CRISPR multi-target detection method and kit

Abstract

The present invention belongs to the field of nucleic acid detection, and provides a method and kit for rapid detection of multiple targets using the CRISPR method. The present invention provides a detection system for detecting target nucleic acid molecules, comprising: (a) n guide RNA-reporter nucleic acid composite probes with specific structures; and (b) Cas protein, wherein the Cas protein is a Cas protein with bypass single-stranded nucleic acid cleavage activity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a CRISPR multi-target detection method and a kit thereof. Background Art

[0002] CRISPR diagnostic methods using Cas13 or Cas12 proteins are hailed as the next generation of detection technologies (called SHERLOCK and HOLMES, respectively) because they are fast, sensitive, specific, simple and inexpensive. The ability of Cas12 and Cas13 proteins to be used in nucleic acid detection is based on their ability to bypass (or trans) cleave, that is, under the guidance of artificially designed guide RNAs, bind to nucleic acid fragments of specific sequences and then cut single-stranded nucleic acid probes, thereby generating a detectable signal. The difference between Cas12 and Cas13 is that the Cas13 protein binds to RNA targets and cuts RNA probes, while Cas12 binds to DNA targets and cuts single-stranded DNA probes.

[0003] In principle, if Cas13 is used to detect conventional DNA targets, the target DNA is amplified and a promoter sequence such as T7 is introduced during the process; then in vitro transcription is required to generate template RNA for Cas13 to recognize and bind. In addition, the RNA reporter probe used in the Cas13 detection process is at great risk of being degraded by RNase, resulting in a high background signal value in the detection system. In contrast, the Cas12-based detection method has more advantages because it does not require in vitro transcription or RNA reporter probes.

[0004] Methods and technologies for simultaneously detecting multiple targets within a single assay system are crucial for the expanded application of in vitro diagnostics. Currently, a multi-target detection method has been developed based on the Cas13 protein. The key to this approach is the use of different species-derived Cas13 proteins that exhibit distinct bypass cleavage activities against different RNA reporter probes. However, no studies have reported on this property of Cas12; therefore, it is necessary to develop a novel method for multi-target nucleic acid detection using Cas proteins. Summary of the Invention

[0005] The purpose of the present invention is to provide a multi-target detection method and kit based on CRISPR-Cas protein.

[0006] In a first aspect of the present invention, a detection system for detecting a target nucleic acid molecule is provided, the detection system comprising:

[0007] (a) n guide RNA-reporter nucleic acid composite probes, wherein the guide RNA-reporter nucleic acid composite probe has a structure as shown in Formula Ia, Ib, Ic or Id,

[0008] Z1-Z2-Z3-Z4-Z5 (Formula Ia)

[0009]

[0010] Z5-Z4-Z3-Z2-Z1 (Formula Ic)

[0011]

[0012] in,

[0013] Z1 is the first stem-loop structure region;

[0014] Z2 is null or nucleic acid linking region;

[0015] Z3 is the guide RNA region;

[0016] Z5 is a single-stranded nucleic acid to be cleaved with a detectable label, wherein the detectable label presents different detection states when the single-stranded nucleic acid to be cleaved is cleaved and when it is not cleaved, thereby being detected;

[0017] Wherein, when the target nucleic acid is not present in the detection system, Z3 and Z5 form a complementary paired double-stranded structure region; and when the target nucleic acid is present in the detection system, Z3 and Z5 do not form the complementary paired double-stranded structure region;

[0018] Z4 is absent, or is a chemical bond or connecting region for connecting Z3 and Z5;

[0019] hydrogen bonds for complementary base pairing;

[0020] And, n is a positive integer n≥1; and

[0021] (b) Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity.

[0022] In another preferred embodiment, the Cas protein is selected from the following group: Cas12 type, Cas13a type, Cas13b type, Cas14 type, CasΦ, or a combination thereof.

[0023] In another preferred embodiment, when the Cas protein is Cas12 type and / or Cas13a type and / or Cas14 type, the guide RNA-reporter nucleic acid composite probe has a structure as shown in Formula Ia or Ib.

[0024] In another preferred embodiment, when the Cas protein is Cas13b type, the guide RNA-reporter nucleic acid composite probe has a structure as shown in Formula Ic or Formula Id.

[0025] In another preferred embodiment, the Cas12 type is selected from the following group: Cas12a, Cas12b, Cas12d, Cas12g, Cas12i, or a combination thereof.

