Complement component C5 iRNA compositions and methods of use thereof

Abstract

The present invention relates to iRNA, such as double-stranded ribonucleic acid (dsRNA), compositions targeting complement component C5 gene and methods of using such iRNA (e.g., dsRNA), compositions to inhibit the expression of C5 and treat subjects suffering from a complement component C5-associated disease (e.g., paroxysmal nocturnal hemoglobinuria).

Description

[0001] The present application is a divisional application of the national invention patent application No. 201480027279.0, whose application date is March 13, 2014 and whose invention name is “Complement component C5 iRNA composition and method of use thereof”.

[0002] Related Applications

[0003] This application claims the benefit of U.S. Provisional Patent Application Nos. 61 / 782,531, filed March 14, 2013, 61 / 837,399, filed June 20, 2013, and 61 / 904,579, filed November 15, 2013, 61 / 912,777, filed December 6, 2013, and 61 / 942367, filed February 20, 2014. The entire contents of each of the foregoing provisional patent applications are hereby incorporated herein by reference.

[0004] Sequence Listing

[0005] This application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 10, 2014, is named 121301-00520_SL.txt and is 734,486 bytes in size. Background of the Invention

[0006] Complement was first discovered in the 1890s when it was found that complement aided or "complemented" the killing of bacteria by heat-stable antibodies present in normal serum (Walport, MJ (2001) N Engl J Med. 344:1058). The complement system consists of more than 30 proteins that are present either as soluble proteins in the blood or as membrane-associated proteins. Activation of complement causes a sequential cascade of enzymatic reactions (called the complement activation pathway) leading to the formation of the potent anaphylatoxins C3a and C5a, which induce a variety of physiological responses ranging from chemoattraction to apoptosis. Initially, complement was thought to play a major role in innate immunity, in which a powerful and rapid response is mounted against invading pathogens. However, it has become increasingly apparent recently that complement also plays an important role in adaptive immunity, which involves helping to eliminate pathogens (Dunkelberger JR and Song WC. (2010) Cell Res. 20:34; Molina H et al. (1996) Proc Natl Acad Sci USA 93:3357), helping to maintain immune memory T cells and B cells that prevent pathogenic re-invasion, and complement is involved in many human pathological conditions (Qu H et al. (2009) Mol Immunol. 47:185; Wagner E. and Frank MM. (2010) Nat Rev Drug Discov. 9:43).

[0007] Complement activation is known to occur via three different pathways: the alternative pathway, the classical pathway, and the lectin pathway ( Figure 1), involving proteins that exist primarily as inactive zymogens that are then sequentially cleaved and activated. All pathways of complement activation result in the cleavage of the C5 molecule, generating the anaphylatoxin C5a and C5b that subsequently forms the terminal complement complex (C5b-9). C5a exerts its primary proinflammatory activity by interacting with the classical G protein-coupled receptor C5aR (CD88) and with the non-G protein-coupled receptor C5L2 (GPR77) expressed on various immune and non-immune cells. C5b-9 causes cell lysis by forming the membrane attack complex (MAC), and the sublytic MAC and soluble C5b-9 also have numerous non-cytolytic immune functions. These two complement effectors, C5a and C5b-9, generated from the cleavage of C5 are key components of the complement system responsible for propagating and / or initiating pathology in various diseases, including paroxysmal nocturnal hemoglobinuria, rheumatoid arthritis, ischemia-reperfusion injury, and neurodegenerative diseases.

[0008] To date, only one therapeutic agent targeting the C5-C5a axis is available for the treatment of complement component C5-associated diseases, the anti-C5 antibody eculizumab. Although eculizumab has been shown to be effective for the treatment of paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), and is currently being evaluated in clinical trials for additional complement component C5-associated diseases, eculizumab therapy requires weekly high-dose infusions at an annual cost of approximately $400,000, followed by maintenance infusions every two weeks. Therefore, there is a need in the art for alternative and combination therapies for subjects with complement component C5-associated diseases. SUMMARY OF THE INVENTION

[0009] The present invention provides iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of C5 genes. The C5 gene can be in a cell, such as a cell in a subject such as a human. The present invention also provides methods and combined therapies for treating subjects with conditions that would benefit from inhibiting or reducing the expression of the C5 gene, such as complement component C5-associated diseases, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), and these methods and combined therapies use iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the C5 gene to inhibit the expression of the C5 gene.

[0010] Therefore, on the one hand, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides.

[0011] On the other hand, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a complementary region comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any antisense sequence listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23.

[0012] In one embodiment, the sense and antisense strands comprise a sequence selected from the group consisting of A-118320, A-118321, A-118316, A-118317, A-118332, A-118333, A-118396, A-118397, A-118386, A-118387, A-118312, A-118313, A-118324, A-118325, A-118324, A-118325 , A-119332, A-119333, A-119328, A-119329, A-119322, A-119323, A-119324, A-119325, A-119334, A-119335, A-119330, A-119331, A-119326, A-119327, A-125167, A-125173, A-125647, A-125157, A-125173, and A-125127. In another embodiment, the sense and antisense strands comprise a sequence selected from the group consisting of any sequence in any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21, and Table 23. In one embodiment, the dsRNA agent comprises at least one modified nucleotide.

[0013] In one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUUAUAAUA (SEQ ID NO: 62), and wherein the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUU (SEQ ID NO: 113). In one embodiment, the dsRNA agent comprises at least one modified nucleotide, as described below.

[0014] In one aspect, the present invention provides a double-stranded RNAi agent for inhibiting the expression of complement component C5, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand attached at the 3'-terminus.

[0015] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand comprise a modification.

[0016] In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal deoxy-thymine (dT) nucleotides. In another embodiment, substantially all of the nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal deoxy-thymine (dT) nucleotides. In another embodiment, the nucleotides of these modifications are short sequences of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand is included in two phosphorothioate internucleotide linkages at the 5'-end. In one embodiment, the antisense strand is included in two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives attached at the 3 '-end via a branched divalent or trivalent linker.

[0017] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of: 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, non-natural base containing nucleotides, nucleotides containing 5'-thiophosphate groups, and terminal nucleotides attached to a cholesterol derivative or a dodecanoic acid didecylamide group.

[0018] In another embodiment, the modified nucleotides contain a short sequence of 3'-terminal deoxy-thymidine (dT) nucleotides.

[0019] In one embodiment, the length of the complementary region is at least 17 nucleotides. In another embodiment, the length of the complementary region is between 19 and 21 nucleotides.

[0020] In one embodiment, the region of complementarity is 19 nucleotides in length.

[0021] In one embodiment, each strand is no more than 30 nucleotides in length.

[0022] In one embodiment, at least one strand comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0023] In one embodiment, the dsRNA agent further comprises a ligand.

[0024] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

[0025] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In one embodiment, the ligand is

[0026]

[0027] In one embodiment, the dsRNA agent is conjugated to a ligand as shown in the following schematic diagram,

[0028]

[0029] and wherein X is O or S.

[0030] In one embodiment, the X is O.

[0031] In one embodiment, the complementary region consists of one of the antisense sequences of any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21, and Table 23.

[0032] In one embodiment, the dsRNA agent is selected from the group consisting of AD-58123, AD-58111, AD-58121, AD-58116, AD-58133, AD-58099, AD-58088, AD-58642, AD-58644, AD-58641, AD-58647, AD-58645, AD-58643, AD-58646, AD-62510, AD-62643, AD-62645, AD-62646, AD-62650 and AD-62651.

[0033] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence AAGCAAGAUAUUUUUUAUAAUA (SEQ ID NO:62), and wherein the antisense strand comprises the nucleotide sequence UAUUAUAAAAAUAUCUUGCUUUUdTdT (SEQ ID NO:2899).

[0034] On the other hand, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence asasGfcAfaGfaUfAfUfuUfuuAfuAfauaL96 (SEQ ID NO: 2876), and wherein the antisense strand comprises the nucleotide sequence usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT (SEQ ID NO: 2889).

[0035] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0036] Meaning: 5'n p -N a -(XXX) i -N b -YY YNb -(ZZZ) j -N a -n q 3'

[0037] Antonym: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0038] in:

[0039] i, j, k and l are each independently 0 or 1;

[0040] p, p', q and q' are each independently 0-6;

[0041] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0042] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0043] Each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、n q and n q 'Each of these may or may not exist;

[0044] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides;

[0045] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0046] Wherein the sense strand is conjugated to at least one ligand.

[0047] In one embodiment, i is 0; j is 0; i is 1; j is 1; both i and j are 0; or both i and j are 1.

[0048] In one embodiment, k is 0; l is 0; k is 1; l is 1; both k and l are 0; or both k and l are 1.

[0049] In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0050] In an embodiment, the YYY motif occurs at or near the cleavage site of the sense strand.

[0051] In one embodiment, the Y'Y'Y' motif occurs at positions 11, 12, and 13 of the antisense strand from the 5'-end.

[0052] In one embodiment, the Y' is 2'-O-methyl.

[0053] In one embodiment, formula (III) is represented by formula (IIIa):

[0054] Meaning: 5'n p -N a -YY YN a -n q 3'

[0055] Antonym: 3'n p' -N a' -Y'Y'Y'-N a' -n q' 5'(IIIa).

[0056] In another embodiment, formula (III) is represented by formula (IIIb):

[0057] Meaning: 5'n p -N a -YY YN b -ZZ ZN a -n q 3'

[0058] Antonym: 3'n p' -N a' -Y'Y'Y'-N b' -Z'Z'Z'-N a' -n q' 5'(IIIb)

[0059] Among them, each N b and N b' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides.

[0060] In yet another embodiment, formula (III) is represented by formula (IIIc):

[0061] Meaning: 5'n p -N a -XX XN b -YY YN a -n q 3'

[0062] Antonym: 3'n p' -N a' -X'X'X'-N b' -Y'Y'Y'-N a' -n q' 5'(IIIc)

[0063] Among them, each N b and N b ' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides.

[0064] In another embodiment, formula (III) is represented by formula (IIId):

[0065] Meaning: 5'n p -N a -XX XN b -YY YN b -ZZ ZN a -n q 3'

[0066] Antonym: 3'n p' -N a' -X'X'X'-N b' -Y'Y'Y'-N b' -Z'Z'Z'-N a' -n q' 5'(IIId)

[0067] Among them, each N b and N b ' independently represents an oligonucleotide sequence comprising 1-5 modified nucleotides, and each N a and N a ' independently represents an oligonucleotide sequence comprising 2-10 modified nucleotides.

[0068] In one embodiment, the double-stranded region is 15-30 nucleotide pairs in length.

[0069] In one embodiment, the length of the double-stranded region is 17-23 nucleotide pairs. In another embodiment, the length of the double-stranded region is 17-25 nucleotide pairs. In another embodiment, the length of the double-stranded region is 23-27 nucleotide pairs. In another embodiment, the length of the double-stranded region is 19-21 nucleotide pairs. In another embodiment, the length of the double-stranded region is 21-23 nucleotide pairs.

[0070] In one embodiment, each strand has 15-30 nucleotides.

[0071] In one embodiment, the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl and combinations thereof.

[0072] In one embodiment, the modifications on the nucleotides are 2'-O-methyl or 2'-fluoro modifications.

[0073] In one embodiment, the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0074] In one embodiment, the ligand is

[0075]

[0076] In one embodiment, the ligand is attached to the 3' end of the sense strand.

[0077] In one embodiment, the RNAi agent is conjugated to a ligand as shown in the following schematic diagram

[0078]

[0079] In one embodiment, the reagent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0080] In an embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3 '-terminus of one strand.

[0081] In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0082] In an embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5 '-terminus of one strand.

[0083] In one embodiment, the strand is the antisense strand. In another embodiment, the strand is the sense strand.

[0084] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5 '-terminus and the 3 '-terminus of a strand.

[0085] In one embodiment, the strand is the antisense strand.

[0086] In one embodiment, the base pair at the 1 position of the 5 '-end of the antisense strand of the duplex is an AU base pair.

[0087] In one embodiment, the Y nucleotides comprise a 2'-fluoro modification.

[0088] In one embodiment, the Y' nucleotides contain a 2'-O-methyl modification.

[0089] In one embodiment, p'>0.

[0090] In one embodiment, p'=2.

[0091] In one embodiment, q'=0, p=0, q=0, and the p' overhang nucleotide is complementary to the target mRNA.

[0092] In one embodiment, q'=0, p=0, q=0, and the p' overhang nucleotide is not complementary to the target mRNA.

[0093] In one embodiment, the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

[0094] In one embodiment, at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage.

[0095] In one embodiment, all n p ' are linked to adjacent nucleotides via phosphorothioate linkages.

[0096] In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table 4, Table 18, Table 19, or Table 23. In another embodiment, the RNAi agent is selected from the group consisting of AD-58123, AD-58111, AD-58121, AD-58116, AD-58133, AD-58099, AD-58088, AD-58642, AD-58644, AD-58641, AD-58647, AD-58645, AD-58643, AD-58646, AD-62510, AD-62643, AD-62645, AD-62646, AD-62650, and AD-62651.

[0097] In one aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding complement component C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0098] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0099] Antonym: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0100] in:

[0101] i, j, k and l are each independently 0 or 1;

[0102] p, p', q and q' are each independently 0-6;

[0103] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0104] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0105] Each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、nq and n q 'Each of these may or may not exist;

[0106] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0107] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0108] Wherein the sense strand is conjugated to at least one ligand.

[0109] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding complement component C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0110] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0111] Antonym: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0112] in:

[0113] i, j, k and l are each independently 0 or 1;

[0114] Each n p 、n q and n q ' independently represents the overhang nucleotide, the n p 、n q and nq 'Each of these may or may not exist;

[0115] p, q and q' are each independently 0-6;

[0116] n p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage;

[0117] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0118] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0119] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0120] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0121] Wherein the sense strand is conjugated to at least one ligand.

[0122] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding complement component C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0123] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0124] Antonym: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0125] in:

[0126] i, j, k and l are each independently 0 or 1;

[0127] Each n p 、n q and n q ' independently represents the overhang nucleotide, the n p 、n q and n q 'Each of these may or may not exist;

[0128] p, q and q' are each independently 0-6;

[0129] n p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage;

[0130] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0131] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0132] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0133] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0134] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0135] In yet another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding complement component C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0136] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0137] Antonym: 3'n p '-N a '-(X'X'X') k –N b '-Y'Y'Y'-Ν b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0138] in:

[0139] i, j, k and l are each independently 0 or 1;

[0140] Each n p 、n q and n q ' independently represents the overhang nucleotide, the n p 、n q and n q 'Each of these may or may not exist;

[0141] p, q and q' are each independently 0-6;

[0142] n p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage;

[0143] Each N a and N a'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0144] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0145] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0146] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y';

[0147] wherein the sense strand comprises at least one phosphorothioate linkage; and

[0148] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0149] In another aspect, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of complement component C5 in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding complement component C5, wherein the length of each strand is about 14 to about 30 nucleotides, wherein the double-stranded RNAi agent is represented by formula (III):

[0150] Meaning: 5'n p -N a -YY YN a -n q 3'

[0151] Antonym: 3'n p '-N a '-Y'Y'Y'-N a '-n q '5'(IIIa)

[0152] in:

[0153] Each n p 、n q and n q ' independently represents the overhang nucleotide, the np 、n q and n q 'Each of these may or may not exist;

[0154] p, q and q' are each independently 0-6;

[0155] n p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage;

[0156] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0157] YYY and Y'Y'Y' each independently represent a motif having three identical modifications on three consecutive nucleotides, and wherein the modifications are 2'-O-methyl or 2'-fluoro modifications;

[0158] wherein the sense strand comprises at least one phosphorothioate linkage; and

[0159] wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0160] In one aspect, the present invention provides a double-stranded RNAi agent for inhibiting the expression of complement component C5, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that are not more than 3 nucleotides different from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprises a nucleotide sequence that is not more than 3 nucleotides different from the nucleotide sequence of SEQ ID NO: 1. NO:5 has a nucleotide sequence that differs by no more than 3 nucleotides for at least 15 consecutive nucleotides, wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification and a 2'-fluoro modification, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5'-terminus and two phosphorothioate internucleotide linkages at the 3'-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached at the 3'-terminus via a branched divalent or trivalent linker.

[0161] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides. In another embodiment, each strand has 19-30 nucleotides.

[0162] In one aspect, the invention provides a cell comprising a dsRNA agent of the invention.

[0163] In one aspect, the invention provides a vector encoding at least one strand of a dsRNA agent, wherein the dsRNA agent comprises a region complementary to at least a portion of an mRNA encoding complement component C5, wherein the dsRNA is 30 base pairs or less in length, and wherein the dsRNA agent targets the mRNA for cleavage.

[0164] In one embodiment, the length of the complementary region is at least 15 nucleotides. In another embodiment, the length of the complementary region is 19 to 21 nucleotides. In another embodiment, each strand has 19-30 nucleotides.

[0165] In one aspect, the invention provides a cell comprising a vector of the invention.

[0166] In one aspect, the present invention provides a pharmaceutical composition for inhibiting the expression of complement component C5 gene, the pharmaceutical composition comprising the dsRNA agent of the present invention.

[0167] In one embodiment, the RNAi agent is administered as an unbuffered solution.

[0168] In one embodiment, the unbuffered solution is saline or water.

[0169] In one embodiment, the RNAi agent is administered with a buffer solution.

[0170] In one embodiment, the buffer solution comprises acetate, citrate, prolamine, carbonate or phosphate or any combination thereof.

[0171] In another embodiment, the buffer solution is phosphate buffered saline (PBS).

[0172] In another aspect, the present invention provides a pharmaceutical composition comprising a double-stranded RNAi agent of the present invention and a lipid formulation.

[0173] In one embodiment, the lipid formulation comprises LNP.In another embodiment, the lipid formulation comprises MC3.

[0174] In one aspect, the present invention provides a composition comprising an antisense polynucleotide agent selected from the group consisting of sequences listed in any one of Table 3, Table 4, Table 5, Table 6, Table 19, Table 18, Table 20, Table 21 and Table 23.

[0175] On the other hand, the present invention provides a composition comprising a sense polynucleotide agent selected from the group consisting of sequences listed in any one of Table 3, Table 4, Table 5, Table 6, Table 19, Table 18, Table 20, Table 21 and Table 23.

[0176] In yet another aspect, the present invention provides a modified antisense polynucleotide agent selected from the group consisting of the antisense sequences listed in any one of Table 4, Table 6, Table 18, Table 19, Table 21 and Table 23.

[0177] In an additional aspect, the present invention provides a modified sense polynucleotide agent selected from the group consisting of the sense sequences listed in any one of Table 4, Table 6, Table 18, Table 19, Table 21 and Table 23.

[0178] In one aspect, the invention provides methods for treating a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the patient, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides.

[0179] In another aspect, the present invention provides methods for preventing at least one symptom in a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom in the subject suffering from a condition that would benefit from reduced expression of C5, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides.

[0180] In another aspect, the invention provides methods for treating a subject having a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby treating the subject, the antisense strand comprising a complementary region comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any of the antisense sequences listed in any of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0181] In yet another aspect, the invention provides methods of preventing at least one symptom in a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a prophylactically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby preventing at least one symptom in the subject suffering from a condition that would benefit from reduced expression of C5, the antisense strand comprising a complementary region comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any of the antisense sequences listed in any of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0182] In one aspect, the invention provides methods for treating a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5, the methods comprising administering to the subject a therapeutically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and wherein the sense strand is conjugated to one or more ligands at the 3'-terminus.

[0183] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0184] In one embodiment, the administration is subcutaneous.

[0185] In one embodiment, substantially all nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, substantially all nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are short sequences of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand is included in two phosphorothioate internucleotide linkages at the 5'-end. In one embodiment, the antisense strand is included in two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives, which are attached to the 3'-end by a branched divalent or trivalent linker.

[0186] In another aspect, the present invention provides methods for preventing at least one symptom in a subject suffering from a disease or disorder that would benefit from reduced expression of complement component C5, the methods comprising administering to the subject a prophylactically effective amount of a double-stranded RNAi agent, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and wherein the sense strand is conjugated to a ligand at the 3'-terminus.

[0187] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0188] In one embodiment, the administration is subcutaneous.

[0189] In one embodiment, substantially all nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, substantially all nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are short sequences of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand is included in two phosphorothioate internucleotide linkages at the 5'-end. In one embodiment, the antisense strand is included in two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives, which are attached to the 3'-end by a branched divalent or trivalent linker.

[0190] In one aspect, the invention provides methods for treating a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby treating the subject, thereby treating a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

[0191] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0192] Antonym: 3'n p '-N a '-(X'X'X') k –N b '-Y'Y'Y'-Ν b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0193] in:

[0194] i, j, k and l are each independently 0 or 1;

[0195] p, p', q and q' are each independently 0-6;

[0196] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0197] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0198] Each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、n q and n q 'Each of these may or may not exist;

[0199] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides;

[0200] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0201] Wherein the sense strand is conjugated to at least one ligand.

[0202] In another aspect, the present invention provides methods for preventing at least one symptom in a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5. These methods comprise administering to the subject a prophylactically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby preventing at least one symptom in the subject suffering from a condition that would benefit from reduced expression of C5, thereby preventing at least one symptom in a subject suffering from a disease or condition that would benefit from reduced expression of complement component C5, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

[0203] Meaning: 5'n p -N a -(XXX)i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0204] Antonym: 3'n p '-N a '-(X'X'X') k –N b '-Y'Y'Y'-Ν b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0205] in:

[0206] i, j, k and l are each independently 0 or 1;

[0207] p, p', q and q' are each independently 0-6;

[0208] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0209] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0210] Each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、n q and n q 'Each of these may or may not exist;

[0211] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides;

[0212] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0213] Wherein the sense strand is conjugated to at least one ligand.

[0214] In one embodiment, administration of the dsRNA to the subject results in reduced intravascular hemolysis, stabilization of hemoglobin levels, and / or reduced accumulation of C5 protein.

[0215] In one embodiment, the condition is a complement component C5-associated disease. In one embodiment, the complement component C5-associated disease is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration. hemolytic, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; pauci-immune vasculitis; epidermolysis bullosa; recurrent abortions; preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin-associated Escherichia coli (E. coli)-associated hemolytic uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibodies vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allogeneic transplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Degos' disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disorders, heart Myositis, cerebrovascular disease, peripheral vascular disease, renal vascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, vasculitis associated with systemic lupus erythematosus, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vascular disease, Kawasaki's disease (arteritis), venous gas embolism (VGE) and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barre syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the complement component C5-associated disease is paroxysmal nocturnal hemoglobinuria (PNH). In yet another embodiment, the complement component C5-associated disease is atypical hemolytic uremic syndrome (aHUS).

[0216] In one embodiment, the subject is a human.

[0217] In another embodiment, the methods of the invention further comprise administering to the subject an anti-complement component C5 antibody or antigen-binding fragment thereof.

[0218] In one embodiment, the antibody or antigen-binding fragment thereof inhibits the cleavage of complement component C5 into fragments C5a and C5b. In another embodiment, the anti-complement component C5 antibody is eculizumab.

[0219] In another embodiment, the methods of the invention further comprise administering to the subject a meningococcal vaccine.

[0220] In one embodiment, the subject is administered eculizumab at a dose of less than about 600 mg weekly for 4 weeks, followed by a fifth dose of less than about 900 mg about one week later, followed by a dose of less than about 900 mg about every two weeks thereafter.

[0221] In another embodiment, the subject is administered eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, followed by doses of less than about 1200 mg about every two weeks thereafter.

[0222] In one embodiment, the subject is less than 18 years old, and

[0223] The subject is administered eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0224] In another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg per week for 2 weeks, followed by a third dose of less than about 900 mg about one week later, followed by a dose of less than about 900 mg about every two weeks thereafter.

[0225] In another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg weekly for 2 weeks, followed by a third dose of less than about 600 mg about one week later, followed by a dose of less than about 600 mg about every two weeks thereafter.

[0226] In yet another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg per week for 1 week, followed by a second dose of less than about 300 mg about one week later, followed by a dose of less than about 300 mg about every two weeks thereafter.

[0227] In one embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 300 mg weekly for 1 week, followed by a second dose of less than about 300 mg about one week later, followed by a dose of less than about 300 mg about every two weeks thereafter.

[0228] In another embodiment, the methods of the invention further comprise performing plasmapheresis or plasma exchange in the subject.In one such embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg or at a dose of less than about 300 mg.

[0229] In a further embodiment, the methods of the invention further comprise performing a plasma transfusion in the subject. In one such embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0230] In one embodiment, eculizumab is administered to the subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg. In another embodiment, eculizumab is administered to the subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0231] In one embodiment, the subject is administered eculizumab at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0232] In one embodiment, eculizumab is administered to the subject by an intravenous infusion.

[0233] In another embodiment, eculizumab is administered subcutaneously to the subject.

[0234] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0235] In another embodiment, the dsRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg.

