the target RNA molecule, the catalytic domain is in an inactive state, and wherein when the target binding domain connected to the catalytic domain binds to the target RNA molecule, the catalytic domain is in an active state; and wherein when both cleavage sites flanking the releasable RNA segment are cleaved by the one or more catalytic domains, the one or more releasable RNA segments are released from the ribozyme.

[0033] The term "ribozyme" as used in this article refers to an RNA molecule that can catalyze a specific biochemical reaction. Common examples of this type of reaction include the cutting or connection of RNA and DNA and the formation of peptide bonds. The term "ribozyme" as used in this article includes both natural ribozymes and artificial ribozymes. Artificial ribozymes include synthetic ribozymes and ribozymes modified or engineered from natural ribozymes. The term "ribozyme" also includes ribozyme fusions or ribozyme complexes derived from natural or artificial ribozymes.

[0034] The term "catalytic domain" as used in this article refers to a domain within a ribozyme that is responsible for catalyzing the biochemical reaction mentioned above. In one embodiment, in a ribozyme capable of cutting RNA, the catalytic domain is a domain responsible for catalyzing the cutting of the RNA skeleton at the ribozyme cleavage site. The term "ribozyme cleavage site" refers to a sequence that is recognized and cut by the ribozyme catalytic domain. Unless otherwise specified, the term "cleavage site" as used in this article refers to a ribozyme cleavage site. When the catalytic domain is capable of catalyzing a biochemical reaction, it is in an "active state"; conversely, when the catalytic domain is not capable of catalyzing a biochemical reaction, it is in an "inactive state". In another embodiment, when the catalytic domain is capable of cutting a ribozyme cleavage site, it is in an "active state"; conversely, when the catalytic domain is not capable of cutting a ribozyme cleavage site, it is in an "inactive state".

[0035] The term "target binding domain" refers to a domain that can bind to a target RNA molecule. In one embodiment, the binding between the target RNA molecule and the target binding domain is carried out by annealing of complementary sequences between the two. Therefore, it is possible to design or modify the sequence of one or more target binding domains so that it can bind to different target RNA molecules with specific sequences.

[0036] The term "complementary" as used in this article, describes the relationship between two nucleotides or two polynucleotides. When referring to RNA complementarity, nucleotide A is complementary to nucleotide U, and vice versa, and nucleotide C is complementary to nucleotide G, and vice versa. Complementary nucleotides include nucleotides that perform Watson and Crick base pairing and nucleotides that perform base pairing in an alternative mode. It should be understood that, unless clearly specified (such as assigning percentages or terms "completely" or "partially"), otherwise when used to relate to polynucleotides (length greater than 2 nucleotides), the term "complementary" includes complementary to varying degrees. The term "complementarity" as used in this article refers to the degree and pattern of complementarity between an RNA chain or segment and another RNA chain or segment. When assigning percentages to "complementarity" or "complementarity" between two polynucleotides (or their segments), the percentage refers to the percentage of nucleotides complementary to another polynucleotide (or their segments) in a polynucleotide (or its segments). Therefore, mentioning two polynucleotide chains as "complementary" should be understood to encompass both complete complementarity and partial complementarity.

[0037] The term "target RNA molecule" as used herein refers to an RNA molecule of interest to be detected and bound by a target binding domain. Examples of target RNA molecules include, but are not limited to, viral RNA, microRNA (miRNA), short interfering RNA (siRNA), small RNA (sRNA), messenger RNA (mRNA), non-coding RNA (ncRNA), short non-coding RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), transfer-messenger RNA (tmRNA), clustered regularly interspaced short palindromic repeats RNA (CRISPR RNA), antisense RNA, mRNA precursors, and miRNA precursors.

[0038] The term "connected" refers to the relationship between two domains, and may refer to a physical connection, a functional connection, or both. In one embodiment of the invention, if the active / inactive state of the catalytic domain is determined by the state of the target binding domain (specifically, whether the target binding domain is bound to its corresponding target RNA molecule), then the catalytic domain is connected to the target binding domain.

[0039] The term "flanking" refers to a polynucleotide sequence adjacent to another sequence or between an upstream polynucleotide sequence and / or a downstream polynucleotide sequence (i.e., 5' and / or 3') relative to the sequence. For example, "a releasable RNA segment "flanked by two cleavage sites" means that one cleavage site is located at the 5' and the other cleavage site is located at the 3' of the releasable RNA segment; however, there may be a spacer sequence in between.

[0040] Since the cleavage site is contained on the ribozyme itself, the ribozyme of the present disclosure is considered to be a self-cleaving ribozyme, and the "releasable RNA segment" is considered to be a cleavage product of self-cleavage activity. Since the release of the releasable RNA segment from the ribozyme is the result of the binding of the ribozyme to one or more target RNA molecules, the ribozyme can be used to detect the presence of the target RNA molecule. Since the target RNA molecule can be released from the ribozyme to activate more ribozymes and trigger the release of more "releasable RNA segments", the presence of the target RNA molecule can be amplified by the "releasable RNA segment" released with higher copies. The "releasable RNA segment" is variable and can be designed to include a specific sequence. In certain embodiments, if the "releasable RNA segment" includes the same sequence as the target RNA molecule, the target RNA molecule (or its sequence) is amplified using the ribozyme of the present disclosure.

[0041] In one embodiment, the ribozyme of the first aspect comprises a catalytic domain and a target binding domain, wherein the ribozyme comprises an RNA strand having the following structure:

[0042]

[0043] wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: motifs [A] and [a] constitute a target binding domain for binding to a target RNA molecule, motifs [C] and [c] constitute a catalytic domain, motif [D] comprises a first cleavage site that can be cleaved by the catalytic domain, motif [D'] comprises a second cleavage site that can be cleaved by the catalytic domain, motif [E] comprises a releasable RNA segment, motif [e] comprises a sequence that is optionally complementary to the sequence of motif [E], wherein each horizontal line connecting the motifs represents an optional linker region; and wherein when the target binding domain binds to the target RNA molecule, the catalytic domain is in an active state.

[0044] In the above-mentioned embodiments, binding of a target RNA molecule to the target binding domain activates the catalytic domain, which results in cleavage of the two cleavage sites and subsequent release of the releasable RNA segment.

[0045] With regard to the definition of "complementary" provided above in this specification, it will be understood by those skilled in the art that the expression "optionally complementary" as used herein and in this specification includes not only complete complementarity (100% complementarity) and partial complementarity (complementarity between 0% and 100%), but also non-complementarity (0% complementarity). In other words, for the ribozyme of the above-mentioned embodiment, having a region between motifs [D'] and [c] that is at least partially complementary to motif [E] is an optional feature.

[0046] The term "directionality" as used herein refers to the end-to-end chemical orientation of a single-stranded RNA molecule. In a single-stranded RNA, the chemical convention for naming the carbon atoms in the nucleotide sugar ring means that there will be a 5' end, which contains a phosphate group attached to the 5' carbon of the ribose ring, and a 3' end, which is typically an unmodified ribose-OH substituent. An illustrative example is that if [A] to [A'] of chain S1 is in a 5' to 3' orientation, then [a] to [a'] of chain S2 will be in a 3' to 5' orientation.

[0047] The term "motif" as used herein refers to a region on an RNA strand that has a specific structure or is involved in a specific function. The term "domain" as used herein refers to a region of a ribozyme that has a specific structure that is involved in a specific function. As used herein, the term "domain" is used when referring to a structure formed by more than one RNA strand or by motifs of more than one RNA strand. An illustrative example is that a target binding domain includes both motifs [A] and [a], and the target binding domain is considered to be "bound" to the target RNA molecule only when both motifs are bound to the RNA molecule.

[0048] In one embodiment, the ribozyme as disclosed herein further comprises one or more inhibitory domains; wherein each of the one or more catalytic domains is functionally connected to one of the one or more inhibitory domains, wherein the catalytic domain is in an inactive state due to inhibition from the inhibitory domain, and the inhibitory domain is connected to one of the one or more target binding domains; wherein when one of the one or more target binding domains binds to a target RNA molecule, the inhibitory domain connected to the target binding domain stops inhibiting the catalytic domain connected to the inhibitory domain, which causes the catalytic domain to be converted into an active state. In this embodiment, the connection between the target binding domain and the catalytic domain is achieved by the inhibitory domain, which is connected to both the target binding domain and the catalytic domain.

[0049] In one embodiment, the ribozyme comprises a catalytic domain, an inhibitory domain and a target binding domain, wherein the ribozyme comprises an RNA strand having the following structure:

[0050]

[0051] wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: motifs [A] and [a] constitute a target binding domain for binding to a target RNA molecule, motifs [B] and [b] constitute an inhibitory domain, motifs [C] and [c] constitute a first catalytic domain, motif [D] comprises a first cleavage site that can be cleaved by the catalytic domain, motif [D'] comprises a second cleavage site that can be cleaved by the catalytic domain, motif [E] comprises a releasable RNA segment, motif [e] comprises a sequence that is optionally complementary to the sequence of motif [E], and each horizontal line connecting the motifs represents an optional linker region; and wherein the inhibitory domain is characterized by the following i) or ii):

[0052] i) when the target binding domain is not bound to the target RNA molecule, the motif [b] anneals to [C], and when the target binding domain is bound to the target RNA molecule, the motif [b] anneals to [B],

[0053] ii) when the first target binding domain is not bound to the target RNA molecule, motif [B] anneals and binds to motif [c], and when the target binding domain is bound to the target RNA molecule, motif [B] anneals and binds to [b], wherein when motif [b] anneals and binds to motif [B], the catalytic domain is in an active state.

[0054] As is generally known in the art, secondary structures are usually formed in ribozymes. In embodiments of the present disclosure, one or more secondary structures are independently formed by any motif or optional joint region, or are formed jointly by a motif, a joint region or a combination thereof. In one embodiment, the optional joint region independently or jointly forms one or more secondary structures.

[0055] The term "secondary structure" as used in this article refers to a structure formed by the interaction between the nucleotides in one or more polynucleotides. The example of secondary structure includes but is not limited to a single nucleotide bulge, a trinucleotide bulge, a stem, a stem loop, a t-RNA type structure, a clover, a tetraloop, a pseudoknot, a symmetrical inner loop, an asymmetric inner loop, a three-stem connector (3-way connector), a four-stem connector (4-way connector), a two-stem connector (2-way connector) or a coaxial stacking or a combination thereof. The specific example of secondary structure includes a stem, a stem loop, a t-RNA type structure, a clover, a tetraloop, a pseudoknot or a combination thereof. The term "stem loop" as used in this article, also referred to as a "hairpin loop", refers to such a secondary nucleic acid structure, when two regions of the same chain are generally complementary in the nucleotide sequence when read in opposite directions, the secondary nucleic acid structure forms a base pair to form a double helix with an unpaired loop at the end.

[0056] FIG. 1 illustrates some exemplary and non-limiting structures formed by ribozymes of the present disclosure. Specifically, Figure 1A-C Provide an example of a ribozyme formed by an RNA strand and having a target binding domain. The motif is labeled consistent with the general structure provided above. In Figure 1A, the ribozyme is characterized in that two 4-way connectors are formed on either side of the releasable RNA segment (motif [E]), with an extended catalytic domain (motif [C] and [c]), an optional inhibitory domain (motif [B] and [b]) and a target binding domain (motif [A] and [a]) based on one of the helices of one of the 4-way connector structures. In addition to replacing the 4-way connector formed by the region between motif [D] and motif [e] with a 3-way connector (Figure 1B) or a 2-way connector (Figure 1C), the ribozymes of Figures 1B and 1C adopt a structure similar to Figure 1A. If not specifically stated, each 4-way connector can also be a 3-way or 2-way connector, and vice versa.

[0057] In embodiments where the ribozyme comprises a target binding domain, the target binding domain consists of motifs [A] and [a], motif [A] binds to a region of the target RNA molecule, and motif [a] binds to a second region of the target RNA molecule; wherein when both [A] and [a] bind to the target RNA molecule, the target binding domain binds to the target RNA molecule. Thus, in another embodiment, motif [A] is complementary to a region of the target RNA molecule, and motif [a] is complementary to a second region of the target RNA molecule. In another embodiment, motif [A] is fully complementary to a region of the target RNA molecule, and motif [a] is fully complementary to a second region of the target RNA molecule. In one embodiment, the first and second regions are adjacent to each other on the target RNA molecule.

[0058] In some embodiments, the ribozyme comprises two catalytic domains. In some embodiments, the ribozyme comprises two inhibitory domains. In some embodiments, the ribozyme comprises two target binding domains. In a specific embodiment, the ribozyme comprises two catalytic domains, each of the two catalytic domains is inhibited by one of the two inhibitory domains, wherein each of the inhibitory domains is further connected to one of the two target binding domains.

[0059] As is generally known in the art, a ribozyme may comprise one or more RNA strands. In a specific embodiment, the ribozyme comprises a first RNA strand and a second RNA strand. When the ribozyme consists of two RNA strands, the two RNA strands have sufficient complementarity to bind to each other. Typically, the two RNA strands are not fully complementary across their entire length. Each RNA strand may independently form a secondary structure, as is generally known in the art. In one embodiment, the ribozyme comprises the following structure:

[0060]

[0061] wherein: S1 is a first RNA strand and S2 is a second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; and motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule, motifs [C] and [c] constitute a first catalytic domain, motif [D] comprises a first cleavage site that can be cleaved by the first catalytic domain, motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule, motifs [C'] and [c'] constitute a second catalytic domain, motif [D'] comprises a second cleavage site that can be cleaved by the second catalytic domain, motif [E] comprises a releasable RNA segment, motif [e] comprises a sequence that is optionally complementary to the sequence of motif [E], and the horizontal line connecting each motif represents an optional linker region; and wherein when the first target binding domain binds to the first target RNA molecule, the first catalytic domain is in an active state; and wherein when the second target binding domain binds to the second target RNA molecule, the second catalytic domain is in an active state.

[0062] In another embodiment, the ribozyme comprises the following structure:

[0063]

[0064] wherein: S1 is a first RNA strand and S2 is a second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; wherein motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule, motifs [B] and [b] constitute a first inhibitory domain, motifs [C] and [c] constitute a first catalytic domain, motif [D] comprises a first cleavage site that can be cleaved by the first catalytic domain, motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; motifs [C'] and [c'] constitute a second catalytic domain, motif [D'] comprises a second cleavage site that can be cleaved by the second catalytic domain, motif [E] comprises a releasable RNA segment, motif [e] comprises a sequence that is optionally complementary to the sequence of motif [E], and each horizontal line connecting the motifs represents an optional linker region; wherein the first inhibitory domain is characterized by the following i) or ii):

[0065] i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B],

[0066] ii) when the first target binding domain is not bound to the first target RNA molecule, the motif [B] anneals with the motif [c], and when the first target binding domain is bound to the first target RNA molecule, the motif [B] anneals with [b],

[0067] When motif [b] anneals with motif [B], the first catalytic domain is in an active state.

[0068] In another embodiment, the first inhibitory domain is further characterized by the following i) or ii): i) motif [b] is at least 50% complementary to motif [C] and at least 20% complementary to motif [B], and ii) motif [B] is at least 50% complementary to motif [c] and at least 20% complementary to motif [b].

[0069] In another embodiment, the first inhibitory domain is further characterized by the following i) or ii):

[0070] i) motif [b] is at least 60%, at least 70%, at least 80% or at least 90% complementary to motif [C] and at least 20% complementary to motif [B], or

[0071] ii) Motif [B] is at least 60%, at least 70%, at least 80% or at least 90% complementary to motif [c] and at least 20% complementary to motif [b].

[0072] In another embodiment, the ribozyme comprises the following structure:

[0073]

[0074] in:

[0075] S1 is a first RNA strand and S2 is a second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; wherein motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule, motifs [B] and [b] constitute a first inhibitory domain, motifs [C] and [c] constitute a first catalytic domain, motif [D] comprises a first cleavage site that can be cleaved by the first catalytic domain, motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; motifs [B'] and [b'] constitute a second inhibitory domain, motifs [C'] and [c'] constitute a second catalytic domain, motif [D'] comprises a second cleavage site that can be cleaved by the second catalytic domain, motif [E] comprises a releasable RNA segment, motif [e] comprises a sequence that is optionally complementary to the sequence of motif [E], and each horizontal line connecting the motifs represents an optional linker region; wherein the first inhibitory domain is characterized by the following i) or ii):

[0076] i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B],

[0077] ii) when the first target binding domain is not bound to the first target RNA molecule, the motif [B] anneals with the motif [c], and when the first target binding domain is bound to the first target RNA molecule, the motif [B] anneals with [b],

[0078] Wherein the second inhibitory domain is characterized by the following i) or ii):

[0079] i) when the second target binding domain is not bound to the first target RNA molecule, the motif [b'] anneals with the motif [C'], and when the second target binding domain is bound to the second target RNA molecule, the motif [b'] anneals with [B'],

[0080] ii) when the second target binding domain is not bound to the second target RNA molecule, the motif [B'] anneals and binds to the motif [c'], and when the second target binding domain is bound to the second target RNA molecule, the motif [B'] anneals and binds to [b'],

[0081] When motif [b] anneals with motif [B], the first catalytic domain is in an active state, and when motif [b'] anneals with motif [B'], the second catalytic domain is in an active state.

[0082] As mentioned above in this specification, one or more secondary structures can be formed independently by any motif or optional linker region, or formed together by motif, linker region or a combination thereof. In one embodiment, the optional linker region independently or together forms one or more secondary structures. In some embodiments of ribozymes in which the ribozyme comprises two target binding domains and two catalytic domains, the ribozyme comprises one of the following structures:

[0083]

[0084]

[0085] The linker regions R1 and R2 independently or jointly form one or more secondary structures, and the linker regions R1' and R2' independently or jointly form one or more secondary structures.