[0026] In another preferred embodiment, when the target nucleic acid is not present in the detection system, the guide RNA-reporter nucleic acid composite probe has a structure of Formula IIa:

[0027]

[0028] Where,

[0029] Z1, Z2, Z3, Z4 and Z5 are as described above,

[0030] Hydrogen bonds for complementary base pairing.

[0031] In another preferred embodiment, the "Z1-Z2-Z3" in the structural formulas of Formula Ia, Formula IIa, and Formula Ic, and the "Z3-Z2-Z1" in Formula Id are from 5' to 3'.

[0032] In another preferred embodiment, when the target nucleic acid is not present in the detection system, the guide RNA-reporter nucleic acid composite probe has a structure of Formula IIc:

[0033]

[0034] Where,

[0035] Z1, Z2, Z3, Z4 and Z5 are as described above,

[0036] Hydrogen bonds for complementary base pairing.

[0037] In another preferred embodiment, the complementary paired double-stranded structure region includes a double-stranded structure region formed by partial or complete complementary pairing of Z3 and Z5.

[0038] In another preferred embodiment, the complementary paired double-stranded structure region is a double-stranded structure region formed by complete complementary pairing of Z3 and Z5.

[0039] In another preferred embodiment, the Z1, Z2 and Z3 are used to guide the Cas protein to bind to the target nucleic acid.

[0040] In another preferred embodiment, the Z1 is used to bind to or anchor the Cas protein.

[0041] In another preferred embodiment, the guide RNA region guides the Cas protein to bind to the target nucleic acid through complementary pairing with the target nucleic acid.

[0042] In another preferred embodiment, Z3, Z4 and Z5 form a second stem-loop structure region, wherein Z4 is a loop region (including loop regions with simple structures and complex structures).

[0043] In another preferred embodiment, the Z1 is substantially or entirely composed of RNA.

[0044] In another preferred embodiment, the Z3 is substantially or entirely composed of RNA.

[0045] In another preferred embodiment, the guide RNA-reporter nucleic acid composite probe is single-stranded.

[0046] In another preferred embodiment, the stem-loop structure in Z1 is a crRNA (or CRISPR RNA) stem-loop structure.

[0047] In another preferred embodiment, the length of Z1 is 10-300 nt, preferably 19-100 nt, and more preferably 19-91 nt.

[0048] In another preferred embodiment, the Z2 is a nucleic acid linking region with no residue or a length of 0-20 nt.

[0049] In another preferred embodiment, in the system:

[0050] (i) n ≥ 2, and n is a positive integer;

[0051] (ii) the detectable label is a fluorescent group, Z5 carries a fluorescent group, and Z4 and / or Z5 also carries a quencher group, and a fluorescent signal emitted by the fluorescent group can be detected when and only when the single-stranded nucleic acid to be cleaved is cleaved; and / or

[0052] (iii) Among the n guide RNA-reporter nucleic acid composite probes, the fluorescent groups are different from each other and can be distinguished.

[0053] In another preferred embodiment, the detectable label is a fluorescent group, and Z5 carries a quenching group, and Z4 and / or Z5 also carry a fluorescent group. When and only when the single-stranded nucleic acid to be cleaved is cleaved, the fluorescent signal emitted by the fluorescent group can be detected.

[0054] In another preferred embodiment, the detectable label is a fluorescent group, wherein the fluorescent group is located in any segment among Z5, Z4 and Z3, and the quencher group is located in any segment among Z5, Z4 and Z3, and the fluorescent signal emitted by the fluorescent group can be detected when and only when the single-stranded nucleic acid to be cut is cut.

[0055] In another preferred embodiment, the fluorescent group and the quenching group are not located at Z3 at the same time.

[0056] In another preferred example, the Z3 contains a nucleic acid sequence that can guide the Cas protein to specifically bind to the target nucleic acid molecule.

[0057] In another preferred embodiment, the length of Z3 is 15-50 nt, preferably 16-40 nt, and more preferably 16-34 nt.

[0058] In another preferred embodiment, Z1, Z2 and Z3 are all RNA nucleic acid sequences.

[0059] In another preferred embodiment, the Z4 is a DNA and / or RNA nucleic acid sequence.

[0060] In another preferred embodiment, the Z5 is a single-stranded DNA nucleic acid sequence, or a single-stranded RNA nucleic acid sequence, or a nucleic acid sequence having both RNA and DNA.

