Antibodies specifically binding to B7-H3 and uses thereof

Abstract

The present invention relates to an anti-B7-H3 antibody that specifically binds to B7-H3 and its use, and more specifically, to an anti-B7-H3 antibody or an antigen-binding fragment thereof, a nucleic acid encoding the same, a vector comprising the nucleic acid, a cell transformed with the vector, a method for preparing the antibody or its antigen-binding fragment, an antibody-drug conjugate or a multispecific antibody comprising the same, a pharmaceutical composition comprising the same for preventing or treating cancer, autoimmune disease or inflammatory disease, or a composition comprising the same for diagnosing cancer, autoimmune disease or inflammatory disease. Since the anti-B7-H3 antibody or its antigen-binding fragment according to the present invention can bind to human and non-human B7-H3 with high affinity, and can flow into cells after binding, the anti-B7-H3 antibody or its antigen-binding fragment, the antibody-drug conjugate or multispecific antibody comprising the same can be effectively applied to the prevention or treatment or diagnosis of cancer or tumors, autoimmune diseases or inflammatory diseases.

Description

Technical Field

[0001] The present invention relates to an anti-B7-H3 antibody that specifically binds to B7-H3 and uses thereof, and more particularly, to an anti-B7-H3 antibody or an antigen-binding fragment thereof, a nucleic acid encoding the same, a vector comprising the nucleic acid, a cell transformed with the vector, a method for preparing the antibody or the antigen-binding fragment thereof, an antibody-drug conjugate or a multispecific antibody comprising the antibody or the antigen-binding fragment thereof, a pharmaceutical composition comprising the same for preventing or treating cancer, autoimmune diseases or inflammatory diseases, or a composition comprising the same for diagnosing cancer, autoimmune diseases or inflammatory diseases. Background Art

[0002] Our immune system is fine-tuned to effectively eliminate invading pathogens while maintaining tolerance to self-antigens. Among them, T lymphocytes are the main cells (Effector cells) that can eliminate tumor cells.

[0003] Immune checkpoints are co-signaling molecules that play an important role in the activity of T lymphocytes. They inhibit (inhibitory) or stimulate (stimulatory) TCR (T cell receptor) signals through regulation (Immunological reviews 2017, 276: 52-65).

[0004] As part of their attempt to evade immune surveillance, some tumor cells express ligand proteins of inhibitory immune checkpoint molecules on their cell surfaces, thereby hindering the function of T lymphocytes and causing changes in the tumor microenvironment, thereby suppressing immunity. Representative successful tumor immunotherapy includes CTLA-4 (cytotoxic T lymphocyte antigen-4) and PD-1 (programmed death-1) as inhibitory immune checkpoint molecules, B7.1 (CD80) and B7.2 (CD86) from the B7 family molecules as corresponding antigen-presenting cells and tumor cell ligands, and monoclonal antibody blockade of B7-H1 / PD-L1 (programmed death-ligand-1) (N Engl J Med., 2011, 364(26):2517-2526; N Engl J Med., 2012, 366(26):2455-2465; and N Engl J Med., 2013, 369(2):134-144).

[0005] B7-H3 (B7 homolog 3, or CD276 (cluster of differentiation 276)), as a member of the B7 family, has 20 to 30% structural homology with B7.1 (CD80), B7.2 (CD86), B7-H1 (PD-L1), B7-DC (PD-L2), B7-H2 (ICOSL), B7-H4 (B7S1, B7x, Vtcn1), B7-H5 (VISTA, GI24, Dies1, PD-1H), B7-H6 (NCR3LG1) and B7-H7 (HHLA2) (Blood 2013, 121(5): 734-744; and Molecular Cancer Therapeutics 2017, 16(7): 1203-1211), and is a systemic conserved protein with multiple biological functions. In 2001, when it was first discovered, it was introduced as a co-stimulatory molecule ligand (Nature Immunology 2001, 2(3): 269-274). However, according to recent research results, when it forms a complex with a ligand of a certain immunosuppressive receptor expressed on activated T cells or NK cells, it can negatively regulate antigen receptor signals (Eur J Immunol. 2009, 39(7): 1754-1764, etc.), and its binding partner is still unclear.

[0006] B7-H3 mRNA is present in various normal tissues, but protein is rarely expressed. When an immune activation signal is given, protein expression is induced in monocytes, macrophages or dendritic cells, etc., but it is overexpressed in various solid tumors, and expression is observed in prostate cancer, ovarian cancer, breast cancer, colon cancer, kidney cancer, non-small cell lung cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, neuroblastoma and other tumors (such as small round blue cell tumors of childhood). In human B7-H3, 4Ig-B7-H3 (IgV-IgC-IgV-IgC) is the main form, and 2Ig-B7-H3 is found in small amounts, while in mice (Murine), it is the 2Ig-B7-H3 form. However, both forms show similar functions (Genome Biol. 2005, 6: 233.1-233.7; Proceedings of the National Academy of Sciences of the United States of America (PNAS) 2008, 105(30): 10277-10278). 4Ig-B7-H3 can inhibit the anti-tumor effect of natural killer cells (Proceedings of the National Academy of Sciences of the United States of America 2004, 101(34): 12640-12645). It is speculated that the B7-H3 inhibitory signal is generated by interacting with molecules involved in TCR signal transduction (NF-kB, AP-1, NFAT, etc.), and inhibition of Th1 (helper T cells), Th2 or Th17 was observed in animal experiments (Journal of Immunology (J. Immunol.) 2004, 173: 2500-2506; Immunol. Rev. (Immunol.) 2009, 229 (1): 145-151).

[0007] B7-H3 protein expression is very limited in normal cells, but it is significantly increased in primary and metastatic tumors and tumor vasculature, and is found in most cell types including differentiated tumor cells, tumor initiating or cancer stem cells (Medicographia 2014, 36(2):285-292; Cancer cell 2017, 31:501-515). Its expression is closely related to poor prognosis in certain tumor types.

[0008] Various modified antibodies, including monoclonal antibodies against B7-H3, have been developed with promising therapeutic effects and are currently under clinical development (Medicographia 2014, 36(2):285-292).

[0009] Against this technical background, the inventors have developed an anti-B7-H3 antibody that has affinity and specific binding to human B7-H3 and non-human (e.g., macaque, mouse, rat, etc.) B7-H3, and have demonstrated that the antibody is introduced into cells after binding to cell surface B7-H3, and is able to function as the desired immune anticancer agent, or therapeutic agent for autoimmune diseases or inflammatory diseases, thereby completing the present invention.

[0010] The above information described in the background section is only for enhancement of understanding of the background of the invention and may not include information that constitutes known prior art to one of ordinary skill in the art. Summary of the invention

[0011] The object of the present invention is to provide an anti-B7-H3 antibody or an antigen-binding fragment thereof that specifically binds to B7-H3.

[0012] Another object of the present invention is to provide a nucleic acid encoding the antibody or antigen-binding fragment thereof and a vector comprising the same.

[0013] Still another object of the present invention is to provide a cell transformed with the vector, and a method for preparing the antibody or antigen-binding fragment thereof using the cell.

[0014] Yet another object of the present invention is to provide a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof for preventing or treating cancer or tumor, autoimmune disease or inflammatory disease, and a method of using the same to treat the disease.

[0015] Yet another object of the present invention is to provide an antibody-drug conjugate or multispecific antibody comprising the antibody or antigen-binding fragment thereof.

[0016] Yet another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer or tumors, autoimmune diseases or inflammatory diseases, and a method of using the same to treat the diseases, wherein the pharmaceutical composition comprises the antibody or its antigen-binding fragment, the antibody-drug conjugate or the multispecific antibody.

[0017] Yet another object of the present invention is to provide a composition for diagnosing cancer or tumor, autoimmune disease or inflammatory disease, and a method of using the same to diagnose the disease, wherein the composition comprises the antibody or its antigen-binding fragment, the antibody-drug conjugate or the multispecific antibody.

[0018] To achieve the above-mentioned object, the present invention provides an anti-B7-H3 antibody or an antigen-binding fragment thereof, which comprises a heavy chain CDR1 selected from SEQ ID Nos: 1, 7, 13 and 19; a heavy chain CDR2 selected from SEQ ID Nos: 2, 8, 14 and 20; a heavy chain CDR3 selected from SEQ ID Nos: 3, 9, 15 and 21; a light chain CDR1 selected from SEQ ID Nos: 4, 10, 16, 22, 24, 26, 28, 30, 33 and 35; a light chain CDR2 selected from SEQ ID Nos: 5, 11, 17 and 31; and a light chain CDR3 selected from SEQ ID Nos: 6, 12, 18, 23, 25, 27, 29, 32, 34 and 36.

[0019] The present invention also provides a nucleic acid encoding the anti-B7-H3 antibody or the antigen-binding fragment thereof, a recombinant expression vector comprising the nucleic acid, and a cell transformed with the recombinant expression vector.

[0020] The present invention also provides a method for preparing an anti-B7-H3 antibody or an antigen-binding fragment thereof, comprising: (i) culturing the transformed cells; and (ii) recovering the anti-B7-H3 antibody or an antigen-binding fragment thereof from the obtained cell culture.

[0021] The present invention also provides an antibody-drug conjugate (ADC) comprising the anti-B7-H3 antibody or the antigen-binding fragment thereof, and a drug.

[0022] The present invention also provides a multispecific antibody comprising the anti-B7-H3 antibody or the antigen-binding fragment thereof.

[0023] The present invention also provides a pharmaceutical composition for preventing or treating cancer or tumors, autoimmune diseases or inflammatory diseases, and a method of using the same to treat the diseases, wherein the pharmaceutical composition comprises the anti-B7-H3 antibody or its antigen-binding fragment, the antibody-drug conjugate or the multispecific antibody as an effective ingredient, and a pharmaceutically acceptable additive.

[0024] The present invention also provides a composition for diagnosing cancer or tumor, autoimmune disease or inflammatory disease, and a method of using the same to diagnose the disease, wherein the composition comprises the anti-B7-H3 antibody or its antigen-binding fragment, the antibody-drug conjugate or the multispecific antibody. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of B7-H3 expression vector.

[0026] Figure 2 The results of measuring the binding ability of multiple scFV-phages to B7-H3 antigen at different panning times are shown.

[0027] Figure 3 The results of ELISA assays confirming the B7-H3-His-specific binding ability of single scFv-phages are shown.

[0028] Figure 4 The results of confirming the screened B7-H3 antibodies by SDS-PAGE are shown.

[0029] Figure 5 Shown are the results of FACs measuring B7-H3 expression levels for each cell line.

[0030] Figures 6a to 6d The results of the FACs assay for the binding ability of the screened B7-H3 antibodies to cell surface B7-H3 are shown. Figure 6a The results of the binding assay of the CD276-033E03 antibody to each cell line are shown. Figure 6b The results of the binding assay of the CD276-051H04 antibody to each cell line are shown. Figure 6c The results of the binding ability assay of CD276-039C05 and CD276-040F10 antibodies to each cell line are shown. Figure 6d The results of the binding ability assays of the six antibodies to each cell line are shown.

[0031] Figures 7a to 7e Shown are the results of ELISAs measuring the binding of screened B7-H3 antibodies to various B7-H3 antigens.

[0032] Figure 8The results of ELISA for measuring the binding ability of the screened B7-H3 antibodies to the FcRn complex protein are shown.

[0033] Figure 9a and Figure 9b The results of the assay of the intracellular influx of the complex of the screened B7-H3 antibody and the cell surface B7-H3 antigen are shown. Figure 9a The results of confirming the intracellular influx of the screened B7-H3 antibodies over time are shown. Figure 9b The results of measuring the intracellular influx of antibodies at 18 hours are shown.

[0034] Fig.10 The results of a cytotoxicity assay resulting from the influx of the screened B7-H3 antibodies into cells are shown. DETAILED DESCRIPTION

[0035] Unless otherwise defined, the meanings of all technical terms and scientific terms used in this specification are the same as those commonly understood by those skilled in the art to which the present invention belongs. Generally, the nomenclature used in this specification is well known and commonly used in the art.