[0236] In one embodiment, the dsRNA agent is administered at a dose selected from the group consisting of 0.5 mg / kg 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg and 30 mg / kg.

[0237] In one embodiment, the dsRNA agent is administered to the subject once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0238] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0239] In one embodiment, the dsRNA agent and the eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and the eculizumab are administered simultaneously to the subject.

[0240] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0241] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%.

[0242] In one embodiment, eculizumab is administered at a dose of about 100-500 mg.

[0243] In one embodiment, the methods of the invention further comprise measuring hemoglobin and / or LDH levels in the subject.

[0244] In one embodiment, the dsRNA is conjugated to a ligand.

[0245] In one embodiment, the ligand is conjugated to the 3 '-end of the sense strand of the dsRNA.

[0246] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0247] In one aspect, the present invention provides methods for inhibiting the expression of complement component C5 in cells. These methods include contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides; and maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0248] On the other hand, the present invention provides methods for inhibiting the expression of complement component C5 in cells. These methods include contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, the antisense strand comprising a complementary region comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any antisense sequence listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23; and maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0249] In another aspect, the present invention provides a method for inhibiting the expression of complement component C5 in a cell, the method comprising contacting the cell with a dsRNA agent comprising a sense strand and an antisense strand, the antisense strand comprising a complementary region, the sense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprising at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and wherein the sense strand is conjugated to one or more ligands at the 3'-terminus; and maintaining the cell produced in the first step for a time sufficient to obtain degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0250] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0251] In one embodiment, substantially all nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, substantially all nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are short sequences of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand is included in two phosphorothioate internucleotide linkages at the 5'-end. In one embodiment, the antisense strand is included in two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives, which are attached to the 3'-end by a branched divalent or trivalent linker.

[0252] In yet another aspect, the present invention provides methods for inhibiting the expression of complement component C5 in a cell. These methods include contacting the cell with a dsRNA agent comprising a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

[0253] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0254] Antonym: 3'n p '-N a '-(X'X'X') k –N b '-Y'Y'Y'-Ν b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0255] in:

[0256] i, j, k and l are each independently 0 or 1;

[0257] p, p', q and q' are each independently 0-6;

[0258] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0259] Each N b and N b ' independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof; each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、n q and n q 'Each of these may or may not exist;

[0260] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides;

[0261] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0262] wherein the sense strand is conjugated to at least one ligand; and the cell produced in step (a) is maintained for a time sufficient to obtain degradation of the mRNA transcript of the C5 gene, thereby inhibiting the expression of the C5 gene in the cell.

[0263] In one embodiment, the cell is within a subject.

[0264] In one embodiment, the subject is a human.

[0265] In one embodiment, the human subject suffers from a complement component C5-associated disease.

[0266] In one embodiment, the complement component C5-associated disease is selected from the group consisting of paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; pauci-immune vasculitis; epidermolysis bullosa; recurrent abortion; preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis, bullous pemphigoid, Shiga toxin coli-associated hemolytic uremic syndrome, C3 nephropathy, antineutrophil cytoplasmic antibody-associated vasculitis, humoral and vascular transplant rejection, graft dysfunction, myocardial infarction, allogeneic transplantation, sepsis, coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, Degos' disease, antiphospholipid syndrome ( In some embodiments, the complement component C5-associated disease is characterized by a combination of factors: APS, catastrophic APS (CAPS), cardiovascular disorders, myocarditis, cerebrovascular disease, peripheral vascular disease, renal vascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, vasculitis associated with systemic lupus erythematosus, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki's disease (arteritis), venous gas embolism (VGE) and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barre syndrome, and percutaneous transluminal coronary angioplasty (PTCA). In another embodiment, the complement component C5-associated disease is paroxysmal nocturnal hemoglobinuria (PNH). In another embodiment, the complement component C5-associated disease is atypical hemolytic uremic syndrome (aHUS).

[0267] In one embodiment, the methods further comprise contacting the cell with an anti-complement component C5 antibody or antigen-binding fragment thereof.

[0268] In one embodiment, the antibody or antigen-binding fragment thereof inhibits the cleavage of complement component C5 into fragments C5a and C5b.

[0269] In one embodiment, the anti-complement component C5 antibody or antigen-binding fragment thereof is eculizumab.

[0270] In one embodiment, the methods further comprise contacting the cell with a meningococcal vaccine.

[0271] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg weekly for 4 weeks, followed by a fifth dose of less than about 900 mg about one week later, followed by a dose of less than about 900 mg about every two weeks thereafter.

[0272] In another embodiment, the cell is contacted with eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0273] In another embodiment, the cell is contacted with eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, and then about every two weeks thereafter at a dose of less than about 1200 mg.

[0274] In yet another embodiment, the cell is contacted with eculizumab at a dose of less than about 600 mg weekly for 2 weeks, followed by a third dose of less than about 900 mg about one week later, and then by a dose of less than about 900 mg about every two weeks thereafter.

[0275] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 600 mg weekly for 2 weeks, followed by a third dose of less than about 600 mg about one week later, followed by a dose of less than about 600 mg about every two weeks thereafter.

[0276] In another embodiment, the cell is contacted with eculizumab at a dose of less than about 600 mg weekly for 1 week, followed by a second dose of less than about 300 mg about one week later, and then by a dose of less than about 300 mg about every two weeks thereafter.

[0277] In one embodiment, the cells are contacted with eculizumab at a dose of less than about 300 mg weekly for 1 week, followed by a second dose of less than about 300 mg about one week later, and then by a dose of less than about 300 mg about every two weeks thereafter.

[0278] In one embodiment, the cell is in a subject.

[0279] In one embodiment, the methods of the invention further comprise performing plasmapheresis or plasma exchange in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0280] In one embodiment, the methods of the invention further comprise performing a plasma transfusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0281] In one embodiment, the cell is contacted with eculizumab at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0282] In another embodiment, the cell is contacted with eculizumab at a dose of about 5 mg / kg to about 15 mg / kg.

[0283] In one embodiment, the cell is contacted with eculizumab at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg, and 15 mg / kg.

[0284] In one embodiment, eculizumab is administered to the subject by an intravenous infusion. In another embodiment, eculizumab is administered to the subject subcutaneously.

[0285] In one embodiment, the cell is contacted with the dsRNA agent at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.

[0286] In another embodiment, the cell is contacted with the dsRNA agent at a dose of about 10 mg / kg to about 30 mg / kg.

[0287] In one embodiment, the cell is contacted with the dsRNA agent at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg and 30 mg / kg.

[0288] In one embodiment, the cell is contacted with the dsRNA agent once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the cell is contacted with the dsRNA agent twice a month.

[0289] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0290] In one embodiment, the dsRNA agent and the eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and the eculizumab are administered simultaneously to the subject.

[0291] In one embodiment, the cell is contacted with the dsRNA agent and the eculizumab simultaneously.

[0292] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0293] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%.

[0294] In one embodiment, eculizumab is administered at a dose of about 100-500 mg.

[0295] In one embodiment, the cell is first contacted with the dsRNA agent for a period of time sufficient to reduce the level of complement component C5 in the cell, and then the cell is contacted with eculizumab at a dose of less than about 600 mg.

[0296] In one embodiment, the level of complement component C5 in the cell is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%.

[0297] In one embodiment, the cell is contacted with eculizumab at a dose of about 100-500 mg.

[0298] In one aspect, the present invention provides methods for inhibiting C5 expression in a subject. These methods include administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting C5 expression in the subject, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides.

[0299] In another aspect, the present invention provides methods for inhibiting C5 expression in a subject. These methods include administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand, thereby inhibiting C5 expression in the subject, wherein the antisense strand comprises a complementary region comprising at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from any antisense sequence listed in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23.

[0300] In another aspect, the present invention provides methods for inhibiting the expression of complement component C5 in a subject, the methods comprising administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand and an antisense strand that form a double-stranded region, thereby inhibiting the expression of the C5 gene in the subject, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 5 by no more than 3 nucleotides, wherein substantially all of the nucleotides of the antisense strand and substantially all of the nucleotides of the sense strand are modified nucleotides, and wherein the sense strand is conjugated to one or more ligands at the 3'-end.

[0301] In one embodiment, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0302] In one embodiment, the administration is subcutaneous.

[0303] In one embodiment, substantially all nucleotides of the sense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, substantially all nucleotides of the antisense strand are modified nucleotides selected from the group consisting of 2'-O-methyl modifications, 2'-fluoro modifications, and 3'-terminal dT nucleotides. In another embodiment, the modified nucleotides are short sequences of deoxy-thymine (dT) nucleotides. In another embodiment, the sense strand is included in two phosphorothioate internucleotide linkages at the 5'-end. In one embodiment, the antisense strand is included in two phosphorothioate internucleotide linkages at the 5'-end and two phosphorothioate internucleotide linkages at the 3'-end. In yet another embodiment, the sense strand is conjugated to one or more GalNAc derivatives, which are attached to the 3'-end by a branched divalent or trivalent linker.

[0304] In another aspect, the present invention provides methods for inhibiting C5 expression in a subject. These methods include administering to the subject a therapeutically effective amount of a dsRNA agent comprising a sense strand complementary to an antisense strand, thereby inhibiting C5 expression in the subject, wherein the antisense strand comprises a region complementary to a portion of an mRNA encoding C5, wherein each strand is about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

[0305] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0306] Antonym: 3'n p '-N a '-(X'X'X') k –N b '-Y'Y'Y'-Ν b '-(Z'Z'Z') l -N a '-n q '5'(III)

[0307] in:

[0308] i, j, k and l are each independently 0 or 1;

[0309] p, p', q and q' are each independently 0-6;

[0310] Each N a and N a 'Independently represents an oligonucleotide sequence comprising 0-25 nucleotides, which are either modified or unmodified or a combination thereof, each sequence comprising at least two differently modified nucleotides;

[0311] Each N b and N b 'Independently represents an oligonucleotide sequence comprising 0-10 nucleotides, which are either modified or unmodified or a combination thereof;

[0312] Each n p 、n p '、n q and n q ' independently represents the overhang nucleotide, the n p 、n p '、nq and n q 'Each of these may or may not exist;

[0313] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides;

[0314] N b The modification on is different from the modification on Y, and N b The modification on ' is different from the modification on Y'; and

[0315] Wherein the sense strand is conjugated to at least one ligand.

[0316] In one embodiment, the methods further comprise administering to the subject an anti-complement component C5 antibody or antigen-binding fragment thereof.

[0317] In one embodiment, the anti-complement component C5 antibody or antigen-binding fragment thereof is eculizumab.

[0318] In one embodiment, the antibody or antigen-binding fragment thereof inhibits the cleavage of complement component C5 into fragments C5a and C5b.

[0319] In one embodiment, the methods of the invention further comprise administering to the subject a meningococcal vaccine.

[0320] In one embodiment, the subject is administered eculizumab at a dose of less than about 600 mg weekly for 4 weeks, followed by a fifth dose of less than about 900 mg about one week later, followed by a dose of less than about 900 mg about every two weeks thereafter.

[0321] In another embodiment, the subject is administered eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, followed by doses of less than about 1200 mg about every two weeks thereafter.

[0322] In one embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 900 mg weekly for 4 weeks, followed by a fifth dose of less than about 1200 mg about one week later, followed by a dose of less than about 1200 mg about every two weeks thereafter.

[0323] In another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg per week for 2 weeks, followed by a third dose of less than about 900 mg about one week later, followed by a dose of less than about 900 mg about every two weeks thereafter.

[0324] In one embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg weekly for 2 weeks, followed by a third dose of less than about 600 mg about one week later, followed by a dose of less than about 600 mg about every two weeks thereafter.

[0325] In another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 600 mg per week for 1 week, followed by a second dose of less than about 300 mg about one week later, followed by a dose of less than about 300 mg about every two weeks thereafter.

[0326] In yet another embodiment, the subject is less than 18 years of age and the subject is administered eculizumab at a dose of less than about 300 mg weekly for 1 week, followed by a second dose of less than about 300 mg about one week later, followed by a dose of less than about 300 mg about every two weeks thereafter.

[0327] In one embodiment, the methods further comprise performing plasmapheresis or plasma exchange in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 600 mg. In another embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0328] In one embodiment, the methods further comprise performing a plasma transfusion in the subject. In one embodiment, eculizumab is administered to the subject at a dose of less than about 300 mg.

[0329] In one embodiment, eculizumab is administered to the subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg. In another embodiment, eculizumab is administered to the subject at a dose of about 5 mg / kg to about 15 mg / kg.

[0330] In another embodiment, the subject is administered eculizumab at a dose selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 7 mg / kg, 10 mg / kg and 30 mg / kg.

[0331] In one embodiment, eculizumab is administered to the subject by an intravenous infusion. In another embodiment, eculizumab is administered to the subject subcutaneously.

[0332] In one embodiment, the dsRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg.

[0333] In one embodiment, the dsRNA agent is administered at a dosage of about 10 mg / kg to about 30 mg / kg. In another embodiment, the dsRNA agent is administered at a dosage selected from the group consisting of 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg and 30 mg / kg.

[0334] In one embodiment, the dsRNA agent is administered to the subject once a week. In another embodiment, the dsRNA agent is administered to the subject twice a week. In another embodiment, the dsRNA agent is administered to the subject twice a month.

[0335] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0336] In one embodiment, the dsRNA agent and the eculizumab are administered subcutaneously to the subject. In another embodiment, the dsRNA agent and the eculizumab are administered simultaneously to the subject.

[0337] In one embodiment, the dsRNA agent is first administered to the subject for a period of time sufficient to reduce the level of complement component C5 in the subject, and then eculizumab is administered at a dose of less than about 600 mg.

[0338] In one embodiment, the level of complement component C5 in the subject is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%.

[0339] In one embodiment, eculizumab is administered at a dose of about 100-500 mg.

[0340] In one embodiment, the dsRNA agent is conjugated to a ligand.

[0341] In one embodiment, the ligand is conjugated to the 3 '-end of the sense strand of the dsRNA agent.

[0342] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative. BRIEF DESCRIPTION OF THE DRAWINGS

[0343] Figure 1 is a schematic diagram of the three complement pathways: the alternative pathway, the classical pathway, and the lectin pathway.

[0344] Figure 2 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice after a single 10 mg / kg dose of the indicated iRNAs.

[0345] Figure 3 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice after a single 10 mg / kg dose of the indicated iRNAs.

[0346] Figure 4 is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice 48 hours after a single 10 mg / kg dose of the indicated iRNAs.

[0347] Figure 5 A is a graph showing the percent hemolysis remaining in rats on days 4 and 7 following a single 2.5 mg / kg, 10 mg / kg, or 25 mg / kg subcutaneous dose of AD-58642.

[0348] Figure 5 B is a Western blot showing the amount of complement component C5 remaining in rats at day 7 following a single 2.5 mg / kg, 10 mg / kg, or 25 mg / kg subcutaneous dose of AD-58642.

[0349] Figure 6 A and Figure 6 B is a graph showing the percentage of complement component C5 remaining in C57BL / 6 mice 5 days after a single 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg dose of AD-58642.

[0350] Figure 7 A and Figure 7 B is a graph showing the percent hemolysis remaining in C57BL / 6 mice on day 5 following a single 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg dose of AD-58642.

[0351] Figure 8 is a Western blot showing the amount of complement component C5 remaining in C57BL / 6 mice on day 5 following a single 1.25 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, or 25 mg / kg dose of AD-58642.

[0352] Fig. 9 is a graph showing the amount of complement component C5 protein remaining in mouse serum after a single 0.625 mg / kg, 1.25 mg / kg, 2.5 mg / kg, 5.0 mg / kg, or 10 mg / kg dose of AD-58641 on days 5 and 9. The lower limit of quantitation (LLOQ) of the assay is shown as a dashed line.

[0353] Fig.10 is a graph showing the amount of complement component C5 protein remaining in mouse serum on day 8 following a 0.625 mg / kg, 1.25 mg / kg, or 2.5 mg / kg dose of AD-58641 on days 0, 1, 2, and 3. The lower limit of quantitation (LLOQ) of the assay is shown as a dashed line.

[0354] Fig.11 A and Fig.11 B depicts the efficacy and cumulative effects of repeated administration of compound AD-58641 in rats. Fig.11 A is a graph depicting the hemolytic activity remaining in rat serum on days 0, 4, 7, 11, 14, 18, 25 and 32 following repeated dosing at 2.5 mg / kg / dose or 5.0 mg / kg / dose, q2w x3 (twice weekly for 3 weeks). Fig.11 B is a Western blot showing the amount of complement component C5 protein remaining in the animal serum.

[0355] Fig.12 Graph showing the amount of complement component C5 protein in cynomolgus monkey serum at different time points before, during and after two rounds of subcutaneous administration of 2.5 mg / kg or 5 mg / kg of AD-58641 every three days for 8 doses. C5 protein levels were normalized to the mean of the three pre-dose samples.

[0356] Fig.13 Graph showing the percentage of hemolysis remaining in cynomolgus monkey serum at different time points before, during and after two rounds of subcutaneous administration of 2.5 mg / kg or 5 mg / kg of AD-58641 every three days for 8 doses. The percentage of hemolysis was calculated relative to the maximum hemolysis and the background hemolysis in the control sample.

[0357] Fig.14 is a graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on day 5 following a single 1 mg / kg dose of the indicated iRNAs.

[0358] Fig.15is a graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on day 5 following a single 0.25 mg / kg, 0.5 mg / kg, 1.0 mg / kg, or 2.0 mg / kg dose of the indicated iRNA.

[0359] Fig.16 is a graph showing the percentage of complement component C5 protein remaining in the serum of C57BL / 6 mice on days 6, 13, 20, 27, and 34 following a single 1 mg / kg dose of the indicated iRNAs.

[0360] Fig.17 is a graph showing the percentage of hemolysis remaining in rat serum at different time points after administration of 5 mg / kg dose of the indicated compound on Day 0, Day 4, and Day 7.

[0361] Fig.18A shows the nucleotide sequence of Homo sapiens complement component 5 (C5) (SEQ ID NO: 1); Fig.18B shows the nucleotide sequence of macaque complement component 5 (C5) (SEQ ID NO: 2); Fig.18C The nucleotide sequence of Mus musculus complement component 5 (C5) is shown (SEQ ID NO: 3); Fig.18D shows the nucleotide sequence of Rattus norvegicus complement component 5 (C5) (SEQ ID NO: 4); Fig.18E The reverse complement of SEQ ID NO: 1 is shown (SEQ ID NO: 5); Fig.18F The reverse complement of SEQ ID NO:2 is shown (SEQ ID NO:6); Figure 18G shows the reverse complement of SEQ ID NO:3 (SEQ ID NO:7); and Fig.18H The reverse complement of SEQ ID NO: 4 is shown (SEQ ID NO: 8).

[0362] Detailed description of the invention

[0363] The present invention provides iRNA agents that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the complement component C5 gene.

[0364] The iRNAs of the invention include an RNA strand (the antisense strand) having a region of about 30 nucleotides or less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19- 30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 nucleotides, which are substantially complementary to at least a portion of the mRNA transcript of the C5 gene. Using these iRNAs, targeted degradation of the mRNA of the C5 gene in mammals can be achieved. Specifically, very low doses of C5 iRNA can specifically and effectively mediate RNA interference (RNAi), thereby causing significant inhibition of the expression of the C5 gene. The present invention has demonstrated that iRNA targeting C5 can mediate RNAi in vitro and in vivo, thereby causing significant inhibition of the expression of the C5 gene. Therefore, methods and compositions including these iRNAs are useful for treating subjects who will benefit from a reduction in the level and / or activity of C5 protein, such as subjects suffering from complement component C5-associated diseases such as paroxysmal nocturnal hemoglobinuria (PNH).

[0365] The present invention also provides methods and combination therapies for treating a subject suffering from a condition that would benefit from inhibition or reduction of expression of the C5 gene, such as a complement component C5-associated disease, such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS), using iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the complement component C5 gene.

[0366] The present invention also provides a method for preventing at least one symptom, such as hemolysis, in a subject suffering from a condition that would benefit from inhibiting or reducing the expression of the C5 gene, such as complement component C5-associated diseases such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). The present invention further provides iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the complement component C5 gene. The C5 gene can be in a cell, such as a cell in a subject such as a human.

[0367] The combination therapies of the invention include administering an RNAi agent of the invention and an additional therapeutic agent, such as an anti-complement component C5 antibody or antigen-binding fragment thereof, e.g., eculizumab, to a patient suffering from a disease associated with complement component C5. The combination therapies of the invention reduce C5 levels in the subject (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 99%) by targeting C5 mRNA with an iRNA agent of the invention, and thus, allow a reduction in the therapeutically (or prophylactically) effective amount of eculizumab required to treat the subject, thereby reducing treatment costs and allowing simpler and more convenient methods of administering eculizumab, such as subcutaneous administration.

[0368] The following detailed description discloses how to make and use compositions containing iRNA that inhibit expression of the C5 gene, as well as compositions, uses and methods for treating subjects suffering from diseases and disorders that would benefit from inhibiting and / or reducing the expression of this gene.

[0369] I. Definitions

[0370] In order to make the present invention more easily understood, some terms are first defined. In addition, it should be noted that whenever a value or range of values ​​of a parameter is listed, the intermediate values ​​and ranges of the values ​​listed are intended to be part of the present invention.

[0371] The articles "a" and "an" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, for example, a plurality of elements.

[0372] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including, but not limited to."

[0373] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly dictates otherwise.

[0374] As used herein, "complement component C5", which is used interchangeably with the term "C5", refers to the well-known gene and polypeptide, which is also known in the art as CPAMD4, C3 and PZP-like alpha-2-macroglobulin domain-containing proteins, anaphylatoxin C5a analogs, hemolytic complement (Hc), and complement C5. The sequence of the human C5 mRNA transcript can be found, for example, in GenBank Accession No. GI:38016946 (NM_001735,2; SEQ ID NO:1). The sequence of the rhesus monkey C5 mRNA can be found, for example, in GenBank Accession No. GI:297270262 (XM_001095750.2; SEQ ID NO:2). The sequence of the mouse C5 mRNA can be found, for example, in GenBank Accession No. GI:291575171 (NM_010406.2; SEQ ID NO:3). The sequence of rat C5 mRNA can be found, for example, in GenBank Accession No. GI:392346248 (XM_345342.4; SEQ ID NO:4).Additional examples of C5 mRNA sequences are readily obtained using publicly available databases such as GenBank.

[0375] As used herein, the term "C5" also refers to naturally occurring DNA sequence variations of the C5 gene, such as single nucleotide polymorphisms in the C5 gene. Numerous SNPs within the C5 gene have been identified and can be found, for example, in NCBI dbSNP (see, e.g., ncbi.nlm.nih.gov / snp). Non-limiting examples of SNPs within the C5 gene can be found in NCBI dbSNP accession numbers rs121909588 and rs121909587.

[0376] As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a C5 gene, including mRNA that is a product of RNA processing of a primary transcript. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near the portion of the nucleotide sequence of an mRNA molecule formed during transcription of a C5 gene.

[0377] The target sequence can be from about 9-36 nucleotides in length, for example, from about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides in length, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 1 21-22, 21-23, 21-24, 21-23 or 21-22 nucleotides. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated as part of the invention.

[0378] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides described in the order mentioned using standard nucleotide nomenclature.

[0379] "G", "C", "A", "T" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymidine and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide, or a substitute replacement moiety (see, e.g., Table 2), as further described in detail below. The skilled artisan will be well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide having such a replacement moiety. For example, and without limitation, a nucleotide comprising inosine as its base may base pair with a nucleotide containing adenine, cytosine or uracil. Thus, a nucleotide containing uracil, guanine or adenine may be replaced in the nucleotide sequence of a dsRNA embodied in the present invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in an oligonucleotide may be replaced with guanine and uracil, respectively, so as to form a GU wobble that base pairs with a target mRNA. Sequences containing such replacement moieties are suitable for use in the compositions and methods embodied in the invention.

[0380] The terms "iRNA," "RNAi agent," "iRNA agent," "RNA interference agent," as used interchangeably herein, refer to agents that contain RNA as such terms are defined herein, and that mediate targeted cleavage of RNA transcripts through an RNA-induced silencing complex (RISC) pathway. The iRNA directs sequence-specific degradation of mRNA by a process known as RNA interference (RNAi). The iRNA modulates (e.g., inhibits) expression of C5 in a cell (e.g., a cell within a subject such as a mammalian subject).

[0381] In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, such as a C5 target mRNA sequence, to guide the cleavage of the target RNA. Without wishing to be bound by theory, it is believed that the long double-stranded RNA introduced into the cell is broken down into siRNA by a type III nuclease called Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer (ribonuclease-III-like enzyme) processes dsRNA into 19-23 base pairs of short interfering RNA with a characteristic two-base 3' overhang (Bernstein et al. (2001) Nature 409:363). The siRNA is then incorporated into an RNA-induced silencing complex (RISC), where one or more helicases unfold the siRNA duplex, thereby enabling complementary antisense strand-guided target recognition (Nykanen et al. (2001) Cell 107:309). When bound to an appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes and Development 15:188). Therefore, on the one hand, the present invention relates to a single-stranded RNA (siRNA) produced in a cell and the single-stranded RNA promotes RISC complex formation to achieve silencing of a target gene, i.e., a C5 gene. Therefore, the term "siRNA" used herein also refers to RNAi as described above.