[0061] In another preferred embodiment, the Z5 contains nucleotides based on natural bases, or nucleotides based on natural bases and non-natural bases.

[0062] In another preferred embodiment, the nucleotides include ribonucleic acid, deoxyribonucleic acid, peptide nucleic acid, or a combination thereof.

[0063] In another preferred embodiment, the natural base is selected from the following group: A, T, C, G, U, and I.

[0064] In another preferred embodiment, the length of Z5 is 3-50 nt, preferably 4-30 nt, and more preferably 6-12 nt.

[0065] In another preferred embodiment, the label carried by Z5 is a fluorescent group and a quenching group.

[0066] In another preferred embodiment, the fluorescent group and the quencher group are independently located at the 5' end, the 3' end and / or the middle of the Z5.

[0067] In another preferred embodiment, in the reaction system, each guide RNA-reporter nucleic acid composite probe carries a different fluorescent group and a different or the same quenching group.

[0068] In another preferred embodiment, the detection system further contains m types of target nucleic acid molecules to be detected, wherein m is a positive integer and m≤n.

[0069] In another preferred embodiment, the target nucleic acid molecule includes a target nucleic acid molecule derived from a plant, an animal, an insect, a microorganism, a virus, or a combination thereof.

[0070] In another preferred embodiment, the target nucleic acid is an artificially synthesized or naturally occurring nucleic acid.

[0071] In another preferred embodiment, the target nucleic acid includes a wild-type or mutant nucleic acid.

[0072] In another preferred embodiment, the target nucleic acid molecule is a target DNA or RNA.

[0073] In another preferred embodiment, the target DNA includes DNA that has not been reverse transcribed or DNA obtained by reverse transcription or amplification of RNA (eg, cDNA, etc.).

[0074] In another preferred embodiment, the target RNA includes RNA that has not been transcribed or is obtained by transcription from DNA.

[0075] In another preferred embodiment, the detection includes: qualitative detection or quantitative detection.

[0076] In another preferred embodiment, the detection system further contains (c) a buffer solution.

[0077] In another preferred embodiment, the detection system further contains a target nucleic acid molecule to be detected.

[0078] In another preferred embodiment, the detection system further contains reagents for nucleic acid amplification reaction.

[0079] In another preferred embodiment, the detection system further comprises:

[0080] (d1) a polymerase for amplifying target DNA;

[0081] (d2) optionally a reverse transcriptase for reverse transcription;

[0082] (d3) optionally a transcriptase for transcription;

[0083] (d4) dNTPs for amplification reaction and / or reverse transcription reaction;

[0084] (d5) NTPs used in the transcription reaction.

[0085] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 1×10 -9 nM to 1×10 3 nM; preferably 1×10 -8 nM to 1×10 2 nM.

[0086] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 1 to 1×10 15 Copies / ml, preferably 1 to 10 10 copies / ml, preferably 1 to 10 5 copies / ml.

[0087] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 1 to 1000 copies / ml, preferably 1 to 100 copies / ml, and more preferably 1 to 10 copies / ml.

[0088] In another preferred embodiment, in the detection system, the molar ratio of each guide RNA-reporter nucleic acid composite probe to the corresponding target nucleic acid molecule is 1:1 to 10 14 : 1, preferably 10: 1 to 10 5 : 1, more preferably 20: 1 to 10 3 :1.

[0089] In another preferred embodiment, the Cas protein is selected from the group consisting of Cas12a, Cas12b, Cas12d, Cas12g, Cas12i, Cas13a, Cas13b, Cas14 and CasΦ.

[0090] In another preferred embodiment, the Cas12a protein is selected from the group consisting of FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a and Lb4Cas12a.

[0091] In another preferred embodiment, the Cas12a protein is LbCas12a or FnCas12a.

[0092] In another preferred embodiment, the Cas12b protein is selected from the group consisting of AaCas12b, AacCas12b, AapCas12b, AbCas12b, AkCas12b, AmCas12b, BhCas12b, BsCas12b, EbCas12b and LsCas12b.

[0093] In another preferred embodiment, the Cas12g protein is Cas12g1.

[0094] In another preferred embodiment, the Cas12i protein is Cas12i1 or Cas12i2.