[0086] In certain embodiments, each of the joint regions R1, R2, R1' and R2' has a length independently selected from the following: between 3-1000 nucleotides, 3-500 nucleotides, 3-300 nucleotides, 3-200 nucleotides, 3-100 nucleotides, 3-80 nucleotides, 3-70 nucleotides, 3-60 nucleotides, 3-50 nucleotides, 3-40 nucleotides, 3-30 nucleotides. In certain specific embodiments, the length of the joint regions R1 and R1' is a length of 40-100 nucleotides, a length of 50-80 nucleotides, a length of 50-70 nucleotides or a length of 60-70 nucleotides. In certain specific embodiments, the length of the joint regions R2 and R2' is a length of 10-60 nucleotides, a length of 20-40 nucleotides or a length of 25-35 nucleotides.

[0087] One or more secondary structures formed independently or collectively by any one or any combination of the joint regions R1, R2, R1' and R2' are independently selected and may be the same or different. In a specific embodiment, the joint regions R1 and R2 form a 2-way, 3-way or 4-way connector. In a specific embodiment, the joint regions R1' and R2' form a 2-way, 3-way or 4-way connector. The secondary structure formed by R1 and R2 is independently selected relative to the secondary structure formed by R1' and R2'. For example, R1 and R2 can form a 4-way connector, while R1' and R2' form a 3-way connector. In one embodiment, R1 and R2 form a 4-way connector, and R1' and R2' also form a 4-way connector.

[0088] Figure 1D-I Some examples of ribozymes formed by two RNA chains and having two target binding domains are provided. The mark of the motif is consistent with the general structure provided above. The ribozyme of Figure 1D is characterized in that two 4-way connectors are formed on either side of the releasable RNA segment, and each side includes a catalytic domain, an optional inhibitory domain and a target binding domain. Except that the 4-way connector is replaced with a 3-way connector and a 2-way connector, Figures 1E and 1F adopt a structure similar to Figure 1D. The ribozyme of each figure in Figure 1D-F can be considered as a tandem ribozyme connected in reverse by two "mono-ribozymes" (therefore "tandem ribozymes connected in reverse"), and the two "mono-ribozymes" show a "mirror" direction. And the ribozyme of Figure 1G-I can also be considered as a tandem ribozyme connected by two "mono-ribozymes", and the two "mono-ribozymes" adopt the same direction (therefore named "repeated tandem ribozymes"). The ribozyme of Figure 1G is characterized in that two 4-way connectors are formed on either side of the releasable RNA segment. The ribozymes of Figures 1H and 1I adopt a similar structure to that of Figure 1G except that the 4-way linker is replaced with a 3-way linker (Figure 1H) or a 2-way linker (Figure 1I).

[0089] For an illustrative example of how different motifs and domains may be included on an exemplary ribozyme and function together, see Figure 2 . Figure 2 A specific configuration is described, in which the ribozyme has a reverse-linked tandem ribozyme structure. The variable motif [b] connecting the motif [c] (of the catalytic domain) and the motif [a] (of the target binding domain) is designed to be complementary to the motif [C] of the catalytic domain. The variable motif [b] connecting the motif [c] (of the catalytic domain) and the motif [a] (of the target binding domain) is designed to be complementary to the motif [C] of the catalytic domain. In the absence of a target RNA molecule, the binding between [b] and [C] acts as a "toehold" to minimize self-cleavage, preventing the cleavage of the cleavage site [D] and the release of the releasable RNA segment. Target RNA binding activates cleavage, releasing the releasable RNA segment (the sequence of the product can be different, which in some embodiments is loosely complementary to the ribozyme, thereby biasing cleavage rather than re-ligation). The released target RNA molecule can bind again to the uncut ribozyme (excessively present) in a new cycle. Because the ribozyme is in excess, a given number of copies of the target RNA molecule can activate the self-cleavage of the ribozyme, resulting in the release of multiple cleavage products, thereby amplifying the target RNA signal. It will be immediately understood by those skilled in the art that the working principles described herein are applicable to ribozymes of other structures, such as the ribozymes described in Figures 1A-I, after necessary modifications.

[0090] In another embodiment, the first and second target RNA molecules are identical. In another embodiment, the first and second target RNA molecules are different. The expression "the first and second target RNA molecules are identical" refers to the case where the ribozyme is activated (resulting in the release of the releasable RNA segment) by one specific target RNA molecule (one copy of the target RNA molecule binds to one of the two target binding domains). The expression "the first and second target RNA molecules are different" refers to the case where the ribozyme is activated by two different target RNA molecules (each target binding domain is used to bind to one of the two target RNA molecules).

[0091] For illustration and without being bound by theory, the active state of the first catalytic domain requires specific nucleotides in motifs [C] and [c] to form specific interactions with the cleavage site via the secondary structure formed by the catalytic domain. When motifs [C] or [c] are annealed to motifs [b] or [B], the specific secondary structure required to support these intermolecular interactions with the cleavage site cannot be formed.

[0092] In another embodiment, the first inhibitory domain is further characterized by the following i) or ii):

[0093] i) motif [b] is at least 50% complementary to motif [C] and at least 20% complementary to motif [B], and

[0094] ii) motif [B] is at least 50% complementary to motif [c] and at least 20% complementary to motif [b];

[0095] And the second inhibitory domain is further characterized by the following i) or ii):

[0096] i) motif [b'] is at least 50% complementary to motif [C'] and at least 20% complementary to motif [B'], and

[0097] ii) Motif [B'] is at least 50% complementary to motif [c'] and at least 20% complementary to motif [b'].

[0098] In another embodiment, the first inhibitory domain is further characterized by the following i) or ii):

[0099] i) motif [b] is at least 80%, 90%, 95% or 100% complementary to motif [C] and at least 30% complementary to motif [B],

[0100] ii) motif [B] is at least 80%, 90%, 95% or 100% complementary to motif [c] and at least 30% complementary to motif [b];

[0101] And the second inhibitory domain is further characterized by the following i) or ii):

[0102] i) motif [b'] is at least 80%, 90%, 95% or 100% complementary to motif [C'] and at least 30% complementary to motif [B'],

[0103] ii) Motif [B'] is at least 80%, 90%, 95% or 100% complementary to motif [c'] and at least 30% complementary to motif [b'].

[0104] In some embodiments, motif [b] is fully complementary to motif [C], or motif [B] is fully complementary to motif [c]. In some embodiments, motif [b'] is fully complementary to motif [C'], or motif [B'] is fully complementary to motif [c'].

[0105] In some embodiments, the complementarity between motif [b] and motif [B] is 100%. In other embodiments, the complementarity between motif [b] and motif [B] is 30%-70%. In a specific embodiment, the complementarity between motif [b] and motif [B] is about 50%.

[0106] In some embodiments where motifs [B'] and [b] are included on the ribozyme, the complementarity between motif [b'] and motif [B'] is 100%. In other specific embodiments, the complementarity between motif [b'] and motif [B'] is 30%-70%. In a specific embodiment, the complementarity between motif [b'] and motif [B'] is about 50%.

[0107] In one embodiment, when motif [b] anneals to motif [B], or when motif [b'] anneals to motif [B'], the annealing is based on alternating segments of complementarity and non-complementarity, wherein each segment is one nucleotide long.

[0108] In some embodiments, the ribozyme comprises a structure of structure IV or VII, and wherein [A] to [A'] is in the 5' to 3' direction, and motif [B] is partially complementary to motif [b]. In some embodiments, the ribozyme comprises a structure of structure V or VIII, motif [B] is partially complementary to motif [b], and motif [B'] is fully complementary to motif [b']. In other embodiments, the ribozyme comprises a structure of structure V or VIII, and wherein [A] to [A'] is in the 5' to 3' direction, motif [B] is fully complementary to motif [b], and motif [B'] is fully complementary to motif [b'].

[0109] In some embodiments, the length of each of the motifs [B], [b], [C], [c], [B'], [b'], [C'], [c'], and [D] is independently 1-100 nucleotides. In some specific embodiments, the length of each of the motifs [B], [b], [C], [c], [B'], [b'], [C'], [c'], and [D] is 1-5, or 5-10, or 10-15, or 15-20, or 20-30, or 30-40, or 40-50, 50-60, 60-70, 70-80, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 nucleotides. In some specific embodiments, motif [B] has the same length as motif [b]. In some specific embodiments, motif [C] has the same length as motif [c]. In some specific embodiments, motif [B'] has the same length as motif [b']. In some specific embodiments, motif [C'] has the same length as motif [c]. In one embodiment, each of motifs [B], [b], [B'], [b'] has a length of 1-20 nucleotides. In another embodiment, each of motifs [C], [c], [C'] and [c'] has a length of 5-12 nucleotides. In one embodiment, each of motifs [B], [b], [B'], [b'] has a length of 8 nucleotides. In another embodiment, each of motifs [C], [c], [C'] and [c'] has a length of 8 nucleotides.

[0110] In another embodiment, motifs [A] and [A'] bind to the first region of the first and second target RNA molecules, respectively, and motifs [a] and [a'] bind to the second region of the first and second target RNA molecules, respectively; wherein when [A] and [a] both bind to the first target RNA molecule, the first target binding domain binds to the first target RNA molecule, and when [A'] and [a'] both bind to the second target RNA molecule, the second target binding domain binds to the second target RNA molecule. In a specific embodiment, the first region and the second region on the first or second target RNA molecule are adjacent to each other. In another embodiment, the first region and the second region are of equal length. Therefore, in another embodiment, motif [A] is complementary to the first region of the first target RNA molecule, motif [a] is complementary to the second region of the first target RNA molecule, motif [A'] is complementary to the first region of the second target RNA molecule, and motif [a'] is complementary to the second region of the second target RNA molecule. In another embodiment, motif [A] is fully complementary to the first region of the first target RNA molecule, motif [a] is fully complementary to the second region of the first target RNA molecule, motif [A'] is fully complementary to the first region of the second target RNA molecule, and motif [a'] is fully complementary to the second region of the second target RNA molecule. In one embodiment, the first region and the second region on the first target RNA molecule are adjacent to each other. In one embodiment, the first region and the second region of the second target RNA molecule are adjacent to each other.

[0111] In some embodiments, the nucleotides of motifs [A] and [a] are complementary to opposite ends of the target RNA molecule, respectively. For example, motif [A] can be complementary to the 5' end of the target RNA molecule, while motif [a] can be complementary to the 3' end of the target RNA molecule, and vice versa. In other embodiments, motifs [A] or [a] are each 1-5, or 5-10, or 10-15, or 15-20, or 20-30, or 30-40, or 40-50, or 50-60, or 60-70, or 70-80 nucleotides long. In some embodiments, motif [a] is 11 nucleotides long. In some embodiments, the above description of motifs [A] and [a] also applies to motifs [A'] and [a'].

[0112] The complementary binding is partially complementary or completely complementary. For example, the motif [A] is complementary to the 5' end of the target RNA molecule by about 70% to about 80%, or about 80% to about 90%, or about 90% to about 100%, or about 75% to about 85%, or about 85% to about 95%, or about 95% to about 100%, or about 88% to about 98%, or about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%; and the motif [A] is complementary to the 5' end of the target RNA molecule by about 70% to about 80%, or about 80% to about 90%, or about 90% to about 100%, or about 95% to about 100%, or about 88% to about 98%, or about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%; The motif [a] is about 70% to about 80%, or about 80% to about 90%, or about 90% to about 100%, or about 75% to about 85%, or about 85% to about 95%, or about 95% to about 100%, or about 88% to about 98%, or about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% complementary to the 3' end of the same target RNA molecule, or vice versa. The lengths of the motifs [A] and [a] are independent of each other and can be the same or different. For example, the length of each of the motifs [A] and [a] can be 3-5, or 5-10, or 10-15, or 15-20, or 20-30, or 30-40, or 40-50, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 nucleotides. In some specific embodiments, the length of each of the motifs [A] and [a] is 11 nucleotides long.

[0113] In some embodiments, motifs [E] and [e] are less than 70%, less than 60%, less than 50%, less than 40% or less than 30% complementary to each other. In a specific embodiment, the complementarity between motifs [E] and [e] is characterized by alternating complementary and non-complementary regions. In a particularly specific embodiment, each complementary region is no longer than 3 consecutive nucleotides, and each non-complementary region is at least 3 consecutive nucleotides in length. In some embodiments, each of motifs [E] and [e] is 3-50 nucleotides in length. In some specific embodiments, the length of each of the motifs [E] and [e] is 3-5, or 5-10, or 10-15, or 15-20, or 20-30, or 30-40, or 40-50, 50-60, 60-70, 70-80, or 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides. In some specific embodiments, the length of each of the motifs [E] and [e] is 23 nucleotides.

[0114] As used herein, "complementary region" refers to the region in which the first and second RNA chains in the ribozyme are completely complementary to each other; and "non-complementary region" refers to the region in which the first and second RNA chains in the ribozyme are not complementary to each other.

[0115] In certain embodiments, the ribozyme is modified from a naturally occurring ribozyme. In certain embodiments, the ribozyme is modified from an artificial ribozyme, a fusion ribozyme, a fragment thereof, and a derivative thereof. In a specific embodiment, the ribozyme is characterized by a hairpin ribozyme or a hammerhead ribozyme or a fragment thereof and a fusion thereof. In a specific embodiment, the ribozyme is a twin ribozyme or a duplex ribozyme. In a specific embodiment, the ribozyme comprises a double hairpin ribozyme structure, as described in Figure 1.

[0116] In one embodiment, wherein the ribozyme comprises the structure of structure V or VIII, the region between motif [A] and motif [E] on the first RNA strand (S1) (in the [A] to [E] direction) comprises the sequence of SEQ ID NO.: 27).

[0117] SEQ ID NO.: 27 refers to the sequence: 5'-GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC-3'.

[0118] In one embodiment, wherein the ribozyme comprises the structure of structure III or VI, the region between motif [A] and motif [E] on the first RNA strand (S1) (in the [A] to [E] direction) comprises the sequence of SEQ ID NO.:81.

[0119] SEQ ID NO.:81 refers to the sequence:

[0120] 5'-GGGAAGUGGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC-3'.

[0121] In one embodiment, wherein the ribozyme comprises the structure of Structure V or VIII, the region between the motif [E] and the motif [A'] on the first RNA strand (S1) (in the [E] to [A'] direction) comprises the sequence of SEQ ID NO.:28.

[0122] SEQ ID NO.: 28 refers to the sequence: 5'-CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACUCUCUGAA-3'.

[0123] In one embodiment, wherein the ribozyme comprises the structure of structure III or VI, the region between motif [E] and motif [A'] on the first RNA strand (S1) (in the [E] to [A'] direction) comprises the sequence of SEQ ID NO.:82.

[0124] SEQ ID NO.:82 refers to the sequence:

[0125] 5'-CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACCUGGUCCC-3'.

[0126] In one embodiment, wherein the ribozyme comprises the structure of Structure V or VIII, the region between motif [a'] and motif [e] on the second RNA strand (S2) (in the direction from [a'] to [e]) comprises the sequence of SEQ ID NO.:30.

[0127] SEQ ID NO.: 30 refers to the sequence: 5'-GUAAUAUAAGAAACACACGAAUCAGAGAAG-3'.

[0128] In one embodiment, wherein the ribozyme comprises the structure of structure III or VI, the region between motif [a'] and motif [e] on the second RNA strand (S2) (in the direction from [a'] to [e]) comprises the sequence of SEQ ID NO.:84.

[0129] SEQ ID NO.: 84 refers to the sequence:

[0130] 5'-GGGACCAGAGAAACACACGAAUCAGAGAAG-3'.

[0131] In one embodiment, wherein the ribozyme comprises the structure of structure V or VIII, the region between motif [e] and motif [a] on the first RNA strand (S1) (in the direction from [e] to [a]) comprises the sequence of SEQ ID NO.:31.

[0132] SEQ ID NO.: 31 refers to the sequence: 5'-GAGAAGUCAACCAGAGAAACAUAAUAUAC-3'.

[0133] In one embodiment, wherein the ribozyme comprises the structure of structure III or VI, the region between motif [e] and motif [a] on the first RNA strand (S1) (in the direction from [e] to [a]) comprises the sequence of SEQ ID NO.:85.

[0134] SEQ ID NO.: 85 refers to the sequence:

[0135] 5'-GAGAAGUCAACCAGAGAAACACACUUCCC-3'.

[0136] In one embodiment, wherein the ribozyme comprises the structure of structure III or VI, the first RNA strand (S1) and the second RNA strand (S2) comprise the sequences of SEQ ID NO.: 80 and SEQ ID NO.: 83, respectively.

[0137] SEQ ID NO.: 80 refers to the sequence:

[0138] 5'-(n) a GGGAAGUGGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACCUGGUCCC(n) b -3', where (n) x represents a region that is partially complementary to the releasable RNA segment on S1, and (n) a and(n) b represents the sequence complementary to the second and first target RNA molecules.

[0139] SEQ ID NO.:83 refers to the sequence:

[0140] 5'-(n) a GGGACCAGAGAAACACACGAAUCAGAGAAG(n) x GAGAAGUCAACCAGAGAAACACACUUCCC(n) b -3', where (n) x represents a region that is partially complementary to the releasable RNA segment on S1, and (n) a and(n) b represents the sequence complementary to the second and first target RNA molecules.