[0382] In another embodiment, the RNAi agent can be a single-stranded siRNA introduced into a cell or organism to inhibit a target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease (Argonaute 2), which then cleaves the target mRNA. These single-stranded siRNAs are typically 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, and the entire contents of each of these references are hereby incorporated by reference herein. Any antisense nucleotide sequence described herein can be used as a single-stranded siRNA chemically modified as described herein or as described in Lima et al. (2012) Cell 150:883-894.

[0383] In another embodiment, the "iRNA" used in the compositions, uses and methods of the invention is a double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target RNA, i.e., the C5 gene. In some embodiments of the invention, the double-stranded RNA (dsRNA) triggers degradation of a target RNA, such as an mRNA, by a post-transcriptional gene silencing mechanism referred to herein as RNA interference or RNAi.

[0384] Typically, most of the nucleotides of each chain of the dsRNA molecule are ribonucleotides, but as described in detail herein, each chain or both chains may also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. In addition, as used in this specification, "RNAi agents" may include ribonucleotides with chemical modifications; RNAi agents may include many modifications on multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications as used in siRNA type molecules are included in "RNAi agents" for the purposes of this specification and claims.

[0385] The duplex region can be of any length that allows for specific degradation of the desired target RNA by the RISC pathway, and can range in length from about 9 to 36 base pairs, such as about 15-30 base pairs in length, such as about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-29, 15-28, 15-29, 15-2 -17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19- Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated as part of the invention.

[0386] The two chains forming the duplex structure can be different parts of a larger RNA molecule, or they can be separate RNA molecules. When the two chains are parts of a larger molecule, and therefore connected by an uninterrupted nucleotide chain between the 3'-end of one chain and the 5'-end of the corresponding other chain forming the duplex structure, the connected RNA chain is called a "hairpin loop". The hairpin loop can include at least one unpaired nucleotide. In certain embodiments, the hairpin loop can include at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.

[0387] When two substantially complementary chains of dsRNA comprise separate RNA molecules, these molecules are not necessary, but can be covalently linked. When these two chains are covalently linked by means other than the uninterrupted nucleotide chain between the 3'-end of one chain and the 5'-end of the corresponding other chain forming a duplex structure, the connected structure is called a "joint". These RNA chains can have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest chain of the dsRNA minus any overhangs present in the duplex. In addition to the duplex structure, RNAi can include one or more nucleotide overhangs.

[0388] In one embodiment, the RNAi agent of the present invention is a dsRNA with 24-30 nucleotides that interacts with a target RNA sequence, such as a C5 target mRNA sequence, to guide the cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is broken down into siRNA by a type III nuclease called Dicer (Sharp et al. (2001) Genes and Development 15:485). Dicer (ribonuclease-III-like enzyme) processes dsRNA into 19-23 base pairs of short interfering RNA with a characteristic two-base 3' overhang (Bernstein et al. (2001) Nature 409:363). The siRNA is then incorporated into an RNA-induced silencing complex (RISC), where one or more helicases unfold the siRNA duplex, thereby enabling complementary antisense strand-guided target recognition (Nikanen et al. (2001) Cell 107:309). When bound to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Bashir et al. (2001) Genes & Development 15:188).

[0389] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide extending from the duplex structure of an iRNA, such as a dsRNA. For example, when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of another strand, or vice versa, there is a nucleotide overhang. The dsRNA may comprise an overhang having at least one nucleotide; alternatively the overhang may comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. The nucleotide overhang may comprise or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). One or more overhangs may be on a sense strand, an antisense strand, or any combination thereof. In addition, one or more nucleotides of the overhang may be present on the 5'-end, 3'-end, or both ends of the antisense strand or the sense strand of the dsRNA.

[0390] In one embodiment, the antisense strand of the dsRNA has an overhang of 1-10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at the 3'-end and / or the 5'-end. In one embodiment, the sense strand of the dsRNA has an overhang of 1-10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at the 3'-end and / or the 5'-end. In another embodiment, one or more nucleotides in the overhang are replaced by nucleoside phosphorothioates.

[0391] "Blunt" or "flat-ended" means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e., there are no nucleotide overhangs. A "flat-ended" RNAi agent is a dsRNA that is double-stranded throughout its length, i.e., there are no nucleotide overhangs at either end of the molecule. The RNAi agents of the present invention include RNAi agents that have a nucleotide overhang at one end (i.e., an agent having one overhang and one blunt end) or have nucleotide overhangs at both ends.

[0392] The term "antisense strand" or "guide strand" refers to a strand of an iRNA, such as a dsRNA, that includes a region that is substantially complementary to a target sequence, such as a C5 mRNA. As used herein, the term "complementary region" refers to a region on the antisense strand that is substantially complementary to a sequence, such as a target sequence (e.g., a C5 nucleotide sequence as defined herein). When the complementary region is not completely complementary to the target sequence, the mismatch may be in an internal region or a terminal region of the molecule. Typically, the most tolerated mismatch is in the terminal region, such as within 5, 4, 3, or 2 nucleotides of the 5'-end and / or 3'-end of the iRNA.

[0393] The term "sense strand" or "passenger strand" as used herein refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0394] As used herein, the term "cracking zone" refers to a zone located next to the cleavage site. The cleavage site is a site on the target where cleavage occurs. In some embodiments, the cleavage zone comprises three bases at either end of the cleavage site and next to the cleavage site. In some embodiments, the cleavage zone comprises two bases at either end of the cleavage site and next to the cleavage site. In some embodiments, the cleavage site specifically occurs at the site where nucleotide 10 and nucleotide 11 of the antisense strand bind, and the cleavage zone comprises nucleotide 11, nucleotide 12, and nucleotide 13.

[0395] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleotide sequence associated with a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions, as will be understood by the skilled artisan. Such conditions may, for example, be stringent conditions, wherein stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual", Sambrook et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions such as physiologically relevant conditions that may be encountered within an organism may be applied. The skilled artisan will be able to determine the set of conditions that are most suitable for testing the complementarity of two sequences, depending on the ultimate application of the hybridizing nucleotides.

[0396] iRNA, for example, in the dsRNA described herein, the complementary sequence includes the oligonucleotide or polynucleotide comprising the first nucleotide sequence and the oligonucleotide or polynucleotide comprising the second nucleotide sequence, base pairing on the entire length of one or two nucleotide sequences. Such sequences can be referred to as "completely complementary" relative to each other here. However, when the first sequence is referred to as "substantially complementary" relative to the second sequence here, the two sequences can be completely complementary, or when the duplex hybridization is up to 30 base pairs, they can form one or more but usually no more than 5,4,3 or 2 mismatched base pairs, while maintaining the ability to hybridize under the conditions most relevant to its final application (such as inhibiting gene expression by RISC pathway). However, when two oligonucleotides are designed to form one or more single-stranded overhangs when hybridizing, such overhangs should not be considered as mispairing determined about complementarity. For example, the dsRNA comprising an oligonucleotide having a length of 21 nucleotides and another oligonucleotide having a length of 23 nucleotides can be referred to as "completely complementary" for the purpose described here, wherein the longer oligonucleotide comprises a sequence with 21 nucleotides that is completely complementary to the oligonucleotide at the end.

[0397] As used herein, "complementary" sequences may also include non-Watson-Crick base pairs and / or base pairs formed from non-natural nucleotides and modified nucleotides, or formed entirely therefrom, so as to achieve the above requirements for their hybridization ability. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing.

[0398] The terms "complementary," "fully complementary," and "substantially complementary" may be used herein with respect to base pairing between the sense and antisense strands of a dsRNA or between the antisense strand of an iRNA agent and a target sequence as will be understood from the context of their use.

[0399] As used herein, a polynucleotide that is "substantially complementary" to at least a portion of a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding C5). For example, a polynucleotide is complementary to at least a portion of a C5 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding C5.

[0400] Generally, most of the nucleotides of each chain are ribonucleotides, but as described in detail herein, each chain or these two chains can also include one or more non-ribonucleotides, such as deoxyribonucleotides and / or modified nucleotides. In addition, " iRNA " can include ribonucleotides with chemical modification. Such modification can include modifications of all types disclosed herein or as known in the art. Any such modification as used in the iRNA molecule is for the purpose of this specification and claims, and is encompassed in " iRNA ".

[0401] In one aspect of the invention, the reagent used in these methods and compositions of the present invention is a single-stranded antisense RNA molecule that inhibits a target mRNA through an antisense inhibition mechanism. The single-stranded antisense RNA molecule is complementary to a sequence in the target mRNA. Single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing with mRNA and physically blocking the translation machine, see, Dias (Dias) N. et al., (2002) Mol Cancer Ther 1: 347-355. The length of the single-stranded antisense RNA molecule can be about 15 to about 30 nucleotides and have a sequence complementary to the target sequence. For example, the single-stranded antisense RNA molecule can include a sequence of at least about 15, 16, 17, 18, 19, 20 or more continuous nucleotides from any one of the antisense sequences described herein.

[0402] The term "lipid nanoparticle" or "LNP" is a vesicle comprising a lipid layer that encapsulates a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed. LNPs are described, e.g., in U.S. Pat. Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated by reference herein.

[0403] As used herein, a "subject" is an animal, such as a mammal, including primates (such as humans, non-human primates, such as monkeys and chimpanzees), non-primates (such as cows, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, mice, horses, and whales), or birds (e.g., ducks or geese). In one embodiment, the subject is a human, such as a human being treated or evaluated for a disease, disorder, or condition that would benefit from reduced C5 expression; a human being at risk for a disease, disorder, or condition that would benefit from reduced C5 expression; a human being suffering from a disease, disorder, or condition that would benefit from reduced C5 expression; and / or a human being treated for a disease, disorder, or condition that would benefit from reduced C5 expression as described herein.

[0404] As used herein, the terms "treating" or "treatment" refer to a beneficial or desired result, including but not limited to alleviating or ameliorating one or more symptoms associated with unwanted complement pathway activation (e.g., hemolysis and / or chronic inflammation); reducing the extent of unwanted complement pathway activation; stabilizing (i.e., not worsening) the condition of chronic inflammation and / or hemolysis; ameliorating or reducing unwanted complement pathway activation (e.g., chronic inflammation and / or hemolysis), whether detectable or undetectable. "Treatment" may also mean prolonging survival compared to expected survival in the absence of treatment.

[0405] The term "reduction" in the context of the level of complement component C5 or a disease marker or symptom in a subject refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more, and is preferably as low as levels accepted within the normal range for individuals who do not have such a disorder.

[0406] As used herein, "prevention" or "preventing," when used in reference to a disease, disorder, or condition that would benefit from a reduction in C5 gene expression, refers to reducing the likelihood that a subject will develop symptoms associated with such a disease, disorder, or condition, e.g., symptoms of unwanted complement activation, such as chronic inflammation, hemolysis, and / or thrombosis. For example, the likelihood of developing thrombosis is reduced when an individual with one or more risk factors for thrombosis does not develop thrombosis or develops thrombosis with less severity relative to a population with the same risk factors and not receiving treatment as described herein. Not developing a disease, disorder, or condition; or reducing the development of symptoms associated with such a disease, disorder, or condition (e.g., a reduction of at least about 10% on a clinically accepted scale for the disease or disorder); or exhibiting delayed symptoms (e.g., a delay of days, weeks, months, or years) is considered effective prevention.

[0407] As used herein, the term "complement component C5-associated disease" is a disease or condition caused by or associated with complement activation. Such diseases are typically associated with inflammation and / or immune system activation, such as membrane attack complex-mediated lysis, allergic reactions, and / or hemolysis.Non-limiting examples of diseases associated with complement component C5 include paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), asthma, rheumatoid arthritis (RA); antiphospholipid antibody syndrome; lupus nephritis; ischemia-reperfusion injury; typical or infectious hemolytic uremic syndrome (tHUS); dense deposit disease (DDD); neuromyelitis optica (NMO); multifocal motor neuropathy (MMN); multiple sclerosis (MS); macular degeneration (e.g., age-related macular degeneration (AMD)); hemolysis, elevated liver enzymes, and low platelets (HELLP) syndrome; thrombotic thrombocytopenic purpura (TTP); spontaneous abortion; pauci-immune vasculitis; epidermolysis bullosa; recurrent abortion; preeclampsia, traumatic brain injury, myasthenia gravis, cold agglutinin disease, dermatomyositis bullous pemphigoid, Shiga toxin (Shiga toxin) Escherichia coli-associated hemolytic uremic syndrome, C3 nephropathy, anti-neutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatosis with polyangiitis (formerly Wegener's granulomatosis), Churg-Strauss syndrome, and microscopic polyangiitis), humoral and vascular transplant rejection, graft dysfunction, myocardial infarction (e.g., tissue damage and ischemia in myocardial infarction), allogeneic transplantation, sepsis (e.g., adverse outcome in sepsis), coronary artery disease, dermatomyositis, Graves' disease, atherosclerosis, Alzheimer's disease, systemic inflammatory response sepsis, septic shock, spinal cord injury, glomerulonephritis, Hashimoto's thyroiditis, type I diabetes mellitus, psoriasis, pemphigus, autoimmune hemolytic anemia (AIHA), ITP, Goodpasture's syndrome, DeGroote's disease disease, antiphospholipid syndrome (APS), catastrophic APS (CAPS), cardiovascular disorders, myocarditis, cerebrovascular disease, peripheral (e.g., musculoskeletal) vascular disease, renovascular disease, mesenteric / intestinal vascular disease, vasculitis, Henoch-Schönlein purpura nephritis, vasculitis associated with systemic lupus erythematosus, vasculitis associated with rheumatoid arthritis, immune complex vasculitis, Takayasu's disease, dilated cardiomyopathy, diabetic vasculopathy, Kawasaki's disease (arteritis), venous gas embolism (VGE) and restenosis after stent placement, rotational atherectomy, membranous nephropathy, Guillain-Barre syndrome, and percutaneous transluminal coronary angioplasty (PTCA) (see, e.g., Holers (2008) Immunological Reviews). Reviews) 223:300-316; Halls and Thurman (2004) Molecular Immunology 41:147-152; US Patent Publication No. 20070172483).

[0408] In one embodiment, the disease associated with complement component C5 is paroxysmal nocturnal hemoglobinuria (PNH). The PNH may be classic PNH or PNH in another bone marrow failure syndrome and / or myelodysplastic syndrome (MDS), such as a cytopenic setting. In another embodiment, the disease associated with complement component C5 is atypical hemolytic uremic syndrome (aHUS).

[0409] II. iRNA of the present invention

[0410] The present invention provides iRNAs that inhibit complement component C5 gene expression. In one embodiment, the iRNA agent includes a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting C5 gene expression in a cell, such as a cell in a subject, such as a mammal (such as a person suffering from a disease associated with complement component C5, such as PNH). The dsRNA includes an antisense strand having a complementary region complementary to at least a portion of the mRNA formed in the expression of the C5 gene. The length of the complementary region is about 30 nucleotides or less (e.g., a length of about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19 or 18 nucleotides or less). When contacted with a cell expressing a C5 gene, the iRNA inhibits expression of the C5 gene (e.g., a human, primate, non-primate or avian C5 gene) by at least about 10%, as determined by, for example, PCR or branched DNA (bDNA)-based methods, or by protein-based methods, such as by immunofluorescence analysis, using, for example, Western blotting or flow cytometry techniques.

[0411] dsRNA includes two RNA chains that are complementary and hybridize to form a duplex structure under the conditions in which the dsRNA will be used. One chain (antisense strand) of the dsRNA includes a complementary region that is substantially complementary to a target sequence and is usually completely complementary. The target sequence can be derived from the sequence of the mRNA formed during the expression of the C5 gene. The other chain (sense strand) includes a region complementary to the antisense strand so that when combined under suitable conditions, the two chains hybridize and form a duplex structure. As described elsewhere herein and as known in the art, in contrast to being on a separate oligonucleotide, the complementary sequence of the dsRNA can also be included as a self-complementary region of a single nucleic acid molecule.

[0412] Typically, the duplex structure is between 15 and 30 base pairs in length, for example, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-3 21-24, 21-23 or 21-22 base pairs. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated as part of the invention.

[0413] Similarly, the length of the region complementary to the target sequence is between 15 and 30 nucleotides, for example, a length of 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 15-23, 15-22, 18-21, 18-20, 19 Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated as part of the invention.

[0414] In some embodiments, the length of the dsRNA is between about 15 and about 20 nucleotides, or the length is between about 25 and about 30 nucleotides. Typically, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, as is well known in the art, a dsRNA longer than about 21-23 nucleotides can be used as a substrate for Dicer. As will be appreciated by the skilled artisan, the region of the RNA targeted for cleavage will most often be a portion of a larger RNA molecule (often an mRNA molecule). Where necessary, a "portion" of an mRNA target is a continuous sequence of an mRNA target long enough to allow it to serve as a substrate for RNAi-guided cleavage (i.e., cleavage by the RISC pathway).

[0415] Those skilled in the art will also recognize that the duplex region is a major functional portion of a dsRNA, e.g., having about 9 to 36 base pairs, e.g., about 10-36, 11-36, 12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35, 14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27 , 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 1 In one embodiment, the duplex region of miRNA is 9-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23 or 21-22 base pairs. Therefore, in one embodiment, to the extent of being processed into a functional duplex of, for example, 15-30 base pairs of the RNA desired for cleavage, the RNA molecule or the complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Therefore, the technician will recognize that miRNA is a dsRNA in one embodiment. In another embodiment, dsRNA is not a naturally occurring miRNA. In another embodiment, iRNA agents useful for targeting C5 expression are not produced in the target cell by cleavage of a larger dsRNA.

[0416] As described herein, dsRNA can further include one or more single-stranded nucleotide overhangs, such as 1,2,3 or 4 nucleotides. The dsRNA with at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to its flat-ended counterpart. The nucleotide overhangs can comprise nucleotide / nucleoside analogs (comprising deoxynucleotides / nucleosides) or be composed of them. One or more overhangs can be in sense strand, antisense strand or any combination thereof. In addition, one or more nucleotides of the overhang can be present in dsRNA or antisense strand or sense strand 5'-end, 3'-end or both ends.

[0417] dsRNA can be synthesized by standard methods known in the art, such as by using an automated DNA synthesizer (such as commercially available from, for example, Biosearch, Applied Biosystems, Inc.), as discussed further below.

[0418] The iRNA compound of the present invention can be prepared using a two-step procedure. First, each chain of the double-stranded RNA molecule is prepared separately. Then, these component chains are annealed. Each chain of the siRNA compound can be prepared using solution phase or solid phase organic synthesis or both. Organic synthesis provides the following advantages, and oligonucleotide chains containing non-natural or modified nucleotides can be easily prepared. Single-stranded oligonucleotides of the present invention can be prepared by using solution phase or solid phase organic synthesis or both.

[0419] In one aspect, the dsRNA of the present invention comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand is selected from the group of sequences provided in any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21 and Table 23, and the corresponding antisense strand of the sense strand is selected from the group of sequences in any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21 and Table 23. In this regard, one of the two sequences is complementary to the other of the two sequences, wherein one of the sequences is substantially complementary to a sequence of mRNA produced in the expression of the C5 gene. Thus, in this regard, a dsRNA will include two oligonucleotides, one of which is described as a sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, and a second oligonucleotide is described as the corresponding antisense strand of the sense strand in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

[0420] It will be understood that while some of the sequences in Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21 and Table 23 are described as modified and / or conjugated sequences, the RNA of the iRNA of the invention, e.g., dsRNA of the invention, can comprise any of the sequences listed in Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21 and Table 23 that is unmodified, unconjugated and / or modified and / or conjugated differently than described therein.

[0421] The skilled artisan will well appreciate that dsRNAs having duplex structures between about 20 and 23 base pairs (e.g., 21 base pairs) are favored as being particularly effective in inducing RNA interference (Bashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the embodiments described above, by virtue of the properties of the oligonucleotide sequences provided in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23, the dsRNAs described herein can include at least one strand having a length of a minimum of 21 nucleotides. It is reasonable to expect that shorter duplexes having one of the sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23 minus only a few nucleotides on one or both ends may be similarly effective compared to the dsRNAs described above. Thus, a dsRNA having a sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides derived from one of the sequences of any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23, and having no more than about 5%, 10%, 15%, 20%, 25% or 30% inhibition in its ability to inhibit the expression of the C5 gene compared to a dsRNA comprising the entire sequence is contemplated to be within the scope of the invention.

[0422] In addition, the RNAs provided in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23 identify one or more sites in the C5 transcript that are susceptible to RISC-mediated cleavage. Thus, the invention further embodies an iRNA that targets within one of these sites. As used herein, an iRNA is said to target within a specific site of an RNA transcript if it promotes cleavage of the transcript anywhere within the specific site. Such an iRNA will typically include at least about 15 consecutive nucleotides from one of the sequences provided in any one of Tables 3, 4, 5, 6, 18, 19, 20, 21 and 23, joined to another nucleotide sequence taken from a region adjacent to the selected sequence in the C5 gene.

[0423] Although the length of the target sequence is generally about 15-30 nucleotides, there are wide variations in the suitability of specific sequences within this range for directing the cleavage of any given target RNA. The different software packages and criteria listed here provide guidance for identifying the best target sequence for any given gene target, but an empirical approach can also be taken, wherein a "window" or "mask" with a given size (as a non-limiting example, 21 nucleotides) is placed on the target RNA sequence literally or figuratively (including, for example, computer simulation) to identify sequences that can be used as target sequences within the size range. By progressively moving the sequence "window" one nucleotide upstream or downstream of the initial target sequence position, the next potential target sequence can be identified until a full set of possible sequences is identified for any given target size selected. This method combines systematic synthesis and testing of identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform best, and can identify those RNA sequences that mediate the best inhibition of target gene expression when targeted with an iRNA agent. Thus, while, for example, the sequences identified in any of Tables 3, 4, 5, 6, 18, 19, 20, 21, and 23 represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of a given sequence to identify sequences with equivalent or better inhibition characteristics.

[0424] In addition, for example, any sequence identified in any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21 and Table 23 should be considered to be further optimized by systematically adding or removing nucleotides to generate longer or shorter sequences and testing those sequences generated by making the window with longer or shorter size walk from the point to the target RNA above or below. Again, combining this method with the generation of new candidate targets, while testing the effectiveness of iRNA based on those target sequences in the inhibition assay as known in the art and / or as described herein, can cause further improvement in inhibition efficiency. Furthermore, such optimized sequences can be adjusted, for example, by introducing modified nucleotides as described herein or as known in the art, adding or changing overhangs or other modifications as known in the art and / or discussed herein, so as to further optimize molecules (e.g., increase serum stability or circulation half-life, increase thermal stability, enhance transmembrane delivery, target specific locations or cell types, increase interaction with silencing pathway enzymes, increase endosome release) as expression inhibitors.

[0425] iRNA as described herein may contain one or more mismatches with the target sequence. In one embodiment, iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains a mismatch with the target sequence, then preferably the mismatch region should not be located in the center of the complementary region. If the antisense strand of the iRNA contains a mismatch with the target sequence, then preferably the mismatch is confined to the last 5 nucleotides from the 5'-end or 3'-end of the complementary region. For example, for an iRNA agent of 23 nucleotides, a strand complementary to a region of the C5 gene does not contain any mismatch in the central 13 nucleotides usually. These methods described herein or methods known in the art can be used to determine whether the iRNA containing a mismatch with the target sequence is effective in suppressing the expression of the C5 gene. It is important to consider the efficacy of the iRNA with mismatch in suppressing the expression of the C5 gene, especially if the specific complementary region in the known C5 gene has a polymorphic sequence variation in the population.

[0426] III. Modified iRNA of the Invention

[0427] In one embodiment, the RNA of iRNA of the present invention, for example, dsRNA, is unmodified, and does not include chemical modifications and / or conjugations such as those known in the art and described herein. In another embodiment, the RNA of iRNA of the present invention, for example, dsRNA, is chemically modified to enhance stability or other beneficial features. In certain embodiments of the present invention, substantially all nucleotides of the iRNA of the present invention are modified. In other embodiments of the present invention, all nucleotides of the iRNA of the present invention are modified. Wherein "substantially all nucleotides are modified" iRNA of the present invention is most but not all modified, and may include no more than 5,4,3,2 or 1 unmodified nucleotides.