[0095] In another preferred embodiment, the Cas13a protein is selected from the group consisting of LshCas13a, LwaCas13a, LbaCas13a, LseCas13a, LbmCas13a, LbnCas13a, CamCas13a, CgaCas13a, Cga2Cas13a, PprCas13a, LweCas13a, Lwa2Cas13a, LbfCas13a, RcsCas13a, RcrCas13a, RcdCas13a and LbuCas13a.

[0096] In another preferred embodiment, the Cas13b protein is selected from the group consisting of BzoCas13b, PinCas13b, PbuCas13b, AspCas13b, PsmCas13b, RanCas13b, PauCas13b, PsaCas13b, Pin2Cas13b, CcaCas13b, PguCas13b, PspCas13b, PigCas13b and Pin3Cas13b.

[0097] In another preferred embodiment, the Cas14 protein is selected from the group consisting of Cas14a, Cas14b, Cas14c, Cas14d, Cas14e, Cas14f, Cas14g, Cas14h and Cas14u.

[0098] In another preferred embodiment, the CasΦ protein is selected from the group consisting of CasΦ-1, CasΦ-2 and CasΦ-3.

[0099] In another preferred embodiment, n is a positive integer between 2 and 200; preferably, n is a positive integer between 2 and 100; more preferably, n is a positive integer between 2 and 20; more preferably, n is a positive integer between 2 and 10.

[0100] In a second aspect of the present invention, a kit for detecting a target nucleic acid molecule is provided, the kit comprising:

[0101] i) a first container and n guide RNA-reporter nucleic acid complex probes having a structure as shown in Formula Ia, Ib, Ic or Id located in the first container,

[0102] Z1-Z2-Z3-Z4-Z5 (Formula Ia)

[0103]

[0104] Z5-Z4-Z3-Z2-Z1 (Formula Ic)

[0105]

[0106] in,

[0107] Z1 is the first stem-loop structure region;

[0108] Z2 is null or nucleic acid linking region;

[0109] Z3 is the guide RNA region;

[0110] Z5 is a single-stranded nucleic acid to be cleaved with a detectable label, wherein the detectable label presents different detection states when the single-stranded nucleic acid to be cleaved is cleaved and when it is not cleaved, thereby being detected;

[0111] Wherein, when the target nucleic acid is not present in the detection system, Z3 and Z5 form a complementary paired double-stranded structure region; and when the target nucleic acid is present in the detection system, Z3 and Z5 do not form the complementary paired double-stranded structure region;

[0112] Z4 is absent, or is a chemical bond or connecting region for connecting Z3 and Z5;

[0113] hydrogen bonds for complementary base pairing;

[0114] Moreover, n is a positive integer n≥1;

[0115] ii) a second container and a Cas protein located in the second container, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity;

[0116] iii) an optional third container and a buffer located in the third container.

[0117] In another preferred embodiment, the target nucleic acid molecule is a target DNA and / or a target RNA.

[0118] In another preferred embodiment, the first container, the second container and the third container may be the same container or different containers.

[0119] In another preferred embodiment, the kit further comprises:

[0120] iv) a fourth container and a polymerase for amplifying the target DNA within the fourth container;

[0121] v) an optional fifth container and a reverse transcriptase for reverse transcription and / or a transcriptase for transcription located within the fifth container;

[0122] vii) a sixth container and dNTPs for amplification reaction and / or reverse transcription reaction and / or NTPs for transcription reaction located in the sixth container.

[0123] In another preferred embodiment, the detection is used to simultaneously detect two or more different target nucleic acid molecules.

[0124] In another preferred embodiment, the detection system further contains reagents for nucleic acid amplification reaction.

[0125] In another preferred example, the fourth container, the fifth container and the sixth container may be the same container or different containers.

[0126] In another preferred embodiment, two, more or all of the first to sixth containers may be the same container or different containers.

[0127] In a third aspect of the present invention, a method for detecting a target nucleic acid molecule in a sample is provided, comprising the following steps:

[0128] (i) providing a detection system for simultaneously detecting multiple target nucleic acid molecules as described in the first aspect of the present invention, wherein the detection system further comprises a sample to be detected; and

[0129] (ii) detecting whether the guide RNA-reporter nucleic acid complex probe in the detection system is cleaved by the Cas protein, wherein the cleavage is a bypass (or trans) cleavage of the single-stranded nucleic acid;

[0130] Among them, if the guide RNA-reporter nucleic acid composite probe is cut by the Cas protein, it indicates that the corresponding target nucleic acid molecule exists in the sample; and if the guide RNA-reporter nucleic acid composite probe is not cut by the Cas protein, it indicates that the corresponding target nucleic acid molecule does not exist in the sample.