[0036] As the antigen of the anti-B7-H3 antibody or antigen-binding fragment thereof according to the present invention, the B7-H3 protein is closely related to the inhibition of the activity of immune cells, is a membrane protein present on the surface of immune cells, and acts as an auxiliary inhibitory receptor of immune cells. The B7-H3 can be derived from mammals, such as primates such as humans and monkeys, and rodents such as mice and rats.

[0037] In this specification, the term "B7-H3" is a concept that collectively refers to any variant, isotype, and species homolog of B7-H3 naturally expressed by cells. Preferably, it refers to human B7-H3, but is not limited thereto, and may be a concept that includes B7-H3 of other mammals.

[0038] In the present invention, the anti-B7-H3 antibody or antigen-binding fragment thereof preferably specifically binds to the amino acid sequence of human B7-H3 protein shown in SEQ ID NO: 65 or a portion thereof, but is not limited thereto.

[0039] The term "antibody" used in this specification refers to an anti-B7-H3 antibody that specifically binds to B7-H3. The scope of the present invention includes not only the complete antibody form that specifically binds to B7-H3, but also the antigen-binding fragment of the antibody molecule.

[0040] The structure of a complete antibody has two full-length light chains and two full-length heavy chains, each light chain being linked to a heavy chain by a disulfide bond. The heavy chain constant region has γ, μ, α, δ, and ε types, and has γ1, γ2, γ3, γ4, α1, and α2 as subtypes. The constant region of the light chain has κ and λ types.

[0041] The "antigen-binding fragment" or "antibody fragment" of an antibody refers to a fragment with antigen-binding function, which can be in the form of Fab, F(ab'), F(ab')2 and Fv. Among antibody fragments, the structure of Fab has the variable regions of the light chain and the heavy chain, the constant region of the light chain and the first constant region (CH1) of the heavy chain, and has an antigen-binding site. The difference between Fab' and Fab is that Fab' has a hinge region (hingeregion) containing one or more cysteine ​​residues at the C-terminus of the heavy chain CH1 domain. F(ab')2 antibodies are generated by the cysteine ​​residues in the hinge region of two Fab's through the formation of disulfide bonds. Fv refers to the smallest antibody fragment that has only the heavy chain variable region and the light chain variable region.

[0042] In a two-chain Fv, the heavy chain variable region and the light chain variable region are connected by a non-covalent bond, and in a single-chain Fv (scFv), the heavy chain variable region and the light chain variable region are generally connected by a peptide bond or directly connected at the C-terminus, so that a dimer structure can be formed like a two-chain Fv. This antibody fragment can be obtained by using proteolytic enzymes (for example, for the whole antibody, restrictive cleavage with papain can obtain Fab, and cleavage with pepsin can obtain F(ab')2 fragments), or it can be obtained by genetic recombination technology.

[0043] In one embodiment, the antibody according to the present invention is in the form of Fv (e.g., scFv) or a complete antibody. In addition, the heavy chain constant region may be any isotype of γ, μ, α, δ, or ε. For example, the constant region is γ1 (IgG1), γ3 (IgG3), or γ4 (IgG4). The light chain constant region may be κ or λ.

[0044] The antibodies of the present invention include monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies (chimera antibodies), single-chain Fvs (scFV), single-chain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFV) and anti-idiotype (anti-Id) antibodies, or epitope binding fragments of the antibodies, etc., but are not limited thereto. For example, the antibodies of the present invention may be human antibody sequences in which all amino acid sequences constituting the antibodies are composed of human immunoglobulin sequences, and may be modified into various forms such as humanized antibodies and chimeric antibodies according to methods known in the art as needed.

[0045] As used in this application, "antibody variable domain" refers to the light chain and heavy chain portion of an antibody molecule comprising the amino acid sequence of the Complementarity Determining Region (CDR) and the Framework Region (FR). VH refers to the variable domain of the heavy chain. VL refers to the variable domain of the light chain.

[0046] "Complementarity determining regions" (CDRs; ie, CDR1, CDR2, and CDR3) refer to the amino acid residues of an antibody variable domain that are required for antigen binding. Each variable domain generally has three CDR regions identified as CDR1, CDR2, and CDR3.

[0047] The present invention provides an anti-B7-H3 antibody or an antigen-binding fragment thereof, which comprises a heavy chain CDR1 selected from SEQ ID Nos: 1, 7, 13 and 19; a heavy chain CDR2 selected from SEQ ID Nos: 2, 8, 14 and 20; a heavy chain CDR3 selected from SEQ ID Nos: 3, 9, 15 and 21; a light chain CDR1 selected from SEQ ID Nos: 4, 10, 16, 22, 24, 26, 28, 30, 33 and 35; a light chain CDR2 selected from SEQ ID Nos: 5, 11, 17 and 31; and a light chain CDR3 selected from SEQ ID Nos: 6, 12, 18, 23, 25, 27, 29, 32, 34 and 36.

[0048] Specifically, the anti-B7-H3 antibody or antigen-binding fragment thereof of the present invention comprises:

[0049] The heavy chain CDR1 shown in SEQ ID NO: 1, the heavy chain CDR2 shown in SEQ ID NO: 2, the heavy chain CDR3 shown in SEQ ID NO: 3, the light chain CDR1 shown in SEQ ID NO: 4, the light chain CDR2 shown in SEQ ID NO: 5, and the light chain CDR3 shown in SEQ ID NO: 6;

[0050] The heavy chain CDR1 set forth in SEQ ID NO:7, the heavy chain CDR2 set forth in SEQ ID NO:8, the heavy chain CDR3 set forth in SEQ ID NO:9, the light chain CDR1 set forth in SEQ ID NO:10, the light chain CDR2 set forth in SEQ ID NO:11, and the light chain CDR3 set forth in SEQ ID NO:12;

[0051] The heavy chain CDR1 set forth in SEQ ID NO: 13, the heavy chain CDR2 set forth in SEQ ID NO: 14, the heavy chain CDR3 set forth in SEQ ID NO: 15, the light chain CDR1 set forth in SEQ ID NO: 16, the light chain CDR2 set forth in SEQ ID NO: 17, and the light chain CDR3 set forth in SEQ ID NO: 18;

[0052] The heavy chain CDR1 set forth in SEQ ID NO: 19, the heavy chain CDR2 set forth in SEQ ID NO: 20, the heavy chain CDR3 set forth in SEQ ID NO: 21, the light chain CDR1 set forth in SEQ ID NO: 22, the light chain CDR2 set forth in SEQ ID NO: 11, and the light chain CDR3 set forth in SEQ ID NO: 23;

[0053] The heavy chain CDR1 set forth in SEQ ID NO:19, the heavy chain CDR2 set forth in SEQ ID NO:20, the heavy chain CDR3 set forth in SEQ ID NO:21, the light chain CDR1 set forth in SEQ ID NO:24, the light chain CDR2 set forth in SEQ ID NO:11, and the light chain CDR3 set forth in SEQ ID NO:25;

[0054] The heavy chain CDR1 set forth in SEQ ID NO:19, the heavy chain CDR2 set forth in SEQ ID NO:20, the heavy chain CDR3 set forth in SEQ ID NO:21, the light chain CDR1 set forth in SEQ ID NO:26, the light chain CDR2 set forth in SEQ ID NO:11, and the light chain CDR3 set forth in SEQ ID NO:27;

[0055] The heavy chain CDR1 set forth in SEQ ID NO:19, the heavy chain CDR2 set forth in SEQ ID NO:20, the heavy chain CDR3 set forth in SEQ ID NO:21, the light chain CDR1 set forth in SEQ ID NO:28, the light chain CDR2 set forth in SEQ ID NO:5, and the light chain CDR3 set forth in SEQ ID NO:29;

[0056] The heavy chain CDR1 set forth in SEQ ID NO: 19, the heavy chain CDR2 set forth in SEQ ID NO: 20, the heavy chain CDR3 set forth in SEQ ID NO: 21, the light chain CDR1 set forth in SEQ ID NO: 30, the light chain CDR2 set forth in SEQ ID NO: 31, and the light chain CDR3 set forth in SEQ ID NO: 32;

[0057] The heavy chain CDR1 set forth in SEQ ID NO:19, the heavy chain CDR2 set forth in SEQ ID NO:20, the heavy chain CDR3 set forth in SEQ ID NO:21, the light chain CDR1 set forth in SEQ ID NO:33, the light chain CDR2 set forth in SEQ ID NO:11, and the light chain CDR3 set forth in SEQ ID NO:34; or

[0058] The heavy chain CDR1 shown in SEQ ID NO: 19, the heavy chain CDR2 shown in SEQ ID NO: 20, the heavy chain CDR3 shown in SEQ ID NO: 21, the light chain CDR1 shown in SEQ ID NO: 35, the light chain CDR2 shown in SEQ ID NO: 11, and the light chain CDR3 shown in SEQ ID NO: 36.

[0059] In addition, the anti-B7-H3 antibody or antigen-binding fragment thereof of the present invention may comprise a heavy chain variable region shown in SEQ ID No: 37, 39, 41 or 43, or a light chain variable region shown in SEQ ID No: 38, 40, 42, 44, 45, 46, 47, 48, 49 or 50.

[0060] Specifically, it may comprise a heavy chain variable region set forth in SEQ ID NO:37 and a light chain variable region set forth in SEQ ID NO:38; a heavy chain variable region set forth in SEQ ID NO:39 and a light chain variable region set forth in SEQ ID NO:40; a heavy chain variable region set forth in SEQ ID NO:41 and a light chain variable region set forth in SEQ ID NO:42; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:44; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:45; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:46; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:47; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:48; a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:49; or a heavy chain variable region set forth in SEQ ID NO:43 and a light chain variable region set forth in SEQ ID NO:50.

[0061] "Framework regions" (FR) are variable domain residues other than CDR residues. Each variable domain generally has four FRs identified as FR1, FR2, FR3, and FR4.

[0062] The antibodies are monovalent or divalent and comprise single or double chains. Functionally, the binding affinity (K D ) is in the range of 10 -8 M to 10 -12 M. For example, the binding affinity of the antibody is 10 -8 M to 10 -12 M, 10 -9 M to 10 -12 M, 10 -10 M to 10 -12 M, 10 -8 M to 10 -11 M, 10 -9 M to 10 -11 M, 10 -10 M to 10 -11 M, 10 -8 M to 10 -10 M, 10 -9 M to 10 -10 M, or 10 -8 M to 10 -9 M.

[0063] "Phage display" is a technique for displaying variant polypeptides as fusion proteins with at least a portion of a coat protein on the surface of a bacteriophage, such as a filamentous phage particle. The usefulness of phage display is that it enables rapid and efficient sorting of sequences that bind to a target antigen with high affinity for large libraries of randomized protein variants. The technique of displaying peptide and protein libraries on phage has been used to screen millions of polypeptides to find polypeptides with specific binding properties.

[0064] Compared with conventional hybridoma and recombinant methods for preparing antibodies with desired properties, the advantage of phage display technology is that it can generate a large antibody library with a variety of sequences in a short period of time. In addition, since immunization is completely unnecessary, phage antibody libraries can also generate antibodies against toxic or low antigenicity antigens. By using phage antibody libraries, it is also possible to generate and confirm new therapeutic antibodies.

[0065] The technology that can identify and isolate high-affinity antibodies from phage display libraries is very important for the isolation of novel antibodies for therapeutic use. The isolation of high-affinity antibodies from a library may depend on the size of the library, the production efficiency of the bacterial cells, and the diversity of the library.

[0066] The anti-B7-H3 antibody or antigen-binding fragment thereof of the present invention also includes an antibody or antigen-binding fragment thereof in which a part of the amino acid sequence is substituted by conservative substitution.

[0067] In this specification, "conservative substitution" refers to the modification of a polypeptide, which includes replacing one or more amino acids with amino acids that do not cause the loss of the biological or biochemical function of the polypeptide and have similar biochemical properties. "Conservative amino acid substitution" is the substitution of an amino acid residue with an amino acid residue with a similar side chain. The categories of amino acid residues with similar side chains have been defined and known in the art. These categories include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine) and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). The antibodies of the present invention can still maintain activity even with the conservative amino acid substitutions described above.