[0428] The nucleic acids embodied in the present invention can be synthesized and / or modified by methods known in the art, such as those described in "Current protocols in nucleic acid chemistry" by Beaucage SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which references are hereby incorporated by reference herein. Modifications include, for example, end modifications, such as 5'-end modifications (phosphorylation, conjugation, reverse linkage) or 3'-end modifications (conjugates, DNA nucleotides, reverse linkage, etc.); base modifications, such as base substitution, base removal (absaccharide nucleotides) or conjugated bases that are paired with stable bases or with an extended antibody library of partners; sugar modifications (e.g., at the 2'-position or 4'-position) or sugar substitutions; and / or backbone modifications, including modifications and substitutions of phosphodiester linkages. The specific examples of the iRNA compounds useful in these embodiments described herein include, but are not limited to, the backbone containing modification or the RNA without natural internucleoside linkage. The RNA with the backbone modified is included in those without phosphorus atoms in the backbone, together with other. For the purpose of this specification and as sometimes mentioned in the art, the modified RNA without phosphorus atoms in its internucleoside backbone can also be considered as oligonucleosides. In certain embodiments, the iRNA modified will have phosphorus atoms in its internucleoside backbone.

[0429] The RNA backbone of modification includes, for example, phosphorothioate; chiral phosphorothioate; phosphorodithioate; phosphotriester; aminoalkylphosphotriester; methylphosphonate and other alkylphosphonates, including 3'-alkylenephosphonates and chiral phosphonates; phosphinates; phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thiophosphoramidates; thioalkylphosphonates; thioalkylphosphotriester; and boranophosphates with common 3'-5' linkages, analogs of 2'-5' connections of these materials and those with reversed polarity, wherein adjacent nucleoside unit pairs are connected to 5'-3' by 3'-5' or 2'-5' is connected to 5'-2'. Also included are different salts, mixed salts and free acid forms.

[0430] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5, 321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587 ,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,63 9; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Patent RE39464, the entire contents of each of which are hereby incorporated by reference herein.

[0431] The modified RNA backbone that does not include a phosphorus atom therein has a backbone formed by a short-chain alkyl or cycloalkyl nucleoside linkage, a mixed heteroatom and alkyl or cycloalkyl nucleoside linkage, or one or more short-chain heteroatom or heterocyclic nucleoside linkages. These backbones include those with the following: morpholino linkages (partially formed from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formyl acetyl and thioformyl acetyl backbones; methylene formyl acetyl and thioformyl acetyl backbones; olefin-containing backbones; sulfonate backbones; methylene imino and methylene hydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and N, O, S and CH with mixed 2 Other skeletons of components.

[0432] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489 ,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated by reference herein.

[0433] In other embodiments, suitable RNA mimics are contemplated for use in iRNA, wherein the sugar and internucleoside linkages (i.e., backbones) of the nucleoside units are replaced by novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound (an RNA mimic that has been shown to have excellent hybridization properties) is referred to as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by a backbone containing amides, specifically an aminoethylglycine backbone. These nuclear bases are maintained and directly or indirectly bound to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents for teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331 and 5,719,262, the entire contents of each of which are hereby incorporated by reference herein. Other PNA compounds suitable for use in the iRNA of the present invention are described in, for example, Nielsen et al., Science, 1991, 254, 1497-1500.

[0434] Some embodiments embodied in the present invention include RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones, and specifically the above-mentioned U.S. Patent No. 5,489,677 -CH 2 --NH--CH 2 -、--CH 2 --(CH 3 )--O--CH 2 --[called methylene (methylimino) or MMI skeleton], --CH 2 --O--N(CH 3 )--CH 2 -、-CH 2 -N(CH 3 )--N(CH 3 )--CH 2 --and--N(CH 3 )-CH 2 --CH 2 -[where the natural phosphodiester backbone is represented as --O--P--O--CH 2 --] and the amide backbone of the above-mentioned US Patent No. 5,602,240. In some embodiments, the RNA embodied herein has a morpholino backbone structure of the above-mentioned US Patent No. 5,034,506.

[0435] The modified RNA may also contain one or more substituted sugar moieties. The iRNA, e.g., dsRNA, embodied herein may include one of the following groups at the 2'-position: OH; F; O-alkyl, S-alkyl, or N-alkyl; O-alkenyl, S-alkenyl, or N-alkenyl; O-alkynyl, S-alkynyl, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C 1 To C 10 Alkyl or C 2 To C 10 Exemplary suitable modifications include O[(CH 2 ) n O] m CH 3 、O(CH 2 ). n OCH 3 、O(CH 2 ) n NH 2 、O(CH 2 ) n CH 3 、O(CH 2 ) n ONH 2 and O(CH2 ) n ON[(CH 2 ) n CH 3 )] 2 , wherein n and m are from 1 to about 10. In other embodiments, the dsRNA includes one of the following groups at the 2' position: C 1 To C 10 Lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 、OCN、Cl、Br、CN、CF 3 、OCF 3 、SOCH 3 、SO 2 CH 3 、ONO 2 、NO 2 、N 3 NH 2 , heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter gene group, intercalator, group for improving the pharmacokinetic properties of iRNA or group for improving the pharmacodynamic properties of iRNA and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O--CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., O(CH 2 ) 2 ON(CH 3 ) 2 A group, also known as 2'-DMAOE, as described below in this example; and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH 2 --O--CH 2 -N(CH 2 ) 2 .

[0436] Other modifications include 2'-methoxy (2'-OCH 3 ), 2'-aminopropyloxy (2'-OCH 2 CH 2 CH 2 NH2 ) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of the iRNA, specifically at the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of the 5' terminal nucleotide. The iRNA can also have sugar mimetics, such as a cyclobutyl moiety instead of the pentofuranosyl sugar.

[0437] Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, some of which are commonly owned with the present application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

[0438] iRNAs may also include modifications or substitutions of nucleobases (often referred to in the art as simply "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic nucleobases and natural nucleobases, such as deoxy-thymine (dT); 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl derivatives and other alkyl derivatives of adenine and guanine; 2-propyl derivatives and other alkyl derivatives of adenine and guanine; 2-thiouracil; 2-thiothymine and 2-thiocytosine; 5-halouracil and cytosine; 5-alkynyluracil and cytosine; 6-azouracil , 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo (specifically 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases include those disclosed in U.S. Pat. No. 3,687,808; those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn P., ed., Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz JL, ed., John Wiley & Sons, 1990; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi Y S., Chapter 15, dsRNA Research and Applications. and Applications, pp. 289-302, Crooke ST and Lebleu B., eds., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds embodied in the present invention.These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6°C-1.2°C (Sanghway YS, Crook ST, and Libreu B., eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0439] Representative U.S. patents that teach the preparation of some of the modified nucleobases described above, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patent Nos. 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,5 7,427,672; and 7,495,088, each of which is hereby incorporated by reference in its entirety.

[0440] The RNA of the iRNA can also be modified to include one or more locked nucleic acids (LNA). Locked nucleic acids are nucleotides with a modified ribose moiety, wherein the ribose moiety contains an additional bridge connecting the 2' carbon and the 4' carbon. This structure effectively "locks" the ribose in a 3'-endo structure configuration. It has been shown that adding locked nucleic acids to siRNA can increase the stability of siRNA in serum and reduce off-target effects (Elrnen J. et al., (2005) Nucleic Acids Research 33 (1): 439-447; Mook OR. et al., (2007) Molecular Cancer Therapy 6 (3): 833-843; Grunweller A. et al., (2003) Nucleic Acids Research 31 (12): 3185-3193).

[0441] Representative U.S. patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, each of which is hereby incorporated by reference in its entirety.

[0442] Potentially stabilizing modifications to the termini of RNA molecules may include N-(acetylaminohexanoyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(hexanoyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminohexanoyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base (idT), and other modifications. Disclosure of such modifications may be found in PCT Publication No. WO 2011 / 005861.

[0443] A. Modified iRNAs Comprising the Motifs of the Invention

[0444] In certain aspects of the invention, the double-stranded RNAi agents of the invention include agents with chemical modifications, as disclosed, for example, in U.S. Provisional Application No. 61 / 561,710, filed on November 18, 2011, or in PCT / US2012 / 065691, filed on November 16, 2012, the entire contents of each of which are incorporated herein by reference.

[0445] As shown in this and in provisional application number 61 / 561,710 or PCT application number PCT / US2012 / 065691, superior results can be obtained by introducing one or more motifs having three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand of RNAi reagent (specifically at or near the cleavage site). In certain embodiments, the sense strand and antisense strand of the RNAi agent can be fully modified in another way. The introduction of these motifs interrupts the modification pattern of the sense strand and / or antisense strand (if present). The RNAi agent can be optionally conjugated with a GalNAc derivative ligand, for example, on the sense strand. The resulting RNAi agent presents superior gene silencing activity.

[0446] More specifically, it was unexpectedly discovered that when the sense and antisense strands of the double-stranded RNAi agent are fully modified to have one or more motifs having three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the RNAi agent, the gene silencing activity of the RNAi agent is significantly enhanced.

[0447] Therefore, the present invention provides a double-stranded RNAi agent capable of inhibiting the expression of a target gene (i.e., complement component C5 (C5) gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. The length of each strand of the RNAi agent can be within the range of 12-30 nucleotides. For example, the length of each strand can be between 14-30 nucleotides, between 17-30 nucleotides, between 25-30 nucleotides, between 27-30 nucleotides, between 17-23 nucleotides, between 17-21 nucleotides, between 17-19 nucleotides, between 19-25 nucleotides, between 19-23 nucleotides, between 19-21 nucleotides, between 21-25 nucleotides, or between 21-23 nucleotides.

[0448] The sense strand and the antisense strand typically form a duplex double-stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent". The length of the duplex region of an RNAi agent can be 12-30 nucleotide pairs. For example, the length of the duplex region can be between 14-30 nucleotide pairs, between 17-30 nucleotide pairs, between 27-30 nucleotide pairs, between 17-23 nucleotide pairs, between 17-21 nucleotide pairs, between 17-19 nucleotide pairs, between 19-25 nucleotide pairs, between 19-23 nucleotide pairs, between 19-21 nucleotide pairs, between 21-25 nucleotide pairs, or between 21-23 nucleotide pairs. In another example, the length of the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides.

[0449] In one embodiment, the RNAi reagent can contain one or more overhanging end regions and / or blocking groups at the 3'-end, 5'-end or both ends of one or two chains. The length of the overhanging end can be 1-6 nucleotides, such as 2-6 nucleotides, 1-5 nucleotides, 2-5 nucleotides, 1-4 nucleotides, 2-4 nucleotides, 1-3 nucleotides, 2-3 nucleotides or 1-2 nucleotides. These overhanging ends can be the result that one chain is longer than another chain, or the result of the staggered two chains with the same length. The overhanging end can form a mismatch with the target mRNA, or it can be complementary to the targeted gene sequence or can be another sequence. The first chain and the second chain can also be connected to form a hairpin or connected by other non-base joints, for example, by other bases.

[0450] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide, including but not limited to 2'-sugar modified, such as 2-F, 2'-O methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo) and any combination thereof. For example, TT can be an overhang sequence at either end of either chain. The overhang can form a mismatch with the target mRNA, or it can be complementary to the targeted gene sequence or can be another sequence.

[0451] The 5'-overhang or 3'-overhang at the sense strand, antisense strand or both strands of the RNAi reagent can be phosphorylated. In certain embodiments, one or more overhang regions contain two nucleotides with phosphorothioate between the two nucleotides, wherein the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3' end of the sense strand, antisense strand or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 3'-overhang is present in the sense strand.

[0452] The RNAi reagent can contain only a single overhang, which can strengthen the interference activity of the RNAi without affecting its overall stability. For example, a single-stranded overhang can be located at the 3'-end of the sense strand, or alternatively at the 3'-end of the antisense strand. The RNAi can also have a flat end located at the 5'-end (or the 3'-end of the sense strand) of the antisense strand, or vice versa. In general, the antisense strand of the RNAi has a nucleotide overhang at the 3'-end, and the 5'-end is flat. Although it is not desired to be bound by theory, the asymmetric flat end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand are conducive to the loading of the guide strand into the RISC process.

[0453] In one embodiment, the RNAi agent is a double-ended blunt-end product having a length of 19 nucleotides, wherein the sense strand contains at least one motif having three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end. The antisense strand contains at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.

[0454] In another embodiment, the RNAi agent is a double-ended blunt-end having a length of 20 nucleotides, wherein the sense strand contains at least one motif having three 2'-F modifications on three consecutive nucleotides at position 8, position 9, and position 10 from the 5' end. The antisense strand contains at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at position 13, position 12, and position 13 from the 5' end.

[0455] In yet another embodiment, the RNAi agent is a double-ended blunt-end having a length of 21 nucleotides, wherein the sense strand contains at least one motif having three 2'-F modifications on three consecutive nucleotides at position 9, position 10, and position 11 from the 5' end. The antisense strand contains at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at position 11, position 12, and position 13 from the 5' end.

[0456] In one embodiment, the RNAi agent comprises a sense strand of 21 nucleotides and an antisense strand of 23 nucleotides, wherein the sense strand contains at least one motif having three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end; the antisense strand contains at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, wherein one end of the RNAi agent is flat and the other end comprises a 2-nucleotide overhang. Preferably, the 2-nucleotide overhang is at the 3'-end of the antisense strand. When the 2-nucleotide overhang is at the 3'-end of the antisense strand, two phosphorothioate internucleotide linkages may be present between the three nucleotides at the end, wherein two of the three nucleotides are overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide. In one embodiment, the RNAi agent additionally has two phosphorothioate internucleotide linkages between the terminal three nucleotides at the 5'-end of the sense strand and at the 5'-end of the antisense strand. In one embodiment, each nucleotide in the sense strand and the antisense strand of the RNAi agent (including nucleotides that are part of the motif) is a modified nucleotide. In one embodiment, each residue is independently modified by, for example, 2'-O-methyl or 3'-fluoro in an alternating motif. Optionally, the RNAi agent further comprises a ligand (preferably GalNAc 3 ).

[0457] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein positions 1 to 23 of the first strand, starting from the 5' terminal nucleotide (position 1), comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides at positions paired with positions 1-23 of the sense strand to form a duplex; wherein at least the 3' terminal nucleotide of the antisense strand is unpaired with the sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with the sense strand, thereby forming a 3' single-stranded overhang of 1-6 nucleotides; wherein the 5' end of the antisense strand comprises from 10-30 consecutive nucleotides that are unpaired with the sense strand, thereby forming a single-stranded 5' overhang of 10-30 nucleotides; wherein when the sense strand and the antisense strand are aligned for maximum complementarity, at least the 5' terminal nucleotide and the 3' terminal nucleotide of the sense strand are base paired with nucleotides of the antisense strand, thereby forming a substantially duplex region between the sense strand and the antisense strand; and along at least 19 ribonucleotides of the length of the antisense strand, the antisense strand is sufficiently complementary to the target RNA so that when the double-stranded nucleic acid is introduced into a mammalian cell, the target gene expression is reduced; and wherein the sense strand contains at least one motif having three 2'-F modifications on three consecutive nucleotides, wherein at least one of these motifs occurs at or near the cleavage site. The antisense strand contains at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.

[0458] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, wherein the RNAi agent comprises a first strand and a second strand, the first strand having a length of at least 25 and at most 29 nucleotides, the second strand having at most 30 nucleotides and at least one motif having three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer than the first strand at its 3' end, wherein the length of the duplex region is at least 25 nucleotides, and along at least 19 nucleotides of the length of the second strand, the second strand is sufficiently complementary to the target mRNA so as to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein dicer cleavage of the RNAi agent preferably produces an siRNA comprising the 3' end of the second strand, thereby reducing target gene expression in the mammal. Optionally, the RNAi agent further comprises a ligand.

[0459] In one embodiment, the sense strand of the RNAi agent contains at least one motif with three identical modifications on three consecutive nucleotides, wherein one of the motifs occurs at the cleavage site in the sense strand.

[0460] In one embodiment, the antisense strand of the RNAi agent may also contain at least one motif having three identical modifications on three consecutive nucleotides, wherein one of these motifs occurs at or near the cleavage site in the antisense strand.

[0461] For RNAi agents with duplex regions of 17-23 nucleotides in length, the cleavage sites of the antisense strand are typically around positions 10, 11, and 12 from the 5'-end. Thus, these motifs with three identical modifications may appear at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the first nucleotide from the 5'-end of the antisense strand, or the count starting from the first paired nucleotide within the duplex region from the 5'-end of the antisense strand. The cleavage site in the antisense strand may also vary depending on the length of the duplex region of the RNAi from the 5' end.

[0462] The sense strand of the RNAi agent may contain at least one motif having three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif having three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand. When the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand may be aligned so that a motif having three nucleotides on the sense strand and a motif having three nucleotides on the antisense strand have at least one nucleotide overlap, i.e., at least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

[0463] In one embodiment, the sense strand of the RNAi agent may contain more than one motif with three identical modifications on three consecutive nucleotides. The first motif may appear at or near the cleavage site of the chain and the other motifs may be wing modifications. The term "wing modification" refers to a motif that appears at another part of the chain that is separated from the motif at or near the cleavage site of the same chain. The wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides. When these motifs are adjacent to each other, the chemical properties of these motifs are different from each other, and when these motifs are separated by one or more nucleotides, the chemical properties may be the same or different. Two or more wing modifications may be present. For example, when there are two wing modifications, each wing modification may be present at one end of the first motif at or near the cleavage site or on either side of the leader motif.

[0464] Like the sense strand, the antisense strand of the RNAi agent can contain more than one motif with three identical modifications on three consecutive nucleotides, at least one of which occurs at or near the cleavage site of the strand. The antisense strand can also contain one or more wing modifications similar to those that can be present on the sense strand in an alignment.

[0465] In one embodiment, the wing modifications on the sense or antisense strand of the RNAi agent typically exclude the first one or two terminal nucleotides at the 3' end, the 5' end, or both ends of the strand.

[0466] In another embodiment, the wing modification on the sense or antisense strand of the RNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3 '-end, 5 '-end, or both ends of the strand.

[0467] When the sense and antisense strands of the RNAi agent each contain at least one wing modification, the wing modifications can fall on the same end of the duplex region and have an overlap of one, two, or three nucleotides.

[0468] When the sense strand and the antisense strand of the RNAi agent each contain at least two wing modifications, the sense strand and the antisense strand can be aligned so that the two modifications from each strand fall on one end of the duplex region, thereby having an overlap of one, two, or three nucleotides; the two modifications from each strand fall on the other end of the duplex region, thereby having an overlap of one, two, or three nucleotides; the two modifications of one strand fall on each side of the leader motif, thereby having an overlap of one, two, or three nucleotides in the duplex region.

[0469] In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent (including nucleotides that are part of the motif) can be modified. Each nucleotide can be modified by the same or different modifications, which can include one or more changes to one or both of the non-bonded phosphate oxygens and / or one or more of the bonded phosphate oxygens; changes to the composition of the ribose, such as the 2' hydroxyl group on the ribose; replacement of the phosphate moiety with a "dephosphorylated" linker; modification or replacement of naturally occurring bases; and replacement or modification of the ribose-phosphate backbone.

[0470] Since nucleic acid is a polymer of subunits, many modifications occur at a position repeated in nucleic acid, such as a modification of a base or a phosphate moiety or a non-bonded O of a phosphate moiety. In some cases, the modification will occur at all target positions in the nucleic acid, but it will not be so in many cases. By way of example, modification can only occur at 3' or 5' terminal positions, can only occur in the terminal region, such as at a position on the terminal nucleotide or in the last 2,3,4,5 or 10 nucleotides of a chain. Modification can occur in double-stranded regions, single-stranded regions or both. Modification can only occur in the double-stranded regions of RNA or can only occur in the single-stranded regions of RNA. For example, a thiophosphate modification at a non-bonded O position can only occur at one or both ends, can only occur in the terminal region, such as at a position on the terminal nucleotide or in the last 2,3,4,5 or 10 nucleotides of a chain, or can occur in double-stranded regions and single-stranded regions particularly at the end. One or more 5' ends can be phosphorylated.

[0471] In order to enhance stability, it is possible that, for example, specific bases are included in the overhang or modified nucleotides or nucleotide substitutes are included in the single-stranded overhang (for example, in a 5' or 3' overhang or both). For example, it may be desirable to include purine nucleotides in the overhang. In certain embodiments, all or some bases in a 3' or 5' overhang may be modified by, for example, the modification described herein. Modification may include, for example, using modification as known in the art at the 2' position of ribose, using modification, for example, using deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl and sulfate groups modified by the ribose of the replacement core base, for example, thiosulfate modification. The overhang need not be homologous to the target sequence.

[0472] In one embodiment, each residue of the sense strand and the antisense strand is independently modified by LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl or 2'-fluoro. These strands may contain more than one modification. In one embodiment, each residue of the sense strand and the antisense strand is independently modified by 2'-O-methyl or 2'-fluoro.

[0473] At least two different modifications are typically present on the sense strand and the antisense strand. Those two modifications can be 2'-O-methyl or 2'-fluoro modifications or other modifications.

[0474] In one embodiment, N a and / or N b Modifications comprising alternating patterns. As used herein, the term "alternating motif" refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of a chain. Alternating nucleotides may refer to one every other nucleotide or one every other two nucleotides, or a similar pattern. For example, if A, B, and C each represent a type of modification to a nucleotide, the alternating motif may be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0475] The types of modifications contained in the alternating motif can be the same or different. For example, if A, B, C, D each represent a type of modification on a nucleotide, the alternating pattern (i.e., the modification on every other nucleotide) can be the same, but each of the sense strand or antisense strand can be selected from several modification possibilities within the alternating motif such as "ABABAB...", "ACACAC...", "BDBDBD..." or "CDCDCD...", etc.

[0476] In one embodiment, the modification pattern of the alternating motif on the sense strand included in the RNAi agent of the present invention is shifted relative to the modification pattern of the alternating motif on the antisense strand. The shift can be such that the modification groups of the nucleotides of the sense strand correspond to different modification groups of the nucleotides of the antisense strand, and vice versa. For example, when the sense strand is paired with the antisense strand in the dsRNA duplex, the alternating motif in the sense strand can start from "ABABAB" from the 5'-3' of the strand, and the alternating motif in the antisense strand can start from "BABABA" from the 5'-3' of the strand in the duplex region. As another example, the alternating motif in the sense strand can start from "AABBAABB" from the 5'-3' of the strand, and the alternating motif in the antisense strand can start from "BBAABBAA" from the 5'-3' of the strand in the duplex region, so that there is a complete or partial shift of the modification pattern between the sense strand and the antisense strand.

[0477] In one embodiment, the RNAi agent comprises an alternating motif pattern initially having 2'-O-methyl modifications and 2'-F modifications on the sense strand, which has a shift relative to an alternating motif pattern initially having 2'-O-methyl modifications and 2'-F modifications on the antisense strand, i.e., 2'-O-methyl modified nucleotides on the sense strand are base paired with 2'-F modified nucleotides on the antisense strand, and vice versa. The 1 position of the sense strand may start with a 2'-F modification, and the 1 position of the antisense strand may start with a 2'-O-methyl modification.

[0478] The introduction of one or more motifs having three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand interrupts the initial modification pattern present in the sense strand and / or antisense strand. This interruption of the modification pattern of the sense strand and / or antisense strand by the introduction of one or more motifs having three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand unexpectedly enhances the gene silencing activity on the target gene.

[0479] In one embodiment, when a motif having three identical modifications on three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide immediately following the motif is a modification different from the modification of the motif. For example, the portion of the sequence containing the motif is "... N a YYYN b ...”, where “Y” represents a modification with a motif of three identical modifications on three consecutive nucleotides, and “N a ” and “N b " indicates a modification of the nucleotide next to the motif "YYY" that is different from the modification of Y, and wherein N a and N bCan be the same or different modifications. Alternatively, when a wing modification is present, N a and / or N b Can be present or not.

[0480] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both strands, in any position of the strand. For example, the internucleotide linkage modification may occur on each nucleotide on the sense strand and / or antisense strand; each internucleotide linkage modification may occur on the sense strand and / or antisense strand in an alternating pattern; or the sense strand or antisense strand may contain these two internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In one embodiment, the double-stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages. In one embodiment, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5 '-terminus and two phosphorothioate internucleotide linkages at the 3 '-terminus, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5 '-terminus or the 3 '-terminus.

[0481] In one embodiment, the RNAi comprises phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region.For example, the overhang region may contain two nucleotides with phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.Internucleotide linkage modification may also be performed to connect the overhang nucleotide to the nucleotide of the terminal pairing in the duplex region.For example, at least 2, 3, 4 or all overhang nucleotides may be connected by phosphorothioate or methylphosphonate internucleotide linkage, and optionally, there may be other phosphorothioate or methylphosphonate internucleotide linkages that connect the overhang nucleotide to a paired nucleotide next to the overhang nucleotide.For example, there may be at least two phosphorothioate internucleotide linkages between the three nucleotides at the end, wherein two of the three nucleotides are overhang nucleotides, and the third is the nucleotide of the pairing next to the overhang nucleotide.These three nucleotides at the end may be at the 3'-end of the antisense strand, the 3'-end of the sense strand, the 5'-end of the antisense strand and / or the 5' end of the antisense strand.