[0141] In another embodiment, wherein the ribozyme comprises the structure of Structure V or VIII, the first RNA strand (S1) and the second RNA strand (S2) comprise the sequences of SEQ ID NO.: 26 and SEQ ID NO.: 29, respectively.

[0142] SEQ ID NO.: 26 refers to the sequence: 5'-(n)a GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACUCUCUGAA(n) b -3', where (n) a corresponding to the variable sequence corresponding to the motif [A] of the first target binding domain, (n) x corresponds to the variable sequence corresponding to the motif [E], and (n) b Corresponds to the variable sequence corresponding to the motif [A'] of the second target binding domain.

[0143] SEQ ID NO.: 29 refers to the sequence: 5'-(n) a GUAUAUAAGAAACACACGAAUCAGAGAAG(n) x GAGAAGUCAACCAGAGAAACAUAAUAUAC(n) b -3', where (n) a corresponding to the variable sequence corresponding to the motif [a'] of the second target binding domain, (n) x corresponds to the variable sequence corresponding to the motif [e], and (n) b Corresponding to the variable sequence corresponding to motif [a] of the second target binding domain.

[0144] The ribozyme can be a single catalytic domain configuration. These ribozymes contain only one RNA chain, such as similar to structures I and II.

[0145] A generic sequence for a single catalytic domain ribozyme comprising the structure of Structure II is provided below:

[0146] 5'-(n) a GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGUGAUCGAAAGAGCACAGACCUGAAAAGGUCUUUCUGGUUUCGACCAGAAUCAGAGAAG(n) y GAGAAGUCAACCAGAGAAACAUAAUAUAC(n) b -3' (SEQ ID.: 88), wherein (n)a and(n) b represents sequences complementary to the first and second target regions of RNA; (n) x represents releasable RNA fragments, and (n) y represents the sequence complementary to the releasable RNA segment.

[0147] In some embodiments, the number of nucleotides in each variable sequence listed above is independently 3-150, 3-100, 3-80, 3-60, 6-50, 6-40, 6-30, 10-15, or 15-23.

[0148] In a specific embodiment, the sequence of the releasable RNA segment (or in some embodiments, the motif [E]) comprises the sequence of 5'-GUCCUUAGUCGAAAGUUUUACUAGAGUCA-3' (SEQ ID NO.: 25).

[0149] In one embodiment, wherein the ribozyme comprises any of structures III-VIII, the first RNA chain (S1) and the second RNA chain (S2) comprise the sequences of SEQ ID NO.: 34 and SEQ ID NO.: 35, respectively. In another embodiment, wherein the ribozyme comprises the structure of structure V or VIII, the first RNA chain (S1) and the second RNA chain (S2) comprise the sequences of SEQ ID NO.: 32 and SEQ ID NO.: 33, respectively.

[0150] In one embodiment, the target RNA molecule is greater than 16, greater than 18, greater than 20, greater than 22, greater than 24, greater than 26, greater than 28, greater than 30, greater than 32, greater than 34, greater than 36, greater than 38, greater than 40 nucleotides, greater than 50 nucleotides, greater than 60 nucleotides, greater than 70 nucleotides, greater than 80 nucleotides, greater than 90 nucleotides or greater than 100 nucleotides in length. In a specific embodiment, the target RNA molecule is 6-200, 6-100, 6-80, 10-60, 10-30, 10-25 or 15-23 nucleotides in length. In another specific embodiment, the target RNA is about 18-23 nucleotides in length.

[0151] In another embodiment, the target RNA molecule comprises a region complementary to the target binding domain, wherein the region is greater than 16, greater than 18, greater than 20, greater than 22, greater than 24, greater than 26, greater than 28, greater than 30, greater than 32, greater than 34, greater than 36, greater than 38, greater than 40, greater than 50 nucleotides, greater than 60 nucleotides, greater than 70 nucleotides in length. In a more specific embodiment, the region is 6-100, 6-80, 6-30, 10-25 or 15-23 nucleotides in length. In yet another specific embodiment, the region is about 6-80 nucleotides in length.

[0152] In another embodiment, the releasable RNA segment is 3-200 nucleotides in length. In another embodiment, the releasable RNA segment is 3-150, or 6-120, or 6-100, or 6-80, or 6-60, or 10-50, or 20-40 nucleotides in length.

[0153] In some embodiments, the ribozyme of the first aspect comprises two RNA chains S1 and S2, S1 and S2 respectively comprise the sequences of SEQ ID NOs. 2 and 3, or respectively comprise the sequences of SEQ ID NOs. 5 and 6, respectively comprise the sequences of SEQ ID NOs. 41 and 42, respectively comprise the sequences of SEQ ID NOs. 44 and 45, respectively comprise the sequences of SEQ ID NOs. 47 and 48, respectively comprise the sequences of SEQ ID NOs. 70 and 71, respectively comprise the sequences of SEQ ID NOs. 72 and 73, respectively comprise the sequences of SEQ ID NOs. 74 and 75, respectively comprise the sequences of SEQ ID NOs. 76 and 77, respectively comprise the sequences of SEQ ID NOs. 78 and 79, respectively comprise the sequences of SEQ ID NOs. 92 and 93, respectively comprise the sequences of SEQ ID NOs. 94 and 95, respectively comprise the sequences of SEQ ID NOs. 96 and 97, respectively comprise the sequences of SEQ ID NOs. 98 and 99, respectively comprise the sequences of SEQ ID NOs. 100 and 101. In some embodiments, wherein the ribozyme of the first aspect comprises one RNA strand, the ribozyme comprises the sequence of SEQ ID NO. 86 or 87.

[0154] In one embodiment, one or more target binding domains of the ribozyme bind or are used to bind to the same target RNA molecule. In a specific embodiment, the ribozyme comprises a first target binding domain and a second target binding domain, and the two target binding domains are used to bind to the same target RNA molecule. As used herein, "the same target RNA molecule" refers to a target RNA molecule with the same sequence.

[0155] In another embodiment, the releasable RNA segment comprises a sequence that is consistent with at least one of the one or more target RNA molecules. In a specific embodiment, the ribozyme comprises two target binding domains for binding to a specific target RNA molecule, wherein the target RNA molecule comprises a sequence that is consistent with the target RNA molecule. In this specific embodiment, the binding of the target RNA molecule results in the release of an RNA molecule that comprises the same sequence as the target RNA molecule.

[0156] In some embodiments, the binding of the target RNA molecule to one or more target binding domains of the ribozyme occurs at temperature T1. In some specific embodiments, T1 is a temperature of no more than 50°C. In other embodiments, T1 is a temperature of 0°C-50°C, a temperature of 15°C-45°C, a temperature of 25°C-45°C, a temperature of 30°C-40°C, a temperature of 35°C-38°C, a temperature of 36.5°C-37.5°C. In a specific embodiment, T1 is a temperature of about 37°C.

[0157] In another embodiment, the target RNA molecule bound to the target binding domain of the ribozyme is released from the target binding domain at a temperature T2. In some embodiments, wherein the two cleavage sites flanking the releasable RNA segment are cleaved, the releasable RNA segment is released at a preferred temperature T2. In some embodiments, T2 is a temperature of 20°C-100°C, a temperature of 25°C-80°C, a temperature of 30°C-80°C, a temperature of 35°C-80°C, a temperature of 40°C-80°C, a temperature of 45°C-80°C, a temperature of 50°C-80°C, a temperature of 55°C-75°C, a temperature of 57°C-63°C. In a specific embodiment, T2 is a temperature of about 60°C.

[0158] It should be understood that T1 and T2 as described above refer to the temperatures that allow binding (of the targeting RNA molecule) and release (of the target RNA molecule and the releasable RNA segment), respectively. T1 should not be considered to mean the temperature at which the target RNA molecule or the releasable RNA segment cannot be released; and T2 should not be considered to mean the temperature at which the target RNA molecule cannot bind to the target binding domain. It is generally understood in the art that the binding (also known as "annealing") and release (also known as "melting") of complementary RNA chains can occur simultaneously across a wide range of temperatures, although with different kinetics, so T1 and T2 can be the same or different. In some embodiments, the target RNA molecule can bind to the target binding domain of the ribozyme, trigger the cutting and release of the releasable RNA segment, and be released from the ribozyme, all at a temperature of 35°C-38°C. However, when the ribozyme is used to detect and amplify the target molecule, the conduction of annealing (at T1) and melting (at T2) (where T2 is higher than T1) drives the reaction forward and leads to an increase in the number of released releasable RNA products.

[0159] In specific embodiments, the target RNA molecule is an RNA molecule obtained from an animal, a virus, a bacterium, a yeast or a plant.

[0160] In a specific embodiment, the target RNA molecule is the genome or fragment thereof of an RNA virus. In another embodiment, the RNA virus is a single-stranded or double-stranded RNA virus. In another embodiment, the RNA virus is a positive sense RNA virus or a negative sense RNA virus or a double sense RNA virus. In another embodiment, the virus is a Retroviridae virus, a Lentivirinae virus, a Coronaviridae virus, a Picornaviridae virus, a Caliciviridae virus, a Flaviviridae virus, a Togaviridae virus, a Bornaviridae virus, a Filoviridae virus, a Paramyxoviridae virus, a Pneumovirinae virus, a Rhabdoviridae virus, an Arenaviridae virus, a Bunyanviridae virus, an Orthomyxoviridae virus, or a Delta virus.

[0161] In a specific embodiment, the RNA virus is selected from lymphocytic choriomeningitis virus, coronavirus, human immunodeficiency virus (HIV), severe acute respiratory syndrome virus (SARS), severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), polio virus, rhinovirus, hepatitis A, Norwalk virus, yellow fever virus, West Nile virus, hepatitis C virus, dengue virus, Zika virus, rubella virus, Ross River virus, Sindbis virus, chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, measles virus, mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hanta virus, Crimean-Congo hemorrhagic fever virus, influenza and hepatitis D virus. In a specific embodiment, the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus.

[0162] In some embodiments, the target RNA molecule is a microRNA (miRNA), a short interfering RNA (siRNA), a small RNA (sRNA), a messenger RNA (mRNA), a non-coding RNA (ncRNA), a short non-coding RNA, a transfer RNA (tRNA), a ribosomal RNA (rRNA), a transfer-messenger RNA (tmRNA), a clustered regularly interspaced short palindromic repeat sequence RNA (CRISPR RNA), an antisense RNA, an mRNA precursor or a miRNA precursor, or a fragment thereof. In a specific embodiment, the target RNA molecule is a microRNA, a precursor thereof, or a fragment thereof.

[0163] The term "microRNA" (abbreviated as miRNA) as used in this article refers to a small non-coding RNA molecule. It usually plays a role in RNA silencing and post-transcriptional regulation of gene expression. Although most miRNAs are located in cells, some miRNAs are also found in extracellular environments including various biological fluids and cell culture media, commonly referred to as circulating miRNAs or extracellular miRNAs. The length of miRNA can be 18-25nt long.

[0164] The ribozyme of the first aspect can be used to detect the presence of a target RNA molecule in a sample. Therefore, in a second aspect, the present invention provides a method for detecting the presence of a target RNA molecule in a sample, wherein the method comprises: a) incubating the sample with the ribozyme of the first aspect at a temperature T1, which allows the binding of the target RNA molecule to bind to one or more target binding domains contained in the ribozyme; b) incubating the sample at a temperature T2, which allows the target RNA molecule and the releasable RNA segment to be released from the ribozyme; c) detecting the release of the releasable RNA segment from the ribozyme. In one embodiment, step c) is performed by detecting the presence of the releasable RNA segment in the sample. Any RNA detection method or RNA detection system known in the art can be used. Exemplary and non-exhaustive examples of RNA detection methods include: reverse transcription polymerase chain reaction (RT-PCR), quantitative RT-PCR (RT-qPCR), probe-based RNA detection (such as Northern blot, microarray and molecular beacon). Exemplary and non-exhaustive examples of RNA detection systems include: NanoString Technologies' miRNA expression assays and Exiqon's Smart Flares), RNA-activated fluorescent sensors such as Pandan fluorescent sensors (PCT patent PCT / SG2017 / 050086; Aw et al., Nucleic Acids Research 2016) and CRISPR-Cas based nucleic acid detection systems such as DETECTR (Chen, JS et al., CRISPR-Cas12a target-binding unleashes in discriminate single-stranded DNase activity. Science 360, 436-439, doi: 10.1126 / science.aar6245 (2018)) and SHERLOCK (Gootenberg, JS et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439-444, doi: 10.1126 / science.aaq0179 (2018)).

[0165] In a specific embodiment, steps a) to b) are repeated one or more times before performing step c), wherein the RNA molecules released from step b) are used to bind to another copy of the ribozyme. In this embodiment, the sample can be incubated with an excess of ribozyme when step a) is performed for the first time, so that no additional ribozyme can be added to the sample when a) is performed for the second or subsequent times. Because the target RNA molecules released from the ribozyme in step b) can further bind to new ribozymes, the number of copies of the released cleavage products ("releasable RNA segments") can be many times the number of copies of the target molecules in the sample. Therefore, the presence or amount of the released "releasable RNA segments" is used as an amplified signal for the presence or amount of target RNA molecules in the sample. Therefore, when used in combination, this method can improve the sensitivity of existing RNA detection technologies.

[0166] The releasable RNA segment may contain a sequence consistent with the target RNA, in which case the released "releasable RNA segment" can further bind to a new ribozyme like the target RNA molecule itself. By repeating steps a) to b) as above, exponential amplification of the target RNA molecule (or the sequence of the target RNA molecule) can be achieved. Therefore, in a third aspect, a method for amplifying a target RNA molecule is provided, wherein the method comprises: a) incubating the target RNA molecule with the ribozyme of the first aspect at a temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme, and wherein the releasable RNA segment contains a sequence consistent with the target RNA molecule; b) incubating the ribozyme bound to the target RNA molecule at a temperature T2, which allows the target RNA molecule and the RNA segment to be released from the ribozyme. In another embodiment, steps a) to b) are repeated one or more times, wherein the target RNA molecule and the releasable RNA segment released from step b) are used to bind to another copy of the ribozyme.

[0167] Many RNA molecules (e.g., microRNAs) serve as biomarkers for disease diagnosis. Detection of genomic nucleic acids of RNA viruses is also useful in diagnosing viral infections and diseases caused by viruses. The ribozyme of the present invention can be conveniently modified to bind to RNA biomarkers indicated in disease or viral RNA. This can be achieved by using common techniques in the art to modify the sequence of the target binding domain to make it complementary to a specific region on the target RNA molecule of interest or by direct synthesis. Therefore, in a fourth aspect, a method for diagnosing a disease in a subject is provided, the method comprising: a) obtaining a sample from a subject; b) incubating the sample with a ribozyme according to the first aspect at a temperature T1, which allows a target RNA molecule associated with a disease to bind to one or more target binding domains contained in the ribozyme; c) incubating the sample at a temperature T2, which allows the target RNA molecule and the releasable RNA segment to be released from the ribozyme; d) detecting the level of the releasable RNA segment from the ribozyme.

[0168] The term "subject", as used herein, may refer to any organism. In some embodiments, the subject may be an animal subject or more specifically a human subject. In other embodiments, the subject may be a plant or a fungus. Thus, the term "disease" includes human diseases, animal diseases, plant diseases, or fungal diseases.

[0169] The term "sample" as used in this article refers to a sample suspected of containing a target RNA molecule. It may include body fluids. The term "sample" as used herein refers to a biological sample, or a sample comprising at least some biological substances (e.g., nucleic acids). The biological sample of the present disclosure may be any sample suspected of containing a target nucleic acid sequence, including liquid samples from animals or human subjects, such as whole blood, serum, plasma, cerebrospinal fluid, central spinal fluid, lymph, cystic fluid, sputum, feces, pleural effusion, mucus, pleural fluid, ascites, amniotic fluid, peritoneal fluid, saliva, bronchial lavage fluid, urine and other body fluids, or extracts thereof. The biological sample of the present disclosure may also be obtained from non-animal subjects, such as plants, fungi or bacteria.

[0170] In a specific embodiment, the method further comprises comparing the level of the releasable RNA segment with a control sample. The term "control sample" as used herein refers to a sample obtained from a healthy subject, which is incubated with the same ribozyme according to steps b) and c).

[0171] In some embodiments, T1 is a temperature not exceeding 50° C. In other embodiments, T1 is a temperature between 0° C.-50° C., a temperature between 15° C.-45° C., a temperature between 25° C.-45° C., a temperature between 30° C.-40° C., a temperature between 35° C.-38° C., a temperature between 36.5° C.-37.5° C. In a specific embodiment, T1 is a temperature of about 37° C.

[0172] In some embodiments, T2 is a temperature of 20° C.-100° C., a temperature of 25° C.-80° C., a temperature of 30° C.-80° C., a temperature of 35° C.-80° C., a temperature of 40° C.-80° C., a temperature of 45° C.-80° C., a temperature of 50° C.-80° C., a temperature of 55° C.-75° C., or a temperature of 57° C.-63° C. In a specific embodiment, T2 is a temperature of about 60° C.

[0173] As mentioned earlier in this specification, because target binding, ribozyme cleavage, and target and product release can occur simultaneously across a wide range of temperatures, it is possible to detect and amplify target RNA molecules with the same or different T1 and T2. However, the conduction of annealing (at T1) and melting (at T2) cycles (where T2 is higher than T1) helps to push the reaction forward and leads to an increase in the number of released releasable RNA products. Therefore, in some embodiments, T2 is a temperature higher than T1. In some embodiments, the release of the target molecule occurs at both T1 and T2. In one embodiment, T1 is a temperature of 25°C-45°C, and T2 is a temperature of 51°C-80°C.