[0068] The present invention also provides a nucleic acid encoding an anti-B7-H3 antibody or antigen-binding fragment thereof according to the present invention. The nucleic acid used in this specification may be present in cells, cell lysates, or may be present in a partially purified form or in a substantially pure form. A nucleic acid is "isolated" or "substantially pure" when it is purified from other cell components or other contaminants (e.g., nucleic acids or proteins of other cells) by standard techniques, wherein standard techniques include alkali / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and other techniques known in the art. The nucleic acid of the present invention may be, for example, DNA or RNA, and may or may not contain intron sequences. In nucleic acids, the basic constituent unit nucleotides of nucleic acids include not only natural nucleotides, but also analogs in which sugar or base regions are modified. The sequences of the nucleic acids encoding the heavy and light chain variable regions of the present invention may be modified. The modifications include addition, deletion, or non-conservative substitution or conservative substitution of nucleotides.

[0069] In the present invention, the nucleic acid encoding the anti-B7-H3 antibody may comprise one or more sequences selected from the polynucleotides shown in SEQ ID Nos: 51, 53, 55 and 57 encoding the heavy chain variable region; and the polynucleotides shown in SEQ ID Nos: 52, 54, 56 and 58 to 64 encoding the light chain variable region.

[0070] Taking into account the above modifications with biologically equivalent activity, it can be considered that the antibodies of the present invention or nucleic acid molecules encoding them also include sequences having substantial identity with respect to the sequences shown in the sequence numbers. The above substantial identity means that when the sequences of the present invention described above are arranged to correspond to each other to the maximum extent and the arranged sequences are analyzed using algorithms commonly used in the art, sequences showing 90% or more homology, preferably 95% or more homology, more preferably 96% or more, 97% or more, 98% or more, or 99% or more homology are shown.

[0071] This homology can be determined by sequence comparison and / or alignment according to methods known in the art. For example, the sequence homology of nucleic acid or protein of the present invention can be determined by using a sequence comparison algorithm (e.g., NCBI basic local alignment search tool; BLAST), manual alignment, visual inspection, etc.

[0072] In another aspect, the present invention relates to a recombinant expression vector comprising the nucleic acid. For the expression of the anti-B7-H3 antibody or antigen-binding fragment thereof according to the present invention, DNA encoding partial or full-length light and heavy chains can be obtained by standard molecular biology techniques (e.g., PCR amplification or cDNA cloning using a hybridoma expressing the target antibody), and the DNA can be inserted into an expression vector by being "operably linked" to transcription and translation control sequences. The vector components generally include, but are not limited to, one or more selected from the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer factor, a promoter, and a transcription termination sequence.

[0073] The term "vector" used in this specification refers to a means for expressing a target gene in a host cell, including plasmid vectors; cosmid vectors; viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated virus vectors, etc. In the vector, the nucleic acid encoding the antibody or antigen-binding fragment thereof is operably linked to a promoter.

[0074] The term "operably connected" as used in this specification refers to that the gene encoding the antibody or its antigen-binding fragment is joined (ligation) in a vector so that the transcription and translation control sequences in the vector play the expected function of regulating the transcription and translation of the antibody gene. The selected expression vector and expression control sequence should be compatible with the expression cell used. The light chain gene and heavy chain gene of the antibody are inserted into different vectors, or the two genes are inserted into the same expression vector. By standard methods (for example, the joining of complementary restriction endonuclease sites on the antibody gene fragment and the vector, or if there is no restriction endonuclease site, it is a blunt end joining), the antibody gene is inserted into the expression vector.

[0075] In some cases, the recombinant expression vector may include a sequence encoding a signal peptide, which helps to secrete the antibody chain from the transformed cells. The antibody chain gene and the signal peptide-coding sequence can be cloned into the vector in a frame so that the signal peptide is bound to the amino terminus of the antibody chain and expressed. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide derived from a protein other than an immunoglobulin). In addition, the recombinant expression vector may include a regulatory sequence for controlling the expression of the antibody chain gene in the transformed cells. "Regulatory sequence" may include promoters, enhancers and other expression control factors (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain gene. It will be appreciated by those skilled in the art that the design of the expression vector may vary depending on the selection of cells to be transformed, protein expression levels and other factors, by selecting different regulatory sequences.

[0076] The vector of the present invention may also contain other sequences fused to the antibody gene to facilitate purification of the antibody expressed from the vector. Such sequences may be, for example, genes such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), 6x His (six-histidine; Quiagen, USA).

[0077] The vector contains an antibiotic resistance gene commonly used in the art as a selection marker, such gene including, for example, resistance genes to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline.

[0078] The present invention also provides a cell transformed with the recombinant expression vector. The cell according to the present invention can be an animal cell, a plant cell, a yeast, an Escherichia coli, an insect cell, etc., but is not limited thereto.

[0079] Specifically, the cell according to the present invention may be a prokaryotic cell such as Escherichia coli, Bacillus subtilis, Streptomyces sp., Pseudomonas sp., Proteus mirabilis or Staphylococcus sp. In addition, it may be a fungus such as Aspergillus sp., a lower eukaryotic cell such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces sp. and Neurospora crassa, etc., and a eukaryotic cell such as a cell of a higher eukaryotic organism (e.g., an insect).

[0080] In addition, the cell according to the present invention can be derived from plants or mammals. For example, COS-7 (monkey kidney cells 7), BHK (baby hamster kidney), CHO (Chinese hamster ovary), CHOK1, DXB-11, DG-44, CHO / -DHFR, CV1, HEK293, BHK, TM4, VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2 / 0, NS0, U20S or HT1080 can be used, but are not limited thereto. Preferably, COS7 cells, NSO cells, SP2 / 0 cells, CHO cells, W138, BHK cells, MDCK, myeloma cell lines, HuT 78 cells and HEK293 cells can be used, and CHO cells are particularly preferred.

[0081] In order to express the anti-B7-H3 antibodies according to the present invention, a variety of cell / vector combinations can be used. Specifically, expression vectors suitable for eukaryotic cells include expression vectors derived from SV40, bovine papilloma virus, adenovirus, adeno-associated virus, cytomegalovirus and retrovirus, but are not limited thereto. Expression vectors that can be used for bacterial cells include bacterial plasmids derived from Escherichia coli such as pET, pRSET, pBluescript, pGEX2T, pUC, col E1, pCR1, pBR322, pMB9 and their derivatives; plasmids with a wider host range such as RP4; phage DNA such as λgt10, λgt11 and NM989 and other phage λ derivatives; and other DNA phages such as M13 and filamentous single-stranded DNA phages. Expression vectors useful for yeast cells are YEp plasmids and their derivatives. A vector useful for insect cells is pVL941.

[0082] The vector is transfected or transfected (transfection) into the cell. In order to achieve "transfection", various types of techniques commonly used when introducing exogenous nucleic acid (DNA or RNA) into prokaryotic or eukaryotic cells can be used, such as electrophoresis, calcium phosphate precipitation, DEAE-dextran transfection or lipid transfection (lipofection) and the like.

[0083] The present invention also provides a method for preparing the antibody or antigen-binding fragment thereof, the method comprising the following steps: (i) culturing the transformed cells; and (ii) recovering the anti-B7-H3 antibody or antigen-binding fragment thereof from the obtained cell culture. When a recombinant expression vector capable of expressing the anti-B7-H3 antibody or antigen-binding fragment thereof is introduced into mammalian cells, the cells are cultured for a certain period of time sufficient to express the antibody in the cells, or more preferably sufficient to secrete the antibody into the culture medium in which the cells are cultured, thereby preparing the antibody or antigen-binding fragment thereof.

[0084] The cells can be cultured in various culture media, and commercially available culture media can be used as culture media without limitation. All other necessary supplements known to those skilled in the art may also be included at appropriate concentrations. In the selected host cells, culture conditions suitable for protein expression, such as temperature, pH, etc., have been used, which will be apparent to those skilled in the art.

[0085] In some cases, the expressed antibody can be separated from the cell culture medium and uniformly purified. The separation or purification of the antibody can be carried out by conventional protein separation and purification methods, such as chromatography. The chromatography can include, for example, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, or hydroxyapatite chromatography using a protein A column or a protein G column. In addition to the above-mentioned chromatography, the antibody can be further separated and purified by combined filtration, ultrafiltration, salting out, dialysis, etc.

[0086] The present invention also provides an antibody-drug conjugate comprising the antibody or the antigen-binding fragment thereof, and a drug.

[0087] In antibody-drug conjugates, the anticancer drug must be stably bound to the antibody before it is delivered to the target cancer cells. The drug delivered to the target must be released from the antibody and induce the death of the target cells. To this end, the drug must be stably bound to the antibody and have cytotoxicity sufficient to induce the death of the target cells when released in the target cells.

[0088] The drug is a preparation that exhibits a pharmacological effect, can bind to the antibody or antigen-binding fragment thereof of the present invention, and can be separated from the antibody or antigen-binding fragment thereof under acidic conditions, and refers to a compound that exhibits a therapeutic effect on target cells. The drug may be a cytotoxin, a radioisotope, an antiproliferative agent, a pro-apoptotic agent, a chemotherapeutic agent, and a nucleic acid used for treatment, but is not limited thereto.

[0089] The antibody-drug conjugate can be internalized into cells and can mediate antibody-dependent cellular cytotoxicity.

[0090] As used herein, the term "cytotoxic activity" refers to the cell death, cell proliferation inhibition or growth inhibition effect of an antibody-drug conjugate or an intracellular metabolite of an antibody-drug conjugate. Cytotoxic activity can be expressed as an IC50 value, i.e., the concentration (molar or mass) per unit volume at which half of the cells survive.

[0091] The term "cytotoxin" generally refers to an agent that inhibits or prevents cell function, and / or destroys cells. Representative cytotoxins include antibiotics, tubulin polymerization inhibitors, alkylating agents that bind to and destroy DNA, and agents that destroy essential cellular protein function or protein synthesis such as protein kinases, phosphatases, topoisomerases, enzymes, and cell cycle proteins. Examples of cytotoxins include paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, D), 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and their analogs or homologues, but are not limited thereto.

[0092] The antibodies of the present invention may contain high-energy radioactive isotopes for use in radiotherapy. The isotope may, for example, be directly bound to the antibody at a cysteine ​​residue present in the antibody, or a chelate may be used to mediate the binding of the antibody to the radioactive isotope. Radioactive isotopes suitable for radiotherapy include, but are not limited to, alpha emitters, beta emitters, and auger electrons. Radioactive isotopes useful for use in diagnosis include positron emitters and gamma emitters.

[0093] Antiproliferative and pro-apoptotic agents include PPAR-γ (e.g., cyclopentenone prostaglandins (cyPGs)), retinoids, triterpenoids (e.g., cycloartane, lupane, ursane, oleanane, friedelane, dammarane, cucurbitacin, and limonoid triterpenoids), inhibitors of EGF receptors (e.g., HER4), rapamycin, calcitriol (1,25-dihydroxycholecalciferol (vitamin D) ), aromatase inhibitors (FEMARA (retrozone)), telomerase inhibitors, iron chelators (3-aminopyridine-2-carboxaldehyde thiosemicarbazone (Triapine)), apoptin (viral protein 3 - VP3 of chicken anemia virus), inhibitors of Bcl-2 and Bcl-X (L), TNF-α, FAS ligand, TNF-related apoptosis-inducing ligand (TRAIL / Apo2L), activators of TNF-α / FAS ligand / TNF-related apoptosis-inducing ligand (TRAIL / Apo2L) signaling, and inhibitors of PI3K-Akt survival pathway signaling (such as UCN-01 and geldanamycin).

[0094] A "chemotherapeutic agent" is a compound useful for the treatment of cancer, regardless of its mechanism of action. Classes of chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites, spindle poison plant alkaloids, cytotoxic / antitumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizers, and kinase inhibitors. Chemotherapeutic agents include compounds used in "targeted therapies" and traditional chemotherapy.