[0482] In one embodiment, the 2 nucleotide overhang is at the 3'-end of the antisense strand, and there are two phosphorothioate internucleotide linkages between the terminal three nucleotides, two of which are overhang nucleotides, and the third nucleotide is the paired nucleotide next to the overhang nucleotide. Optionally, the RNAi agent can additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and at the 5'-end of the antisense strand.

[0483] In one embodiment, the RNAi agent comprises one or more mismatches with the target within the duplex, or a combination thereof. The mismatch may occur in an overhang region or a duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (e.g., for a specific paired association or dissociation free energy, the simplest approach is to examine these pairs based on individual pairs, but immediate neighbors or similar analyses may also be used). With respect to promoting dissociation, A:U is preferred to G:C; G:U is preferred to G:C; and I:C is preferred to G:C (I = inosine). Mismatches such as non-canonical pairings or pairings other than canonical (as described elsewhere herein) are preferred to canonical (A:T, A:U, G:C) pairings; and pairings including universal bases are preferred to canonical pairings.

[0484] In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4 or 5 base pairs within the duplex region from the 5'-end of the antisense strand, the base pairs being independently selected from the group consisting of A:U, G:U, I:C and mismatched pairs, e.g., non-canonical pairings or pairings other than canonical, or pairings including universal bases, so as to promote dissociation of the antisense strand at the 5'-end of the duplex.

[0485] In one embodiment, the nucleotide at the 1 position in the duplex region from the 5'-end of the antisense strand is selected from the group consisting of A, dA, dU, U and dT. Alternatively, at least one of the first 1, 2 or 3 base pairs in the duplex region from the 5'-end of the antisense strand is an AU base pair. For example, the first base pair in the duplex region from the 5'-end of the antisense strand is an AU base pair.

[0486] In another embodiment, the nucleotide at the 3'-end of the sense strand is deoxy-thymine (dT). In another embodiment, the nucleotide at the 3'-end of the antisense strand is deoxy-thymine (dT). In one embodiment, there is a short sequence of deoxy-thymine nucleotides, such as two dT nucleotides, at the 3'-end of the sense strand and / or the antisense strand.

[0487] In one embodiment, the sense strand sequence can be represented by formula (I):

[0488] 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'(I)

[0489] in:

[0490] i and j are each independently 0 or 1;

[0491] p and q are each independently 0-6;

[0492] Each N a independently represent oligonucleotide sequences comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0493] Each N b independently represent an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0494] Each n p and n q Overhanging nucleotides are represented independently;

[0495] wherein Nb and Y do not have the same modifications; and

[0496] XXX, YYY and ZZZ each independently represent a motif having three identical modifications on three consecutive nucleotides. Preferably YYY are all 2'-F modified nucleotides.

[0497] In one embodiment, N a and / or N b Contains modifications with alternating patterns.

[0498] In one embodiment, the YYY motif appears at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif may appear at or near the cleavage site of the sense strand (e.g., may appear at position 6, position 7, position 8, position 7, position 8, position 9, position 8, position 9, position 10, position 9, position 10, position 11, position 10, position 11, position 12 or position 11, position 12, position 13), counting from the first nucleotide from the 5'-end; or optionally, counting from the first paired nucleotide in the duplex region from the 5'-end.

[0499] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can thus be represented by the formula:

[0500] 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib);

[0501] 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or

[0502] 5'n p -N a -XXX-N b -YYY-N b -N a -n q 3'(Id).

[0503] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. a Oligonucleotide sequences comprising 2-20, 2-15 or 2-10 modified nucleotides may independently be represented.

[0504] When the sense strand is represented by formula (Ic), N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. a Oligonucleotide sequences comprising 2-20, 2-15 or 2-10 modified nucleotides may independently be represented.

[0505] When the sense strand is represented by formula (Id), each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6. Each N a Oligonucleotide sequences comprising 2-20, 2-15 or 2-10 modified nucleotides may independently be represented.

[0506] X, Y and Z each may be the same as or different from each other.

[0507] In other embodiments, i is 0 and j is 0, and the sense strand can be represented by the formula:

[0508] 5'n p -N a -YYY-N a -n q 3'(Ia).

[0509] When the sense strand is represented by formula (Ia), each N a Oligonucleotide sequences comprising 2-20, 2-15 or 2-10 modified nucleotides may independently be represented.

[0510] In one embodiment, the antisense strand sequence of the RNAi can be represented by formula (II):

[0511] 5'n q -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N a '-n p '3'(II)

[0512] in:

[0513] k and l are each independently 0 or 1;

[0514] p' and q' are each independently 0-6;

[0515] Each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0516] Each N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0517] Each n p ' and n q ' independently represent the overhanging nucleotides;

[0518] Where N b ' and Y' do not have the same modifications;

[0519] and

[0520] X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides.

[0521] In one embodiment, Na ' and / or N b 'Contains modifications with alternating patterns.

[0522] The Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the Y'Y'Y' motif may occur at position 9, position 10, position 11; position 10, position 11, position 12; position 11, position 12, position 13; position 12, position 13, position 14; or position 13, position 14, position 15 of the antisense strand, wherein counting starts from the first nucleotide from the 5'-end; or optionally, counting starts at the first paired nucleotide in the duplex region from the 5'-end. Preferably, the Y'Y'Y' motif occurs at position 11, position 12, position 13.

[0523] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0524] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0525] The antisense strand can therefore be represented by the following formula:

[0526] 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(IIb);

[0527] 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(IIc); or

[0528] 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3'(IId).

[0529] When the antisense strand is represented by formula (IIb), N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. a' independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0530] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0531] When the antisense strand is represented by formula (IId), each N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides. Preferably, N b Is 0, 1, 2, 3, 4, 5, or 6.

[0532] In other embodiments, k is 0 and l is 0, and the antisense strand can be represented by the formula:

[0533] 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia).

[0534] When the antisense strand is represented by formula (IIa), each N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0535] X', Y' and Z' may each be the same as or different from each other.

[0536] Each nucleotide of the sense strand and the antisense strand can be independently modified by LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro. For example, each nucleotide of the sense strand and the antisense strand is independently modified by 2'-O-methyl or 2'-fluoro. Specifically, each of X, Y, Z, X', Y' and Z' can represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0537] In one embodiment, the sense strand of the RNAi agent may contain a YYY motif, which appears at positions 9, 10, and 11 of the strand when the duplex region is 21 nucleotides, with the count starting from the first nucleotide from the 5'-end, or optionally, the count starting at the first paired nucleotide within the duplex region from the 5'-end; and Y represents a 2'-F modification. The sense strand may additionally contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region; and XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0538] In one embodiment, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, and 13 of the strand, counting starting from the first nucleotide from the 5'-end, or optionally, counting starting at the first paired nucleotide within the duplex region from the 5'-end; and Y' represents a 2'-O-methyl modification. The antisense strand may additionally contain a X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region; and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0539] The sense strand represented by any one of the above formulae (Ia), (Ib), (Ic) and (Id) forms a duplex with the antisense strand correspondingly represented by any one of formulae (IIa), (IIb), (IIe) and (IId).

[0540] Thus, the RNAi agents used in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex being represented by formula (III):

[0541] Meaning: 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'

[0542] Antonym: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5'

[0543] (III)

[0544] in:

[0545] i, j, k and l are each independently 0 or 1;

[0546] p, p', q and q' are each independently 0-6;

[0547] Each N a and N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0548] Each N b and N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0549] in

[0550] Each n p '、n p 、n q ' and n q independently represent the overhang nucleotides, the n p '、n p 、n q ' and n q Each of may or may not be present; and

[0551] XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent a motif having three identical modifications on three consecutive nucleotides.

[0552] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or i and j are both 0; or i and j are both 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or k and l are both 0; or k and l are both 1.

[0553] Exemplary combinations of the sense and antisense strands that form RNAi duplexes include the following:

[0554] 5'n p -N a -YYY-N a -n q 3'

[0555] 3'n p '-N a '-Y'Y'Y'-N a 'n q '5'

[0556] (IIIa)

[0557] 5'n p -N a -YY YN b -ZZ ZN a -n q 3'

[0558] 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5'

[0559] (IIIb)

[0560] 5'n p -N a -XX XN b -YY YN a -n q 3'

[0561] 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5'

[0562] (IIIc)

[0563] 5'n p -N a -XX XN b -YY YN b -ZZ ZN a -n q 3'

[0564] 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5'

[0565] (IIId)

[0566] When the RNAi agent is represented by formula (IIIa), each N a Independently refers to an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0567] When the RNAi agent is represented by formula (IIIb), each N b N independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. a Independently refers to an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0568] When the RNAi agent is represented by formula (IIIc), each N b 、N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N a Independently refers to an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides.

[0569] When the RNAi agent is represented by formula (IIId), each N b 、N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N a 、N a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15 or 2-10 modified nucleotides. N a 、N a '、N b and N b Each of ' independently comprises modifications having an alternating pattern.

[0570] X, Y and Z in formula (III), (IIIa), (IIIb), (IIIc) and (IIId) may be the same as or different from each other.

[0571] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), at least one of the Y nucleotides can form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form a base pair with the corresponding Y' nucleotide; or all three Y nucleotides form a base pair with the corresponding Y' nucleotide.

[0572] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form a base pair with the corresponding Z' nucleotide; or all three Z nucleotides form a base pair with the corresponding Z' nucleotide.

[0573] When the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides can form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form a base pair with the corresponding X' nucleotide; or all three X nucleotides form a base pair with the corresponding X' nucleotide.

[0574] In one embodiment, the modification on the Y nucleotide is different from the modification on the Y' nucleotide, the modification on the Z nucleotide is different from the modification on the Z' nucleotide, and / or the modification on the X nucleotide is different from the modification on the X' nucleotide.

[0575] In one embodiment, when the RNAi agent is represented by formula (IIId), N a In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is 2'-O-methyl or 2'-fluoro, and n p '>0 and at least one n p ' is linked to the adjacent nucleotide via a phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is 2'-O-methyl or 2'-fluoro modification, n p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is 2'-O-methyl or 2'-fluoro modification, n p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0576] In one embodiment, when the RNAi agent is represented by formula (IIIa), N a The modification is 2'-O-methyl or 2'-fluoro modification, np '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

[0577] In one embodiment, the RNAi agent is a polymer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the polymer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target the same gene at two different target sites.

[0578] In one embodiment, the RNAi agent is a polymer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId). The linker can be cleavable or non-cleavable. Optionally, the polymer further comprises a ligand. Each of these duplexes can target the same gene or two different genes; or each of these duplexes can target the same gene at two different target sites.

[0579] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId) are linked to each other at the 5' end and one or both of the 3' ends, and are optionally conjugated to a ligand. Each of these agents can target the same gene or two different genes; or each of these agents can target the same gene at two different target sites.

[0580] Various publications describe the polymer RNAi agents that can be used in the methods of the invention. Such publications include WO2007 / 091269, U.S. Patent No. 7858769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887 and WO2011 / 031520, the entire contents of each of which are hereby incorporated by reference.

[0581] As described in more detail below, the RNAi agent containing one or more carbohydrate moieties and the conjugation of RNAi agents can optimize one or more characteristics of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose of one or more ribonucleotide subunits of a dsRNA agent can be replaced by another part (e.g., a non-carbohydrate (preferably cyclic) carrier attached to a carbohydrate ligand). The ribonucleotide subunit in which the ribose of the subunit is so replaced is referred to as a ribose replacement modified subunit (RRMS) herein. A cyclic carrier can be a carbocyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic system, or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system, or it can contain one or more double bonds.

[0582] The ligand can be attached to the polynucleotide via a carrier. These carriers include (i) at least one "backbone attachment point", preferably two "backbone attachment points", and (ii) at least one "tether attachment point". As used herein, a "backbone attachment point" refers to a functional group (e.g., a hydroxyl group), or generally, a bond (e.g., a phosphate or modified phosphate) available and suitable for binding the carrier to a backbone (e.g., a sulfur-containing backbone) of a ribonucleic acid. In some embodiments, a "tether attachment point" (TAP) refers to a constituent ring atom of the cyclic carrier, such as a carbon atom or a heteroatom (different from the atom that provides the backbone attachment point), to which a selected moiety is attached. The moiety can be, for example, a carbohydrate, such as a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, and a polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier via an intervening tether. Thus, the cyclic carrier will often include a functional group (e.g., an amino group), or generally provide a bond suitable for binding or tethering another chemical entity (e.g., a ligand) to the constituent ring.

[0583] These RNAi agents can be conjugated to a ligand via a carrier, wherein the carrier can be a cyclic group or a non-cyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinone, tetrahydrofuranyl and decahydronaphthalene; preferably, the non-cyclic group is selected from a serinol backbone or a diethanolamine backbone.

[0584] In certain specific embodiments, the RNAi agent used in the methods of the invention is an agent selected from the group having agents listed in any one of Table 3, Table 4, Table 5, Table 6, Table 18, Table 19, Table 20, Table 21, and Table 23. The agents may further comprise a ligand.

[0585] IV. iRNA Conjugated to Ligand

[0586] Another modification of the RNA of the iRNA of the invention involves chemically linking the RNA to one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include, but are not limited to, lipid moieties, such as a cholesterol moiety (Letsinger et al., Proc. Natl Acid. Sci. USA, 1989, 86:6553-6556), bile acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1994, 4:1053-1060), Res., 1992, 20:533-538), aliphatic chains, for example dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, for example di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphate (Manhanlan et al., Tetrahedron Lett., 1993, 75:49-54), Lett., 1995, 36:3651-3654; Shea et al., Nucleic Acids Research, 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manhanlan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manhanlan et al., Tetrahedron Express, 1995, 36:3651-3654), Palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937).

[0587] In one embodiment, the ligand alters the distribution, targeting or lifetime of the iRNA agent into which it is incorporated. In preferred embodiments, such a ligand provides enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cell or organ compartment, tissue, organ or region of the body)) compared to, for example, a species in which such a ligand is not present. Preferred ligands will not participate in duplex pairing in duplex nucleic acids.

[0588] The ligand can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL) or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine or hyaluronic acid); or lipids. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example a synthetic polyamino acid. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly-(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly-(2-ethylacrylic acid), N-isopropylacrylamide polymer or polyphosphazene. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0589] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type such as a kidney cell, such as a lectin, a glycoprotein, a lipid or a protein, such as an antibody. The targeting group can be thyrotropin, melanocyte stimulating hormone, a lectin, a glycoprotein, surfactant protein A, a mucin carbohydrate, a multivalent lactose, a multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, a multivalent fucose, a glycosylated polyamino acid, a multivalent galactose, transferrin, a bisphosphonate, polyglutamic acid, polyaspartic acid, a lipid, cholesterol, a steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0590] Other examples of ligands include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules, such as cholesterol, bile acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1, 3-di-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, methanol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., antenna gene peptide, Tat peptide), alkylating agents, phosphate esters, amino groups, sulfhydryl groups, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP or AP.

[0591] The ligand can be a protein, such as a glycoprotein, or a peptide, such as a molecule with specific affinity for the auxiliary ligand, or an antibody, such as an antibody that binds to a specified cell type such as a hepatocyte. The ligand can also include hormones and hormone receptors. The ligand can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

[0592] The ligand can be a substance, such as a drug, that can increase the uptake of an iRNA agent into a cell, for example, by disrupting the cytoskeleton of the cell (e.g., by disrupting cellular microtubules, microfilaments and / or intermediate filaments). The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0593] In certain embodiments, a part attached to the iRNA as described herein is used as a pharmacokinetic regulator (PK regulator).PK regulators include lipophilic substances, cholic acid, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, etc.Exemplary PK regulators include, but are not limited to cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen (ibuprofen), vitamin E, biotin, etc.Oligonucleotides comprising many thiophosphate linkages are also known to be combined with serum proteins, so the short oligonucleotides comprising multiple thiophosphate linkages in the skeleton, for example, oligonucleotides with about 5 bases, 10 bases, 15 bases or 20 bases, are also subject to the present invention as a part (for example, as a PK regulator).In addition, the aptamers in conjunction with serum components (for example, serum proteins) are also suitable for use as the PK regulators in these embodiments described herein.

[0594] The ligand-conjugated oligonucleotides of the invention can be synthesized using an oligonucleotide having a pendant reactive functionality, such as from the attachment of a linker molecule to the oligonucleotide (as described below). The reactive oligonucleotide can react directly with a commercially available ligand, a synthetic ligand having any of a variety of protecting groups, or a ligand having a linker moiety attached thereto.

[0595] The oligonucleotide used in the conjugate of the present invention can be conveniently and routinely prepared by the well-known technology of solid phase synthesis. The instrument used for this synthesis is sold by several suppliers, including, for example, Applied Biosystems (California, Foster City, Calif). Any other device known in the art for this synthesis can be used additionally or alternatively. It is also known to use similar techniques to prepare other oligonucleotides (such as thiophosphates and alkylated derivatives).

[0596] In the ligand-conjugated oligonucleotides and ligand-molecules with sequence-specifically linked nucleosides of the present invention, the oligonucleotides and oligonucleosides can be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already have a linking portion, ligand-nucleotide or nucleoside conjugate precursors that already have a ligand molecule, or non-nucleoside ligands with structural motifs.

[0597] When using nucleotide-conjugate precursors that already have a linking moiety, the synthesis of the sequence-specific linked nucleoside is typically completed, and then the ligand molecule reacts with the linking moiety to form a ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0598] A. Lipid Conjugates

[0599] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. This lipid or lipid-based molecule preferably binds to serum proteins, such as human serum albumin (HSA). The ligand that binds to HSA allows the conjugate to be distributed to a target tissue, such as a non-renal target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipids or lipid-based ligands can (a) increase the resistance of the conjugate to degradation, (b) increase targeting or transport to target cells or cell membranes, and / or (c) can be used to regulate binding to serum proteins (such as HSA).

[0600] Lipid-based ligands can be used to inhibit (e.g., control) the binding of the conjugate to the target tissue. For example, a lipid or lipid-based ligand that binds more strongly to HSA will be less likely to target the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds less strongly to HSA can be used to target the conjugate to the kidney.

[0601] In a preferred embodiment, the lipid-based ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity so that the conjugate will preferentially distribute to non-renal tissues. However, it is preferred that this affinity is not so strong that the HSA-ligand binding cannot be reversed.

[0602] In another preferred embodiment, the lipid-based ligand binds HSA weakly or not at all, such that the conjugate will preferentially distribute to the kidney.Other moieties that target kidney cells may be used instead of or in addition to lipid-based ligands.

[0603] On the other hand, the ligand is a moiety taken up by target cells (e.g., cells that are proliferating), such as a vitamin. These are particularly useful for treating conditions characterized by unwanted cell proliferation (e.g., of malignant or non-malignant type, such as cancer cells). Exemplary vitamins include vitamin A, vitamin E, and vitamin K. Other exemplary vitamins include vitamin B, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by target cells such as liver cells. HSA and low-density lipoprotein (LDL) are also included.

[0604] B. Cell Permeabilization Agents

[0605] In another aspect, the ligand is a cell permeating agent, preferably a helical cell permeating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennapedia. If the agent is a peptide, it can be modified, including the use of peptidyl mimetics, retroisomers, non-peptide linkages or pseudopeptide linkages and D-amino acids. The helical agent is preferably an alpha-helical agent, which preferably has a lipophilic phase and a lipophobic phase.

[0606] The ligand can be a peptide or peptide mimetic. Peptide mimics (also referred to herein as oligopeptide mimics) are molecules that can be folded into a limited three-dimensional structure similar to a natural peptide. The engagement of peptides and peptide mimics with iRNA agents can affect the pharmacokinetic distribution of iRNA, such as by enhancing cell identification and absorption. The peptide or peptide mimetic portion can be about 5-50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids long.

[0607] Peptide or peptide mimetic can be, for example, cell permeation peptide, cationic peptide, amphipathic peptide or hydrophobic peptide (for example, mainly composed of Tyr, Trp or Phe). The peptide part can be a dendritic peptide, a constrained peptide or a cross-linked peptide. In another alternative, the peptide part can include a hydrophobic membrane translocation sequence (MTS). An exemplary peptide containing hydrophobic MTS is RFGF with amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:9). RFGF analogs containing hydrophobic MTS (for example, amino acid sequence AALLPVLLAAP (SEQ ID NO:10)) can also be targeting moieties. The peptide part can be a "delivery" peptide, and the delivery peptide can carry large polar molecules, including peptides, oligonucleotides and proteins across cell membranes. For example, it has been found that the sequence (GRKKRRQRRRPPQ (SEQ ID NO:11)) from HIVTat protein and the sequence (RQIKIWFQNRRMKWKK (SEQ ID NO:12)) of Drosophila antennapedia protein can be used as a delivery peptide. Peptides or peptide mimetics can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or one bead one compound (OBOC) combinatorial libraries (Lam et al., Nature, 354:82-84, 1991). Examples of peptides or peptide mimetics tethered to dsRNA agents by monomeric units bound for the purpose of cell targeting are arginine-glycine-aspartic acid (RGD)-peptides or RGD mimetics. The length of the peptide portion can be in the range of from about 5 amino acids to about 40 amino acids. These peptide portions can have structural modifications, such as to increase stability or guide conformational properties. Any structural modification described below can be utilized.

[0608] The RGD peptides used in the compositions and methods of the invention can be linear or cyclic and can be modified, for example glycosylated or methylated to facilitate targeting to one or more specific tissues. RGD-containing peptides and peptide mimetics can include D-amino acids as well as synthetic RGD mimetics. In addition to RGD, other moieties targeting integrin ligands can be used. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0609] "Cell penetrating peptides" can penetrate cells such as microbial cells (such as bacteria or fungal cells) or mammalian cells (such as human cells). Microbial cell penetrating peptides can be, for example, α-helical linear peptides (e.g., LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins or bovine antimicrobial peptides), or peptides containing only one or two major amino acids (e.g., PR-39 or indolicidin). Cell penetrating peptides can also include a nuclear localization signal (NLS). For example, a cell penetrating peptide can be a dual amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1gp41 and the NLS of the large T antigen of SV40 (Simeoni et al., Nucleic Acids Research, 31: 2717-2724, 2003).

[0610] C. Carbohydrate Conjugates

[0611] In some embodiments of these compositions and methods of the present invention, the iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate-conjugated iRNA is conducive to the in vivo delivery of nucleic acids as described herein and compositions suitable for in vivo treatment. As used herein, "carbohydrate" refers to a compound of a carbohydrate composed of one or more monosaccharide units having at least 6 carbon atoms (these carbon atoms can be linear, branched or cyclic) and bonded to oxygen, nitrogen or sulfur atoms on each carbon atom; or a compound having a part of a carbohydrate part composed of one or more monosaccharide units, each monosaccharide having at least six carbon atoms (these carbon atoms can be linear, branched or cyclic) and bonded to oxygen, nitrogen or sulfur atoms on each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing from about 4, 5, 6, 7, 8 or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose and polysaccharide gum. Specific monosaccharides include C5 and above (eg, C5, C6, C7, or C8) sugars; disaccharides and trisaccharides include sugars having two or three monosaccharide units (eg, C5, C6, C7, or C8).

[0612] In one embodiment, the carbohydrate conjugate used in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as

[0613]

[0614] In another embodiment, the carbohydrate conjugate used in the compositions and methods of the invention is selected from the group consisting of:

[0615]

[0616]

[0617]

[0618]

[0619]

[0620] Another representative carbohydrate conjugate used in the described embodiments includes, but is not limited to

[0621]

[0622] When one of X or Y is an oligonucleotide, the other is hydrogen.

[0623] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modifier and / or a cell penetrating peptide.

[0624] D.Connector

[0625] In some embodiments, the conjugates or ligands described herein can be attached to iRNA oligonucleotides via various linkers, which can be cleavable or non-cleavable.

[0626] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, for example, covalently attaches two parts of a compound. Linkers typically include direct bonds or atoms such as oxygen or sulfur, units such as NR8, C(O), C(O)NH, SO, SO 2 、SO 2NH or a chain of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroaryl Arylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, the one or more methylene groups may be replaced by O, S, S(O), SO 2 , N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic ring interrupted or terminated; wherein R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16 or 8-16 atoms.

[0627] A cleavable linking group is a sufficiently stable group outside the cell, but the group is cleaved upon entry into the target cell to release the two parts of the linker that are bound together. In a preferred embodiment, the cleavage ratio of the cleavable linking group in the target cell or under a first reference condition (the first reference condition can, for example, be selected to simulate or represent intracellular conditions) is at least about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster than in the blood of the subject or under a second reference condition (the second reference condition can, for example, be selected to simulate or represent conditions found in the blood or serum).