[0174] In a fifth aspect, a polynucleotide encoding the ribozyme of the first aspect of the present disclosure is provided. In some embodiments in which the ribozyme consists of more than one RNA strand, the RNA strands may be encoded together by one polynucleotide or independently by several polynucleotides.

[0175] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably herein to refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine or pyrimidine bases or other natural nucleotide bases, chemically or biochemically modified non-natural or derived nucleotide bases.

[0176] In a sixth aspect, there is further provided a kit comprising the ribozyme of the first aspect of the present disclosure.

[0177] In a specific embodiment, the kit further includes an RNA detection system. In some embodiments, the RNA detection system includes an RNA-activated fluorescent sensor. In a specific embodiment, the sensor is a Pandan fluorescent sensor or detection system (PCT patent PCT / SG2017 / 050086; Aw et al., Nucleic Acids Research 2016). In another embodiment, the RNA detection system is a nucleic acid detection system based on CRISPR-Cas. CRISPR-Cas based RNA detection methods and systems are known in the art and disclosed in, for example, Chen, JS et al., CRISPR-Cas12a target-binding unleashes indiscriminate single-stranded DNase activity. Science 360, 436-439, doi: 10.1126 / science.aar6245 (2018), and Gootenberg, JS et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439-444, doi: 10.1126 / science.aaq0179 (2018).

[0178] The present invention described illustratively in this article can be properly implemented in the absence of any element or any element, any restriction or any restriction, and the elements and restrictions are not specifically disclosed in this article. Therefore, for example, the terms "including", "comprising", "containing", etc. should be expanded and understood without restriction. In addition, the terms and expressions used herein are used as descriptive and non-restrictive terms, and it is not intended to exclude any equivalents or parts of the features shown and described when using the terms and expressions, but it is considered that various modifications within the scope of the invention of the claims are possible. Therefore, it should be understood that although the present invention is specifically disclosed by preferred embodiments and optional features, the modifications and changes of the present invention implemented therein disclosed herein are adoptable by those skilled in the art, and it is considered that the modifications and changes are within the scope of the present invention.

[0179] The invention is described herein in a general and generic manner. Narrower species and subgeneric groupings falling within the general disclosure each also form part of the present invention. This includes the general description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether the removed matter is specifically described herein.

[0180] Other embodiments are within the following claims and non-limiting examples.

[0181] Experimental part

[0182] Detection platform with Cas13, Cas12a, and Csm6. Science 360, 439-444, doi: 10.1126 / science.aaq0179 (2018).

[0183] The present invention described illustratively in this article can be properly implemented in the absence of any element or any element, any restriction or any restriction, and the elements and restrictions are not specifically disclosed in this article. Therefore, for example, the terms "including", "comprising", "containing", etc. should be expanded and understood without restriction. In addition, the terms and expressions used herein are used as descriptive and non-restrictive terms, and it is not intended to exclude any equivalents or parts of the features shown and described when using the terms and expressions, but it is considered that various modifications within the scope of the invention of the claims are possible. Therefore, it should be understood that although the present invention is specifically disclosed by preferred embodiments and optional features, the modifications and changes of the present invention implemented therein disclosed herein are adoptable by those skilled in the art, and it is considered that the modifications and changes are within the scope of the present invention.

[0184] The invention is described herein in a general and generic manner. Narrower species and subgeneric groupings falling within the general disclosure each also form a part of the present invention. This includes the general description of the invention with a proviso or negative limitation removing any subject name from the genus, regardless of whether the removed material is specifically described herein.

[0185] 1. Methods for ribozyme production and cleavage assays

[0186] PCR amplification of template

[0187] PCR amplification of templates for in vitro transcription of RNA strands used for cleavage reactions was performed using Phusion High-Fidelity PCR Master Mix (Cat. No. F531L; Thermo Fisher Scientific, USA) with HF buffer according to the manufacturer's instructions. The primers and templates used were designed as shown above and in the accompanying sequence table. The resulting PCR product was purified using the QIAquick PCR Purification Kit (Cat. No. 28106; Qiagen, USA) according to the manufacturer's protocol.

[0188] In vitro transcription of RNA

[0189] The purified PCR product was used as template for PCR using Epicentre AmpliScribe according to the manufacturer's protocol. TM T7-Flash TMIn vitro transcription of transcription kit (catalog number ASF3507 Lucigen, the United States). After the reaction, 280 μL of RNase-free water (catalog number SH30538.02; Hyclone, the United States) was added to the in vitro transcription reaction of 20 μL. By adding 300 μL of pH 4.5 acid-phenol: chloroform (containing IAA, 125:24:1) (catalog number AM9722 Invitrogen, the United States), mixing and centrifuging at room temperature for 3min at 14,000rpm to purify RNA. The aqueous phase was transferred to a new centrifuge tube, and 300 μL of chloroform was added. The mixture was centrifuged at room temperature for 3min at 14,000rpm again. The aqueous phase was transferred to a new centrifuge tube and 1 / 10 volume (25 μL) of 3M sodium acetate at pH 5.2 and 2.5x volume (625 μL) of 100% ethanol were used to precipitate RNA. After precipitation overnight at -20°C, the sample was centrifuged at 13,000 rpm at 4°C for 20 min. The supernatant was discarded, the RNA precipitate was washed with cold 75% ethanol, and centrifuged again at 13,000 rpm at 4°C for 20 min. After centrifugation, the supernatant was completely removed and the precipitate was air dried for about 30 seconds. The precipitate was resuspended with 50 μL of RNase-free water and its concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA).

[0190] Cleavage reaction

[0191] Annealing and cleavage reactions were set to 200 nM each of S1 and S2, with water (control) or 50 nM (unless otherwise specified) of each target RNA added. Reactions were performed in a total volume of 600 μL in reaction buffer (50 mM Tris, 12 mM magnesium chloride, and 5 mM spermine tetrahydrochloride, pH 7.4). The 600 μL reaction volume was divided into 6 equal portions of 100 μL each and transferred to PCR strip tubes. Samples were incubated in a thermal cycler using the following program:

[0192] 1. 60℃, 1min

[0193] 2. 56.5℃, 1min

[0194] 3. 53℃, 1min

[0195] 4. 49.5℃, 1min

[0196] 5. 46℃, 1min

[0197] 6. 42.5℃, 1min

[0198] 7. 39℃, 1min

[0199] 8. 37℃, 15min

[0200] 9. Repeat steps 1-8 9 times

[0201] RNA precipitation for visualization

[0202] At the end of the cleavage reaction, each sample is transferred to a 15mL centrifuge tube and 900 μL stop buffer (7M urea and 50nM EDTA) is added to terminate. RNA is purified by adding 1.8mL pH 4.5 acid-phenol:chloroform (containing IAA, 125:24:1) (Catalog number AM9722 Invitrogen, the U.S.). Each sample is mixed and centrifuged at 13,000rpm for 15min at 4°C. The aqueous phase is transferred to a new centrifuge tube, and 1.8mL chloroform (Catalog number 07278-00 Kanto Chemical, Japan) is added. Each sample is mixed again and centrifuged at 13,000rpm for 15min at 4°C. The aqueous phase was transferred to a new centrifuge tube and precipitated with 1 / 10 volume (120 μL) of 3M sodium acetate at pH 5.2, 2.5x volume (3.3 mL) of 100% ethanol, 2 μL of RNA grade glycogen (Catalog No. R0551; ThermoFisher Scientific, USA), and 1 / 100 volume (43 μL) of 1M magnesium chloride. After precipitation overnight at -20°C, the sample was centrifuged at 13,000 rpm for 1 hour at 4°C. The supernatant was discarded, the RNA precipitate was washed with cold 75% ethanol, transferred to a 1.5 mL microcentrifuge tube, and centrifuged again at 13,000 rpm at 4°C for 30 min. After centrifugation, the supernatant was completely removed and the precipitate was air dried for about 10 seconds. The RNA precipitate was resuspended with 10 μL of RNase-free water and its concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific).

[0203] 300 μg of RNA was heat denatured at 70°C for 10 min, loaded with RNA loading dye (Cat. No. B0363S NEB, USA) and separated on a 10% denaturing polyacrylamide gel (Cat. No. EC-833 National Diagnostics, USA) in 10x TBE (Tris / boric acid / EDTA) buffer (Cat. No. 1610770 Bio-Rad, USA) at 200 V for 1 hour, or until the dye front migrated to the bottom of the gel. A low range ssRNA ladder (Cat. No. N0364S NEB, USA) was loaded as a size standard, and 25 ng of a 29 nt oligonucleotide (5'-GUCCUUAGUCGAAAGUUUUACUAGAGUCA-3') (IDT) (SEQ ID NO. 25) was spiked into the ladder as an additional size marker, which corresponds to the size of the expected cleavage product. Where appropriate, 25 ng of the target sequence was also spiked into the ladder as a size marker. Use 1:10,000 SYBR TM The gel was stained with Gold nucleic acid gel stain (Catalog No. S11494 Invitrogen, USA) and developed using the Gel Doc XR+ gel imaging system (Bio-Rad, USA). Images were analyzed using Image Lab software (Bio-Rad, USA).

[0204] Sensitivity assay

[0205] The sensitivity of the ribozyme assay was determined using the Tlet7f_Cban3pR ribozyme, which detects hsa-let-7f-5p. Serial dilutions of the target miRNA were performed. These serial dilutions were then added to the cleavage reactions at final working concentrations of 50 nM, 10 nM, and 0.1 nM. Each cleavage reaction contained 200 nM of the ribozyme for hsa-let-7f-5p.

[0206] Specificity assay

[0207] The sequence specificity of the Tlet7f_Cban3pR ribozyme was determined by: 1) adding miRNAs with different sequences (hsa-miR-122-5p: 5'-UGGAGUGUGACAAUGGUGUUUG-3') (SEQ ID NO. 24); 2) adding equal concentrations of two miRNAs (hsa-let-7f-5p and hsa-miR-122-5p), or 3) spiking total RNA extracted from adult Drosophila melanogaster into the RNA mixture at a series of concentrations (10-fold, 100-fold, or 1000-fold total RNA compared to the amount of target miRNA). Each cleavage reaction contained 200 nM ribozyme against hsa-let-7f-5p.

[0208] 2. Sequences for ribozyme design (with two target binding domains)

[0209] A ribozyme with two target binding domains (e.g., a ribozyme similar to structures III-V in the detailed description of the invention) consists of two RNA chains: chain S1 (containing RNA cleavage products) and chain S2 (which will not be cleaved). To generate S1 and S2 RNA, we used a DNA template generated by PCR for in vitro RNA transcription. The DNA template and primers were ordered from Integrated DNA technologies (IDT). The forward primers used to amplify the S1 and S2 chains were designed to include a 5' promoter sequence (5'-GTATAATACGACTCACTATAGGGA-3') (SEQ ID NO.: 7) for T7 RNA polymerase; the 3' terminal GGGA will be included in the final transcribed RNA and included at its 5' end. However, the GGGA is not a functional part of S1 or S2. The forward and reverse primers used to amplify S1 and S2 are designed to encode sequences complementary to the 3' region and 5' region of the target RNA molecule, respectively. First, an embodiment of a ribozyme targeting microRNA is shown, followed by an embodiment of a ribozyme targeting a viral RNA sequence.

[0210] A. Targeting microRNAs dme-ban-5p (Tban5p_Cban3pR) and hsa-let-7f (Tlet7f-Cban3pR) Examples of ribozymes, both of which cut the dme-ban3p reverse sequence).

[0211] Table 1. Targeting microRNAs dme-ban-5p (Tban5p_Cban3pR) and hsa-let-7f (Tlet7f- Examples of ribozymes that cleave the dme-ban3p reverse sequence). The underlined (______) sequences represent the sequences contained in the target binding domain. Wavy underline The sequence represents a sequence contained in the releasable RNA segment, or a sequence contained in a region opposite to and at least partially complementary to the releasable RNA segment.

[0212]

[0213]

[0214] i) General schematic of a ribozyme containing two catalytic domains and two inhibitory domains ("toehold"). (general schematic) (e.g., a ribozyme similar to structure V in the detailed description of the invention)

[0215] The sequence of S1 contains a cleavage product. In this example, the cleavage product has the sequence {GUCCUUAGUCGAAAGUUUUACUAGAGUCA} (SEQ ID NO 25, wherein the underlined nucleotides correspond to the reverse sequence of dme-ban3p (the variable "releasable RNA segment" as defined in the detailed description of the invention). Note that the GUCC at the 5' end and the CA at the 3' end are necessary for cleavage at the cleavage site and are therefore not part of the "releasable RNA segment", but rather part of the cleavage product. The following is a schematic representation of S1 and S2, where (n) a and(n) b represents the sequence complementary to the target miRNA, and the cleavage products are demarcated by {}:

[0216] S1 sequence:

[0217] 5'-(n) a GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACA{GUCCUUAGUCGAAAGUUUUACUAGAGUCA}GUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACUCUCUGAA(n) b -3' (SEQ ID NO.: 8).

[0218] S2 sequence:

[0219] 5'-(n) a GUAUAUAAGAAACACACGAAUCAGAGAAGACGAGCGUCCCACGGGCGCAGAAGAGAAGUCAACCAGAGAAACAUAAUAUAC(n) b -3' (SEQ ID NO.: 9).

[0220] ii) Exemplary ribozyme sequences:

[0221] Core S1 template (can be used as PCR template for S1 of all ribozymes) (SEQ ID NO.: 10):

[0222] 5'-CTGGTTTTCGATCGAAAGATCGACGAGGTGAAAACCTCGTGACAGTCCTTAGTCGAAAGTTTTACTAGAGTCAGTCCTGATTGTGCTCGAAAGAGCAC-3'

[0223] Core S2 template (can be used as PCR template for S1 of all ribozymes) (SEQ ID NO.: 11):

[0224] 5'-AGAAACACACGAATCAGAGAAGACGAGCGTCCCACGGGCGCAGAAGAGAAGTCA-3'

[0225] Example 1: Drosophila bantam-5p ribozyme

[0226] Sequence of dme-ban-5p: 5'-CCGGUUUUCGAUUUGGUUUGACU-3' (SEQ ID NO.: 2)

[0227] The reverse complementary sequence of the 5' mate sequence: AUCGAAAACCGG (SEQ ID NO.: 12).

[0228] The reverse complementary sequence of the 3' mate sequence: AGUCAAACCAA (SEQ ID NO.: 13).

[0229] S1 forward primer (for dme-ban-5p): (T7 promoter sequence is underlined) (SEQ ID NO.: 14):

[0230] 5'- GTATAATACGACTCACTATAGGGA AGTCAACCAAGTATATTAGTATATTACCTGGTTTTCGATCGAAAGATC-3'

[0231] S1 reverse primer (for dme-ban-5p) (SEQ ID NO.: 15):

[0232] 5'-CCGGTTTTCGATTTCAGAGAGTAATATACCACGAAAGACCTTTTCAGGTCTGTGCTCTTTCGAGCACAATC-3'

[0233] S2 forward primer (for dme-ban-5p): (T7 promoter sequence is underlined) (SEQ ID NO.: 16):

[0234] 5'- GTATAATACGACTCACTATAGGGAAGTCAAACCAAGTAATATAAGAAACACACGAATCAGAGAA-3'

[0235] S2 reverse primer (for dme-ban-5p) (SEQ ID NO.: 17):

[0236] 5'-CCGGTTTTCGATGTATATTATGTTTCTCTGGTTGACTTCTCTTCTGCG-3'

[0237] The obtained S1 chain of dme-ban-5p ribozyme (SEQ ID NO.: 2):

[0238] 5'-GGGAAGUCAAACCAAGUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGACAGUCCUUAGUCGAAAGUUUUACUAGAGUCAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACUCUGAAAUCGAAAACCGG-3'

[0239] The obtained S2 chain of dme-ban-5p ribozyme (SEQ ID NO.: 3):

[0240] 5'-GGGAAGUCAAACCAAGUAAUAUAAGAAACACACGAAUCAGAGAAGACGAGCGUCCCACGGGCGCAGAAGAGAAGUCAACCAGAGAAACAUAAUAUACAUCGAAAACCGG-3'

[0241] Example 2: Human let-7f-5p ribozyme

[0242] Sequence of hsa-let-7f-5p: 5'-UGAGGUAGUAGAUUGUAUAGUU-3' (SEQ ID NO.: 4)

[0243] The reverse complementary sequence of the 5' mate sequence: CUACUACCUCA (SEQ ID NO.: 18).

[0244] The reverse complementary sequence of the 3' mate sequence: AACUAUACAAU (SEQ ID NO.: 19).