[0095] The conjugate can be prepared by combining the drug with an antibody or its antigen-binding fragment according to known methods. The antibody and the drug can be directly combined through the linking group they have, etc., or indirectly combined through a linker or other substances. The main mechanism by which the drug is sheared from the antibody includes hydrolysis of the lysosome (hydrazone, acetal and cis-aconitic acid-like amide) at acidic pH, peptide cleavage caused by lysosomal enzymes (cathepsins and other lysosomal enzymes), and reduction of disulfides. As a result of these multiple shearing mechanisms, the mechanism of drug-antibody connection is very diverse, and any suitable linker can be used.

[0096] Suitable linking groups for conjugating antibodies to drugs are well known in the art and include, for example, disulfide groups, thioether groups, acid-cleavable groups, photo-cleavable groups, peptidase-cleavable groups, and esterase-cleavable groups.

[0097] When the drug is directly bound, the linking group may be, for example, a disulfide bond using an SH group or a bond mediated by maleimide. For example, the intramolecular disulfide bond of the antibody Fc region and the disulfide bond of the drug are reduced, and the two are linked via a disulfide bond. There are also methods using maleimide and methods of introducing cysteine ​​into antibodies by genetic engineering.

[0098] The antibody and the drug can also be indirectly bound through other substances (linkers). Preferably, the linker has one or more types of functional groups that react with the antibody, the drug, or both. The functional groups may include, for example, amino, carboxyl, sulfhydryl, maleimide, pyridyl, etc.

[0099] The present invention also provides a multi-specific antibody comprising the antibody or its antigen-binding fragment. A multi-specific antibody refers to an antibody that can bind to two or more different types of antigens (target proteins) and is prepared by genetic engineering or any method. Multi-specific antibodies include bispecific antibodies, trispecific antibodies or tetraspecific antibodies.

[0100] Preferably, the multispecific antibody is in the form of an anti-B7-H3 antibody according to the present invention combined with an antibody or fragment thereof having binding ability to an immune effector cell-specific target molecule. Preferably, the immune effector cell-specific target molecule is selected from TCR / CD3, CD16 (FcγRIIIa) CD44, CD56, CD69, CD64 (FcγRI), CD89 and CD11b / CD18 (CR3), but is not limited thereto.

[0101] Preferably, the multispecific antibody is in the form of an anti-B7-H3 antibody according to the present invention combined with an antibody or a fragment thereof having binding ability to a cytokine that stimulates or suppresses immunity. Preferably, the cytokine that stimulates or suppresses immunity is selected from, for example, IL-2, IL-6, IL-7, IFNα, GM-CSF, IL-10 and TGF-β, but is not limited thereto.

[0102] Preferably, the multispecific antibody is in the form of an anti-B7-H3 antibody according to the present invention combined with an antibody or a fragment thereof having binding ability to a target for cancer treatment, such as PD-1, PD-L1, VEGF, EGFR, Her2 / neu, VEGF receptor, other growth factor receptors, CD20, CD40, CTLA-4, TIGIT, TIM-3, LAG-3, OX-40, 4-IBB and ICOS, but not limited thereto.

[0103] Antibodies belonging to multispecific antibodies can be divided into scFv-based antibodies, Fab-based antibodies, IgG-based antibodies, etc. In the case of bispecific antibodies, since two signals can be inhibited or amplified at the same time, it may be more effective than the case of inhibiting / amplifying one signal, and low-dose administration can be achieved compared to the case of treating each signal with its own signal inhibitor, and two signals can be inhibited / amplified at the same time and space.

[0104] Methods for the preparation of bispecific antibodies are well known. Typically, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain / light chain pairs under conditions in which the two heavy chains have different specificities.

[0105] In the case of scFv-based bispecific antibodies, hybrid scFvs in the form of heterodimers can be prepared by combining VL and VH of different scFvs to form diabodies, and tandem scFvs can be prepared by connecting different scFvs to each other. Heterodimer miniantibodies can be prepared by expressing CH1 and CL of Fab at the ends of scFv, respectively. Miniantibodies in the form of heterodimer scFvs can be prepared by replacing amino acids in part of the CH3 domain, which is the homodimer domain of Fc, and changing it to a heterodimer structure in the form of 'knob into hole', and expressing these changed CH3 domains at the ends of different scFvs.

[0106] In the case of Fab-based bispecific antibodies, individual Fab's of specific antigens can be combined with each other through disulfide bonds or mediators to prepare heterodimeric Fab forms, and scFvs of different antigens can be expressed at the ends of the heavy or light chains of specific Fabs so that the antigen binding valency is divalent, or a hinge region is placed between Fab and scFv so that the prepared homodimeric form has a tetravalent antigen binding valency. In addition, by fusing scFvs of different antigens to the light and heavy chain ends of Fabs to obtain a trivalent antigen binding valency, and by fusing different scFvs to the light and heavy chain ends of Fabs, respectively, a trivalent antigen binding valency can be prepared in the form of a trivalent antibody (bibody), or it can be prepared by chemically coupling three different Fabs.

[0107] In the case of IgG-based bispecific antibodies, a method for producing bispecific antibodies by rehybridizing mouse and rat hybridomas to prepare hybrid hybridomas (also known as quadromas) is known. In addition, while sharing the light chain portion, a heterodimer form, i.e., a bispecific antibody in the form of 'Holes and Knob', can be prepared by modifying a portion of the amino acids of the CH3 homodimer domain of the Fc of different heavy chains. It is also possible to prepare a homodimer form of (scFv)4-IgG by fusing and expressing two different scFvs to the constant domains of the light and heavy chains of IgG, respectively, instead of the variable domains.

[0108] The present invention also provides a pharmaceutical composition for preventing or treating cancer or tumors, autoimmune diseases or inflammatory diseases, which comprises the anti-B7-H3 antibody or its antigen-binding fragment as an effective ingredient, or the multispecific antibody or antibody-drug conjugate comprising the same, and a pharmaceutically acceptable additive.

[0109] The cancer or tumor, autoimmune disease or inflammatory disease may be associated with the expression or overexpression of B7-H3.

[0110] As used herein, "cancer" and "tumor" are used with essentially the same meaning and refer to or connote the physiological condition in mammals that is typically characterized by unregulated cell growth and proliferation.

[0111] "Prevention" refers to all actions to inhibit or delay the progression of cancer or tumor, autoimmune disease or inflammatory disease by administering the composition according to the present invention, and "treatment" refers to inhibiting the development of cancer or tumor, alleviating or eliminating cancer or tumor, inhibiting, alleviating or eliminating autoimmune disease or inflammatory disease.

[0112] The cancer or carcinoma that can be treated with the composition of the present invention is not particularly limited, including solid cancer and blood cancer. Examples of these cancers can be selected from skin cancer such as melanoma, liver cancer, hepatocellular carcinoma, gastric cancer, breast cancer, lung cancer, ovarian cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, pancreatic cancer, cervical cancer, brain cancer, prostate cancer, non-small cell lung cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer, kidney cancer, esophageal cancer, bile duct cancer, testicular cancer, rectal cancer, head and neck cancer, cervical cancer, ureteral cancer, osteosarcoma, neuroblastoma, fibrosarcoma, rhabdomyosarcoma, astrocytoma, glioblastoma, neuroblastoma, glioma and other tumors (such as small round blue cell tumors in children), but are not limited thereto.

[0113] More preferably, the cancer or tumor may be characterized by the expression of B7-H3 protein and is selected from prostate cancer, ovarian cancer, breast cancer, colon cancer, kidney cancer, non-small cell lung cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, neuroblastoma and other tumors (e.g., small round blue cell tumor in children). The cancer may be a primary cancer or a metastatic cancer.

[0114] In the present invention, the autoimmune disease or inflammatory disease may be asthma, rheumatoid arthritis, or multiple sclerosis, but is not limited thereto.

[0115] In the present invention, the pharmaceutical composition comprises a therapeutically effective dose of an anti-B7-H3 antibody or an antigen-binding fragment thereof, and a pharmaceutically acceptable additive. A "pharmaceutically acceptable additive" is a substance that can be added to an active ingredient to facilitate formulation or stabilization of the pharmaceutical composition and does not cause significant toxic effects on patients.

[0116] The additives refer to carriers or diluents that are non-irritating to the patient and do not hinder the biological activity and characteristics of the administered compound. In the composition formulated as a liquid solution, sterile and biocompatible saline, sterile water, Ringer's solution, buffered saline, albumin injection, dextrose solution, maltodextrin solution, glycerol, ethanol and mixtures thereof can be used as acceptable drug carriers, and other conventional additives such as antioxidants, buffers and antibacterial agents can be added as needed. In addition, diluents, dispersants, surfactants, binders and lubricants can be further added to formulate the formulation into injection forms such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets.

[0117] Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders to prepare sterile and injectable solutions or dispersions for immediate administration (extemporaneous). Preferably, the composition is prepared for parenteral injection. The composition can be prepared into solutions, microemulsions, liposomes or other customized dosage forms suitable for high drug concentrations. The carrier can be a solvent or dispersion medium comprising, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.) and their suitable mixtures. In some cases, isotonic agents, such as sugars, polyols, such as mannitol, sorbitol or sodium chloride, may be included in the composition. Various preparations can be prepared using methods known in the pharmaceutical field.

[0118] The dosage of the pharmaceutical composition according to the present invention is not particularly limited and can be changed according to various factors including the health status and body weight of the patient, the severity of the disease, the type of drug, the route of administration and the time of administration. The pharmaceutical composition according to the present invention can be administered with one or more doses per day by various routes such as the commonly accepted oral or parenteral routes of mammals including people, rats, mice, livestock, etc. Specifically, it can be administered by oral, rectal, local, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, intranasal, inhalation, intraocular, intrapulmonary or intradermal routes in a conventional manner, but is not limited thereto.

[0119] The pharmaceutical composition according to the present invention can be administered to the patient by bolus injection or continuous infusion as needed. For example, the bolus dosage of the antigen-binding fragment of the anti-B7-H3 antibody of the present invention represented by the Fab fragment can be 0.0025 mg / kg to 100 mg / kg body weight, 0.025 mg / kg to 0.25 mg / kg, 0.010 mg / kg to 0.10 mg / kg, or 0.10 mg / kg to 0.50 mg / kg. In the case of continuous infusion, the antigen-binding fragment of the anti-B7-H3 antibody of the present invention represented by the Fab fragment can be administered at a dose of 0.001 to 100 mg / kg body weight / min, 0.0125 to 1.25 mg / kg / min, 0.010 to 0.75 mg / kg / min, 0.010 to 1.0 mg / kg / min or 0.10 to 0.50 mg / kg / min for 1 hour to 24 hours, 1 hour to 12 hours, 2 hours to 12 hours, 6 hours to 12 hours, 2 hours to 8 hours, or 1 hour to 2 hours. When the anti-B7-H3 antibody or its antigen-binding fragment of the present invention is administered, the dosage may be about 1 to 10 mg / kg body weight, 2 to 8 mg / kg, 3 to 7 mg / kg, or 4 to 6 mg / kg. The full-length anti-B7-H3 antibody is usually administered by continuous infusion for 30 minutes to 35 minutes. The frequency of administration will vary depending on the severity of the condition. The frequency can range from three times a week to once every week or two weeks.

[0120] The present invention also relates to a method for preventing or treating cancer or tumor, autoimmune disease or inflammatory disease, comprising the following steps: administering a therapeutically effective dose of the anti-B7-H3 antibody or antigen-binding fragment thereof or the multispecific antibody or antibody-drug conjugate to a patient who needs to prevent or treat cancer or tumor, autoimmune disease or inflammatory disease. The method for preventing or treating may further include the step of identifying a patient who needs to prevent or treat the disease before the administration step.