[0628] Cleavable linking groups are sensitive to cleavage agents, such as pH, redox potential or the presence of degradable molecules. Typically, cleavage agents are more common or found at higher levels or activity in cells than in serum or blood. Examples of such degradants include: redox agents selected for specific substrates or without substrate specificity, including, for example, present in cells, oxidative or reductive enzymes or reductants such as thiols that can degrade redox cleavable linking groups by reduction; esterases; endosomes or reagents that can produce an acidic environment, such as those that produce 5 or lower pH; enzymes that can hydrolyze or degrade acid-cleavable linking groups as generalized acids, peptidases (the peptidases can be substrate-specific) and phosphatases.

[0629] A cleavable bond group, such as a disulfide bond, may be sensitive to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH in the range of 5.5-6.0, and lysosomes have an even more acidic pH around 5.0. Some linkers will have a cleavable linking group that cleaves at a preferred pH, thereby releasing the cationic lipid from the ligand within the cell, or into a desired cellular compartment.

[0630] The joint can comprise a cleavable linking group that can be cleaved by a specific enzyme. The type of the cleavable linking group that is incorporated into the joint can depend on the cell to be targeted. For example, the part of the liver can be connected to the cationic lipid by a joint that comprises an ester group. Hepatocytes are rich in esterases, and therefore this joint will crack more effectively in hepatocytes than in a cell type that is not rich in esterases. Other cell types that are rich in esterases comprise the cells of lung, renal cortex and testis.

[0631] When targeting cell types rich in peptidases, such as hepatocytes and synoviocytes, linkers containing peptide bonds can be used.

[0632] Usually, the suitability of a candidate's cleavable linking group can be assessed by testing the ability of the candidate's linking group to be cracked by a degradation agent (or condition). It is also desirable to test the candidate's cleavable linking group in blood or when contacting with other non-target tissues to resist the ability of cracking. Therefore, it is possible to determine the relative sensitivity of cracking between a first condition and a second condition, wherein the first condition is selected to indicate the cracking in the target cell and the second condition is selected to indicate the cracking in other tissues or biofluids (such as blood or serum). These assessments can be carried out in a cell-free system, in a cell, in a cell culture, in an organ or tissue culture or in a whole animal. It is useful to carry out an initial assessment under cell-free or culture conditions and to confirm by further assessment in a whole animal. In a preferred embodiment, the cracking ratio of a useful candidate compound in a cell (or under the in vitro conditions selected to simulate intracellular conditions) in blood or serum (or under the in vitro conditions selected to simulate extracellular conditions) is at least about 2,4,10,20,30,40,50,60,70,80,90 or about 100 times faster.

[0633] i. Redox-cleavable linking groups

[0634] In one embodiment, the cleavable linking group is a kind of redox cleavable linking group that is cleaved when reduced or oxidized.An example of a linking group that can be reduced and cleaved is a disulfide linking group (-SS-).In order to determine whether a kind of candidate's cleavable linking group is suitable for " linking group that can be reduced and cleaved ", or for example whether it is suitable for use with a kind of specific iRNA part and specific targeting agent, can refer to the method described herein.For example, a kind of candidate can be evaluated by hatching with dithiothreitol (DTT) or other reagents using reducing agents as known in the art, which simulates the cleavage rate that can be observed in cells (such as target cells).These candidates can also be evaluated under the condition of being selected to simulate blood or serum conditions.In one embodiment, candidate compound is cracked in blood by at most about 10%. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in cells (or under in vitro conditions selected to simulate intracellular conditions) than in blood (or under in vitro conditions selected to simulate extracellular conditions). The rate of cleavage of a candidate compound can be determined using standard enzyme kinetic assays under conditions selected to simulate intracellular media and compared to the rate under conditions selected to simulate extracellular media.

[0635] ii. Phosphate-based cleavable linking groups

[0636] In another embodiment, the cleavable linker includes a cleavable linking group based on phosphate. The cleavable linking group based on phosphate is cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that cleaves the phosphate group in a cell is an enzyme, such as a phosphatase in a cell. Examples of phosphate-based linking groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, -OP(S)(Rk)-S-. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-. Methods similar to those described above can be used to evaluate these candidates.

[0637] iii. Acid-cleavable linking groups

[0638] In another embodiment, the cleavable linker includes an acid-cleavable linking group. Acid-cleavable linking groups are linking groups that are cleaved under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0 or lower), or is cleaved by a variety of reagents (such as enzymes that can be used as broad acids). In cells, specific low pH organelles (such as endosomes or lysosomes) can provide a cleavage environment for acid-cleavable linking groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups can have the general formula -C=NN-, C(O)O or -OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group (such as dimethylpentyl or tert-butyl). Methods similar to those described above can be used to evaluate these candidates.

[0639] iv. Ester-based linking groups

[0640] In another embodiment, cleavable joint comprises a kind of cleavable linking group based on ester.The cleavable linking group based on ester is cracked by enzyme such as esterase and amidase in cell.The example of cleavable linking group based on ester includes but not limited to the ester of alkylene, alkenylene and alkynylene group.The cleavable linking group of ester has general formula-C (O) O or-OC (O)-.Can use the method similar to those described above to evaluate these candidates.

[0641] v. Peptide-based cleavage groups

[0642] In another embodiment, the cleavable linker includes a cleavable linking group based on a peptide. The cleavable linking group based on a peptide is cleaved by an enzyme such as a peptidase and a protease in a cell. The cleavable linking group based on a peptide is a peptide bond formed between amino acids to obtain oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The cleavable group based on a peptide does not include an amide group (-C (O) NH-). An amide group can be formed between any alkylene, alkenylene or alkynylene. The peptide bond is an amide bond formed between amino acids to obtain a specific type of peptide and protein. The cleavable group based on a peptide is usually limited to forming a peptide bond (i.e., an amide bond) between amino acids to obtain a peptide and protein, and does not include the entire amide functional group. The cleavable linking group based on a peptide has a general formula -NHCHRAC (O) NHCHRBC (O) -, wherein RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.

[0643] In one embodiment, the iRNA of the invention is conjugated to a carbohydrate via a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

[0644] as well as

[0645] When one of X or Y is an oligonucleotide, the other is hydrogen.

[0646] In certain embodiments of the compositions and methods of the invention, the ligand is one or more "GalNAc" (N-acetylgalactosamine) derivatives attached via a divalent or trivalent branched linker.

[0647] In one embodiment, the dsRNA of the invention is conjugated to a divalent or trivalent branched linker selected from the group having a structure shown in any of Formulas (XXXI)-(XXXIV):

[0648]

[0649] in:

[0650] q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C independently represent 0-20 for each occurrence and wherein the repeating units may be the same or different;

[0651] P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C For each occurrence, independently: absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NH or CH 2 O;

[0652] Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C for each occurrence is independently: absent, alkylene, substituted alkylene, wherein one or more methylene groups may be interrupted or terminated by one or more of: O, S, S(O), SO 2 、N(R N ), C(R')=C(R"),C≡C or C(O);

[0653] R 2A , R 2B , R 3A , R 3B , R 4A , R4B , R 5A , R 5B , R 5C For each occurrence, independently: does not exist,

[0654] NH, O, S, CH 2 、C(O)O、C(O)NH、NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=NO, or a heterocyclic group;

[0655] L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represents a ligand; that is, for each occurrence, independently represents a monosaccharide (such as GalNAc), a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide or a polysaccharide; and R a Is H or an amino acid side chain. Trivalent conjugated GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of target genes, such as those having formula (XXXV):

[0656] Formula XXXV

[0657]

[0658] Where L 5A , L 5B and L 5C Represents a monosaccharide, such as a GalNAc derivative.

[0659] Examples of suitable divalent and trivalent branched linker groups for conjugating GalNAc derivatives include, but are not limited to, the structures listed above as Formula II, Formula VII, Formula XI, Formula X, and Formula XIII.

[0660] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5 ,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,1 12,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,56 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated by reference herein.

[0661] It is not necessary for all positions in a given compound to be uniformly modified, and in fact, more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an iRNA.The present invention also includes iRNA compounds that are chimeric compounds.

[0662] "Chimeric" iRNA compounds or "chimeras" in the context of the present invention are iRNA compounds, preferably dsRNAs, that contain two or more chemically distinct regions, each consisting of at least one monomeric unit, ie, a nucleotide in the case of a dsRNA compound.

[0663] These iRNAs typically contain at least one region, wherein the RNA is modified to give the iRNA increased nuclease degradation resistance, increased cellular uptake and / or increased target nucleic acid binding affinity.An additional region of iRNA can be used as a substrate for the enzyme that can crack RNA:DNA or RNA:RNA hybrids.By way of example, RNase H is the cellular endonuclease of the RNA chain of the cracking RNA:DNA duplex.Therefore, the activation of RNase H causes the cracking of RNA target, thereby greatly enhancing the efficiency of iRNA suppressing gene expression.Therefore, compared with the thiophosphate deoxy dsRNA that is hybridized to the same target region, comparable results can be obtained with shorter iRNA when using chimeric dsRNA.The cracking of the RNA target can be routinely detected by gel electrophoresis and if necessary in conjunction with nucleic acid hybridization techniques as known in the art.

[0664] In some instances, the RNA of the iRNA can be modified by a non-ligand group. Many non-ligand molecules have been conjugated to the iRNA to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties include lipid moieties such as cholesterol (Kubo T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Lezsinger et al., Proceedings of the National Academy of Sciences, 1989, 86:6553), bile acid (Manhanlan et al., Bioorganic Chemistry and Medicinal Chemistry Communications, 1994, 4:1053), thioethers, For example, hexyl-S-tritylthiol (Mannhanlan et al., Annals of the New York Academy of Sciences, 1992, 660:306; Mannhanlan et al., Bioorganic and Medicinal Chemistry Communications, 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucleic Acids Research, 1992, 20:533), aliphatic chains, such as dodecanediol or undecyl residues (Saison-Bemeros et al., Journal of the European Molecular Biology Association, 1991, 10:111; carboxymethyl thiol) (Mannhanlan et al., Bioorganic and Medicinal Chemistry Communications, 1993, 3:2765), thiocholesterol (Oberhauser et al., Nucleic Acids Research, 1992, 20:533), Banov et al., FEBS Letters, 1990, 259:327; Swinachuk et al., Biochemistry and Molecular Biology, 1993, 75:49), phospholipids, such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphate (Manhanlan et al., Tetrahedron Letters, 1995, 36:3651; Shea et al., Nucleic Acids Res., 1990, 18:3777), Polyamine or polyethylene glycol chains (Manhanlan et al., Nucleosides and Nucleotides, 1995, 14:969), or adamantaneacetic acid (Manhanlan et al., Tetrahedron Express, 1995, 36:3651), palmityl moieties (Mishra et al., Biochimica et Biophysica Acta, 1995, 1264:229), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crook et al., Am. J. Pharmacol. Exp. Therapeutics, 1996, 277:923). Representative U.S. patents teaching the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve synthesizing RNA with an amino linker at one or more positions in the sequence. The amino group is then reacted with the molecule to be conjugated using an appropriate coupling agent or activator. The conjugation reaction can be performed with the RNA still bound to a solid support or in solution phase after cleavage of the RNA. Purification of the RNA conjugate by HPLC typically provides a pure conjugate.

[0665] IV. Delivery of iRNAs of the Invention

[0666] The delivery of the iRNA of the present invention to a cell can be achieved in many different ways, such as a cell in a subject, such as a human subject (e.g., a subject in need, such as a subject suffering from a disease associated with complement component C5). For example, delivery can be carried out by contacting a cell with the iRNA of the present invention in vitro or in vivo. Delivery in vivo can also be carried out directly by administering a composition comprising an iRNA (e.g., dsRNA) to the subject. Alternatively, delivery in vivo can be carried out indirectly by administering one or more vectors that encode and guide the expression of the iRNA. These alternatives are further discussed below.

[0667] Generally, any method of delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the iRNA of the present invention (see, e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139-144 and WO94 / 02595, which are incorporated herein by reference in their entirety). For in vivo delivery, factors considered for delivery of iRNA molecules include, for example, the biological stability of the delivered molecule, the prevention of nonspecific effects, and the accumulation of the delivered molecule in the target tissue. Nonspecific effects of iRNA can be minimized by local administration, such as by direct injection or implantation into tissues or by local administration of formulations. Local administration to the treatment site maximizes the local concentration of the agent, limits the exposure of the agent to systemic tissues that otherwise may be damaged by the agent or may degrade the agent, and allows administration of a lower total dose of the iRNA molecule. Several studies have shown successful knockdown of gene products when iRNA is administered locally. For example, intraocular delivery of VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino ML et al. (2004) Retina 24: 132-138) and subretinal injection in mice (Reich SJ et al. (2003) Mol. Vis. 9: 210-216) has been shown to prevent neovascularization in experimental models of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA in mice reduces tumor volume (Pille J. et al. (2005) Mol. Ther. 11: 267-274) and can prolong the survival of tumor-bearing mice (Kim WJ et al. (2006) Mol. Ther. 14: 343-350; Li S. et al. (2007) Mol. Ther. 15: 515-523).RNA interference has also been shown to be delivered locally to the CNS by direct injection (Dorn G. et al. (2004) Nucleic Acids 32:e49; Tan PH. et al. (2005) Gene Ther. 12:59-66; Makimura H. et al. (2002) BMC Neuroscience. =Neurosci. 3:18; Shishkina G. et al. (2004) Neuroscience 129:521-528; Thakker ER. et al. (2004) Proc. Nat. Acad. Sci. USA 101:17270-17275; Akaneya Y. et al. (2005) J. Neurophysiol 93:594-602), and local delivery to the lungs by intranasal administration (Howard KA. et al. (2006) Mol. Ther. 14:476-484; Zhang X. et al. (2004) J. Biol. Chem. 279:10677-10684; Bitko V. et al. (2005) Nat. Med. 11:50-55). For systemic administration of iRNA for the treatment of disease, the RNA can be modified or alternatively delivered using a drug delivery system; these two methods are used to prevent the rapid degradation of dsRNA caused by endonucleases and exonucleases in vivo. Modification of RNA or drug carriers can also allow iRNA compositions to target target tissues and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, iRNA for ApoB conjugated with lipophilic cholesterol moieties is systemically injected into mice and causes apoB mRNA knockdown in both liver and jejunum (Soutschek J. et al. (2004) Nature 432: 173-178). It has been shown that the conjugation of iRNA to aptamers inhibits tumor growth and mediates tumor regression in a mouse model of prostate cancer (McNamara JO. et al. (2006) Nature Biotechnology (Nat.Biotechnol.) 24: 1005-1015). In alternative embodiments, iRNA can be delivered using a drug delivery system such as nanoparticles, dendrimers, polymers, liposomes or cationic delivery systems. Positively charged cationic delivery systems promote the binding of (negatively charged) iRNA molecules and also enhance interactions at negatively charged cell membranes to allow efficient uptake of iRNA by cells.Cationic lipids, dendrimers or polymers can either bind to the iRNA or induce the formation of vesicles or micelles that encapsulate the iRNA (see, e.g., Kim SH et al. (2008) Journal of Controlled Release 129(2): 107-116). The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for preparing and administering cationic-iRNA complexes are within the capabilities of those skilled in the art (see, e.g., Sorensen DR. et al. (2003) J. Mol. Biol 327: 761-766; Verma UN. et al. (2003) Clin. Cancer Res. 9: 1291-1300; Arnold AS et al. (2007) J. Hypertens. 25: 197-205, the references are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNA include DOTAP (Sorensen DR. et al. (2003), supra; Verma UN. et al. (2003), supra), Oligofectamine "solid nucleic acid lipid particles" (Zimmermann TS. et al. (2006) Nature 441: 111-114), cardiolipin (Chien PY. et al. (2005) Cancer Gene Ther. 12: 321-328; Pal A. et al. (2005) Int Oncology 12: 331-332. (J. Oncol.) 26: 1087-1091), polyethylene imine (Bonnet ME et al. (2008) Pharm. Res. Aug. 16, electronic preprint; Aigner A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptide (Liu S. (2006) Mol. Pharm. 3: 472-487), and polyamidoamines (Tomalia DA et al. (2007) Biochem. Soc. Trans. 35: 61-67; Yoo H et al. (1999) Pharm. Res. 16: 1799-1804). In some embodiments, the iRNA forms a complex with a cyclodextrin for systemic administration.Methods for administering pharmaceutical compositions of iRNA and cyclodextrin can be found in U.S. Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

[0668] A. Vector-Encoded iRNA of the Invention

[0669] iRNAs targeting the C5 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture A. et al. TIG. (1996), 12: 5-10; Skillern A. et al., International PCT Publication No. WO 00 / 22113; Conrad, International PCT Publication No. WO 00 / 22114 and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or persistent (weeks to months or longer) depending on the specific construct used and the target tissue or cell type. These transgenes can be introduced as linear constructs, circular plasmids, or viral vectors that can be integrating or non-integrating vectors. The transgene can also be constructed to allow it to be inherited as an extrachromosomal plasmid (Gassmann et al. Proc. Natl. Acad. Sci. USA (1995) 92: 1292).

[0670] Single chain or multiple chains of iRNA can be transcribed from the promoter on the expression vector.When two independent chains are to be expressed to produce, for example, dsRNA, two independent expression vectors can be introduced (for example, by transfection or infection) into the target cell.Alternately, each independent chain of dsRNA can be transcribed by the promoter all being located on the same expression plasmid.In one embodiment, dsRNA is expressed as the inverted repeat polynucleotide connected by a kind of joint polynucleotide sequence, so that the dsRNA has a stem-loop structure.

[0671] iRNA expression vector is DNA plasmid or viral vector normally.Expression vector compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to produce the recombinant construct for expressing iRNA as described herein.Eukaryotic cell expression vector is well known in the art and available from many commercial sources.Typically, this type of vector containing suitable restriction sites for inserting the nucleic acid segment of hope is provided.The delivery of iRNA expression vector can be systemic, as given intravenously or intramuscularly, by giving to the target cell then reintroduced into the patient from the patient's explantation, or by allowing any other means to be introduced into the target cell of hope.

[0672] iRNA expression plasmids can be transfected into target cells as a vector with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO TM). The present invention also contemplates multiple lipid transfections for iRNA-mediated knockdown of different regions of the targeted target RNA over a period of one week or longer. Successful introduction of the vector into the host cell can be monitored using a variety of known methods. For example, transient transfection can be signaled using a reporter gene, such as a fluorescent marker, such as green fluorescent protein (GFP). Markers can be used to ensure stable transfection of cells in vitro, which provide transfected cells with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0673] Viral vector systems that can be used with the methods and compositions described herein include, but are not limited to (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated viral vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) poxvirus vectors such as orthopoxviruses, such as vaccinia virus vectors or avian pox viruses, such as canary pox or fowl pox; and (j) helper-dependent or empty-shelled adenoviruses. Replication-defective viruses can also be advantageous. Different vectors will or will not be incorporated into the genome of the cell. If desired, the construct can contain viral sequences for transfection. Alternatively, the construct can be incorporated into a vector capable of episomal replication (e.g., EPV and EBV vectors). Constructs for recombinant expression of iRNAs will generally require regulatory elements, such as promoters, enhancers, etc., to ensure expression of the iRNA in the target cell. Additional aspects to consider for vectors and constructs are described further below.

[0674] Vectors useful for delivering iRNA will include regulatory elements (promoters, enhancers, etc.) sufficient to express the iRNA in the desired target cells or tissues. Regulatory elements can be selected to provide constitutive or regulated / inducible expression.

[0675] The expression of iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8: 20-24). Such inducible expression systems suitable for controlling dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). Those skilled in the art will be able to select appropriate regulatory / promoter sequences based on the intended use of the iRNA transgene.

[0676] Viral vectors containing the nucleotide sequence encoding iRNA can be used.For example, retroviral vectors can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain components necessary for the correct packaging of viral genome and integration into host cell DNA. The nucleotide sequence encoding iRNA is cloned into one or more vectors that promote the delivery of the nucleic acid into the patient. More details about retroviral vectors can be found, for example, in Bosen et al., Biotherapy 6:291-302 (1994), which describes a retroviral vector that delivers the mdrl gene to hematopoietic stem cells to prepare stem cells that are more resistant to chemotherapy. Other references describing the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, HIV-based vectors described in U.S. Pat. Nos. 6,143,520; 5,665,557 and 5,981,276, which are incorporated herein by reference.

[0677] It is also contemplated that adenovirus is used in the delivery of the iRNA of the present invention. Adenovirus is a particularly attractive vehicle, for example for delivering genes to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium, where they cause mild disease. Other targets of adenovirus-based delivery systems are the liver, central nervous system, endothelial cells, and muscle. Adenovirus has the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, New Perspectives in Genetics and Development 3: 499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5: 3-10 (1994) demonstrate the use of adenovirus vectors to transfer genes to the respiratory epithelium of rhesus monkeys. Other examples of the use of adenovirus in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., Journal of Clinical Invest. 91:225-234 (1993); PCT Publication WO 94 / 12649 and Wang et al., Gene Therapy 2:775-783 (1995). Suitable AV vectors for expressing iRNAs embodied in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Xia H et al. (2002), Nature Biotechnology 20:1006-1010.

[0678] Adeno-associated virus (AAV) vectors can also be used to deliver the iRNA of the invention (Walsh et al., Proc. Soc, Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, a U6 or H1 RNA promoter or a cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA embodied in the present invention, methods for constructing recombinant AV vectors, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61:3096-3101; Fisher KJ et al. (1996), J. Virol. 70:520-532; Samulski R et al. (1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94 / 13788 and International Patent Application No. WO 93 / 24641, the entire disclosures of which are incorporated herein by reference.

[0679] Another viral vector suitable for delivery of the iRNA of the invention is a poxvirus such as vaccinia virus, for example, attenuated vaccinia, like modified Ankara virus (MVA) or NYVAC; avipox virus, such as fowlpox or canarypox.

[0680] The tropism of viral vectors can be modified by pseudotyping these vectors with envelope proteins or other surface antigens from other viruses, or by replacing different viral capsid proteins as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, etc. AAV vectors can be made to target different cells by engineering vectors to express different capsid protein serotypes; see, e.g., Rabinowitz JE et al. (2002), Journal of Virology 76: 791-801, the entire disclosure of which is incorporated herein by reference.

[0681] The pharmaceutical preparation of the vector may include the vector in an acceptable diluent, or may include a slow-release matrix in which the gene delivery vehicle is embedded. Alternatively, when the complete gene delivery vector can be produced intact from recombinant cells, such as retroviral vectors, the pharmaceutical preparation may include one or more cells that produce the gene delivery system.

[0682] V. Pharmaceutical Compositions of the Invention

[0683] The present invention also includes pharmaceutical compositions and formulations comprising the iRNA of the present invention. In one embodiment, provided herein is a pharmaceutical composition comprising an iRNA as described herein and a pharmaceutically acceptable carrier.

[0684] The phrase "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0685] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium talc, calcium or zinc stearate, or stearic acid), or solvent encapsulating material (involved in carrying or transporting the subject compound from one organ or part of the body to another organ or part of the body). Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject being treated. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as propylene glycol and polyols. (1) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids; (23) serum components, such as serum albumin, HDL and LDL; and (24) other non-toxic compatible substances used in pharmaceutical formulations.

[0686] Pharmaceutical compositions containing iRNA are useful for treating diseases or conditions associated with the expression or activity of the C5 gene, such as diseases associated with complement component C5. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration by parenteral delivery, such as subcutaneous (SC) or intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, such as by continuous pump infusion, for example, by infusion into the brain. These pharmaceutical compositions of the present invention can be given at a dose sufficient to inhibit the expression of the C5 gene. Typically, the suitable dosage of the iRNA of the present invention will be within the range of about 0.001 to about 200.0 mg / kg body weight of the recipient per day, typically within the range of about 1 mg to 50 mg / kg body weight per day. For example, the dsRNA can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg kg, about 40 mg / kg, or about 50 mg / kg per single dose.