[0245] S1 forward primer (for hsa-let-7f-5p): (T7 promoter sequence is underlined) (SEQ ID NO.: 20):

[0246] 5'- GTATAATACGACTCACTATAGGGA AACTATACAATGTATATTAGTATATTACCTGGTTTTCGATCGAAAGATC-3'

[0247] S1 reverse primer (for hsa-let-7f-5p) (SEQ ID NO.: 21):

[0248] 5'-TGAGGTAGTAGTTCAGAGAGTAATATACCACGAAAGACCTTTTCAGGTCTGTGCTCTTTCGAGCACAATC-3'

[0249] S2 forward primer (for hsa-let-7f-5p): (T7 promoter sequence is underlined) (SEQ ID NO.: 22):

[0250] 5'- GTATAATACGACTCACTATAGGGA AACTATACAATGTAATATAAGAAACACACGAATCAGAGAA-3'

[0251] S2 reverse primer (for hsa-let-7f-5p) (SEQ ID NO.: 23):

[0252] 5'-TGAGGTAGTAGGTATATTATGTTTCTCTGGTTGACTTCTCTTCTGCG-3'

[0253] The obtained S1 chain of hsa-let-7f-5p ribozyme (SEQ ID NO.: 5):

[0254] 5'-GGGAAACUAUACAAUGUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGACAGUCCUUAGUCGAAAGUUUUACUAGAGUCAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACUCUGAACUACUACCUCA-3'

[0255] The obtained S2 chain of hsa-let-7f-5p ribozyme (SEQ ID NO.: 6):

[0256] 5'-GGGAAACUAUACAAUGUAAUAUAAGAAACACACGAAUCAGAGAAGACGAGCGUCCCACGGGCGCAGAAGAGAAGUCAACCAGAGAAACAUAAUAUACCUACUACCUCA-3'

[0257] B. Targeting viral RNA sequences of different sizes from the SARS-CoV-2 viral genome (Orf1ab and E genes) Example of a ribozyme that cleaves the dme-ban3p reverse sequence)

[0258] Based on their use in other protocols for SARS-CoV-2 detection, two genes were selected for detection: the Orf1ab gene and the E gene. Note that the sequences used herein are slightly different from the exact sequences used in the other methods mentioned above. Since the target sequence is very long, the target RNA was prepared via in vitro transcription, and the resulting RNA contained a 5'T7 promoter sequence (5'-GTATAATACGACTCACTATAGGGA-3') (SEQ ID NO.: 7). The sequence of the ribozyme and the target sequence are summarized in the table below (the T7 promoter sequence is underlined).

[0259] Table 2. Targeting viral RNA sequences of different sizes (Orf1ab and E gene) from the SARS-CoV-2 viral genome Example of a ribozyme that cleaves the dme-ban3p reverse sequence)

[0260]

[0261]

[0262] Primers used to amplify the S1 and S2 strands of each ribozyme:

[0263] S1_Orf1ab_Gene_20_F (SEQ ID NO.52):

[0264] 5'- GTATAATACGACTCACTATAGGGA GCAGCCATTAGTATATTAGTATATTACCTGGTTTTCGATCGAAAGATC-3'

[0265] S1_Orf1ab_Gene_20_R (SEQ ID NO.53):

[0266] 5'-GGGACAGATCTTCAGAGAGTAATATACCACGAAAGACCTTTTCAGGTCTGTGCTCTTTCGAGCACAATC-3'

[0267] S2_Orf1ab_Gene_20_F (SEQ ID NO.54):

[0268] 5'- GTATAATACGACTCACTATAGGGAGCAGCCATTAGTAATATAAGAAACACACGAATCAGAGAA-3’

[0269] S2_Orf1ab_gene_20_R (SEQ ID NO.55):

[0270] 5’-GGGACAGATCGTATATTATGTTTCTCTGGTTGACTTCTCTTCTGCG-3’

[0271] S1_Orf1ab_gene_40_F (SEQ ID NO.56):

[0272] 5’- GTATAATACGACTCACTATAGGGA ATTAGGTTTCTTAATAGTAAGTATATTAGTATATTACCTGGTTTTCGATCGAAAGATC-3’

[0273] S1_Orf1ab_gene_40_R (SEQ ID NO.57):

[0274] 5’-GGGAGTAGACAATTCTAGTCTTCAGAGAGTAATATACCACGAAAGACCTTTTCAGGTCTGTGCTCTTTCGAGCACAATC-3’

[0275] S2_Orf1ab_gene_40_F (SEQ ID NO.58):

[0276] 5’- GTATAATACGACTCACTATAGGGA ATTAGGTTTCTTAATAGTAAGTAATATAAGAAACACACGAATCAGAGAA-3’

[0277] S2_Orf1ab_gene_40_R (SEQ ID NO.59):

[0278] 5’-GGGAGTAGACAATTCTAGTCGTATATTATGTTTCTCTGGTTGACTTCTCTTCTGCG-3’

[0279] S1_E_gene_60_F (SEQ ID NO.60):

[0280] 5’- GTATAATACGACTCACTATAGGGA TTTTACAAGACTCACGTTAACAATATTGCAGTATATTAGTATATTACCTGGTTTTCGATCGAAAGATC-3’

[0281] S1_E_gene_60_R (SEQ ID NO.61):

[0282] 5'-GGGACTGCGCTTCGATTGTGTGCGTACTGCTTCAGAGAGTAATATACCACGAAAGACCTTTTCAGGTCTGTGCTCTTTCGAGCACAATC-3'

[0283] S2_E_gene_60_F (SEQ ID NO.62):

[0284] 5'- GTATAATACGACTCACTATAGGGA TTTTACAAGACTCACGTTAACAATATTGCAGTAATATAAGAAACACACGAATCAGAGAA-3'

[0285] S2_E_gene_60_R (SEQ ID NO.63):

[0286] 5'-GGGACTGCGCTTCGATTGTGTGCGTACTGCGTATATTATGTTTCTCTGGTTGACTTCTCTTCTGCG-3'.

[0287] The ribozymes mentioned above can also be arranged in a "repeated tandem ribozyme" configuration, as described in Figures 1G-I. Table 3 provides exemplary sequences of ribozymes in the configuration (specifically the configuration described in Figure 1I), which target microRNAs dme-ban-5p, hsa-let-7f-5p, and viral Orf1ab gene fragments of different lengths.

[0288] Table 3. Exemplary sequences of ribozymes in the described configurations (specifically the configurations illustrated in FIG. 1F ). The underlined (______) sequences represent sequences included in the target binding domain. Wavy underline The sequence represents a sequence contained in the releasable RNA segment, or a sequence contained in a region opposite to and at least partially complementary to the releasable RNA segment.

[0289]

[0290]

[0291] Example 3. The above ribozymes all contain an inhibitory domain ("toehold") to minimize background cleavage activity. As described in the detailed description of the invention, we also disclose herein ribozymes without toehold features (e.g., ribozymes similar to structure III in the detailed description of the invention). The following table provides the sequences of ribozymes (without toehold) targeting microRNA dme-ban-5p, hsa-let-7f-5p, and viral Orf1ab and E gene fragments of different lengths.

[0292] The ribozymes in the table below follow the universal S1 sequence:

[0293] 5'-(n) a GGGAAGUGGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUACCUGGUCCC(n) b -3' (SEQ ID.: 80), and the universal S2 sequence:

[0294] 5'-(n) a GGGACCAGAGAAACACACGAAUCAGAGAAG(n) x GAGAAGUCAACCAGAGAAACACACUUCCC(n) b -3' (SEQ ID.: 83), wherein (n) x represents the releasable RNA segment, and (n) a and(n) b represents sequences complementary to the first and second target RNA molecules.

[0295] Table 4. Examples of ribozymes without a toehold (inhibitory domain). The underlined (______) sequences represent sequences contained in the target binding domain. Wavy underline The sequence represents a sequence contained in the releasable RNA segment, or a sequence contained in a region opposite to and at least partially complementary to the releasable RNA segment.

[0296]

[0297]

[0298]

[0299] Example 4. The ribozyme may be in a single catalytic domain configuration. These ribozymes contain only one RNA strand, similar to structures I and II in the detailed description of the invention.

[0300] A generic sequence for a single catalytic domain ribozyme is provided below:

[0301] 5'-(n) a GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGUGAUCGAAAGAGCACAGACCUGAAAAGGUCUUUCUGGUUUCGACCAGAAUCAGAGAAG(n) y GAGAAGUCAACCAGAGAAACAUAAUAUAC(n) b -3' (SEQ ID.: 88), wherein (n) a and(n) b represents a sequence complementary to the first and second target RNA molecules; (n) x represents the releasable RNA segment, and (n) y represents the sequence complementary to the releasable RNA segment.

[0302] The sequences of the two specific ribozymes detected in Figure 10 are provided in Table 5:

[0303] Table 5. Examples of ribozymes comprising a single catalytic domain. Sequences with a single underline (______) represent sequences contained in the target binding domain. Wavy underline The sequences in represent the sequences contained in the releasable RNA segment. The sequence represents a sequence contained in a region opposite to and at least partially complementary to the releasable RNA segment.

[0304]

[0305] 3. Results

[0306] Figure 3The working principle of an exemplary ribozyme is shown. In this embodiment, the ribozyme is reversely connected by two hairpin ribozymes, which are arranged in series and each have a modified spiral 4 containing a variable stem region and a complementary sequence of a target miRNA. The variable stem connecting the complementary side of the ribozyme and the target RNA is designed to have partial complementarity with the catalytic loop, acting as a "toehold" to minimize self-cleavage. In the absence of target RNA, no cleavage occurs, and the cleavage product is not released. The target RNA binding during the annealing cycle activates the cleavage, releasing the RNA product (the sequence of the product can be different and has loose complementarity with the ribozyme, thereby biasing cleavage rather than reconnection); RNA cleavage products and target miRNA are both released during the melting cycle. Therefore, the released target RNA molecule can be combined with the uncut ribozyme (excessive presence) again in the next round of annealing cycle. Because the ribozyme is excessive, a single target miRNA can activate the self-cleavage of multiple tandem HpRz, resulting in the release of multiple cleavage products, thereby amplifying the target RNA signal.

[0307] Alternatively, the cleavage product sequence can be identical to that of the target RNA, allowing exponential amplification.)

[0308] Figure 4 and 5 Results showing the ribozyme against miRNA dme-bantam-5p and its target. Increased miRNA levels ( Figure 4 ) and increase the number of cycles ( Figure 4 and 5 ) resulted in a 3-4 fold increase in the level of cleavage product produced. Given that the ribozyme was provided at a 4x molar ratio relative to the target, this confirms that the provided ribozyme was fully cleaved.

[0309] The ribozyme also works on human miRNAs, as demonstrated by the hsa-let-7f sensor ( Figure 6 When the amount of let-7f sensor was provided at a 2000-fold molar ratio relative to the target miRNA (200 nM sensor to 0.1 nM target), the target signal was amplified by about 200-fold ( Figure 6 ).

[0310] The ribozyme is specific, able to distinguish between its target RNA and different microRNAs, and can detect its target from a complex RNA mixture with a concentration 1000 times that of its target RNA ( Figure 7 ).

[0311] The ribozyme can detect and amplify target RNA molecules of 40nt, 60nt and 80nt in length, which contain RNA sequence fragments of genes (Orf1ab and E genes) from the genome of the coronavirus SARS-CoV-2. 200nM of ribozyme and 50nM of target RNA are provided in each reaction.

[0312] The cleavage products generated by the self-cleavage of the ribozyme can be used to activate Pandan fluorescence, as compared with mutant ribozymes that cannot cleave ( Fig. 9 ).

[0313] We also tested ribozymes with a single catalytic domain configuration. The single catalytic domain configuration can cut two cleavage sites to cause the release of RNA products. Two "single catalytic domain" configurations were tested, both of which target microRNA dme-ban-5p. (B) Designs 1 and 2 both effectively release cleavage products (ban3p reverse RNA) after incubation with target RNA molecules (dme-ban-5p).

[0314] Melting temperatures ranging from 50° C. to 90° C. were tested in the cleavage reaction of the ribozyme targeting dme-ban-5p (target RNA molecule). Temperatures ranging from above 50° C. to 90° C. were particularly effective in promoting the release of the cleavage product.