[0121] In some cases, by combining the antibody or its antigen-binding fragment with other existing anti-cancer therapeutic agents, tumor cells expressing B7-H3 can be effectively targeted and anti-tumor T cell activity can be increased to enhance immune response. The antibody or its antigen-binding fragment can be used in combination with the following substances or methods: other anti-tumor agents or immunogenic agents, such as weakened cancer cells, tumor antigens (including recombinant proteins, peptides and carbohydrate molecules), antigen-presenting cells (e.g., dendritic cells pulsed with tumor-derived antigens or nucleic acids), immunostimulatory cytokines (e.g., IL-2, IFNα2, GM-CSF), and cells transfected with genes encoding immunostimulatory cytokines; standard cancer treatments, such as chemotherapy, radiotherapy or surgery; or other antibodies, such as PD-1, PD-L1, VEGF, EGFR, Her2 / neu, VEGF receptors, other growth factor receptors, CD20, CD40, CTLA-4, OX-40, 4-IBB and ICOS antibodies. The anti-B7-H3 antibody or antigen-binding fragment thereof, and the pharmaceutical composition comprising the same according to the present invention can be administered simultaneously with the existing anticancer therapeutic agent, or can be administered sequentially.

[0122] The present invention also provides a composition for diagnosing cancer or tumor, autoimmune disease or inflammatory disease, and a method of using the same to diagnose the disease, wherein the composition comprises the anti-B7-H3 antibody or its antigen-binding fragment, the antibody-drug conjugate, or the multispecific antibody.

[0123] By measuring the expression level of B7-H3 in a sample using the anti-B7-H3 antibody or antigen-binding fragment thereof, the antibody-drug conjugate, or the multispecific antibody according to the present invention, cancer or tumor, autoimmune disease or inflammatory disease can be diagnosed. The expression level can be measured according to conventional immunoassay assays, and can be measured by radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, ELISA (enzyme-linked immunosorbent assay), capture ELISA, inhibition or competition analysis, sandwich analysis, flow cytometry, immunofluorescence staining and immunoaffinity purification using the antibody of B7-H3, but is not limited thereto. In the immunoassay results, when the expression of B7-H3 protein in a biological sample is higher than that in a normal biological sample (e.g., normal gastric tissue, blood, plasma or serum), the disease can be diagnosed.

[0124] The present invention also provides a diagnostic kit comprising the composition for diagnosis. The kit according to the present invention may include an anti-B7-H3 antibody or antigen-binding fragment thereof according to the present invention, or an antibody-drug conjugate or a multispecific antibody comprising the same, and a label that generates a detectable signal. The label may include a chemical substance (e.g., biotin) bound to the antibody, an enzyme (alkaline phosphatase, β-galactosidase, horseradish peroxidase, luciferase, or cytochrome P450), a radioactive substance (e.g., C14, I125, P32, and S35), a fluorescent substance (e.g., fluorescein), a luminescent substance, a chemiluminescent substance, and FRET (fluorescence resonance energy transfer), but is not limited thereto. In this case, when alkaline phosphatase is used as the enzyme, a color reaction substrate such as bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol AS-BI phosphate (naphthol-AS-B1-phosphate) and ECF (enhanced chemifluorescence) can be used as the enzyme substrate, and when horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-fluorescein, lucigenin (bis-N-methylacridine nitrate), resorufin benzyl ether), luminol, Amplex red reagent (10-acetyl-3,7-dihydroxyphenazine), HYR (p-phenylenediamine-HCl and catechol), TMB (tetramethylbenzidine), ABTS (2,2'-azidobis[3-ethylbenzothiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine, glucose oxidase and t-NBT (nitro blue tetrazolium) and m-PMS (phenazine methyl sulfate), but are not limited thereto.

[0125] By analyzing the signal intensity displayed by the reaction between the sample and the antibody, cancer or tumor, autoimmune disease or inflammatory disease can be diagnosed. The enzyme activity measurement or signal measurement used for diagnosis can be carried out according to various methods known in the art, thereby qualitatively or quantitatively analyzing the expression of B7-H3.

[0126] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only used to describe the present invention, and the scope of the present invention is not limited by these examples.

[0127] [Example 1] Expression and purification of B7-H3 antigen

[0128] [Example 1-1] Construction of B7-H3 protein expression vector

[0129] In order to clone only the extracellular domain of B7-H3, polymerase chain reaction (PCR) was performed by using a Jurkat cell cDNA library (Stratagene, USA) and a primer pair of B7-H3 containing restriction endonuclease SfiI sites at 5' and 3' (Table 1). The obtained PCR product and N293F vector were used to construct expression vectors, which express proteins fused with 8x His, human Fc or mouse Fc at the carboxyl terminus of the extracellular domain of B7-H3, respectively ( Figure 1 ).

[0130]

Table 1

[0131] Primers used for B7-H3 cloning

[0132] name 5'→3' sequence SEQ ID No: B7-H3-F CTGGAGGTCCAGGTCCCTGAAGACC 66 B7-H3-R GGCCTCTGGGGGGAATGTCATAGGC 67

[0133] [Example 1-2] Expression and purification of B7-H3 antigen

[0134] Transfection was performed using PEI (polyethyleneimine, 23966, Polysciences) under optimized conditions. Human HEK293F cells were plated at 5×10 5 Cells / ml were inoculated into culture medium (#Freestyle 293AGT; AG100009P1, Thermo.) and cultured until the cell count reached 1x10 6Cells / ml. Each expression vector obtained in Example 1-1 was mixed with PEI to form a complex (polyplex), then added to the cells for transformation, and then 5g / L of soy peptone (Soytone; #212488, DIFCO) was added and further cultured for 6 days. The expressed B7-H3-Fc antigen was purified by sequentially using protein A agarose and Superdex200 (1.5cm*100cm) gel filtration chromatography. Each antigen production culture solution was centrifuged at 8,000rpm for 30 minutes to remove cell debris and filtered using a bottle top filter with a pore size of 0.22μm. 3ml of Ni-NTA resin (#30230, QIAGEN) was placed in an empty column, and then the resin was filled with 20ml of binding buffer (10mM imidazole) for purification. The filtered culture fluid was flowed into the filled resin at a gravity flow rate, thereby binding to the resin at a rate of 0.2 ml per minute. After washing with 100 ml of washing buffer (20 mM imidazole), elution was performed with elution buffer (250 mM imidazole). The eluate obtained using the elution buffer was dialyzed and buffer exchanged with DPBS (Dulbecco's phosphate buffered saline) (1 L, 3 times). The concentration of the protein was determined by nano-drop. Each protein was purified and the purity was confirmed using SDS-PAGE and size exclusion chromatography (#TSK-GEL G-3000SWXLSize-exclusion chromatography (SEC), Tosoh), and the purity was 95% or more.

[0135] [Example 2] Identification of B7-H3 human antibodies

[0136] [Example 2-1] Preparation of antigen

[0137] 50 μg of B7-H3-His prepared in Example 1 and B7-H3-his (#11188-H08H) and B7-H3-Fc (#11188-H02H) antigens purchased from SinoBiological Inc. were coated on immunosorbent tubes, respectively, and then blocked.

[0138] [Example 2-2] Preparation of human antibody library phage

[0139] 2.7×10 10The human scFv library phage with diversity (Y Biologics) was infected into E. coli, and then the obtained E. coli was cultured for 16 hours at 30° C. The culture solution was centrifuged, and the supernatant was concentrated with PEG (polyethylene glycol) and then dissolved in PBS (phosphate buffered saline) buffer to prepare human antibody library phage.

[0140] [Example 2-3] Biopanning

[0141] The library phage obtained in Example 2-2 was placed in the immunoadsorption tube prepared in Example 2-1, reacted at room temperature for 2 hours, washed with 1x PBST and 1x PBS, and then treated with 100mM TAE and Tris-HCl (pH7.5) solution in sequence, so as to elute only the scFv-phage that specifically binds to the antigen. The positive phage pool was obtained by infecting the eluted phage to Escherichia coli again and amplifying the panning process. In the first round of panning, the amplified phage was only increased in the number of times in the PBST (PBS + Tween 20) washing step, and the rest was panned in the second and third rounds according to the same method. As a result, as shown in Table 2, it was confirmed that the number of phages bound to the antigen in the third round of panning increased slightly.

[0142]

Table 2

[0143] Comparison of titers of selected antibodies

[0144] Panning times The number of phage influx The number of phage binding First round <![CDATA[3x10 12 ]]> <![CDATA[2x10 5 ]]> Round 2 <![CDATA[4x10 12 ]]> <![CDATA[3x10 6 ]]> Round 3 <![CDATA[4x10 12 ]]> <![CDATA[5x10 7 ]]>

[0145] [Example 2-4] Multi-phage ELISA

[0146] Multiphage ELISA was performed to confirm the antigen specificity of the positive polyscFv-phage antibody pool obtained by each round of panning. ELISA was performed simultaneously on the phage pools obtained in each round by using immuno-plates coated with antigens B7-H3-His (Sino) and B7-H3-His (in house), respectively, and an immuno-plate coated with ITGA6-Fc protein used as a non-specific binding index. As a negative control group for ELISA, M13 phage without antibody display, i.e. #38, was used together.

[0147] The results are as follows Figure 2 As shown, the ability to bind to the B7-H3-His antigen increased from the positive phage pool of the second round of panning, and it was confirmed that anti-B7-H3 phage antibodies were successfully increased.

[0148] [Example 2-5] Screening of positive phages

[0149] Thousands of single clones were screened from the positive phage pool of the third round of panning that was confirmed to have high binding capacity by multi-phage ELISA, infected and cultured with helper phage in a 96-deep well plate, and then the single scFv-phage present in the supernatant was transferred to an immunoplate coated with B7-H3 antigen for ELISA. At this time, single phage ELISA of B7-H3-His (Sino) or B7-H3-His (in house) and ELISA of ITGA6-Fc protein, a nonspecific antigen control group, were performed simultaneously to confirm whether the obtained positive phage clones were specific for B7-H3.

[0150] The results, such as Figure 3 As shown, a single scFv-phage clone was confirmed to have strong binding ability only to B7-H3-His, and dozens of preliminary antibody clones were screened. In addition, an attempt was made to increase the affinity of the CD276-039C05 clone screened by property analysis to obtain further excellent antibody clones.

[0151] [Example 2-6] Base sequence analysis of positive phage antibodies

[0152] For the selected single clones, phagemid DNA was isolated using a DNA purification kit (Qiagen, Germany) and the base sequence was analyzed. The clones shown in Table 3 were confirmed by analyzing the sequences of the CDR3 sites of the heavy and light chains.

[0153]

Table 3

[0154] Characterization of B7-H3 monoclonal

[0155]

[0156] In addition, the amino acid sequences of the CDRs and variable regions of the heavy and light chains are shown in Tables 4 and 5. The polynucleotide sequences encoding the heavy and light chain variable regions are shown in Table 6 below.

[0157]

Table 4

[0158] Amino acid sequences of heavy chain CDR and light chain CDR

[0159]

[0160]

[0161]

Table 5

[0162] Heavy and light chain variable region amino acid sequences

[0163]

[0164]

[0165]

Table 6

[0166] Polynucleotide sequences encoding heavy and light chain variable regions

[0167] [Example 3] Production of B7-H3 human antibody

[0168] [Example 3-1] Conversion from scFv format to IgG format

[0169] In order to convert the monoclonal phage antibody screened in Example 2 from scFv format to IgG format, the base sequence of the heavy chain variable region was cloned into pNATVH (Y-Biologics) by utilizing the restriction endonuclease SfiI / NheI site to prepare the N293FHC vector, and the base sequence of the light chain variable region was cloned into pNATVL (Y-Biologics) by utilizing the restriction endonuclease SfiI / BglII site to prepare the N293F LC vector.

[0170] [Example 3-2] Production and purification of human antibodies

[0171] The N293F HC and N293F LC vectors were co-transfected into HEK293F cells. The culture medium was collected on the 7th day of culture, and the cells and suspended matter were removed by centrifugation and 0.22 μm top filtration. The supernatant was then collected and purified by protein A beads. The purity of the anti-B7-H3 antibody was analyzed by SDS-PAGE ( Figure 4 ).