[0687] For example, it can be about 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8 mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1 mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / k In some embodiments, the dsRNA is administered at a dosage of about 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg, 10 mg / kg,

[0688] In another embodiment, the dosage form is about 0.1 mg / kg to about 50 mg / kg, about 0.25 mg / kg to about 50 mg / kg, about 0.5 mg / kg to about 50 mg / kg, about 0.75 mg / kg to about 50 mg / kg, about 1 mg / kg to about 50 mg / kg, about 1.5 mg / kg to about 50 mg / kg, about 2 mg / kg to about 50 mg / kg, about 2.5 mg / kg to about 50 mg / kg, about 3 mg / kg to about 50 mg / kg, about 3.5 mg / kg to about 50 mg / kg, about 4 mg / kg to about 50 mg / kg, about 4.5 mg / kg to about 50 mg / kg, about 5 mg / kg to about 50mg / kg, about 7.5mg / kg to about 50mg / kg, about 10mg / kg to about 50mg / kg, about 15mg / kg to about 50mg / kg, about 20mg / kg to about 50mg / kg, about 20mg / kg to about 50mg / kg, about 25mg / kg to about 50mg / kg, about 25mg / kg to about 50mg / kg, about 30mg / kg to about 50mg / kg, about 35mg / kg to about 50mg / kg, about 40mg / kg to about 50mg / kg, about 45mg / kg to about 50mg / kg, about 0.1mg / kg to about 45mg / kg, about 0.25mg / kg to about 45mg / kg, about 0.5 mg / kg to about 45 mg / kg, about 0.75 mg / kg to about 45 mg / kg, about 1 mg / kg to about 45 mg / kg, about 1.5 mg / kg to about 45 mg / kg, about 2 mg / kg to about 45 mg / kg, about 2.5 mg / kg to about 45 mg / kg, about 3 mg / kg to about 45 mg / kg, about 3.5 mg / kg to about 45 mg / kg, about 4 mg / kg to about 45 mg / kg, about 4.5 mg / kg to about 45 mg / kg, about 5 mg / kg to about 45 mg / kg, about 7.5 mg / kg to about 45 mg / kg, about 10 mg / kg to about 45 mg / kg, about 15 mg / kg to about 45 mg / kg, about 20 mg / kg to about 45 mg / kg, about 20 mg / kg to about 45 mg / kg, about 25 mg / kg to about 45 mg / kg, about 25 mg / kg to about 45 mg / kg, about 30 mg / kg to about 45 mg / kg, about 35 mg / kg to about 45 mg / kg, about 40 mg / kg to about 45 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.25 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 40 mg / kg, about 0.75 mg / kg to about 40 mg / kg, about 1 mg / kg to about 40 mg / kg, about 1.5 mg / kg to about 40 mg / kg, about 2 mg / kg to about 40 mg / kg, about 2.5 mg / kg to about 40 mg / kg, about 3 mg / kg to about 40 mg / kg, about 3.5 mg / kg to about 40 mg / kg, about 4 mg / kg to about 40 mg / kg, about 4.5 mg / kg to about 40 mg / kg, about 5 mg / kg to about 40 mg / kg, about 7.5 mg / kg to about 40 mg / kg, about 10 mg / kg to about 40 mg / kg, about 15 mg / kg to about 40 mg / kg, about 20 mg / kg to about 40 mg / kg, about 25 mg / kg g to about 40 mg / kg, about 25 mg / kg to about 40 mg / kg, about 30 mg / kg to about 40 mg / kg, about 35 mg / kg to about 40 mg / kg, about 0.1 mg / kg to about 30 mg / kg, about 0.25 mg / kg to about 30 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.75 mg / kg to about 30 mg / kg, about 1 mg / kg to about 30 mg / kg, about 1.5 mg / kg to about 30 mg / kg, about 2 mg / kg to about 30 mg / kg, about 2.5 mg / kg to about 30 mg / kg, about 3 mg / kg to about 30 mg / kg, about 3.5 mg / kg to about 30 mg / kg. kg to about 30 mg / kg, about 4 mg / kg to about 30 mg / kg, about 4.5 mg / kg to about 30 mg / kg, about 5 mg / kg to about 30 mg / kg, about 7.5 mg / kg to about 30 mg / kg, about 10 mg / kg to about 30 mg / kg, about 15 mg / kg to about 30 mg / kg, about 20 mg / kg to about 30 mg / kg, about 20 mg / kg to about 30 mg / kg, about 25 mg / kg to about 30 mg / kg, about 0.1 mg / kg to about 20 mg / kg, about 0.25 mg / kg to about 20 mg / kg, about 0.5 mg / kg to about 20 mg / kg, about 0.75 mg / kg The dsRNA is administered at a dosage of about 1 mg / kg to about 20 mg / kg, about 1 mg / kg to about 20 mg / kg, about 1.5 mg / kg to about 20 mg / kg, about 2 mg / kg to about 20 mg / kg, about 2.5 mg / kg to about 20 mg / kg, about 3 mg / kg to about 20 mg / kg, about 3.5 mg / kg to about 20 mg / kg, about 4 mg / kg to about 20 mg / kg, about 4.5 mg / kg to about 20 mg / kg, about 5 mg / kg to about 20 mg / kg, about 7.5 mg / kg to about 20 mg / kg, about 10 mg / kg to about 20 mg / kg, or about 15 mg / kg to about 20 mg / kg. Values ​​and ranges intermediate to these recited values ​​are also intended to be part of the present invention.

[0689] For example, the dsRNA can be administered at a dose of about 0.01 mg / kg, 0.02 mg / kg, 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.06 mg / kg, 0.07 mg / kg, 0.08 mg / kg, 0.09 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg or about 10 mg / kg.Values ​​and ranges intermediate to these recited values ​​are also intended to be part of the present invention.

[0690] In another embodiment, the dosage is about 0.5 mg / kg to about 50 mg / kg, about 0.75 mg / kg to about 50 mg / kg, about 1 mg / kg to about 50 mg / kg, about 1.5 mg / kg to about 50 mg / kg, about 2 mg / kg to about 50 mg / kg, about 2.5 mg / kg to about 50 mg / kg, about 3 mg / kg to about 50 mg / kg, about 3.5 mg / kg to about 50 mg / kg, about 4 mg / kg to about 50 mg / kg, about 4.5 mg / kg to about 50 mg / kg, about 5 mg / kg to about 50 mg / kg, about 7.5 mg / kg to about 50 mg / kg, about 10 mg / kg to about 50 mg / kg, about 15mg / kg to about 50mg / kg, about 20mg / kg to about 50mg / kg, about 20mg / kg to about 50mg / kg, about 25mg / kg to about 50mg / kg, about 25mg / kg to about 50mg / kg, about 30mg / kg to about 50mg / kg, about 35mg / kg to about 50mg / kg, about 40mg / kg to about 50mg / kg, about 45mg / kg to about 50mg / kg, about 0.5mg / kg to about 45mg / kg, about 0.75mg / kg to about 45mg / kg, about 1mg / kg to about 45mg / kg, about 1.5mg / kg to about 45mg / kg, about 2mg / kg to about 45m g / kg, about 2.5 mg / kg to about 45 mg / kg, about 3 mg / kg to about 45 mg / kg, about 3.5 mg / kg to about 45 mg / kg, about 4 mg / kg to about 45 mg / kg, about 4.5 mg / kg to about 45 mg / kg, about 5 mg / kg to about 45 mg / kg, about 7.5 mg / kg to about 45 mg / kg, about 10 mg / kg to about 45 mg / kg, about 15 mg / kg to about 45 mg / kg, about 20 mg / kg to about 45 mg / kg, about 20 mg / kg to about 45 mg / kg, about 25 mg / kg to about 45 mg / kg, about 25 mg / kg to about 45 mg / kg, about 30 mg / kg to about 45 mg / kg, about 35 mg / kg to about 45 mg / kg, about 40 mg / kg to about 45 mg / kg, about 0.5 mg / kg to about 40 mg / kg, about 0.75 mg / kg to about 40 mg / kg, about 1 mg / kg to about 40 mg / kg, about 1.5 mg / kg to about 40 mg / kg, about 2 mg / kg to about 40 mg / kg, about 2.5 mg / kg to about 40 mg / kg, about 3 mg / kg to about 40 mg / kg, about 3.5 mg / kg to about 40 mg / kg, about 4 mg / kg to about 40 mg / kg, about 4.5 mg / kg to about 40 mg / kg, about 5 mg / kg to about 40 mg / kg, about 7.5mg / kg to about 40mg / kg, about 10mg / kg to about 40mg / kg, about 15mg / kg to about 40mg / kg, about 20mg / kg to about 40mg / kg, about 20mg / kg to about 40mg / kg, about 25mg / kg to about 40mg / kg, about 25mg / kg to about 40mg / kg, about 30mg / kg to about 40mg / kg, about 35mg / kg to about 40mg / kg, about 0.5mg / kg to about 30mg / kg, about 0.7 5mg / kg to about 30mg / kg, about 1mg / kg to about 30mg / kg, about 1.5mg / kg to about 30mg / kg, about 2mg / kg to about 30mg / kg, about 2.5mg / kg to about 30mg / kg, about 3mg / kg to about 30mg / kg, about 3.5mg / kg to about 30mg / kg, about 4mg / kg to about 30mg / kg, about 4.5mg / kg to about 30mg / kg, about 5mg / kg to about 30mg / kg, about 7.5mg / kg to about 30mg / kg, about 8.5mg / kg to about 30mg / kg, about 10.5mg / kg to about 30mg / kg, about 15.5mg / kg to about 30mg / kg, about 16.5mg / kg to about 30mg / kg, about 18.5mg / kg to about 30mg / kg, about 19.5mg / kg to about 30mg / kg, about 20.5mg / kg to about 30mg / kg, about 21.5mg / kg to about 30mg / kg, about 24.5mg / kg to about 30mg / kg, about 26.5mg / kg to about 30mg / kg, about 28.5mg / kg to about 30mg / kg kg to about 30 mg / kg, about 10 mg / kg to about 30 mg / kg, about 15 mg / kg to about 30 mg / kg, about 20 mg / kg to about 30 mg / kg, about 20 mg / kg to about 30 mg / kg, about 25 mg / kg to about 30 mg / kg, about 0.5 mg / kg to about 20 mg / kg, about 0.75 mg / kg to about 20 mg / kg, about 1 mg / kg to about 20 mg / kg, about 1.5 mg / kg to about 20 mg / kg, about 2 mg / kg to about 30 mg / kg. The dsRNA is administered at a dose of about 20 mg / kg, about 2.5 mg / kg to about 20 mg / kg, about 3 mg / kg to about 20 mg / kg, about 3.5 mg / kg to about 20 mg / kg, about 4 mg / kg to about 20 mg / kg, about 4.5 mg / kg to about 20 mg / kg, about 5 mg / kg to about 20 mg / kg, about 7.5 mg / kg to about 20 mg / kg, about 10 mg / kg to about 20 mg / kg, or about 15 mg / kg to about 20 mg / kg. In one embodiment, the dsRNA is administered at a dose of about 10 mg / kg to about 30 mg / kg. Values ​​and ranges intermediate to these recited values ​​are also intended to be part of the invention.

[0691] Lastly, it is possible to generate a genetically modified iRNA, which can be used to generate a small amount of iRNA 0.1mg / kg、0.125mg / kg、0.15mg / kg、0 .175mg / kg、0.2mg / kg、0.225mg / kg、0.25mg / kg、0.275mg / kg、0.3mg / kg、0.3 25mg / kg、0.35mg / kg、0.375mg / kg、0.4mg / kg、0.425mg / kg、0.45mg / kg、0.4 75mg / kg、0.5mg / kg、0.525mg / kg、0.55mg / kg、0.575mg / kg、0.6mg / kg、0.625 mg / kg、0.65mg / kg、0.675mg / kg、0.7mg / kg、0.725mg / kg、0.75mg / kg、0.775 mg / kg、0.8mg / kg、0.825mg / kg、0.85mg / kg、0.875mg / kg、0.9mg / kg、0.925mg / kg、0.95mg / kg、0.975mg / kg、1mg / kg、1.1mg / kg、1.2mg / kg、1.3mg / kg、1.4 mg / kg、1.5mg / kg、1.6mg / kg、1.7mg / kg、1.8mg / kg、1.9mg / kg、2mg / kg、2.1mg / kg、2.2mg / kg、2.3mg / kg、2.4mg / kg、2.5mg / kg、2.6mg / kg、2.7mg / kg、2.8m g / kg、2.9mg / kg、3mg / kg、3.1mg / kg、3.2mg / kg、3.3mg / kg、3.4mg / kg、3.5mg / kg、3.6mg / kg、3.7mg / kg、3.8mg / kg、3.9mg / kg、4mg / kg、4.1mg / kg、4.2mg / k g、4.3mg / kg、4.4mg / kg、4.5mg / kg、4.6mg / kg、4.7mg / kg、4.8mg / kg、4.9mg / kg g、5mg / kg、5.1mg / kg、5.2mg / kg、5.3mg / kg、5.4mg / kg、5.5mg / kg、5.6mg / kg 、5.7mg / kg、5.8mg / kg、5.9mg / kg、6mg / kg、6.1mg / kg、6.2mg / kg、6.3mg / kg、6 .4mg / kg、6.5mg / kg、6.6mg / kg、6.7mg / kg、6.8mg / kg、6.9mg / kg、7mg / kg、7. 1mg / kg、7.2mg / kg、7.3mg / kg、7.4mg / kg、7.5mg / kg、7.6mg / kg、7.7mg / kg、7.8mg / kg、7.9mg / kg、8mg / kg、8.1mg / kg、8.2mg / kg、8.3mg / kg、8.4mg / kg、8.5mg / kg、8.6mg / kg、8.7mg / kg、8.8mg / kg 、8.9mg / kg、9mg / kg、9.1mg / kg、9.2mg / kg、9.3mg / kg、9.4mg / kg、9.5mg / kg、9.6mg / kg、9.7mg / kg、9.8mg / kg、9.9mg / kg、10mg / kg、10.5mg / kg、11mg / kg、11.5mg / kg、12mg / kg、12.5mg / kg、13mg / kg、13.5mg / kg、14mg / kg、14.5mg / kg、 15mg / kg、15.5mg / kg、16mg / kg、16.5mg / kg、17mg / kg、17.5mg / kg、18mg / kg、18.5mg / kg、19mg / kg、19.5mg / kg、20mg / kg、20.5mg / kg、21mg / kg、21.5mg / kg、22mg / kg、22.5mg / kg、23mg / kg、23.5mg / kg、24mg / kg、24.5mg / kg、25mg / kg、2 5.5mg / kg、26mg / kg、26.5mg / kg、27mg / kg、27.5mg / kg、28mg / kg、28.5mg / kg、29mg / kg、29.5mg / kg、30mg / kg、31mg / kg、32mg / kg、33mg / kg、34mg / kg、34mg / kg、35mg / kg、36mg / kg、37mg / kg、38mg / kg、39mg / kg、40mg / kg、41mg / kg、42m g / kg、43mg / kg、44mg / kg、45mg / kg、46mg / kg、47mg / kg、48 mg / kg and 49mg / kg dose of 50mg / kg.

[0692] In some embodiments, multiple doses of a therapeutic amount of an iRNA are administered to a subject, e.g., subcutaneously or intravenously, such as about 0.1 mg / kg, 0.125 mg / kg, 0.15 mg / kg, 0.175 mg / kg, 0.2 mg / kg, 0.225 mg / kg, 0.25 mg / kg, 0.275 mg / kg, 0.3 mg / kg, 0.325 mg / kg, 0.35 mg / kg, 0.375 mg / kg, 0.4 mg / kg, 0.425 mg / kg, 0.45 mg / kg, 0.475 mg / kg, 0.5 mg / kg, 0.525 mg / kg, 0.55 mg / kg, 0.575 mg / kg, 0.6 mg / kg g, 0.625mg / kg, 0.65mg / kg, 0.675mg / kg, 0.7mg / kg, 0.725mg / kg, 0.75mg / kg, 0.775mg / kg, 0.8mg / kg, 0.825mg / kg, 0.85mg / kg, 0.875mg / kg, 0.9mg / kg , 0.925mg / kg, 0.95mg / kg, 0.975mg / kg, 1mg / kg, 1.1mg / kg, 1.2mg / kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / k g, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6 .3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9 .8mg / kg, 9.9mg / kg, 10mg / kg, 10.5mg / kg, 11mg / kg, 11.5mg / kg, 12mg / kg, 12.5mg / kg, 13mg / kg, 13.5mg / kg, 14m g / kg, 14.5mg / kg, 15mg / kg, 15.5mg / kg, 16mg / kg, 16.5mg / kg, 17mg / kg, 17.5mg / kg, 18mg / kg, 18.5mg / kg, 19mg / k g, 19.5mg / kg, 20mg / kg, 20.5mg / kg, 21mg / kg, 21.5mg / kg, 22mg / kg, 22.5mg / kg, 23mg / kg, 23.5mg / kg, 24mg / kg, 24.5mg / kg, 25mg / kg, 25.5mg / kg, 26mg / kg, 26.5mg / kg, 27mg / kg, 27.5mg / kg, 28mg / kg, 28.5mg / kg, 29mg / kg, 29 .5mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg or about 50mg / kg. Multiple dose regimens can include daily administration of a therapeutic amount of the iRNA, such as for two, three, four, five, six, seven or more days. .

[0693] In other embodiments, repeated doses of a therapeutic amount of the iRNA, such as about 0.1 mg / kg, 0.125 mg / kg, 0.15 mg / kg, 0.175 mg / kg, 0.2 mg / kg, 0.225 mg / kg, 0.25 mg / kg, 0.275 mg / kg, 0.3 mg / kg, 0.325 mg / kg, 0.35 mg / kg, 0.375 mg / kg, 0.4 mg / kg, 0.425 mg / kg, 0.45 mg / kg, 0.475 mg / kg, 0.5 mg / kg, 0.525 mg / kg, 0.55 mg / kg, 0.575 mg / kg, 0.6 mg / kg, are administered to the subject, for example, subcutaneously or intravenously. g, 0.625mg / kg, 0.65mg / kg, 0.675mg / kg, 0.7mg / kg, 0.725mg / kg, 0.75mg / kg, 0.775mg / kg, 0.8mg / kg, 0.825mg / kg, 0.85mg / kg, 0.875mg / kg, 0.9mg / kg , 0.925mg / kg, 0.95mg / kg, 0.975mg / kg, 1mg / kg, 1.1mg / kg, 1.2mg / kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / k g, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6 .3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9 .8mg / kg, 9.9mg / kg, 10mg / kg, 10.5mg / kg, 11mg / kg, 11.5mg / kg, 12mg / kg, 12.5mg / kg, 13mg / kg, 13.5mg / kg, 14m g / kg, 14.5mg / kg, 15mg / kg, 15.5mg / kg, 16mg / kg, 16.5mg / kg, 17mg / kg, 17.5mg / kg, 18mg / kg, 18.5mg / kg, 19mg / k g, 19.5mg / kg, 20mg / kg, 20.5mg / kg, 21mg / kg, 21.5mg / kg, 22mg / kg, 22.5mg / kg, 23mg / kg, 23.5mg / kg, 24mg / kg, 24.5mg / kg, 25mg / kg, 25.5mg / kg, 26mg / kg, 26.5mg / kg, 27mg / kg, 27.5mg / kg, 28mg / kg, 28.5mg / kg, 29mg / kg, 29 .5mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg or about 50mg / kg. Repeated dosage regimens can include administering therapeutic amounts of the iRNA on a regular basis, such as every other day, every other day, every third day, twice a week, once a week, every other week, or once a month. .

[0694] Pharmaceutical composition can be given by intravenous infusion over a period of time, such as through 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 and 21,22,23,24 or about 25 minutes of cycle.Can for example repeat this giving on the basis of rule, such as weekly, every two weeks (i.e. every two weeks) continue one month, two months, three months, four months or longer.After initial treatment scheme, can be based on lower frequency to give treatment.For example give after continuing three months weekly or biweekly, give can be repeated once per month, continue six months or one year or longer.

[0695] The pharmaceutical composition can be given once a day, or the iRNA can be given twice, three times or more subdoses at appropriate intervals in one day, or even can be given by continuous infusion or delivery through a controlled release formulation. In the case, the iRNA included in each subdosage must be relatively smaller, so as to achieve a total daily dose. The dosage unit can also be compounded for delivery in a few days, for example, using a conventional sustained release formulation that provides a continuous iRNA release within a few days time frame. Sustained release formulations are well known in the art and are particularly useful for delivering agents at specific sites, and can be used with agents of the present invention thus. In this embodiment, the dosage unit comprises a plurality of corresponding daily doses.

[0696] In other embodiments, the pharmaceutical composition of a single dose can be long-lasting, so that subsequent doses are given at intervals of no more than 3, 4 or 5 days or at intervals of no more than 1, 2, 3 or 4 weeks. In some embodiments of the invention, a single dose of these pharmaceutical compositions of the invention are given once a week. In other embodiments of the invention, a single dose of these pharmaceutical compositions of the invention are given every two months.

[0697] Those skilled in the art will appreciate that certain factors may affect the dosage and time schedule required for effective treatment of a subject, including, but not limited to, the severity of the disease or condition, previous treatment, the subject's overall health and / or age, and other existing diseases. In addition, treatment of a subject with a therapeutically effective dose of the composition may include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of each iRNA encompassed by the present invention may be assessed using conventional methods or based on in vivo testing using appropriate animal models.

[0698] Advances in mouse genetics have produced many mouse models for studying different human diseases, such as conditions that would benefit from reduced C5 expression. Such models can be used for in vivo testing of iRNAs, as well as for determining therapeutically effective doses. Suitable mouse models are known in the art, and include, for example, collagen-induced arthritis mouse models (Courtenay JS et al. (1980) Nature 283, 666-668), myocardial ischemia (Homeister JW and Lucchesi BR (1994) Pharmacology and Toxicology Annual Review (Annu Rev Pharmacol Toxicol) 34: 17-40), ovalbumin-induced asthma mouse models (e.g., Tomkinson A. et al. (2001). Journal of Immunology (J. Immunol.) 166, 5792-5800), (NZB×NZW) F1, MRL / Fas lpr (MRL / lpr) and BXSB mouse models (Theofilopoulos AN and Kono DH 1999. Murine lupus models; gene-specific and genome-wide studies. In Lahita RG, ed., Systemic Lupus Erythematosus, 3rd ed., p. 145. Academic Press, San Diego, CA), mouse aHUS models (Goicoechea de Jorge et al., (2011) The development of atypical hemolytic uremic syndrome depends on complement C5. J Am Soc Nephrol 22: 137-145).

[0699] The pharmaceutical compositions of the invention can be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (e.g., by a transdermal patch); pulmonary, such as by inhalation or insufflation of a powder or aerosol, including by a nebulizer; intratracheal; intranasal; epidermal and transdermal; oral or parenteral. Parenteral administration includes intravenous, arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous, such as by an implantable device; or intracranial, such as by intraparenchymal, intrathecal or intraventricular administration.

[0700] iRNA can be delivered in such a way as to target a specific tissue, such as the liver (eg, hepatocytes of the liver).

[0701] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, water, powders or oil bases, thickeners, etc. may be necessary or desirable. Coated condoms, gloves, etc. may also be useful. Suitable topical formulations include those in which the iRNA embodied in the present invention is mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (e.g., dimyristoylphosphatidylglycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNA embodied in the present invention can be encapsulated in liposomes or can form complexes therewith, specifically with cationic liposomes. Alternatively, the iRNA can be complexed with lipids, specifically with cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, palmitic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, 1-monocaprin, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine or C 1-20 Alkyl esters (eg, isopropyl myristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof). Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0702] A. iRNA Formulations Containing Membrane Molecular Components

[0703] The iRNA used in these compositions and methods of the present invention can be formulated for delivery in a membranous molecular assembly such as a liposome or micelle. As used herein, the term "liposome" refers to a vesicle mainly composed of amphophilic lipids arranged in at least one double layer (e.g., a double layer or multiple double layers). Liposomes include unilamellar vesicles and multilamellar vesicles, which have a film formed from a lipophilic material and an aqueous interior. The aqueous portion contains the iRNA composition. The lipophilic material separates the aqueous interior from the aqueous exterior (although in some instances, it may include) that typically does not include the iRNA composition. Liposomes are useful for transferring active ingredients and delivering them to the site of action. Because the liposome membrane is structurally similar to a biomembrane, when liposomes are applied to tissues, the liposome double layer merges with the double layer of the cell membrane. As the merging of liposomes and cells proceeds, the internal aqueous inclusions including the iRNA are delivered to the cell, wherein the iRNA can specifically bind to the target RNA and can mediate RNAi. In some cases, the liposomes are also specifically targeted, for example, to direct the iRNA to a particular cell type.

[0704] Liposomes containing RNAi agents can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include chelates, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent formulation is then added to the micelle comprising the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form liposomes. After condensation, the detergent is removed, for example, by dialysis to obtain a liposome formulation of the RNAi agent.

[0705] If necessary, a carrier compound that assists condensation can be added during the condensation reaction, for example by controlled addition. For example, the carrier compound can be a polymer other than nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to facilitate condensation.

[0706] Methods for generating stable polynucleotide delivery vesicles that incorporate polynucleotide / cationic lipid complexes as structural components of the delivery vesicles are further described in, for example, WO 96 / 37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of the exemplary methods described in the following references: Feigner PL et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987; U.S. Pat. No. 4,897,355; U.S. Pat. No. 5,171,678; Bangham et al., M. Mot Biol. 23:238, 1965; Olson et al., Biochim. Biophys. Acta 557:9, 1979; Szoka et al., Proc. Natl. Acad. Sci. USA 75:4194, 1978; Mayhew et al., Biochim. Biophys. Acta 775:169, 1984; Kim et al., Biochim. Biophys. Acta 728:339, 1983; and Fukunaga et al., Endocrinol. 115:757, 1984. Common techniques for preparing lipid aggregates of appropriate size for use as delivery vesicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., Biochimica et Biophysica Sinica 58:161, 1986). When uniformly small (50 nm to 200 nm) and relatively uniform aggregates are desired, microfluidization can be used (Mayhew et al., Biochimica et Biophysica Sinica 775:169, 1984). These methods are easily adapted to encapsulate RNAi agent formulations into liposomes.