[0315] 4. Sequence Listing

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326] Sequence Listing <110> A*STAR <120> Ribozymes comprising a target binding domain <130> 9869SG5876 <150> SG 10201903323U <151> 2019-04-12 <160> 102 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> RNA <213> Artificial sequence <220> <223> Sequence of exemplary target RNA dme-bantam-5p <400> 1 ccgguuuucg auuugguuug acu 23 <210> 2 <211> 181 <212> RNA <213> Artificial sequence <220> <223> The resulting S1 chain of dme-ban-5-ribozyme (S1_Tban5p_Cban3pR) <400> 2 gggaagucaa accaaguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauugugcuc 120 gaaagagcac agaccugaaa aggucuuucg ugguauauua cucucugaaa ucgaaaaccg 180 g 181 <210> 3 <211> 109 <212> RNA <213> Artificial sequence <220> <223> The resulting S2 chain of dme-ban-5p-ribozyme (S2_Tban5p_Cban3pR) <400> 3 gggaagucaa accaaguaau auaagaaaca cacgaaucag agaagacgag cgucccacgg 60 gcgcagaaga gaagucaacc agagaaacau aauauacauc gaaaaccgg 109 <210> 4 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> Sequence of an exemplary target RNA hsa-let-7f-5p <400> 4 ugagguagua gauuguauag uu 22 <210> 5 <211> 180 <212> RNA <213> Artificial sequence <220> <223> The resulting S1 chain of hsa-let-7f-5p-ribozyme (S1_Tlet7f_Cban3pR) <400> 5 gggaaacuau acaauguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauugugcuc 120 gaaagagcac agaccugaaa aggucuuucg ugguauauua cucucugaac uacuaccuca 180 <210> 6 <211> 108 <212> RNA <213> Artificial sequence <220> <223> The resulting S2 chain of hsa-let-7f-5p-ribozyme (S2_Tlet7f_Cban3pR) <400> 6 gggaaacuau acaauguaau auaagaaaca cacgaaucag agaagacgag cgucccacgg 60 gcgcagaaga gaagucaacc agagaaacau aauauaccua cuaccuca 108 <210> 7 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> T7 promoter sequence <400> 7 gtataatacg actcactata ggga 24 <210> 8 <211> 156 <212> RNA <213> Artificial sequence <220> <223> S1 sequences with exemplary cleavage products, and (n)a and (n)b represent sequences complementary to the target RNA molecule. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (63)..(91) <223> Exemplary cleavage product SEQ ID NO. 25 <220> <221> misc_feature <222> (156)..(156) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 8 nguauauuag uauauuaccu gguuuucgau cgaaagaucg acgaggugaa aaccucguga 60 caguccuuag ucgaaaguuuuacuagaguc aguccugauu gugcucgaaa gagcacagac 120 cugaaaaggu cuuucguggu auauuacucu cugaan 156 <210> 9 <211> 84 <212> RNA <213> Artificial sequence <220> <223> S2 sequence. (n)a and (n)b represent sequences complementary to the target RNA molecule. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (84)..(84) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 9 nguaauauaa gaaacacacg aaucagagaa gacgagcguc ccacgggcgc agaagagaag 60 ucaaccagag aaacauaaua uacn 84 <210> 10 <211> 98 <212> DNA <213> Artificial sequence <220> <223> Core S1 DNA template <400> 10 ctggttttcg atcgaaagat cgacgaggtg aaaacctcgt gacagtcctt agtcgaaagt 60 tttactagag tcagtcctga ttgtgctcga aagagcac 98 <210> 11 <211> 54 <212> DNA <213> Artificial sequence <220> <223> Core S2 DNA template <400> 11 agaaacacac gaatcagaga agacgagcgt cccacgggcg cagaagagaa gtca 54 <210> 12 <211> 12 <212> RNA <213> Artificial sequence <220> <223> Reverse complementary sequence of the 5' mate sequence of dme-ban-5p <400> 12 aucgaaaacc gg 12 <210> 13 <211> 11 <212> RNA <213> Artificial sequence <220> <223> Reverse complementary sequence of the 3' mate sequence of dme-ban-5p <400> 13 agucaaacca a 11 <210> 14 <211> 73 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for dme-ban-5p <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 14 gtataatacg actcactata gggaagtcaa accaagtata ttagtatatt acctggtttt 60 cgatcgaaag atc 73 <210> 15 <211> 71 <212> DNA <213> Artificial sequence <220> <223> S1 reverse primer for dme-ban-5p <400> 15 ccggttttcg atttcagaga gtaatatacc acgaaagacc ttttcaggtc tgtgctcttt 60 cgagcacaat c 71 <210> 16 <211> 64 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer for dme-ban-5p <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 16 gtataatacg actcactata gggaagtcaa accaagtaat ataagaaaca cacgaatcag 60 agaa 64 <210> 17 <211> 48 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer for dme-ban-5p <400> 17 ccggttttcg atgtatatta tgtttctctg gttgacttct cttctgcg 48 <210> 18 <211> 11 <212> RNA <213> Artificial sequence <220> <223> The reverse complementary sequence of the 5' mate sequence of hsa-let-7f-5p <400> 18 cuacuaccuc a 11 <210> 19 <211> 11 <212> RNA <213> Artificial sequence <220> <223> The reverse complementary sequence of the 3' mate sequence of hsa-let-7f-5p <400> 19 aacuauacaa u 11 <210> 20 <211> 73 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for hsa-let-7f-5p <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 20 gtataatacg actcactata gggaaactat acaatgtata ttagtatatt acctggtttt 60 cgatcgaaag atc 73 <210> twenty one <211> 70 <212> DNA <213> Artificial sequence <220> <223> S1 reverse primer for hsa-let-7f-5p <400> twenty one tgaggtagta gttcagagag taatatacca cgaaagacct tttcaggtct gtgctctttc 60 gagcacaatc 70 <210> twenty two <211> 64 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer for hsa-let-7f-5p <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> twenty two gtataatacg actcactata gggaaactat acaatgtaat ataagaaaca cacgaatcag 60 agaa 64 <210> twenty three <211> 47 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer for hsa-let-7f-5p <400> twenty three tgaggtagta ggtatattat gtttctctgg ttgacttctc ttctgcg 47 <210> twenty four <211> twenty two <212> RNA <213> Artificial sequence <220> <223> hsa-miR-122-5p, a control RNA molecule with a different sequence from the target RNA molecule, is used to determine the sequence specificity of the ribozyme <400> twenty four uggaguguga caaugguguu ug 22 <210> 25 <211> 29 <212> RNA <213> Artificial sequence <220> <223> Exemplary cleavage products of SEQ ID NO. 8. <400> 25 guccuuaguc gaaaguuuua cuagaguca 29 <210> 26 <211> 134 <212> RNA <213> Artificial sequence <220> <223> Exemplary S1 sequences containing toeholds. (n)x represents a releasable RNA segment, and (n)a and (n)b represent sequences complementary to the first and second target RNA molecules. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (67)..(67) <223> (n)x represents a releasable RNA segment. <220> <221> misc_feature <222> (134)..(134) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 26 nguauauuag uauauuaccu gguuuucgau cgaaagaucg acgaggugaa aaccucguga 60 caguccncag uccugauugu gcucgaaaga gcacagaccu gaaaaggucu uucgugguau 120 auuacucucu gaan 134 <210> 27 <211> 65 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)a (the first sequence complementary to the target RNA molecule) and (n)x (the releasable RNA segment) of SEQ ID NO.: 26. <400> 27 guauauuagu auauuaccug guuuucgauc gaaagaucga cgaggugaaa accucgugac 60 agucc 65 <210> 28 <211> 66 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)x (cleavage product) and (n)b (second sequence complementary to the target RNA molecule) of SEQ ID NO.: 26. <400> 28 caguccugau ugugcucgaa agagcacaga ccugaaaagg ucuuucgugg uauauuacuc 60 ucugaa 66 <210> 29 <211> 62 <212> RNA <213> Artificial sequence <220> <223> Exemplary S2 sequence (including toehold). (n)x represents a region complementary to a portion of the releasable RNA segment on S1, and (n)a and (n)b represent sequences complementary to the second and first target RNA molecules. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (32)..(32) <223> (n)x represents a region that is partially complementary to the releasable RNA segment on S1. <220> <221> misc_feature <222> (62)..(62) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 29 nguaauauaa gaaacacacg aaucagagaa gngagaaguc aaccagagaa acauaauaua 60 cn 62 <210> 30 <211> 30 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)a (the sequence complementary to the second target RNA molecule) and (n)x (the region complementary to the portion of the releasable RNA segment) of SEQ ID NO.: 29. <400> 30 guaauauaag aaacacacga aucagagaag 30 <210> 31 <211> 29 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)x (region complementary to a portion of the releasable RNA segment) and (n)b (sequence complementary to the second target RNA molecule) of SEQ ID NO.: 29. <400> 31 gagaagucaa ccagagaaac auaauauac 29 <210> 32 <211> 154 <212> RNA <213> Artificial sequence <220> <223> Exemplary sequences of the region between motifs [A] and [A'] of S1, in the direction [A] to [A']. <400> 32 guauauuagu auauuaccug guuuucgauc gaaagaucga cgaggugaaa accucgugac 60 aguccuuagu cgaaaguuuu acuagaguca guccugauug ugcucgaaag agcacagacc 120 ugaaaagguc uuucguggua uauuacucuc ugaa 154 <210> 33 <211> 82 <212> RNA <213> Artificial sequence <220> <223> Exemplary sequences of the region between motifs [a'] and [a] of S2, in the direction [a'] to [a]. <400> 33 guaauauaag aaacacacga aucagagaag acgagcgucc cacgggcgca gaagagaagu 60 caaccagaga aacauaauau ac 82 <210> 34 <211> 107 <212> RNA <213> Artificial sequence <220> <223> Exemplary sequences of the region between motifs [B] and [B'] of S1, in the direction [B] to [B']. <220> <221> misc_feature <222> (1)..(9) <223> Catalytic domain <400> 34 guauauuacc ugguuuucga ucgaaagauc gacgagguga aaaccucgug acaguccuua 60 gucgaaaguu uuacuagagu caguccugau ugugcucgaa agagcac 107 <210> 35 <211> 66 <212> RNA <213> Artificial sequence <220> <223> Exemplary sequences of the region between motifs [b'] and [b] of S2, in the direction [b'] to [b]. <220> <221> misc_feature <222> (55)..(66) <223> Catalytic domain <400> 35 agaaacacac gaaucagaga agacgagcgu cccacgggcg cagaagagaa gucaaccaga 60 gaaaca 66 <210> 36 <211> 49 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for dme-ban-5p without T7 promoter sequence <400> 36 agtcaaacca agtatattag tatattacct ggttttcgat cgaaagatc 49 <210> 37 <211> 40 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer for dme-ban-5p without T7 promoter sequence <400> 37 agtcaaacca agtaatataa gaaacacacg aatcagagaa 40 <210> 38 <211> 49 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for hsa-let-7f-5p without T7 promoter sequence <400> 38 aactatacaa tgtatattag tatattacct ggttttcgat cgaaagatc 49 <210> 39 <211> 40 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer for hsa-let-7f-5p without T7 promoter sequence <400> 39 aactatacaa tgtaatataa gaaacacacg aatcagagaa 40 <210> 40 <211> 40 <212> RNA <213> Artificial sequence <220> <223> Target RNA T7_Orf1ab_ 20 <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 40 guauaauacg acucacuaua gggacagauc uaauggcugc 40 <210> 41 <211> 174 <212> RNA <213> Artificial sequence <220> <223> S1_Orf1ab_20 <400> 41 gcagccauua guauauuagu auauuaccug guuuucgauc gaaagaucga cgaggugaaa 60 120 agcacagacc ugaaaagguc uuucguggua uauuacucuc ugaagaucug uccc 174 <210> 42 <211> 102 <212> RNA <213> Artificial sequence <220> <223> S2_Orf1ab_20 <400> 42 gcagccauua guaauauaag aaacacacga aucagagaag acgagcgucc cacgggcgca 60 gaagagaagu caaccagaga aacauaauau acgaucuguccc 102 <210> 43 <211> 60 <212> RNA <213> Artificial sequence <220> <223> Target RNA T7_Orf1ab_ 40 <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 43 guauaauacg acucacuaua gggaguagac aauucuaguc uuacuauuaa gaaaccuaau 60 <210> 44 <211> 194 <212> RNA <213> Artificial sequence <220> <223> S1_Orf1ab_40 <400> 44 auuagguuuc uuaauaguaa guauauuagu auauuaccug guuuucgauc gaaagaucga 60 cgaggugaaa accucgugac aguccuuagu cgaaaguuuu acuagaguca guccugauug 120 ugcucgaaag agcacagacc ugaaaagguc uuucguggua uauuacucuc ugaagacuag 180 aauugucuac uccc 194 <210> 45 <211> 122 <212> RNA <213> Artificial sequence <220> <223> S2_Orf1ab_40 <400> 45 auuagguuuc uuaauaguaa guaauauaag aaacacacga aucagagaag acgagcgucc 60 cacgggcgca gaagagaagu caaccagaga aacauaauau acgacuagaa uugucuacuc 120 cc 122 <210> 46 <211> 80 <212> RNA <213> Artificial sequence <220> <223> T7_E gene_60 <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 46 guauaauacg acucacuaua gggacugcgc uucgauugug ugcguacugc ugcaauauug 60 uuaacgugag ucuuguaaaa 80 <210> 47 <211> 214 <212> RNA <213> Artificial sequence <220> <223> S1_E_gene_60 <400> 47 uuuuacaaga cucacguuaa caauauugca guauauuagu auauuaccug guuuucgauc 60 gaaagaucga cgaggugaaa accucgugac aguccuuagu cgaaaguuuu acuagaguca 120 guccugauug ugcucgaaag agcacagacc ugaaaagguc uuucguggua uauuacucuc 180 ugaagcagua cgcacacaau cgaagcgcag uccc 214 <210> 48 <211> 142 <212> RNA <213> Artificial sequence <220> <223> S2_E gene_60 <400> 48 uuuuacaaga cucacguuaa caauauugca guaauauaag aaacacacga aucagagaag 60 acgagcgucc cacgggcgca gaagagaagu caaccagaga aacauaauau acgcaguacg 120 cacacaaucg aagcgcaguc cc 142 <210> 49 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Target RNA without T7 promoter sequence T7_Orf1ab_20 <400> 49 cagaucuaau ggcugc 16 <210> 50 <211> 36 <212> RNA <213> Artificial sequence <220> <223> Target RNA without T7 promoter sequence T7_Orf1ab_40 <400> 50 guagacaauu cuagucuuac uauuaagaaa ccuaau 36 <210> 51 <211> 56 <212> RNA <213> Artificial sequence <220> <223> T7_E gene without T7 promoter sequence_60 <400> 51 cugcgcuucg augugugcg uacugcugca auauuguuaa cgugagucuu guaaaa 56 <210> 52 <211> 72 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for S1_Orf1ab_Gene_20_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 52 gtataatacg actcactata gggagcagcc attagtatat tagtatatta cctggttttc 60 gatcgaaaga tc 72 <210> 53 <211> 69 <212> DNA <213> Artificial sequence <220> <223> S1 reverse primer S1_Orf1ab_Gene_20_R <400> 53 gggacagatc ttcagagagt aatataccac gaaagacctt ttcaggtctg tgctctttcg 60 agcacaatc 69 <210> 54 <211> 63 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_Orf1ab_gene_20_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 54 gtataatacg actcactata gggagcagcc attagtaata taagaaacac acgaatcaga 60 63 <210> 55 <211> 46 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer S2_Orf1ab_Gene_20_R <400> 55 gggacagatc gtatattatg tttctctggt tgacttctct tctgcg 46 <210> 56 <211> 82 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer S1_Orf1ab_gene_40_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 56 gtataatacg actcactata gggaattagg tttcttaata gtaagtatat tagtatatta 60 cctggttttc gatcgaaaga tc 82 <210> 57 <211> 79 <212> DNA <213> Artificial sequence <220> <223> S1 reverse primer S1_Orf1ab_Gene_40_R <400> 57 gggagtagac aattctagtc ttcagagagt aatataccac gaaagacctt ttcaggtctg 60 tgctctttcg agcacaatc 79 <210> 58 <211> 73 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_Orf1ab_gene_40_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 58 gtataatacg actcactata gggaattagg tttcttaata gtaagtaata taagaaacac 60 acgaatcaga gaa 73 <210> 59 <211> 56 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer S2_Orf1ab_Gene_40_R <400> 59 gggagtagac aattctagtc gtatattatg tttctctggt tgacttctct tctgcg 56 <210> 60 <211> 92 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer S1_E_gene_60_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 60 gtataatacg actcactata gggattttac aagactcacg ttaacaatat tgcagtatat 60 tagtatatta cctggttttc gatcgaaaga tc 92 <210> 61 <211> 89 <212> DNA <213> Artificial sequence <220> <223> S1 reverse primer S1_E_gene_60_R <400> 61 gggactgcgc ttcgattgtg tgcgtactgc ttcagagagt aatataccac gaaagacctt 60 ttcaggtctg tgctctttcg agcacaatc 89 <210> 62 <211> 83 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_E_gene_60_F <220> <221> Promoter <222> (1)..(24) <223> T7 promoter sequence <400> 62 gtataatacg actcactata gggattttac aagactcacg ttaacaatat tgcagtaata 60 taagaaacac acgaatcaga gaa 83 <210> 63 <211> 66 <212> DNA <213> Artificial sequence <220> <223> S2 reverse primer S2_E_gene_60_R <400> 63 gggactgcgc ttcgattgtg tgcgtactgc gtatattatg tttctctggt tgacttctct 60 tctgcg 66 <210> 64 <211> 48 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer for S1_Orf1ab_Gene_20_F without T7 promoter sequence <400> 64 gcagccatta gtatattagt atattacctg gttttcgatc gaaagatc 48 <210> 65 <211> 39 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_Orf1ab_Gene_20_F without T7 promoter sequence <400> 65 gcagccatta gtaatataag aaacacacga atcagagaa 39 <210> 66 <211> 58 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer S1_Orf1ab_Gene_40_F without T7 promoter sequence <400> 66 attaggtttc ttaatagtaa gtatattagt atattacctg gttttcgatc gaaagatc 58 <210> 67 <211> 49 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_Orf1ab_Gene_40_F without T7 promoter sequence <400> 67 attaggtttc ttaatagtaa gtaatataag aaacacacga atcagagaa 49 <210> 68 <211> 68 <212> DNA <213> Artificial sequence <220> <223> S1 forward primer S1_E_gene_60_F without T7 promoter sequence <400> 68 ttttacaaga ctcacgttaa caatattgca gtatattagt atattacctg gttttcgatc 60 gaaagatc 68 <210> 69 <211> 59 <212> DNA <213> Artificial sequence <220> <223> S2 forward primer S2_E_gene_60_F without T7 promoter sequence <400> 69 ttttacaaga ctcacgttaa caatattgca gtaatataag aaacacacga atcagagaa 59 <210> 70 <211> 181 <212> RNA <213> Artificial sequence <220> <223> S1 chain of dme-ban-5p without toehold <400> 70 gggaagucaa accaagggaa gugguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauugugcuc 120 gaaagagcac agaccugaaa aggucuuucg ugguauauua ccugguccca ucgaaaaccg 180 g 181 <210> 71 <211> 109 <212> RNA <213> Artificial sequence <220> <223> S2 chain of dme-ban-5p without toehold <400> 71 gggaagucaa accaagggac cagagaaaca cacgaaucag agaagacgag cgucccacgg 60 gcgcagaaga gaagucaacc agagaaacac acuucccauc gaaaaccgg 109 <210> 72 <211> 180 <212> RNA <213> Artificial sequence <220> <223> S1 strand of hsa-let-7f-5p without toehold <400> 72 gggaaacuau acaaugggaa gugguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauugugcuc 120 gaaagagcac agaccugaaa aggucuuucg ugguauauua ccuggucccc uacuaccuca 180 <210> 73 <211> 108 <212> RNA <213> Artificial sequence <220> <223> S2 strand of hsa-let-7f-5p without toehold <400> 73 gggaaacuau acaaugggac cagagaaaca cacgaaucag agaagacgag cgucccacgg 60 gcgcagaaga gaagucaacc agagaaacac acuuccccua cuaccuca 108 <210> 74 <211> 174 <212> RNA <213> Artificial sequence <220> <223> Orf1ab_gene_20nt S1 strand without toehold <400> 74 gcagccauua gggaaguggu auauuaccug guuuucgauc gaaagaucga cgaggugaaa 60 120 agcacagacc ugaaaagguc uuucguggua uauuaccugg ucccgaucug uccc 174 <210> 75 <211> 102 <212> RNA <213> Artificial sequence <220> <223> Orf1ab_gene_20nt S2 strand without toehold <400> 75 gcagccauua gggaccagag aaacacacga aucagagaag acgagcgucc cacgggcgca 60 gaagagaagu caaccagaga aacacacuuc ccgaucuguc cc 102 <210> 76 <211> 194 <212> RNA <213> Artificial sequence <220> <223> Orf1ab_gene_40nt S1 strand without toehold <400> 76 auuagguuuc uuaauaguaa gggaaguggu auauuaccug guuuucgauc gaaagaucga 60 cgaggugaaa accucgugac aguccuuagu cgaaaguuuu acuagaguca guccugauug 120 ugcucgaaag agcacagacc ugaaaagguc uuucguggua uauuaccugg ucccgacuag 180 aauugucuac uccc 194 <210> 77 <211> 122 <212> RNA <213> Artificial sequence <220> <223> Orf1ab_gene_40nt S2 strand without toehold <400> 77 auuagguuuc uuaauaguaa gggaccagag aaacacacga aucagagaag acgagcgucc 60 cacgggcgca gaagagaagu caaccagaga aacacacuuc ccgacuagaa uugucuacuc 120 cc 122 <210> 78 <211> 214 <212> RNA <213> Artificial sequence <220> <223> E_gene_60nt S1 strand without toehold <400> 78 uuuuacaaga cucacguuaa caauauugca gggaaguggu auauuaccug guuuucgauc 60 gaaagaucga cgaggugaaa accucgugac aguccuuagu cgaaaguuuu acuagaguca 120 guccugauug ugcucgaaag agcacagacc ugaaaagguc uuucguggua uauuaccugg 180 ucccgcagua cgcacacaau cgaagcgcag uccc 214 <210> 79 <211> 142 <212> RNA <213> Artificial sequence <220> <223> E_gene_60nt S2 strand without toehold <400> 79 uuuuacaaga cucacguuaa caauauugca gggaccagag aaacacacga aucagagaag 60 acgagcgucc cacgggcgca gaagagaagu caaccagaga aacacacuuc ccgcaguacg 120 cacacaaucg aagcgcaguc cc 142 <210> 80 <211> 134 <212> RNA <213> Artificial sequence <220> <223> Exemplary S1 sequence (without toehold). (n)x represents a region partially complementary to the releasable RNA segment on S1, and (n)a and (n)b represent sequences complementary to the target miRNA molecule. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (67)..(67) <223> (n)x represents a region that is partially complementary to the releasable RNA segment on S1. <220> <221> misc_feature <222> (134)..(134) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 80 ngggaagugg uauauuaccu gguuuucgau cgaaagaucg acgaggugaa aaccucguga 60 caguccncag uccugauugu gcucgaaaga gcacagaccu gaaaaggucu uucgugguau 120 auuaccuggu cccn 134 <210> 81 <211> 65 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)a (the first sequence complementary to the target RNA molecule) and (n)x (the releasable RNA segment) of SEQ ID NO.: 80. <400> 81 gggaaguggu auauuaccug guuuucgauc gaaagaucga cgaggugaaa accucgugac 60 agucc 65 <210> 82 <211> 66 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)x (cleavage product) and (n)b (second sequence complementary to the target RNA molecule) of SEQ ID NO.: 80. <400> 82 caguccugau ugugcucgaa agagcacaga ccugaaaagg ucuuucgugg uauauuaccu 60 gguccc 66 <210> 83 <211> 62 <212> RNA <213> Artificial sequence <220> <223> Exemplary S2 sequence (without toehold). (n)x represents a region that is partially complementary to the releasable RNA segment on S1, and (n)a and (n)b represent sequences that are complementary to the second and first target RNA molecules. <220> <221> misc_feature <222> (1) <223> (n)a represents the first sequence complementary to the target RNA molecule. <220> <221> misc_feature <222> (32)..(32) <223> (n)x represents a region that is partially complementary to the releasable RNA segment on S1. <220> <221> misc_feature <222> (62)..(62) <223> (n)b represents a second sequence complementary to the target RNA molecule. <400> 83 ngggaccaga gaaacacacg aaucagagaa gngagaaguc aaccagagaa acacacuucc 60 cn 62 <210> 84 <211> 30 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)a (the sequence complementary to the second target RNA molecule) and (n)x (the region complementary to the portion of the releasable RNA segment) of SEQ ID NO.: 83. <400> 84 gggaccagag aaacacacga aucagagaag 30 <210> 85 <211> 29 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)x (region complementary to the portion of the releasable RNA segment) and (n)b (sequence complementary to the second target RNA molecule) of SEQ ID NO.: 83. <400> 85 gagaagucaa ccagagaaac acacuuccc 29 <210> 86 <211> 237 <212> RNA <213> Artificial sequence <220> <223> Tban5p_Cban3pR_Single-side design 1_Full length <220> <221> misc_feature <222> (5)..(15) <223> Sequence complementary to the target RNA <220> <221> misc_feature <222> (81)..(103) <223> Releasable RNA segments <220> <221> misc_feature <222> (174)..(196) <223> Sequences partially complementary to the releasable RNA segment <220> <221> misc_feature <222> (226)..(237) <223> Sequence complementary to the target RNA <400> 86 gggaagucaa accaaguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauugugauc 120 gaaagagcac agaccugaaa aggucuuucu gguuucgacc agaaucagag aagacgagcg 180 ucccacgggc gcagaagaga agucaaccag agaaacauaa uauacaucga aaaccgg 237 <210> 87 <211> 193 <212> RNA <213> Artificial sequence <220> <223> Tban5p_Cban3pR_Single-side design 2_Full length <220> <221> misc_feature <222> (5)..(15) <223> Sequence complementary to the target RNA molecule <220> <221> misc_feature <222> (81)..(103) <223> Releasable RNA segments <220> <221> misc_feature <222> (130)..(152) <223> Sequences partially complementary to the releasable RNA segment <220> <221> misc_feature <222> (182)..(193) <223> Sequence complementary to the target RNA molecule <400> 87 gggaagucaa accaaguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucaguccu gauuuucgaa 120 ucagagaaga cgagcguccc acgggcgcag aagagaaguc aaccagagaa acauaauaua 180 caucgaaaac cgg 193 <210> 88 <211> 168 <212> RNA <213> Artificial sequence <220> <223> Exemplary sequences of single-chain ribozymes. <220> <221> misc_feature <222> (1) <223> (n)a represents a sequence complementary to the first region of the target RNA molecule <220> <221> misc_feature <222> (67)..(67) <223> (n)x represents the releasable RNA segment <220> <221> misc_feature <222> (138)..(138) <223> (n)y represents a sequence that is optionally complementary to the releasable RNA segment <220> <221> misc_feature <222> (168)..(168) <223> (n)b represents a sequence complementary to the second region of the target RNA molecule <400> 88 nguauauuag uauauuaccu gguuuucgau cgaaagaucg acgaggugaa aaccucguga 60 caguccncag uccugauugu gaucgaaaga gcacagaccu gaaaaggucu uucugguuuc 120 gaccagaauc agagaagnga gaagucaacc agagaaacau aauauacn 168 <210> 89 <211> 65 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)a and (n)x of SEQ ID NO.: 88 <400> 89 guauauuagu auauuaccug guuuucgauc gaaagaucga cgaggugaaa accucgugac 60 agucc 65 <210> 90 <211> 70 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)x and (n)y of SEQ ID NO.: 88 <400> 90 caguccugau uggaucgaa agagcacaga ccugaaaagg ucuuucugu uucgaccaga 60 aucagagaag 70 <210> 91 <211> 29 <212> RNA <213> Artificial sequence <220> <223> The portion between (n)y and (n)b of SEQ ID NO.: 88 <400> 91 gagaagucaa ccagagaaac auaauauac 29 <210> 92 <211> 183 <212> RNA <213> Artificial sequence <220> <223> S1_Tban5p_Cban3pR_Dup <400> 92 gggaagucaa accaaguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucagucca gaaaucuccc 120 ucacuucggu gagggagauu ucugagaaga caccagagaa acauaauaua caucgaaaac 180 cgg 183 <210> 93 <211> 95 <212> RNA <213> Artificial sequence <220> <223> S2_Tban5p_Cban3pR_Dup <400> 93 gggaagucaa accaaguaua uuaguauauu accugguguc ccacgggcgc agaagagaag 60 ucaaccagag aaacauaaua uacaucgaaa accgg 95 <210> 94 <211> 182 <212> RNA <213> Artificial sequence <220> <223> S1_Tlet7f_Cban3pR_Dup <400> 94 gggaaacuau acaauguaua uuaguauauu accugguuuu cgaucgaaag aucgacgagg 60 ugaaaaccuc gugacagucc uuagucgaaa guuuuacuag agucagucca gaaaucuccc 120 ucacuucggu gagggagauu ucugagaaga caccagagaa acauaauaua ccuacuaccu 180 ca 182 <210> 95 <211> 94 <212> RNA <213> Artificial sequence <220> <223> S2_Tlet7f_Cban3pR_Dup <400> 95 gggaaacuau acaauguaua uuaguauauu accugguguc ccacgggcgc agaagagaag 60 ucaaccagag aaacauaaua uaccuacuac cuca 94 <210> 96 <211> 180 <212> RNA <213> Artificial sequence <220> <223> S1_T_Orf1ab_20_Cban3pR_Dup <400> 96 gggagcagcc auuaguauau uaguauauua ccugguuuuc gaucgaaaga ucgacgaggu 60 gaaaaccucg ugacaguccu uagucgaaag uuuuacuaga gucaguccag aaaucucccu 120 cacuucggug agggagauuu cugagaagac accagagaaa cauaauauac gaucuguccc 180 <210> 97 <211> 92 <212> RNA <213> Artificial sequence <220> <223> S2_T_Orf1ab_20_Cban3pR_Dup <400> 97 gggagcagcc auuaguauau uaguauauua ccuggugucc cacgggcgca gaagagaagu 60 caaccagaga aacauaauau acgaucuguc cc 92 <210> 98 <211> 200 <212> RNA <213> Artificial sequence <220> <223> S1_T_Orf1ab_40_Cban3pR_Dup <400> 98 gggaauuagg uuucuuaaua guaaguauau uaguauauua ccugguuuuc gaucgaaaga 60 ucgacgaggu gaaaaccucg ugacaguccu uagucgaaag uuuuacuaga gucaguccag 120 aaaucucccu cacuucggug agggagauuu cugagaagac accagagaaa cauaauauac 180 gacuagaauu gucuacuccc 200 <210> 99 <211> 112 <212> RNA <213> Artificial sequence <220> <223> S2_T_Orf1ab_40_Cban3pR_Dup <400> 99 gggaauuagg uuucuuaaua guaaguauau uaguauauua ccuggugucc cacgggcgca 60 gaagagaagu caaccagaga aacauaauau acgacuagaa uugucuacuc cc 112 <210> 100 <211> 220 <212> RNA <213> Artificial sequence <220> <223> S1_T_E gene_60_Cban3pR_Dup <400> 100 gggauuuuac aagacucacg uuaacaauau ugcaguauau uaguauauua ccugguuuuc 60 gaucgaaaga ucgacgaggu gaaaaccucg ugacaguccu uagucgaaag uuuuacuaga 120 gucaguccag aaaucucccu cacuucggug agggagauuu cugagaagac accagagaaa 180 cauaauauac gcaguacgca cacaaucgaa gcgcaguccc 220 <210> 101 <211> 132 <212> RNA <213> Artificial sequence <220> <223> S2_T_E gene_60_Cban3pR_Dup <400> 101 gggauuuuac aagacucacg uuaacaauau ugcaguauau uaguauauua ccuggugucc 60 cacgggcgca gaagagaagu caaccagaga aacauaauau acgcaguacg cacacaaucg 120 aagcgcaguc cc 132 <210> 102 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> RNA T7 promoter sequence <400> 102 guauaauacg acucacuaua ggga 24