[0172] (1) Protein A chromatography

[0173] The culture solution was centrifuged at 8,000 rpm for 30 minutes to remove cell debris and filtered using a 0.22 μm pore size bottle top filter (Steritop-GP Filter Unit. #SCGPS01RE, Millipore). In addition, 4 ml of protein A agarose resin slurry (KANEKA KanCapA TM, catalog number: KKC20170403_01) into an empty column (#BR731-1550, Bio-rad), and then fill the resin with 100ml of DPBS (#LB001-02) and wash. The filtered medium is loaded onto the filled resin and flows at a rate of 1ml per minute (#EP-1Econopump, Bio-Rad). After washing with 150ml of DPBS performance, elution is performed with 10ml of 0.1M glycine-HCl (pH3.3). 10% of 1MTris-HCl (pH9.0) is added to the eluent to neutralize the pH, and the buffer is replaced with DPBS using Amicon Ultra-10 (#UFC901096, Millipore). This process is performed about 3 times, then stopped when concentrated to about 1ml, and the concentration is measured with a nanodrop.

[0174] (2)SDS-PAGE

[0175] SDS-PAGE was performed to confirm the purity of the protein after purification. 3 μg of the purified protein sample was mixed with 5 μl of reducing sample buffer and non-reducing sample buffer, respectively, and boiled at 100°C for 3 minutes. A 12% gel was loaded into an electrophoresis tank (#165-8027, Bio-Rad), 1x electrophoresis buffer was filled inside the gel and filled to about 1 / 3 of the outside of the gel, and the prepared sample was loaded into the well using a pipette to prevent air bubbles from entering. 4 μl of AccuBand pre-stained protein marker was loaded into the leftmost well. The top cover of the gel chamber was installed and the power supply was connected, and electrophoresis was performed under the conditions of 200V and 1 hour. After one hour, the gel was separated from the tank and stained on a stirrer to the extent of immersion in the staining buffer for 1 hour. Then the staining solution was discarded, destained while stirring with the destaining solution for about 1 hour, and the destaining solution was replaced again to destain again. The gel after destaining was washed with distilled water, and the image was saved using an imaging device.

[0176] (3) Western blotting

[0177] After electrophoresis of SDS-PAGE for 1 hour as in (2), the gel was separated from the tank, the NC membrane was placed under the gel and the cassette was fixed to place it in the transfer tank (#165-8027, Bio-Rad), and after filling it with transfer buffer, electrophoresis was performed at 110V for about 2 hours. If the transfer is expected to be completed, the transfer is stopped, and then the NC membrane is taken out and blocked with blocking solution (1% skim milk / PBS) at room temperature for 1 hour. Then, anti-hFc-HRP (#31413, Thermo) and anti-His-HRP (#A7058, Sigma) as secondary antibodies were diluted 1:4000 in the blocking solution, and then placed on the NC membrane and reacted at room temperature for 1 hour. The NC membrane was washed 5 times with 1xPBST, 10 ml each time. Afterwards, ECL solution (#16024, Intron) was dispersed on the NC membrane and then detected by Chemi Doc (UVITEC, mini HD). The exposure time was set to 1 s, 30 s, and 1 min, respectively, and the best image was selected and saved.

[0178] [Example 4] Characteristics of B7-H3 monoclonal antibody

[0179] [Example 4-1] Specific binding capacity to human B7-H3 expressed on the cell surface (FACs)

[0180] By preparing cells expressing human B7-H3 to reach 0.5x10 6 cells, the antibodies were diluted to a certain multiple, and then reacted with the prepared cells at 4°C for 30 minutes. Thereafter, the cells were washed three times with PBS (#LB001-02, welgene) containing 2% fetal bovine serum, and reacted with anti-human IgG antibody (#FI-3000, Vectorlabs) or PE-anti-hIgG antibody (#555787, BD) conjugated with FITC (fluorescein isothiocyanate) fluorescent substance at 4°C for 20 minutes, and then washed in the same manner as above. The cells were suspended in PBS containing 0.5 ml of 2% FBS (#26140-079, Thermo), and then the binding force was analyzed using a FACSCanto II flow cytometer (BD Biosciences, USA). As a result, it was confirmed by geometric mean that the B7-H3 antibody bound to B7-H3 expressed on the cell surface in a concentration-dependent manner, and did not bind to Raji cells that did not express B7-H3, Jurkat cells that hardly expressed B7-H3, and HEK293E / KD cell lines in which B7-H3 was knocked down by shRNA (GIPZ humanCD276 shRNA Transfection Start Kit, #V3LHS_306029, Thermo). Figures 6a to 6d , and Table 7). The expression of B7-H3 in each cell line was determined by using an anti-human CD276 antibody (#331606, Biolegend) conjugated with PE fluorescent substance ( Figure 5 ).

[0181]

Table 7

[0182] FACS binding of B7-H3 antibodies in cell lines that express little or no B7-H3

[0183]

[0184] [Example 4-2] Thermal stability of anti-B7-H3 antibodies

[0185] The thermal stability of the antibody was tested using Differential Scanning Fluorimetry. The antibody protein was diluted to 3 μM, 45 μl in DPBS, then mixed with 5 μl of 200x sypro orange dye (#S6650, Thermo), and 50 μl was added to each qPCR tube (#TLS0851-white, Bio-Rad) and covered with a lid (#TCS0803, Bio-Rad). qPCR was performed using a Biorad CFX96 real-time PCR instrument. qPCR was reacted at 25°C for 30 seconds, then heated to 99°C in 0.5°C units, and reacted for 0.5 minutes at each temperature, and finally ended after 10 seconds at 25°C. Melt Tm (melting temperature) was used as the rate constant for the unwinding of the antibody structure. The results are shown in Table 8 below.

[0186]

Table 8

[0187] Melting temperature

[0188]

[0189] [Example 4-3] Affinity for B7-H3 antigen (OCTET)

[0190] The binding affinity of antibodies to B7-H3 antigens was determined by using an Octet QK instrument (Fortebio Inc.) based on the BLI (biofilm layer interference) principle. The screened anti-B7-H3 antibodies were fixed on an AHC (Anti-Human IgG FcCapture) biosensor (Fortebio Inc.), on which different concentrations of human B7-H3 antigens were combined to obtain affinity (KD). All buffers used were Kinetic buffers (Fortebio Inc.). First, the biosensor was immersed in a buffer to stabilize it, and the anti-B7-H3 antibody dissolved in the buffer at a concentration of 10 μg / ml was reacted for about 5 minutes and fixed on the AHC biosensor. The biosensor was washed with a buffer for 3 to 5 minutes to remove unfixed antibodies, and a 10-minute binding reaction was performed with B7-H3 antigens of different concentrations (30nM to 0.24nM), followed by a 10-minute dissociation reaction. All experiments were performed at 30°C and 1,000 rpm, and sensorgram data were collected according to time during the binding and dissociation processes. The equilibrium dissociation constant (KD) was calculated by applying a 1:1 global binding fitting model according to Octet data analysis software 9.0. As a result, the KD value was 0.04 to 2.0 nM, showing high affinity for the B7-H3 antigen. The results are shown in Table 9 below.

[0191]

Table 9

[0192] Affinity of anti-B7-H3 antibodies for B7-H3 antigen (OCTET)

[0193] name <![CDATA[K D (M)]]> Kon(1 / Ms) Koff(1 / s) CD276-033E03 <![CDATA[2x10 -9 ]]> <![CDATA[1x10 6 ]]> <![CDATA[2x10 -4 ]]> CD276-040F10 <![CDATA[5x10 -11 ]]> <![CDATA[7x10 5 ]]> <![CDATA[4x10 -5 ]]> CD276-051H04 <![CDATA[3x10 -10 ]]> <![CDATA[1x10 6 ]]> <![CDATA[4x10 -4 ]]> CD276-039C05 <![CDATA[4x10 -11 ]]> <![CDATA[6x10 5 ]]> <![CDATA[3x10 -5 ]]> CD276-39C05-LS-001E10 <![CDATA[6x10 -11 ]]> <![CDATA[1x10 6 ]]> <![CDATA[7x10 -5 ]]> CD276-39C05_LS_002A11 <![CDATA[1.2x10 -10 ]]> <![CDATA[1.3x10 6 ]]> <![CDATA[1.5x10 -4 ]]> CD276-39C05-LS-002B07 <![CDATA[2x10 -10 ]]> <![CDATA[3x10 6 ]]> <![CDATA[6x10 -4 <!-- 23 -->]]> CD276-39C05_LS_002D03 <![CDATA[3.0x10 -10 ]]> <![CDATA[1.6x10 6 ]]> <![CDATA[4.7x10 -4 ]]> CD276-39C05-LS-002H07 <![CDATA[3x10- 10 ]]> <![CDATA[9x10 5 ]]> <![CDATA[3x10 -4 ]]>

[0194] [Example 4-4] Binding ability to B7-H3 antigen (ELISA)

[0195] Place His-tagged B7-H3 into Pierce TMNickel coated plate (#152, pierce) wells and coated at room temperature for 1 hour, or Fc-tagged B7-H3 was placed in the wells of immunoplate (#4394454, Thermo) and coated overnight at 4°C. Mouse B7-H3 (#50973-M08H, Sino), rat B7-H3 (#80380-R08H, Sino), macaque B7-H3 (#90806-C08H, Sino) and human B7-H3 (#S1435, Ybiologics) were used as antigens. After washing three times with a washing solution (PBS containing 0.05% Tween 20 (#P9416, Sigma-Aldrich)), 300 μl of blocking solution 4% skim milk (#232120, Becton, Dickinson and Company) / PBS was added according to the conditions and placed at room temperature for 1 hour to block nonspecific binding. Add the antibody diluted serially at a certain dilution multiple, and perform rocking for 1 hour at room temperature to react. After washing in the same way, add anti-human κ antibody conjugated with HRP (#A7164, Sigma) and leave it at room temperature for 1 hour. After washing 5 times with washing solution, add TMB substrate solution (#T0440-1L, Sigma), and react for 3 minutes or more under light-shielding and room temperature conditions to confirm color development, and add 1N sulfuric acid solution (#S1478, Samchun) to terminate the reaction. Use a spectrophotometer (#GM3000, Promega or SpectraMaxM5, Moleculardevices) to measure the absorbance at 450nm. It was confirmed that the screened single B7-H3 antibody has a concentration-related binding affinity not only to the human B7-H3 antigen, but also to the mouse, rat and macaque B7-H3 antigen ( Figures 7a to 7e ).

[0196] [Example 4-5] Binding ability to FcRN at different pH (ELISA)

[0197] Using EZ-Link TM Biotin was coupled to FCGRT & B2M heterodimer protein (#CT009-H08H, Sino) using Sulfo-NHS-biotin (#15508, Thermo) and then prepared to 0.5 mg / mL and incubated in a Pierce plate blocked with ovalbumin (#A5503, Sigma). TM NeutrAvidin TM100ul was placed in each well of the high-capacity coated plate and shaken at room temperature for 2 hours for coating. After washing each well three times with sodium phosphate solution titrated to pH 6.0 and pH 7.2, 100ul of antibody diluted in each solution at a certain multiple was added to each well and shaken at room temperature for 1 hour for reaction. After washing three times with each solution, 100ul of peroxidase-labeled affinity-purified F(ab')2 fragment goat anti-human IgG (H+L) (#109-036-003, Jackson) diluted 1:5000 was added to each well and shaken at room temperature for 1 hour for reaction. After washing three times with sodium phosphate solution at pH 6.0, TMB substrate was added and the reaction was carried out under light-shielding conditions. When a color change was observed, the reaction was terminated with 0.5M / L sulfuric acid solution. In Glomax TM The absorbance at 450 nm was measured using the Discover system (#GM3000, Promega). It was confirmed that the anti-B7-H3 antibody bound to the FcRN-B2M complex only at pH 6.0 in a concentration gradient-dependent manner, but did not bind at pH 7.2 ( Figure 8 ).