[0707] Liposomes are divided into two major categories. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid / liposome complex binds to the negatively charged nucleic acid / liposome complex and is internalized in the endosome. Due to the acidic pH in the endosome, the liposomes rupture, thereby releasing their contents into the cytoplasm (Wang et al., Biochemistry and Biophysics Research Communications, 1987, 147, 980-985).

[0708] pH-sensitive or negatively charged liposomes entrap nucleic acids without complexing with them. Since the nucleic acid and the lipid are similarly charged, repulsion rather than complexation occurs. However, certain nucleic acids are embedded within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cultured cell monolayers. Expression of exogenous genes was detected in target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0709] A main type of liposome composition comprises phospholipids except phosphatidylcholine of natural origin.For example neutral liposome composition can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC).Anionic liposome composition is usually formed from dimyristoylphosphatidylglycerol, and anionic fusogenic liposome is mainly formed from dioleoylphosphatidylethanolamine (DOPE).Another type of liposome composition is formed from phosphatidylcholine (PC), for example, as soybean PC and egg PC.Another type is formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0710] Examples of other methods for introducing liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94 / 00569; WO 93 / 24640; WO 91 / 16024; Figner, J. Biol. Chem. 269:2550, 1994; Nabel, P. A. S. A. 90:1 1307, 1993; Nabel, Hum. Gene Ther. 3:649, 1992; Gershon, Biol. Chem. 32:7143, 1993; and Strauss, EMBO J. 11:417, 1992.

[0711] Nonionic liposomal systems have also been examined to determine their use in delivering drugs to the skin, particularly systems comprising nonionic surfactants and cholesterol. TM I (Dilaurin / Cholesterol / Polyoxyethylene-10-stearyl ether) and Novasome TM A nonionic liposomal formulation of II (distearin / cholesterol / polyoxyethylene-10-stearyl ether) was used to deliver cyclosporin-A into the dermis of mouse skin. The results showed that such nonionic liposomal systems were effective in promoting the deposition of cyclosporin A into different layers of the skin (Hu et al., STP Pharma. Sci., 1994, 4 (6) 466).

[0712] Liposomes also include "sterically stabilized" liposomes, a term used herein to refer to liposomes that contain one or more specialized lipids that, when incorporated into the liposomes, result in an increased circulation life relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which a portion (A) of the vesicle-forming lipid portion of the liposomes contains one or more glycolipids, such as monosialoylganglioside G MlOr (B) those liposomes derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. While not wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelins, or PEG-derivatized lipids, the increased circulation half-life of these sterically stabilized liposomes is derived from reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0713] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoiilos et al. reported in Ann. NY Acad. Sci., 1987, 507, 64 that monosialoylganglioside G Ml , galactocerebroside sulfate and phosphatidylinositol to improve the blood half-life of liposomes. These findings were elaborated by Gabizon et al. (Proceedings of the National Academy of Sciences, 1988, 85, 6949). U.S. Patent No. 4,837,028 and WO 88 / 04924 to Allen et al. disclose a liposome containing (1) sphingomyelin and (2) ganglioside G Ml Liposomes containing sphingomyelin or galactocerebroside sulfate. U.S. Patent No. 5,543,152 (Webb et al.) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97 / 13499 (Lim et al.).

[0714] In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse to the cell membrane. Although non-cationic liposomes cannot fuse to the plasma membrane as effectively, they can be taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

[0715] Additional advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can bind a wide range of water- and lipid-soluble drugs; liposomes can protect RNAi agents encapsulated in their compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms", Lieberman, Rieger and Banker (Eds.), 1988, Vol. 1, p. 245). Important considerations in preparing liposome formulations are the lipid surface charge, vesicle size, and the aqueous volume of the liposomes.

[0716] The positively charged synthetic cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that spontaneously interact with nucleic acids to form lipid-nucleic acid complexes that are able to fuse with negatively charged lipids of the cell membranes of tissue culture cells to deliver RNAi agents (see, e.g., Figner PL et al., Proc. Natl. Acad. Sci. USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

[0717] The DOTMA analog 1,2-di(oleoyloxy)-3-(trimethylammonium)propane (DOTAP) can be used in combination with phospholipids to form DNA-complexed vesicles. TM (Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for delivering highly anionic nucleic acids to living tissue culture cells, which contain positively charged DOTMA liposomes that spontaneously interact with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge of the resulting complex is also positive. The positively charged complex prepared in this way spontaneously attaches to the negatively charged cell surface, fuses with the plasma membrane, and effectively delivers functional nucleic acids to, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-di(oleoyloxy)-3,3-(trimethylammonium) propane ("DOTAP") (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl moiety is connected by an ester rather than an ether bond.

[0718] Other reported cationic lipid compounds include those that have been conjugated to various moieties, including, for example, carboxyspermine, which has been conjugated to one of the two types of lipids, and include compounds such as 5-carboxyspermineglycine dioctaoleoylamide ("DOGS") (Transfectam TM , Promega (Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5-carboxyspermineamide ("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).

[0719] Another cationic lipid conjugate includes a derivative of lipid and cholesterol ("DC-Chol"), which is formulated into liposomes combined with DOPE (see, Gao X. and Huang L., Biochemistry and Biophysics Research Communications 179:280, 1991). It has been reported that lipid polylysine prepared by conjugating polylysine to DOPE is effective for transfection in the presence of serum (Zhou X. et al., Biochemistry and Biophysics Acta 1065:8, 1991). For some cell lines, these liposomes containing conjugated cationic lipids are said to show lower toxicity and provide more effective transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, California) and Lipofectamine (DOSPA) (Life Technologies, Gaithersburg, Maryland). Other cationic lipids suitable for delivery of oligonucleotides are described in WO 98 / 39359 and WO 96 / 37194.

[0720] Liposomal formulations are particularly suitable for topical administration, and liposomes present several advantages over other formulations. These advantages include: reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer RNAi agents into the skin. In some implementations, liposomes are used to deliver RNAi agents to epidermal cells and are also used to enhance the penetration of RNAi agents into dermal tissues, such as into the skin. For example, these liposomes can be applied topically. It has been documented that drugs formulated as liposomes are delivered topically to the skin (see, for example, Weiner et al., Journal of Drug Targeting, 1992, Vol. 2, 405-410 and du Plessis et al., Antiviral Research (Enzym. Res., 1992, 259-265; Mannino RJ and Fould-Fogerite S., Biotecimiques 6:682-690, 1988; Itani T. et al., Gene 56:267-276, 1987; Nicolau C. et al., Meth. Enz. 149:157-176, 1987; Straubinger M. and Papahadjobrilos D. Meth. Enzym. 101:512-527, 1983; Wang CY and Huang L., Proc. Natl. Acad. Sci. USA 84:7851-7855, 1987).

[0721] Nonionic liposome systems have also been examined to determine their use in delivering drugs to the skin, specifically systems comprising nonionic surfactants and cholesterol. Nonionic liposome formulations comprising Novasome I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver drugs to the dermis of mouse skin. Such formulations with RNAi agents are useful for treating dermatological disorders.

[0722] Liposomes including iRNA can be made highly deformable. This deformability can enable liposomes to penetrate through holes less than the average radius of the liposomes. For example, a transfersome is a type of deformable liposome. A transfersome can be made by adding a surface edge activator (usually a surfactant) to a standard liposome composition. A transfersome including an RNAi agent can be delivered, for example, by subcutaneous infection to deliver the RNAi agent to the keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of pores under the influence of a suitable transdermal gradient, each having a diameter less than 50nm. In addition, due to lipid properties, these transfersomes can be automatically optimized (suitable for the shape of the pores in the skin, for example), automatically repaired, and can often reach their target without breaking, and usually automatically loaded.

[0723] Other formulations suitable for the present invention are described in U.S. Provisional Application Serial No. 61 / 018,616 filed January 2, 2008; U.S. Provisional Application Serial No. 61 / 018,611 filed January 2, 2008; U.S. Provisional Application Serial No. 61 / 039,748 filed March 26, 2008; U.S. Provisional Application Serial No. 61 / 047,087 filed April 22, 2008; and U.S. Provisional Application Serial No. 61 / 051,528 filed May 8, 2008. PCT Application No. PCT / US2007 / 080331 filed October 3, 2007 also describes formulations suitable for the present invention.

[0724] Transfersomes are another type of liposomes, and are highly deformable lipid aggregates, which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets, which are highly deformable so that they can easily pass through holes smaller than the lipid droplets. Transfersomes can be suitable for environments where they are used, such as they are automatically optimized (shapes suitable for the pores in the skin), automatically repaired, often reach their targets without breaking, and usually automatically loaded. In order to prepare transfersomes, it is possible to add a surface edge activator (usually a surfactant) to a standard liposome composition. Transfersomes have been used to deliver serum albumin to the skin. It has been shown that the transfersome-mediated delivery of serum albumin is as effective as subcutaneous injection of a solution containing serum albumin.

[0725] Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes. The most common method for classifying and rating the properties of many different types of surfactants (both natural and synthetic) is by using the hydrophile / lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for classifying the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0726] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceutical and cosmetic products and can be used over a wide range of pH values, usually with HLB values ​​ranging from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glycerol esters, polyglycerol esters, sorbitan esters, sucrose esters and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated / propoxylated block polymers are also included in this category. Polyoxyethylene surfactants are the most commonly used members of the nonionic surfactant class.

[0727] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, amino acid acylamides, sulfates such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl glutathionse, acyl taurates and sulfosuccinates and phosphates. The most important members in the anionic surfactant category are alkyl sulfates and soaps.

[0728] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. These quaternary ammonium salts are the most commonly used members of this class.

[0729] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkyl amides, N-alkyl betaines, and phospholipids.

[0730] The use of surfactants in pharmaceutical products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0731] iRNA for use in the methods of the invention can also be provided as micellar formulations. "Micelles" are defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure such that all hydrophobic portions of the molecules are oriented inwardly, so that the hydrophilic portions are in contact with the surrounding water. If the environment is hydrophobic, the opposite arrangement exists.

[0732] Mixed micellar formulations suitable for transdermal membrane delivery can be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C 8 -C 22 The present invention relates to a method for preparing the micelles of the present invention. The micelles of the present invention are prepared by using alkali metal alkyl sulfates and micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxycholestyl glycine and pharmaceutically acceptable salts thereof, glycerol, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ether and analogs thereof, polyether alcohol alkyl ether and analogs thereof, chenodeoxycholate, deoxycholate and mixtures thereof. The micelle forming compounds can be added at the same time or after adding alkali metal alkyl sulfates. Mixed micelles can be formed with the mixing (but violent mixing) of these ingredients of substantially any kind to provide micelles of smaller size.

[0733] In one method, a first micellar composition is prepared, which comprises the siRNA composition and at least the alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micelle-forming compounds to form a mixed micellar composition. In another method, the micellar composition is prepared by mixing the siRNA composition, the alkali metal alkyl sulfate and at least one micelle-forming compound, and then adding the remaining micelle-forming compound (under vigorous mixing).

[0734] Phenol and / or m-cresol can be added to the mixed micellar composition to stabilize the formulation and prevent bacterial growth. Alternatively, phenol and / or m-cresol can be added along with the micelle forming ingredients. Isotonic agents, such as glycerol, can also be added after the mixed micellar composition is formed.

[0735] For the delivery of micellar formulations as sprays, the formulation can be loaded into an aerosol dispenser and the dispenser is filled with a propellant. The propellant (which is under pressure) is in liquid form in the dispenser. The ratio of the components is adjusted so that the aqueous phase and the propellant phase are integrated, i.e. there is one phase. If there are two phases, it is necessary to oscillate the dispenser before dispensing a portion of the contents, for example, through a metering valve. The dispensed amount of the pharmaceutical agent is propelled from the metering valve with a fine mist.

[0736] Propellants may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether, and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2 tetrafluoroethane) may be used.

[0737] The specific concentrations of these essential ingredients can be determined by relatively simple experimentation.For absorption via the oral cavity, it is often desirable to increase the dose for administration by injection or via the gastrointestinal tract, for example by at least two or three times.

[0738] B. Lipid particles

[0739] An iRNA (eg, dsRNA) of the invention can be fully encapsulated in a lipid formulation, such as an LNP or other nucleic acid-lipid particle.

[0740] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNP typically contains cationic lipids, non-cationic lipids and lipids (e.g., PEG-lipid conjugates) that prevent particle aggregation. LNP is particularly useful for systemic applications because they show extended circulation life after intravenous (intravenous (iv)) injection, and accumulate at distal sites (e.g., physically separated from the site of administration). LNP includes "pSPLP", which includes a condensing agent-nucleic acid complex of an encapsulation as cited in PCT Publication No. WO 00 / 03683. These particles of the present invention typically have an average diameter of about 50nm to about 150nm, more typically about 60nm to about 130nm, more typically about 70nm to about 110nm, most typically about 70nm to about 90nm, and are substantially nontoxic. In addition, when present in nucleic acid-lipid particles of the present invention, these nucleic acids are resistant to the degradation of nucleases in aqueous solution. Nucleic acid-lipid particles and methods of making them are disclosed, for example, in U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010 / 0324120 and PCT Publication No. WO 96 / 40964.

[0741] In one embodiment, the ratio of lipid to drug (mass / mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1: 1 to about 50: 1, from about 1: 1 to about 25: 1, from about 3: 1 to about 15: 1, from about 4: 1 to about 10: 1, from about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1. Ranges intermediate to the above-recited ranges are also contemplated as being part of the invention.

[0742] The cat...

Claims

1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement component C5 or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises at least 20 consecutive nucleotides of the nucleotide sequence 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ of SEQ ID NO: 113, wherein the dsRNA agent comprises at least one modified nucleotide, and wherein each strand is no more than 25 nucleotides in length.

2. The dsRNA agent according to claim 1 or a pharmaceutically acceptable salt thereof, wherein the antisense strand comprises the nucleotide sequence 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ of SEQ ID NO:

113.

3. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUUAUAAUA-3' of SEQ ID NO:

62.

4. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUUAUAAUA-3' of SEQ ID NO: 62, and the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

5. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand comprise a modification.

6. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein at least one of the modified nucleotides is selected from the group consisting of: 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, nucleotides containing 5'-thiophosphate groups, and terminal nucleotides attached to cholesterol derivatives or dodecanoic acid didecylamide groups.

7. The dsRNA agent or a pharmaceutically acceptable salt thereof according to claim 6, wherein the modified nucleotide comprises a short sequence of 3'-terminal deoxy-thymidine nucleotide (dT).

8. The dsRNA agent or a pharmaceutically acceptable salt thereof according to claim 1, wherein the length of the double-stranded region is 20-21 nucleotide pairs.

9. The dsRNA agent or a pharmaceutically acceptable salt thereof according to claim 8, wherein the length of the double-stranded region is 20 nucleotide pairs.

10. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein at least one strand comprises a 3' overhang of at least 1 nucleotide.

11. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein at least one strand comprises a 3' overhang of at least 2 nucleotides.

12. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, further comprising a ligand.

13. The dsRNA agent or pharmaceutically acceptable salt thereof of claim 12, wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent or pharmaceutically acceptable salt thereof.

14. The dsRNA agent of claim 12 or a pharmaceutically acceptable salt thereof, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

15. The dsRNA agent of claim 14 or a pharmaceutically acceptable salt thereof, wherein the ligand is 16. The dsRNA agent of claim 14 or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent is conjugated to the ligand as shown schematically below, And, wherein X is O or S.

17. The dsRNA agent of claim 16 or a pharmaceutically acceptable salt thereof, wherein X is O.

18. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the sense strand comprises the nucleotide sequence 5'-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3', and the antisense strand comprises the nucleotide sequence 5'-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3', wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C and U, respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U, respectively; dT is a deoxy-thymidine nucleotide; and s is a phosphorothioate linkage.

19. The dsRNA agent of claim 18 or a pharmaceutically acceptable salt thereof, further comprising a ligand.

20. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the double-stranded region has a length of 20-25 nucleotide pairs.

21. The dsRNA agent of claim 20 or a pharmaceutically acceptable salt thereof, wherein the double-stranded region has a length of 20-23 nucleotide pairs.

22. The dsRNA agent of claim 20 or a pharmaceutically acceptable salt thereof, wherein the double-stranded region has a length of 23-25 ​​nucleotide pairs.

23. The dsRNA agent of claim 20 or a pharmaceutically acceptable salt thereof, wherein the double-stranded region has a length of 21-23 nucleotide pairs.

24. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the sense strand is 21-23 nucleotides in length, and the antisense strand is 21-25 nucleotides in length.

25. The dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof, wherein the at least one modified nucleotide is selected from the group consisting of: LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, and combinations thereof.

26. The dsRNA agent of claim 25, or a pharmaceutically acceptable salt thereof, wherein the at least one modified nucleotide is 2'-O-methyl or 2'-fluoro modified.

27. The dsRNA agent of claim 12, or a pharmaceutically acceptable salt thereof, wherein the ligand is one or more GalNAc derivatives attached through a divalent or trivalent branched linker.

28. The dsRNA agent of claim 1, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

29. The dsRNA agent of claim 28, or a pharmaceutically acceptable salt thereof, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-terminus of one strand.

30. The dsRNA agent of claim 29, or a pharmaceutically acceptable salt thereof, wherein the strand is the antisense strand.

31. The dsRNA agent of claim 29, or a pharmaceutically acceptable salt thereof, wherein the strand is the sense strand.

32. The dsRNA agent of claim 28, or a pharmaceutically acceptable salt thereof, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-terminus of one strand.

33. The dsRNA agent of claim 32, or a pharmaceutically acceptable salt thereof, wherein the strand is the antisense strand.

34. The dsRNA agent of claim 32, or a pharmaceutically acceptable salt thereof, wherein the strand is the sense strand.

35. The dsRNA agent of claim 28, or a pharmaceutically acceptable salt thereof, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5'-end and the 3'-end of a strand.

36. The dsRNA agent of claim 35, or a pharmaceutically acceptable salt thereof, wherein the strand is the antisense strand.

37. An isolated cell comprising a dsRNA agent as described in any one of claims 1-36 or a pharmaceutically acceptable salt thereof, wherein the cell is not an embryonic stem cell or a germ cell.

38. A pharmaceutical composition for inhibiting the expression of complement component C5 gene, the composition comprising the dsRNA agent according to any one of claims 1 to 36 or a pharmaceutically acceptable salt thereof.

39. The pharmaceutical composition of claim 38, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is present in an unbuffered solution.

40. The pharmaceutical composition of claim 39, wherein the unbuffered solution is saline or water.

41. The pharmaceutical composition of claim 38, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is present in a buffer solution.

42. The pharmaceutical composition of claim 41, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof.

43. The pharmaceutical composition of claim 41, wherein the buffer solution is phosphate buffered saline (PBS).

44. A pharmaceutical composition comprising the dsRNA agent of claim 1 or a pharmaceutically acceptable salt thereof and a lipid formulation.

45. The pharmaceutical composition of claim 44, wherein the lipid formulation comprises a LNP.

46. ​​The pharmaceutical composition of claim 44, wherein the lipid formulation comprises a MC3.

47. Use of a dsRNA agent or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 36 or a pharmaceutical composition according to any one of claims 38 to 46 in the preparation of a medicament for treating a subject suffering from a hemolytic disorder.

48. The use of claim 47, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof or a pharmaceutical composition thereof causes a reduction in intravascular hemolysis, a stabilization of hemoglobin levels and / or a reduction in C5 protein in the subject.

49. The use of claim 47, wherein the hemolytic disorder is paroxysmal nocturnal hemoglobinuria (PNH).

50. The use of claim 47, wherein the hemolytic disorder is atypical hemolytic uremic syndrome (aHUS).

51. The use of claim 47, wherein the subject is a human.

52. The use of any one of claims 47-51, further comprising an anti-complement component C5 antibody or an antigen-binding fragment thereof.

53. The use of any one of claims 47-52, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for administration at a dose of 0.01 mg / kg to 10 mg / kg or 0.5 mg / kg to 50 mg / kg.

54. The use of claim 53, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is administered at a dose of 10 mg / kg to 30 mg / kg.

55. The use of claim 53, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is administered at a dose selected from the group consisting of: 0.5mg / kg 1mg / kg, 1.5mg / kg, 3mg / kg, 5mg / kg, 10mg / kg and 30mg / kg.

56. The use of claim 53, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for once-weekly administration.

57. The use of claim 53, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for administration twice a week.

58. The use of claim 53, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for twice monthly administration.

59. The use of any one of claims 47-58, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for subcutaneous administration.

60. The use of claim 47, further comprising measuring hemoglobin and / or LDH levels in the subject.

61. The use of claim 52, wherein the anti-complement component C5 antibody or antigen-binding fragment thereof is eculizumab.

62. Use of a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) agent or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating a subject suffering from a hemolytic disorder, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises at least 20 consecutive nucleotides of the nucleotide sequence 5′-UAUUAUAAAAAUAUCUUGCUUUU-3′ of SEQ ID NO: 113, wherein the dsRNA agent comprises at least one modified nucleotide, and wherein the length of each strand is no more than 25 nucleotides, The dsRNA agent or a pharmaceutically acceptable salt thereof is administered together with an anti-complement component C5 antibody or an antigen-binding fragment thereof.

63. The use of claim 62, wherein the sense strand comprises the nucleotide sequence 5'-AAGCAAGAUAUUUUUUAUAAUA-3' of SEQ ID NO: 62, and the antisense strand comprises the nucleotide sequence 5'-UAUUAUAAAAAUAUCUUGCUUUU-3' of SEQ ID NO:

113.

64. The use of claim 62, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand comprise a modification.

65. purposes as claimed in claim 64, wherein the nucleotide of at least one modification and / or the modification are selected from: 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides comprising non-natural bases, nucleotides comprising 5'-thiophosphate groups and terminal nucleotides connected to a cholesterol derivative or a dodecanoic acid didecylamide group.

66. The use of claim 65, wherein the modified nucleotide comprises a short sequence of 3'-terminal deoxy-thymidine nucleotide (dT).

67. The use of claim 62, wherein the double-stranded region is 17 nucleotide pairs in length.

68. The use of claim 62, wherein the double-stranded region is 17-23 nucleotide pairs in length, 17-25 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-23 nucleotide pairs in length, or 23-25 ​​nucleotide pairs in length.

69. The use of claim 68, wherein the double-stranded region is 21 nucleotide pairs in length.

70. The use of claim 62, wherein the sense strand is 21-23 nucleotides in length, and the antisense strand is 21-25 nucleotides in length.

71. The use of claim 62, wherein at least one strand comprises a 3' overhang of at least 1 nucleotide or at least 2 nucleotides.

72. The use of claim 62, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof further comprises a ligand.

73. The use of claim 72, wherein the ligand or a pharmaceutically acceptable salt thereof is conjugated to the 3' end of the sense strand of the dsRNA agent.

74. The use of claim 72, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

75. The use of claim 74, wherein the ligand is 76. The method of claim 74, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is conjugated to the ligand as shown schematically below: and wherein X is O or S.

77. The use of claim 76, wherein X is O.

78. Use of a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) agent or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating a subject suffering from a hemolytic disorder, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 2876, 5′-asasGfcAfaGfaUfAfUfuUfuuAfuAfaua-3′, and wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 2889, 5′-usAfsUfuAfuaAfaAfauaUfcUfuGfcuususudTdT-3′, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C and U, respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U, respectively; dT is a deoxy-thymidine nucleotide; and s is a phosphorothioate linkage, and The 3' end of the sense strand is conjugated to a ligand as shown in the following schematic diagram: Where X is O; The dsRNA agent or a pharmaceutically acceptable salt thereof is administered together with an anti-complement component C5 antibody or an antigen-binding fragment thereof.

79. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is present in an unbuffered solution.

80. The use of claim 79, wherein the unbuffered solution is saline or water.

81. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is present in a buffer solution.

82. The use of claim 81, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate or phosphate or any combination thereof.

83. The use of claim 81, wherein the buffer solution is phosphate buffered saline (PBS).

84. The use of claim 62 or 78, wherein the anti-complement component C5 antibody is eculizumab.

85. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof reduces intravascular hemolysis, stabilizes hemoglobin levels, and / or reduces C5 protein levels in the subject.

86. The use of claim 62 or 78, wherein the hemolytic disorder is paroxysmal nocturnal hemoglobinuria (PNH).

87. The use of claim 62 or 78, wherein the complement component C5-associated disease is atypical hemolytic uremic syndrome (aHUS).

88. The use of claim 62 or 78, wherein the subject is a human.

89. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof comprises a dose of 0.01 mg / kg to 10 mg / kg or 0.5 mg / kg to 50 mg / kg.

90. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for administration to the subject once a week, twice a week, or twice a month.

91. The use of claim 62 or 78, wherein the dsRNA agent or a pharmaceutically acceptable salt thereof is for subcutaneous administration.

Images