Claims

1. A ribozyme comprising: a) one or more catalytic domains that are capable of switching between an active state and an inactive state; b) one or more releasable RNA segments, wherein each of the releasable RNA segments is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by at least one of the one or more catalytic domains in the active state; c) one or more target binding domains, each of the one or more target binding domains being used to bind to a target RNA molecule; wherein each of the one or more catalytic domains is linked to one of the one or more target binding domains; wherein when the target binding domain connected to the catalytic domain does not bind to the target RNA molecule, the catalytic domain is in an inactive state, and wherein when the target binding domain connected to the catalytic domain binds to the target RNA molecule, the catalytic domain is in an active state; and Wherein when two cleavage sites flanking the releasable RNA segment are both cleaved due to activation of the one or more catalytic domains, the one or more releasable RNA segments are released from the ribozyme.

2. The ribozyme of claim 1, further comprising one or more inhibitory domains; wherein at least one of the one or more catalytic domains is linked to one of the one or more inhibitory domains, wherein the catalytic domain is inactive due to inhibition from the inhibitory domain, and the inhibitory domain is linked to one of the one or more target binding domains; Wherein when one of the one or more target binding domains binds to a target RNA molecule, the inhibitory domain connected to the target binding domain stops inhibiting the catalytic domain connected to the inhibitory domain, which causes the catalytic domain to switch to an active state.

3. The ribozyme of claim 1, wherein the ribozyme comprises a catalytic domain and a target binding domain, wherein the ribozyme comprises the following structure: wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: The motifs [A] and [a] constitute the target binding domain for binding to the target RNA molecule; Motifs [C] and [c] constitute the catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the catalytic domain; Motif [E] contains a releasable RNA segment; The motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of the motif [E]; and wherein when the target binding domain binds to the target RNA molecule, the catalytic domain is in an active state.

4. The ribozyme of claim 3, wherein the horizontal line of each connecting motif represents a linker region.

5. The ribozyme of claim 2, wherein the ribozyme comprises a catalytic domain, an inhibitory domain and a target binding domain, wherein the ribozyme comprises an RNA strand having the following structure: wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: The motifs [A] and [a] constitute the target binding domain for binding to the target RNA molecule; Motifs [B] and [b] constitute the inhibitory domain; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the catalytic domain; Motif [D'] comprises a second cleavage site capable of being cleaved by the catalytic domain; Motif [E] comprises a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary or non-complementary to the sequence of motif [E]; and wherein the inhibitory domain is characterized by the following i) or ii): i) when the target binding domain is not bound to the target RNA molecule, the motif [b] anneals to [C], and when the target binding domain is bound to the target RNA molecule, the motif [b] anneals to [B], ii) when the first target binding domain is not bound to the target RNA molecule, motif [B] anneals with motif [c], and when the target binding domain is bound to the target RNA molecule, motif [B] anneals with motif [b], wherein when motif [b] anneals with motif [B], the catalytic domain is in an active state.

6. The ribozyme of claim 5, wherein the horizontal line of each connecting motif represents a linker region.

7. The ribozyme of claim 1, wherein the ribozyme comprises two catalytic domains.

8. The ribozyme of claim 7, wherein the ribozyme comprises two target binding domains.

9. The ribozyme of claim 7, wherein the ribozyme comprises a first RNA strand and a second RNA strand.

10. The ribozyme of claim 5, wherein the ribozyme comprises the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; and wherein when the first target binding domain binds to the first target RNA molecule, the first catalytic domain is in an active state; and wherein when the second target binding domain binds to the second target RNA molecule, the second catalytic domain is in an active state.

11. The ribozyme of claim 10, wherein the horizontal line of each connecting motif represents a linker region.

12. The ribozyme of claim 2, wherein the ribozyme comprises the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [B] and [b] constitute the inhibitory domain; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; wherein the inhibitory domain is characterized by the following i) or ii): i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B], ii) when the first target binding domain is not bound to the first target RNA molecule, motif [B] anneals with motif [c], and when the first target binding domain is bound to the first target RNA molecule, motif [B] anneals with motif [b]; When motif [b] anneals with motif [B], the first catalytic domain is in an active state.

13. The ribozyme of claim 12, wherein the horizontal line of each connecting motif represents a linker region.

14. The ribozyme of claim 5, wherein the inhibitory domain is further characterized by i) or ii) below: i) motif [b] is at least 50% complementary to motif [C] and at least 20% complementary to motif [B], and ii) Motif [B] is at least 50% complementary to motif [c] and at least 20% complementary to motif [b].

15. The ribozyme of claim 2, wherein the ribozyme comprises the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [B] and [b] constitute the first inhibitory domain; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; the motifs [B'] and [b'] constitute a second inhibition domain; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; Wherein the first inhibitory domain is characterized by the following i) or ii): i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B], ii) when the first target binding domain is not bound to the first target RNA molecule, motif [B] anneals with motif [c], and when the first target binding domain is bound to the first target RNA molecule, motif [B] anneals with motif [b], Wherein the second inhibitory domain is characterized by the following i) or ii): i) when the second target binding domain is not bound to the first target RNA molecule, the motif [b'] anneals with the motif [C'], and when the second target binding domain is bound to the second target RNA molecule, the motif [b'] anneals with [B'], ii) when the second target binding domain is not bound to the second target RNA molecule, the motif [B'] anneals with the motif [c'], and when the second target binding domain is bound to the second target RNA molecule, the motif [B'] anneals with [b'], When motif [b] anneals with motif [B], the first catalytic domain is in an active state, and when motif [b'] anneals with motif [B'], the second catalytic domain is in an active state.

16. The ribozyme of claim 15, wherein the horizontal line of each connecting motif represents a linker region.

17. The ribozyme of claim 15, wherein the first inhibitory domain is further characterized by i) or ii) below: i) motif [b] is at least 50% complementary to motif [C] and at least 20% complementary to motif [B], and ii) motif [B] is at least 50% complementary to motif [c] and at least 20% complementary to motif [b]; and the second inhibitory domain is further characterized by i) or ii): i) motif [b'] is at least 50% complementary to motif [C'] and at least 20% complementary to motif [B'], ii) Motif [B'] is at least 50% complementary to motif [c'] and at least 20% complementary to motif [b'].

18. The ribozyme of claim 4, wherein the linker regions independently or collectively form one or more secondary structures.

19. The ribozyme of claim 18, wherein the one or more secondary structures are selected from the group consisting of a single nucleotide bulge, a trinucleotide bulge, a stem, a stem-loop, a t-RNA type structure, a cloverleaf, a tetraloop, a pseudoknot, a symmetric internal loop, an asymmetric internal loop, a three-stem connector, a four-stem connector, a two-stem connector, or a coaxial stacking or a combination thereof.

20. The ribozyme of claim 6, wherein the linker regions independently or collectively form one or more secondary structures.

21. The ribozyme of claim 20, wherein the one or more secondary structures are selected from the group consisting of a single nucleotide bulge, a trinucleotide bulge, a stem, a stem-loop, a t-RNA type structure, a cloverleaf, a tetraloop, a pseudoknot, a symmetric internal loop, an asymmetric internal loop, a three-stem connector, a four-stem connector, a two-stem connector, or a coaxial stacking or a combination thereof.

22. The ribozyme of claim 11, wherein the linker regions independently or collectively form one or more secondary structures.

23. The ribozyme of claim 22, wherein the one or more secondary structures are selected from the group consisting of a single nucleotide bulge, a trinucleotide bulge, a stem, a stem-loop, a t-RNA type structure, a cloverleaf, a tetraloop, a pseudoknot, a symmetric internal loop, an asymmetric internal loop, a three-stem connector, a four-stem connector, a two-stem connector, or a coaxial stacking or a combination thereof.

24. The ribozyme of claim 13, wherein the linker regions independently or collectively form one or more secondary structures.

25. The ribozyme of claim 24, wherein the one or more secondary structures are selected from the group consisting of a single nucleotide bulge, a trinucleotide bulge, a stem, a stem-loop, a t-RNA type structure, a cloverleaf, a tetraloop, a pseudoknot, a symmetric internal loop, an asymmetric internal loop, a three-stem connector, a four-stem connector, a two-stem connector, or a coaxial stacking or a combination thereof.

26. The ribozyme of claim 16, wherein the linker regions independently or collectively form one or more secondary structures.

27. The ribozyme of claim 26, wherein the one or more secondary structures are selected from the group consisting of a single nucleotide bulge, a trinucleotide bulge, a stem, a stem-loop, a t-RNA type structure, a cloverleaf, a tetraloop, a pseudoknot, a symmetric internal loop, an asymmetric internal loop, a three-stem connector, a four-stem connector, a two-stem connector, or a coaxial stacking or a combination thereof.