[0198] [Example 4-6] Intracellular influx of B7-H3 antigen-antibody complex (Incucyte)

[0199] Calu-6 cell line was diluted to 1, 2 or 4x10 in 1 ml growth medium (RPMI1640 (#A10491-01, Gibco), 10% FBS (#26140-079, Gibco), 1XAntibiotic-Antimycotic (#15240-062, Gibco), 100xMEM NEAA (#11140-050, Gibco)). 5 Then, 50 μl was added to each well of a 96-well plate (#3595, Corning) and cultured in a 37°C, CO2 incubator for 24 hours or more. TM A498 cells were diluted to 1, 2, or 4×10 in 1% FBS (#26140-079, Gibco), 1X Antibiotic-Antimycotic (#15240-062, Gibco), and 100× MEM NEAA (#11140-050, Gibco). 4 Then add 50 μl to each well of a 96-well plate (#3595, Corning) and incubate in a 37°C, CO2 incubator for 24 hours or more.TM FabFluor red (#4722, essen bioscience) was mixed to a molar ratio of 1:3 and allowed to stand at 37°C for 15 minutes, and then 50 μl was carefully added to the wells containing cells. The plate was placed in a CO2 incubator equipped with IncuCyte ZOOM (essen bioscience, USA) and internalization was observed. The scanning conditions were 100 or 200 times magnification every 30 minutes during 24 hours, and images at 4 locations in each well were scanned at each measurement time point. The scanned images were edited in the IncuCyte ZOOM 2016B program and analyzed using the one phase association function in the nonlinear fitting of Graphpad PRISM ( Figure 9a ). Alternatively, after 24 hours or more of incubation, TM The intensity of red fluorescence was measured using the fluorescence filter (excitation: 627 nm, emission: 660-720 nm) in the Discover system (#GM3000, Promega). Figure 9b ). The characteristic of Incucyte FabFlour Red reagent is that it does not show fluorescence at neutral pH, but emits red fluorescence as the acidic pH increases. After the cell surface B7-H3 antigen binds to the antibody, it flows into the cell through the endosome, and when it fuses with the lysosome, it emits strong red fluorescence due to exposure to the acidic pH (~4.7) environment. After treatment with anti-B7-H3 antibody, it can be confirmed that the number of cells with red color on the inside of the cell increases over time (the number of red objects / well or the total area of ​​red objects, um2 / well). This shows that B7-H3 on the cell surface is the target for the antibody to flow into the cell, and the intracellular influx of anti-B7-H3 antibodies increases over time.

[0200] [Example 4-7] Intracellular influx of B7-H3 antigen-antibody complex (FabZAP)

[0201] The intracellular influx of antibodies was confirmed by using the FabZAP Antibody Internalization Kit (#IT-51) from Advanced Targeting System and using cytotoxicity efficacy. Saporin, as a ribosome inhibitor, causes cytotoxicity when it enters cells and is released. The FabZAP protein coupled to saporin was diluted to 45nM in the growth medium, and the antibody was diluted to a certain ratio with this solution, and then placed at room temperature for 15 minutes to react with saporin. Saporin used as a negative control group was prepared as a 10uM solution and then serially diluted at a certain ratio, and the control-SAP used as another negative control group was prepared as a 100nM solution and then diluted at a certain ratio. The day before treatment with each substance, the A498 renal cancer cell line was diluted with growth medium, seeded into a 96-well culture plate at 1x10e3 / well, and cultured in a 37°C, CO2 incubator for 16 hours or more. After 72 hours of treatment with antibodies and various substances, 50 μl of XTT substrate solution prepared with PBS was added to each well and reacted in a 37°C, CO2 incubator for 2 hours. TM The absorbance was measured by the Discover system at 450 nm. Saporin substances do not show cytotoxicity because they cannot penetrate the cell membrane, and the control-SAP without specific antigen binding has no effect on cell growth. In contrast, it was confirmed that the cytotoxic effect of the anti-B7-H3 antibody coupled with FabZAP increased with the increase of antibody concentration. This indicates that the anti-B7-H3 antibody bound to B7-H3 expressed on the surface of the A498 cell line has entered the cell, and the saporin released from the lysosome causes cytotoxicity ( Fig.10 ).

[0202] Industrial Applicability

[0203] Since the anti-B7-H3 antibody or antigen-binding fragment thereof according to the present invention can bind to human and non-human B7-H3 with high affinity and flow into cells after binding, the anti-B7-H3 antibody or antigen-binding fragment thereof, antibody-drug conjugates or multispecific antibodies comprising the same can be effectively used in the prevention, treatment or diagnosis of cancer or tumors, autoimmune diseases or inflammatory diseases.

[0204] As mentioned above, specific parts of the present invention have been described in detail, and those skilled in the art should understand that these specific technologies are only preferred embodiments, and the scope of the present invention is not limited thereto. Therefore, the protection scope of the present invention will be limited by the attached claims and their equivalents.

[0205]