28. The ribozyme of claim 3, wherein motifs [E] and [e] are complementary to each other with a complementarity of less than 70%.

29. The ribozyme of any one of claims 15-17 and 22-27, wherein the first RNA strand and the second RNA strand comprise the sequences of SEQ ID NO.: 26 and SEQ ID NO.: 29, respectively.

30. The ribozyme of any one of claims 1-28, wherein the target RNA molecule comprises a region complementary to the target binding domain, wherein the region is greater than 16 nucleotides in length.

31. The ribozyme of any one of claims 1-28, wherein the releasable RNA segment is 6-150 nucleotides in length.

32. The ribozyme of any one of claims 1-28, wherein the one or more target binding domains are used to bind to the same target RNA molecule.

33. The ribozyme of any one of claims 1-28, wherein the releasable RNA segment comprises a sequence identical to at least one of the one or more target RNA molecules.

34. The ribozyme of any one of claims 1-28, wherein the target RNA molecule is an RNA molecule obtained from an animal, a virus, a bacterium, a yeast or a plant.

35. The ribozyme of any one of claims 1-28, wherein the target RNA molecule is a microRNA, or a precursor thereof, or a fragment thereof.

36. The ribozyme of any one of claims 1-28, wherein the target RNA molecule is the genome of an RNA virus, or a fragment thereof.

37. The ribozyme of claim 36, wherein the RNA virus is selected from the group consisting of Retroviridae, Coronaviridae, Picornaviridae, Caliciviridae, Flaviviridae, Togaviridae, Bornaviridae, Filoviridae, Paramyxoviridae, Pneumovirinae, Rhabdoviridae, Arenaviridae, Bunyanviridae, and Orthomyxoviridae.

38. The ribozyme of claim 37, wherein the RNA virus is selected from the group consisting of a lentivirinae virus, lymphocytic choriomeningitis virus, human immunodeficiency virus (HIV), severe acute respiratory syndrome virus (SARS), poliovirus, rhinovirus, hepatitis A virus, Norwalk virus, yellow fever virus, West Nile virus, hepatitis C virus, dengue virus, Zika virus, rubella virus, Ross River virus, Sindbis virus, chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, measles virus, mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hanta virus, Crimean-Congo hemorrhagic fever virus, influenza virus, and hepatitis D virus.

39. The ribozyme of claim 37, wherein the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

40. Use of a ribozyme according to any one of claims 1 to 39 in the preparation of a reagent or kit for use in a method for diagnosing a disease, wherein the diagnosis comprises detecting the presence of a target RNA molecule in a sample, the detection comprising the following steps: a) incubating the sample with the ribozyme at temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme; b) incubating the sample at temperature T2, which allows the target RNA molecules and RNA segments to be released from the ribozyme; c) detecting the release of the releasable RNA segment from said ribozyme.

41. The use of claim 40, wherein steps a) to b) are repeated one or more times before performing step c), wherein the RNA molecule released from step b) is capable of binding to another copy of the ribozyme.

42. Use of a ribozyme according to any one of claims 1 to 39 in the preparation of a reagent or kit for use in a method for diagnosing a disease, wherein the diagnosis comprises amplifying a target RNA molecule, the amplification comprising: a) incubating the target RNA molecule with the ribozyme at temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme, and wherein the releasable RNA segment comprises a sequence identical to the target RNA molecule; b) incubating the ribozyme bound to the target RNA molecule at temperature T2, which allows the target RNA molecule and RNA segment to be released from the ribozyme.

43. The use of claim 42, wherein steps a) to b) are repeated one or more times, wherein the target RNA molecules and releasable RNA segments released from step b) are capable of binding to another copy of the ribozyme.

44. The use according to any one of claims 40 to 43, wherein T1 is a temperature not exceeding 50°C.

45. The use according to any one of claims 40 to 43, wherein T2 is a temperature of 20°C to 100°C.

46. ​​The use according to claim 40 or 42, wherein the target RNA molecule is an RNA molecule obtained from an animal, a virus, a bacterium or a yeast.

47. The use according to claim 40 or 42, wherein the target RNA molecule is a microRNA, or a precursor thereof, or a fragment thereof.

48. The method of claim 40 or 42, wherein the target RNA molecule is a genome of an RNA virus, or a fragment thereof.

49. The use of claim 48, wherein the RNA virus is selected from the group consisting of Retroviridae, Coronaviridae, Picornaviridae, Caliciviridae, Flaviviridae, Togaviridae, Bornaviridae, Filoviridae, Paramyxoviridae, Pneumovirinae, Rhabdoviridae, Arenaviridae, Bunyanviridae and Orthomyxoviridae.

50. The method of claim 49, wherein the RNA virus is selected from the group consisting of a lentivirinae virus, lymphocytic choriomeningitis virus, human immunodeficiency virus (HIV), severe acute respiratory syndrome virus (SARS), poliovirus, rhinovirus, hepatitis A virus, Norwalk virus, yellow fever virus, West Nile virus, hepatitis C virus, dengue virus, Zika virus, rubella virus, Ross River virus, Sindbis virus, chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, measles virus, mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hanta virus, Crimean-Congo hemorrhagic fever virus, influenza virus, and hepatitis D virus.

51. The method of claim 49, wherein the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

52. A polynucleotide encoding the ribozyme of any one of claims 1-39.

53. A kit comprising the ribozyme of any one of claims 1-39.

54. The kit of claim 53, further comprising an RNA detection system.

55. The kit of claim 54, wherein the RNA detection system comprises an RNA-activated fluorescent sensor.

56. A kit as described in claim 54, wherein the RNA detection system is a CRISPR-Cas based nucleic acid detection system.

57. A ribozyme comprising: a) a catalytic domain, the catalytic domain being capable of switching between an active state and an inactive state; b) a releasable RNA segment, wherein the releasable RNA segment is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by a catalytic domain in an active state; c) a target binding domain, which is used to bind to a target RNA molecule; The ribozyme comprises an RNA chain having the following structure: wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: Motifs [A] and [a] constitute the target binding domain for binding to the target RNA molecule; Motifs [C] and [c] constitute the catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; wherein when the target binding domain binds to the target RNA molecule, the catalytic domain is in an active state; and Wherein when two cleavage sites flanking the releasable RNA segment are both cleaved due to activation of the catalytic domain, the releasable RNA segment is released from the ribozyme.

58. A ribozyme comprising: a) a catalytic domain, the catalytic domain being capable of switching between an active state and an inactive state; b) a releasable RNA segment, wherein the releasable RNA segment is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by a catalytic domain in an active state; c) an inhibitory domain; and d) a target binding domain, which is used to bind to a target RNA molecule; The ribozyme comprises an RNA chain having the following structure: wherein [A] to [a] are 5' to 3' directional or 3' to 5' directional, and wherein: Motifs [A] and [a] constitute the target binding domain for binding to the target RNA molecule; Motifs [B] and [b] constitute the inhibitory domain; Motifs [C] and [c] constitute the catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; wherein the catalytic domain is connected to the inhibitory domain, wherein the catalytic domain is in an inactive state due to inhibition from the inhibitory domain, and the inhibitory domain is connected to the target binding domain; wherein the inhibitory domain is characterized by the following i) or ii): i) when the target binding domain is not bound to the target RNA molecule, the motif [b] anneals to [C], and when the target binding domain is bound to the target RNA molecule, the motif [b] anneals to [B], ii) when the target binding domain is not bound to the target RNA molecule, motif [B] anneals to motif [c], and when the target binding domain is bound to the target RNA molecule, motif [B] anneals to motif [b], wherein when motif [b] anneals to motif [B], the catalytic domain is in an active state; and Wherein when two cleavage sites flanking the releasable RNA segment are both cleaved due to activation of the catalytic domain, the releasable RNA segment is released from the ribozyme.

59. The ribozyme of claim 58, comprising the sequence 5'(n) a GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAAGAUCGAC GAGGUGAAAACCUCGUGACAGUCC(n) x CAGUCCUGAUUGGUGAUCGAAAGAGCACAGACCUGAAAAGGUCUUUCUGGUUUCGACCAGAAUCA GAGAAG(n) y GAGAAGUCAACCAGAGAAACAUAAUAUAC(n) b 3'(SEQ ID.:88), Where (n) a represents motif [A]; (n) b Represents motif [a], (n) x represents the motif [E], and (n) y Represents motif [e].

60. A ribozyme comprising: a) two catalytic domains, which are capable of switching between an active state and an inactive state; b) a releasable RNA segment, wherein the releasable RNA segment is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by a catalytic domain in an active state; and c) two target binding domains, each of which is used to bind to two target RNA molecules; wherein each of the catalytic domains is linked to one of the target binding domains; wherein the ribozyme comprises a first RNA chain and a second RNA chain having the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; and The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is less than 70% complementary to the sequence of motif [E]; wherein when the first target binding domain binds to the first target RNA molecule, the first catalytic domain is in an active state; wherein when the second target binding domain binds to the second target RNA molecule, the second catalytic domain is in an active state; Wherein when two cleavage sites flanking the releasable RNA segment are both cleaved due to activation of the catalytic domain, the releasable RNA segment is released from the ribozyme.

61. The ribozyme of claim 60, wherein the first RNA strand S1 comprises the nucleotide sequence 5'(n) a1 GGGAAGUGGUAUAUUACCUGGUUUUCGAUCGAAAGA UCGACGAGGUGAAAACCUCGUGACAGUCC(n) x1 CAGUCCUGAUUGUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAUUA CCUGGUCCC(n) b1 3'(SEQ ID NO:80); wherein (n) a1 Representative motif [A], (n) x1 represents the motif [E], and (n) b1 represents the motif [A']; and The second RNA strand S2 comprises a nucleotide sequence 5'(n) a2 GGGACCAGAGAAA CACACGAAUCAGAGAAG(n) x GAGAAGUCAACCAGAGAAACACACUU CCC(n) b2 3'(SEQ ID NO:83); wherein (n) a2 Represents motif [a], (n) x2 represents the motif [e], and (n) b2 Represents the motif [a'].

62. A ribozyme comprising: a) two catalytic domains, which are capable of switching between an active state and an inactive state; b) a releasable RNA segment, wherein the releasable RNA segment is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by a catalytic domain in an active state; c) an inhibitory domain; and d) two target binding domains, each of the target binding domains is used to bind to two target RNA molecules; The ribozyme comprises a first RNA chain and a second RNA chain having the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [B] and [b] constitute the inhibitory domain; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is fully complementary, partially complementary, or non-complementary to the sequence of motif [E]; wherein the first catalytic domain is connected to the inhibitory domain; wherein the catalytic domain is inactive due to inhibition from the inhibitory domain, and the inhibitory domain is connected to the target binding domain; wherein the inhibitory domain is characterized by the following i) or ii): i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B], ii) when the first target binding domain is not bound to the first target RNA molecule, motif [B] anneals with motif [c], and when the first target binding domain is bound to the first target RNA molecule, motif [B] anneals with motif [b], When motif [b] anneals with motif [B], the first catalytic domain is in an active state.

63. A ribozyme comprising: a) two catalytic domains, which are capable of switching between an active state and an inactive state; b) a releasable RNA segment, wherein the releasable RNA segment is flanked by two ribozyme cleavage sites, wherein cleavage at each cleavage site is catalyzed by a catalytic domain in an active state; c) two inhibitory domains; and d) two target binding domains, each of the target binding domains is used to bind to two target RNA molecules; The ribozyme comprises a first RNA chain and a second RNA chain having the following structure: in: S1 is the first RNA strand and S2 is the second RNA strand, wherein [A] to [A'] and [a] to [a'] represent opposite directionality; The motifs [A] and [a] constitute a first target binding domain for binding to a first target RNA molecule; Motifs [B] and [b] constitute the first inhibitory domain; Motifs [C] and [c] constitute the first catalytic domain; Motif [D] comprises a first cleavage site capable of being cleaved by the first catalytic domain; The motifs [A'] and [a'] constitute a second target binding domain for binding to a second target RNA molecule; Motifs [B'] and [b'] constitute the second inhibitory domain; The motifs [C'] and [c'] constitute the second catalytic domain; The motif [D'] comprises a second cleavage site capable of being cleaved by the second catalytic domain; Motif [E] contains a releasable RNA segment; Motif [e] comprises a sequence that is less than 70% complementary to the sequence of motif [E]; wherein the first catalytic domain is connected to the first inhibitory domain and the second catalytic domain is connected to the second inhibitory domain; wherein the catalytic domain is inactive due to inhibition from the inhibitory domain, and the inhibitory domain is connected to the target binding domain; Wherein the first inhibitory domain is characterized by the following i) or ii): i) when the first target binding domain is not bound to the first target RNA molecule, the motif [b] anneals to [C], and when the first target binding domain is bound to the first target RNA molecule, the motif [b] anneals to [B], ii) when the first target binding domain is not bound to the first target RNA molecule, motif [B] anneals with motif [c], and when the first target binding domain is bound to the first target RNA molecule, motif [B] anneals with motif [b], Wherein the second inhibitory domain is characterized by the following i) or ii): i) when the second target binding domain is not bound to the first target RNA molecule, the motif [b'] anneals with the motif [C'], and when the second target binding domain is bound to the second target RNA molecule, the motif [b'] anneals with [B'], ii) when the second target binding domain is not bound to the second target RNA molecule, the motif [B'] anneals with the motif [c'], and when the second target binding domain is bound to the second target RNA molecule, the motif [B'] anneals with [b'], wherein when motif [b] is annealed to motif [B], the first catalytic domain is in an active state, and when motif [b'] is annealed to motif [B'], the second catalytic domain is in an active state; Wherein when two cleavage sites flanking the releasable RNA segment are both cleaved due to activation of the catalytic domain, the releasable RNA segment is released from the ribozyme.

64. The ribozyme of claim 63, wherein the first RNA strand S1 comprises the nucleotide sequence 5'(n) a1 GUAUAUUAGUAUAUUACCUGGUUUUCGAUCGAAA GAUCGACGAGGUGAAAACCUCGUGACAGUCC(n) x1 CAGUCCUGAUU GUGCUCGAAAGAGCACAGACCUGAAAAGGUCUUUCGUGGUAUAU UACUCUCUGAA(n) b1 3', where (n) a1 Representative motif [A], (n) x1 represents the motif [E], and (n) b1 represents the motif [A']; and The second RNA strand S2 comprises a nucleotide sequence 5'(n) a2 GUAUAUAAGAAACACACGAAUCAGAGAAG(n) x2 GAGAAGUC AACCAGAGAAACAUAAUAUAC(n) b2 3', where (n) a2 represents the motif [a'], (n) x2 represents the motif [e], and (n) b2 Represents motif [a].

65. A non-diagnostic and non-therapeutic method for detecting the presence of a target RNA molecule in a sample, wherein the method comprises the following steps: a) incubating a sample with a ribozyme according to any one of claims 1 to 39 at a temperature T1, which allows the target RNA molecule to bind to one or more target binding domains contained in the ribozyme; b) incubating the sample at temperature T2, which allows the target RNA molecules and RNA segments to be released from the ribozyme; c) detecting the release of the releasable RNA segment from said ribozyme.

66. The method of claim 65, wherein steps a) to b) are repeated one or more times before performing step c), wherein the RNA molecules released from step b) are capable of binding to another copy of the ribozyme.

67. A non-diagnostic and non-therapeutic method for amplifying a target RNA molecule, wherein the method comprises: a) incubating a target RNA molecule with a ribozyme according to any one of claims 1 to 39 at a temperature T1, which allows the target RNA molecule to bind to one or more target binding domains comprised in the ribozyme, and wherein the releasable RNA segment comprises a sequence identical to the target RNA molecule; b) incubating the ribozyme bound to the target RNA molecule at temperature T2, which allows the target RNA molecule and RNA segment to be released from the ribozyme.

68. The method of claim 67, wherein steps a) to b) are repeated one or more times, wherein the target RNA molecules and releasable RNA segments released from step b) are capable of binding to another copy of the ribozyme.

69. The method of any one of claims 65-68, wherein T1 is a temperature not exceeding 50°C.

70. The method of any one of claims 65-68, wherein T2 is a temperature of 20°C to 100°C.

71. The method of claim 65 or 67, wherein the target RNA molecule is an RNA molecule obtained from an animal, a virus, a bacterium, a yeast or a plant.

72. The method of claim 65 or 67, wherein the target RNA molecule is a microRNA, or a precursor thereof, or a fragment thereof.

73. The method of claim 65 or 67, wherein the target RNA molecule is the genome of an RNA virus, or a fragment thereof.

74. The method of claim 73, wherein the RNA virus is selected from the group consisting of Retroviridae, Coronaviridae, Picornaviridae, Caliciviridae, Flaviviridae, Togaviridae, Bornaviridae, Filoviridae, Paramyxoviridae, Pneumovirinae, Rhabdoviridae, Arenaviridae, Bunyanviridae, and Orthomyxoviridae.

75. The method of claim 74, wherein the RNA virus is selected from the group consisting of a lentivirinae virus, lymphocytic choriomeningitis virus, human immunodeficiency virus (HIV), severe acute respiratory syndrome virus (SARS), poliovirus, rhinovirus, hepatitis A virus, Norwalk virus, yellow fever virus, West Nile virus, hepatitis C virus, dengue virus, Zika virus, rubella virus, Ross River virus, Sindbis virus, chikungunya virus, Borna disease virus, Ebola virus, Marburg virus, measles virus, mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, rabies virus, Lassa virus, Hanta virus, Crimean-Congo hemorrhagic fever virus, influenza virus, and hepatitis D virus.

76. The method of claim 74, wherein the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

Images