Sequence Listing Free Text

[0206] Attach electronic file. <110> Y Biotech Co., Ltd. <120> Antibodies specifically binding to B7-H3 (CD276) and uses thereof <130> 2435 <150> KR 10-2019-0082492 <151> 2019-07-09 <160> 67 <170> PatentIn version 3.5 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH1 of CD276-040F10 <400> 1 Gly Tyr Thr Phe Ser Ser Tyr Trp 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH2 of CD276-040F10 <400> 2 Ile Asn Pro Gly Asn Gly His Thr 1 5 <210> 3 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> CDRH3 of CD276-040F10 <400> 3 Val Ala Asp Pro Arg Arg Pro Lys Val Pro Thr Ala Leu Phe Val Tyr 1 5 10 15 <210> 4 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-040F10 <400> 4 Gln Gly Ile Gly Thr Trp 1 5 <210> 5 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> CDRL2 of CD276-040F10 <400> 5 Ala Ala Ser 1 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-040F10 <400> 6 Gln Gln Ala Ile Asn Phe Pro Ile Thr 1 5 <210> 7 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH1 of CD276-051H04 <400> 7 Gly Phe Asn Phe His Asp Tyr Ala 1 5 <210> 8 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> CDRH2 of CD276-051H04 <400> 8 Ile Arg His Gln Arg Tyr Gly Gly Thr Thr 1 5 10 <210> 9 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> CDRH3 of CD276-051H04 <400> 9 Ala Arg Gly Ser Ser Ser Ser Ser Trp Tyr Leu Pro Asn Asp Tyr 1 5 10 15 <210> 10 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-051H04 <400> 10 Gln Asp Ile Ser Thr Trp 1 5 <210> 11 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> CDRL2 of CD276-051H04, CD276-039C05 <400> 11 Lys Ala Ser 1 <210> 12 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-051H04 <400> 12 Gln Gln Tyr Asn Arg Phe Trp Thr 1 5 <210> 13 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH1 of CD276-033E03 <400> 13 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 14 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH2 of CD276-033E03 <400> 14 Ile Ser Gly Ser Gly Gly Ser Arg 1 5 <210> 15 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> CDRH3 of CD276-033E03 <400> 15 Ala Ser His Thr Ile Pro Gly Ala Trp Asp Val 1 5 10 <210> 16 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-033E03 <400> 16 Thr Arg Asp Val Gly Gly Tyr Asn Tyr 1 5 <210> 17 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> CDRL2 of CD276-033E03 <400> 17 Asp Val Asn 1 <210> 18 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-033E03 <400> 18 Ser Ser Tyr Thr Thr Ser Ser Arg Arg Val 1 5 10 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH1 of CD276-039C05 <400> 19 Gly Gly Thr Phe Ser Ser Tyr Ala 1 5 <210> 20 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> CDRH2 of CD276-039C05 <400> 20 Ile Ile Pro Ile Leu Gly Ile Ala 1 5 <210> 21 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> CDRH3 of CD276-039C05 <400> 21 Ala Asn Gly Gly Asp Ser Ser Ser Trp Tyr Thr Phe Asp Tyr 1 5 10 <210> 22 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05 <400> 22 Gln Ser Ile Ser Arg Trp 1 5 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05 <400> 23 Gln Gln Tyr Asn Thr Phe Pro Leu Thr 1 5 <210> 24 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_001E10 <400> 24 Gln Thr Ile Asn Ser Trp 1 5 <210> 25 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_001E10 <400> 25 Gln Gln Tyr Asn Ser Tyr Ser Leu Thr 1 5 <210> 26 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_002A11 <400> 26 Gln Asn Ile Asn Ser Trp 1 5 <210> 27 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_002A11 <400> 27 Gln Gln Tyr Asp Ser Asn Pro Leu Thr 1 5 <210> 28 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_002B07 <400> 28 Gln Gly Ile Ser Ser Tyr 1 5 <210> 29 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_002B07 <400> 29 Gln Gln Tyr Tyr Ser Phe Pro Leu Thr 1 5 <210> 30 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_002C07 <400> 30 Gln Ser Ile Arg Ser Trp 1 5 <210> 31 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> CDRL2 of CD276-039C05_LS_002C07 <400> 31 Lys Ala Tyr 1 <210> 32 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_002C07 <400> 32 Gln Gln Tyr Asn Thr Ser Pro Leu Thr 1 5 <210> 33 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_002D03 <400> 33 Glu Thr Ile Ser Ser Trp 1 5 <210> 34 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_002D03 <400> 34 Gln Gln Tyr Tyr Ser Tyr Pro Ile Thr 1 5 <210> 35 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> CDRL1 of CD276-039C05_LS_002H07 <400> 35 Gln Ser Ile Asp Asn Trp 1 5 <210> 36 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> CDRL3 of CD276-039C05_LS_002H07 <400> 36 Gln Gln Tyr Asp Ser Asn Pro Leu Thr 1 5 <210> 37 <211> 123 <212> PRT <213> Artificial Sequence <220> <223> VH <400> 37 Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Ala Pro Gly Gln Arg Leu Glu Trp Met 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Val Thr Ile Thr Val Asp Lys Ser Ala Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Val Ala Asp Pro Arg Arg Pro Lys Val Pro Thr Ala Leu Phe Val Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 38 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 38 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Gly Ile Gly Thr Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Asp Ser Gly Val Pro Ser Arg Phe Ser Ala 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Ile Asn Phe Pro Ile 85 90 95 Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 <210> 39 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> VH <400> 39 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Thr Ser Gly Phe Asn Phe His Asp Tyr 20 25 30 Ala Leu Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Phe Ile Arg His Gln Arg Tyr Gly Gly Thr Thr Gln Tyr Ala Ala 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Gly Ile 65 70 75 80 Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Ala Arg Gly Ser Ser Ser Ser Ser Trp Tyr Leu Pro Asn Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 40 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 40 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Thr Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Arg Phe Trp Thr 85 90 95 Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 41 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> VH <400> 41 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ser Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Val Ile Ser Gly Ser Gly Gly Ser Arg Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser His Thr Ile Pro Gly Ala Trp Asp Val Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 42 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 42 Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15 Ser Ile Thr Ile Ser Cys Thr Gly Thr Thr Arg Asp Val Gly Gly Tyr 20 25 30 Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45 Met Ile Tyr Asp Val Asn Asn Arg Pro Ser Gly Val Ser Tyr Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80 Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Thr Ser 85 90 95 Ser Arg Arg Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 100 105 110 <210> 43 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> VH <400> 43 Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30 Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Arg Ile Ile Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Asn Gly Gly Asp Ser Ser Ser Trp Tyr Thr Phe Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Leu Ile Thr Val Ser Ser 115 120 <210> 44 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 44 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Lys Leu Thr Leu Thr Cys Arg Ala Ser Gln Ser Ile Ser Arg Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Tyr Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Thr Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Thr Phe Pro Leu 85 90 95 Thr Phe Ala Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 45 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 45 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Asn Ile Thr Cys Arg Ala Ser Gln Thr Ile Asn Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Tyr Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ala Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Ser Tyr Ser Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 46 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 46 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Leu Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asn Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Tyr Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Thr Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Ser Tyr Tyr Cys Gln Gln Tyr Asp Ser Asn Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 47 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 47 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Phe Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 48 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 48 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Gly Gln Ser Ile Arg Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Glu Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Tyr Tyr Leu Gln Thr Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ala Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asn Thr Ser Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 49 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 49 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Thr Ile Ser Ser Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Ile 85 90 95 Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys 100 105 <210> 50 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> VL <400> 50 Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asp Asn Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Lys Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Asp Asp Phe Ala Ser Tyr Tyr Cys Gln Gln Tyr Asp Ser Asn Pro Leu 85 90 95 Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105 <210> 51 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> VH <400> 51 caggtgcagc tggtggagtc tgggggaggc ttggtacagt cgggggggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120 ccagggaagg ggctggagtg ggtctcagtt attagtggta gtggtggtag cagatactac 180 gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagtctgag agccgaggac acggccgtgt attactgtgc gagtcatact 300 ataccaggag cttgggatgt ctggggccaa gggacactgg tcaccgtctc ctca 354 <210> 52 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 52 cagtctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccatc 60 tcctgcactg gaaccacccg tgacgtcggt ggttataact atgtctcctg gtaccaacaa 120 caccccggca aagcccccaa actcatgatt tatgatgtca ataatcggcc ctcaggggtt 180 tcttatcgct tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc 240 caggctgagg acgaggctga ttattactgc agctcatata caaccagcag cagaagggtc 300 ttcggaactg ggaccaaggt caccgtccta 330 <210> 53 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> VH <400> 53 caggtgcagc tggtagagtc tggggctgaa gtgaagaagc ctggggcttc agtgaagctg 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gcgccaggcc 120 cctggacaac gccttgagtg gatgggagag attaatcctg gcaacggtca tactaactac 180 aacgagaagt tcaagtcacg cgtgacaatc actgtagaca aatccgcgag cacagcctac 240 atggagctca gcagcctgag atctgaggac acggccgtgt attactgtgt tgcagatccg 300 agaaggccta aagtaccaac tgctttgttt gtctattggg gccagggaac cctggtcacc 360 gtctcctca 369 <210> 54 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 54 gacatccaga tgacccagtc tccatcttcc gtgtctgcat ctgtaggaga cagagtcacc 60 atcagttgtc gggcgagtca gggtattggc acctggttag cctggtatca gcagaagcca 120 ggtaaagccc ctagactctt gatctatgct gcatccagtt tggacagtgg ggtcccatcg 180 agattcagcg ccagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240 gaagattttg caacttacta ctgtcaacag gctatcaatt tcccgatcac cttcggccaa 300 gggacacgac tggaaatcaa a 321 <210> 55 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> VH <400> 55 caggtgcagc tggtggagtc tgggggaggc ttggtacagc caggacggtc cctgagactc 60 tcctgtacaa cctctggatt caatttccat gattatgctc tgtcctgggt ccggcaggct 120 ccagggaagg ggctggaatg ggtgagtttc attagacacc aacgttatgg tgggacaacg 180 cagtacgccg cgtctgtgaa aggcagattc accatctcaa gagacgattc caaaggcatc 240 gcatacctgc aaatgaacag tctgagagcc gaggacacgg ccgtgtatta ctgtgcgaga 300 ggatcttcca gcagcagctg gtaccttcca aatgactact ggggccaggg aaccctggtc 360 accgtctcct ca 372 <210> 56 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 56 gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60 atcacttgcc gggccagtca ggacattagt acctggttgg cctggtatca gcagaagcca 120 gggaaagccc ctaaactcct gatctataag gcgtctagtt tacaaagtgg ggtcccatca 180 agattcagcg gcagtggatc tgggacagaa ttcactctca ctatcagcag cctgcagcct 240 gatgattttg caacttatta ctgccaacag fatherggt tttggacatt cggccaaggg accaaggtgg aaatcaaa <210> 57 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> VH <400> 57 60. caggtgcagc tggtggagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggaagg atcatcccta tccttggtat agcaaactac gcacagaagt tccagggcag agtcacgatt accgcggaca aatccacgag cacagcctac atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gaatggaggg 360. gatagcagca gctggtacac ctttgactac tggggccagg gaaccctgat caccgtctcc tca 363 <210> 58 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 58 60. gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga caaactcacc ctcacctgcc gggccagtca gagtattagt agatggttgg cctggtatca gcagaaacct 180. ggaaaagccc ctaaactcct catctaag gcatcttatt tacaaactgg ggtcccgtca agttcagcg gcagtggaac tgggacagaa ttcactctca ccatcagcag cctgcagcct gatgattttg cgacttatta ctgccaacaa tataactt tcccgctcac tttcgccgga gggaccaagg tggaatcaa a <210> 59 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 59 gacatccaga tgacccagtc tccttccacc ctgtctgctt ctgtaggaga cagagtcaat atcacttgcc gggccagtca aactat agttggttgg cctggtatca gcagaaacca gggaaagccc ctaaactcct catctatag gcatcttatt tacaaactgg ggtcccgtca agttcagcg gcagtggagc tgggacagaa ttcactctca ccatcagcag cctgcagcct gatgattttg cgacttatta ctgccaacag tatatagtt attctcttac tttcggcgga gggaccaagg scientist a <210> 60 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 60 60. gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgttggtga cagactcacc atcacttgtc gggccagtc gaatattaat agttggttgg cctggtatca gcagaaacct 180. ggaaaagccc ctaaactcct catctaag gcatcttatt tacaaactgg ggtcccgtca agttcagcg gcagtggatc tgggacagaa ttcaccctca ccatcaccag cctgcagcct gacgattttg caagttatta ctgccaacag tatgacagta atccgctcac tttcggcgga gggaccaagg tggaatcaa a <210> 61 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 61 60. gacatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc atcacttgcc gggccagtca gggcattagc agttatttag cctggtatca gcaaaaacca 120 gggaaagccc ctaagctcct gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180 aggttcagcg gcagtggatc tgggacggat ttcactctca ccatcagcag cctgcagcct gaagattttg caacttatta ctgccaacag tattattctt ttccgctcac tttcggcgga gggaccaagg tggaatcaa a <210> 62 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 62 60. gacatccaga tgacccagtc tccttctacc ctgtctgctt ctgtcgggga cagagtcacc atcacttgcc gggccggtca gagtattcgt agttggctgg cctggtatca gcagaaacca ggggaggccc ctaaactcct catctatag gcatattatt tacaaactgg ggtcccgtca agttcagcg gcagtggagc tgggacagaa ttcactctca ccatcagcag cctgcagcct gatgattttg cgacttatta ctgccaaca fatherctt cccccctcac tttcggcgga gggaccaagg tggaatcaa a <210> 63 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 63 60. gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc atcacttgcc gggccagtga gactattagt agctggttgg cctggtatca gcagaaacca gggaaagccc ctaagctcct gatctaag gcatctagtt tacaaagtgg ggtcccatca 240. aggttcagcg gcagcggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct gatgattttg caacttatta ctgccaacag father atccgatcac cttcggccaa gggacacgac tggagatcaa a <210> 64 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> VL <400> 64 60. gacatccaga tgacccagtc tccttccacc ctgtctgcat ctgttggaga cagagtcacc atcacttgcc gggccagtca gagtattgat aattggttgg cctggtatca gcagaagcca gggaaagccc ctaagctcct gatctaag gcgtctagtt tacaaagtgg ggtcccatca aggttcagcg gcagtggatc tgggacagaa ttcactctca ccatcagcag cctgcagcct 240 gacgatttg caagttatta ctgccaacag tatgacagta atccgctcac ttcggcgga 300 gggaccaagg tggaaatcaa a 321 <210> 65 <211> 438 <212> PRT <213> Artificial Sequence <220> <223> B7-H3 <400> 65 Leu Glu Val Gln Val Pro Glu Asp Pro Val Val Ala Leu Val Gly Thr 1 5 10 15 Asp Ala Thr Leu Cys Cys Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu 20 25 30 Ala Gln Leu Asn Leu Ile Trp Gln Leu Thr Asp Thr Lys Gln Leu Val 35 40 45 His Ser Phe Ala Glu Gly Gln Asp Gln Gly Ser Ala Tyr Ala Asn Arg 50 55 60 Thr Ala Leu Phe Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg 65 70 75 80 Leu Gln Arg Val Arg Val Ala Asp Glu Gly Ser Phe Thr Cys Phe Val 85 90 95 Ser Ile Arg Asp Phe Gly Ser Ala Ala Val Ser Leu Gln Val Ala Ala 100 105 110 Pro Tyr Ser Lys Pro Ser Met Thr Leu Glu Pro Asn Lys Asp Leu Arg 115 120 125 Pro Gly Asp Thr Val Thr Ile Thr Cys Ser Ser Tyr Gln Gly Tyr Pro 130 135 140 Glu Ala Glu Val Phe Trp Gln Asp Gly Gln Gly Val Pro Leu Thr Gly 145 150 155 160 Asn Val Thr Thr Ser Gln Met Ala Asn Glu Gln Gly Leu Phe Asp Val 165 170 175 His Ser Ile Leu Arg Val Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys 180 185 190 Leu Val Arg Asn Pro Val Leu Gln Gln Asp Ala His Ser Ser Val Thr 195 200 205 Ile Thr Pro Gln Arg Ser Pro Thr Gly Ala Val Glu Val Gln Val Pro 210 215 220 Glu Asp Pro Val Val Ala Leu Val Gly Thr Asp Ala Thr Leu Arg Cys 225 230 235 240 Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn Leu Ile 245 250 255 Trp Gln Leu Thr Asp Thr Lys Gln Leu Val His Ser Phe Thr Glu Gly 260 265 270 Arg Asp Gln Gly Ser Ala Tyr Ala Asn Arg Thr Ala Leu Phe Pro Asp 275 280 285 Leu Leu Ala Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val Arg Val 290 295 300 Ala Asp Glu Gly Ser Phe Thr Cys Phe Val Ser Ile Arg Asp Phe Gly 305 310 315 320 Ser Ala Ala Val Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys Pro Ser 325 330 335 Met Thr Leu Glu Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr Val Thr 340 345 350 Ile Thr Cys Ser Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val Phe Trp 355 360 365 Gln Asp Gly Gln Gly Val Pro Leu Thr Gly Asn Val Thr Thr Ser Gln 370 375 380 Met Ala Asn Glu Gln Gly Leu Phe Asp Val His Ser Val Leu Arg Val 385 390 395 400 Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn Pro Val 405 410 415 Leu Gln Gln Asp Ala His Gly Ser Val Thr Ile Thr Gly Gln Pro Met 420 425 430 Thr Phe Pro Pro Glu Ala 435 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 66 ctggaggtcc aggtccctga agacc 25 <210> 67 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 67 ggcctctggg gggaatgtca taggc 25

Claims

1. An anti-B7-H3 antibody or an antigen-binding fragment thereof, comprising: The heavy chain CDR1 shown in SEQ ID No: 1; The heavy chain CDR2 shown in SEQ ID No: 2; The heavy chain CDR3 shown in SEQ ID No: 3; The light chain CDR1 shown in SEQ ID No: 4; The light chain CDR2 shown in SEQ ID No: 5; and The light chain CDR3 shown in SEQ ID No:

6.

2. The anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1, characterized in that: It comprises the heavy chain variable region shown in SEQ ID NO:

37.

3. The anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1, characterized in that: It comprises the light chain variable region shown in SEQ ID No:

38. 4 . A nucleic acid encoding the anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1 . A recombinant expression vector comprising the nucleic acid according to claim 4 .

6. A cell transformed with the recombinant expression vector according to claim 5.

7. The cell according to claim 6, characterized in that The cell is selected from animal cells, plant cells, yeast, Escherichia coli and insect cells.

8. The cell according to claim 6, characterized in that The cells are selected from COS-7 (monkey kidney cell 7), NSO cells, SP2 / 0 cells, CHO (Chinese hamster ovary) cells, W138, BHK (baby hamster kidney) cells, MDCK, myeloma cell lines, HuT 78 cells, HEK293 cells, Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis, Staphylococcus, Aspergillus, Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces, and Neurospora crassa.

9. A method for preparing an anti-B7-H3 antibody or an antigen-binding fragment thereof, comprising: (i) a step of culturing the cell according to claim 6; and (ii) a step of recovering the anti-B7-H3 antibody or the antigen-binding fragment thereof from the obtained cell culture.

10. A pharmaceutical composition for preventing or treating cancer or tumor, autoimmune disease or inflammatory disease, comprising as an effective ingredient the anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1 and a pharmaceutically acceptable additive. 11 . A composition for diagnosing cancer or tumor, autoimmune disease or inflammatory disease, comprising the anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1 .

12. Use of the anti-B7-H3 antibody or antigen-binding fragment thereof according to claim 1 in the preparation of a medicament for treating cancer or tumor, wherein the cancer or tumor is selected from prostate cancer, ovarian cancer, breast cancer, colon cancer, kidney cancer, lung cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma and neuroblastoma.

Images