[0131] In another preferred embodiment, the sample to be detected includes a non-amplified sample and an amplified (or nucleic acid amplified) sample.

[0132] In another preferred embodiment, the sample to be detected is a sample obtained by amplification.

[0133] In another preferred embodiment, the method of nucleic acid amplification is selected from the following group: PCR amplification, LAMP amplification, RPA amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription-mediated amplification, rolling circle amplification, HDA, SPIA, NEAR, TMA and SMAP2.

[0134] In another preferred embodiment, the PCR includes high temperature PCR, normal temperature PCR, or low temperature PCR.

[0135] In another preferred embodiment, the detection in step (ii) comprises fluorescence detection.

[0136] In another preferred embodiment, the fluorescence detection method is performed using an enzyme-labeled instrument, a fluorescence spectrophotometer, or a fluorescence quantitative PCR instrument.

[0137] In another preferred embodiment, the method is an in vitro detection method.

[0138] In another preferred embodiment, the sample is an in vitro or ex vivo sample.

[0139] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0140] In another preferred embodiment, the method is diagnostic.

[0141] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0142] Figure 1 A schematic diagram of a guide RNA-reporter nucleic acid complex probe (Formula Ia) is shown. In the figure, F represents a fluorescent group (or other detectable label), and Q represents a quencher group (or other quenching functional group for quenching the F signal).

[0143] Figure 2 CRISPR multi-target assay results are shown.

[0144] in, Figure 2 A shows the colors representing 8 different samples; Figure 2 B is the Green channel: detecting FAM fluorescence, and the target sequence detected is the DNMT1-3 site; Figure 2 C is the Orange channel: detects ROX fluorescence, and the target sequence detected is the sry site).

[0145] Figure 3 A schematic diagram of another guide RNA-reporter nucleic acid complex probe (Formula Ib) is shown. In the figure, F represents a fluorescent group (or other detectable label), and Q represents a quenching group (or other quenching functional group for quenching the F signal).

[0146] Figure 4 A schematic diagram of another guide RNA-reporter nucleic acid complex probe (Formula Ic) is shown. In the figure, F represents a fluorescent group (or other detectable label), and Q represents a quenching group (or other quenching functional group for quenching the F signal).

[0147] Figure 5A schematic diagram of another guide RNA-reporter nucleic acid complex probe (Formula Id) is shown. In the figure, F represents a fluorescent group (or other detectable label), and Q represents a quenching group (or other quenching functional group for quenching the F signal).

[0148] Figure 6 The structure of the guide RNA-reporter nucleic acid composite probe in Example 2 or Example 3 is shown.

[0149] Figure 7 Results of a Cas12b multi-target detection test are shown.

[0150] Figure 8 Results of a Cas14a1 multi-target detection test are shown. DETAILED DESCRIPTION

[0151] After extensive and in-depth research and extensive screening, the inventors have developed for the first time a method based on CRISPR technology that can simultaneously detect multiple target nucleic acid molecules in the same detection system. Specifically, the inventors have developed a guide RNA-reporter nucleic acid composite probe, which contains in series the first stem-loop structure region of RNA, the guide RNA region, the linker region, and a single-stranded nucleic acid to be cleaved with a fluorescent group and a quencher group. In the same detection system, multiple different guide RNA-reporter nucleic acid composite probes can be contained, and each probe targeting different target nucleic acid molecules has a different fluorescent group and quencher group. Therefore, the different target nucleic acid molecules detected can be distinguished based on the different fluorescent signals detected. Using this multi-target detection method based on CRISPR technology, different target nucleic acid molecules contained in the same sample system can be detected simultaneously, quickly, and accurately. The present invention was completed on this basis.

[0152] the term

[0153] The term "CRISPR" refers to clustered regularly interspaced short palindromic repeats, which are part of the immune system of many prokaryotes.

[0154] The term "Cas protein" refers to a CRISPR-associated protein, which is an associated protein in the CRISPR system.

[0155] The term "Cas12a" (formerly known as "Cpf1") refers to a crRNA-dependent endonuclease, which is a type VA enzyme in the CRISPR system classification.

[0156] The terms "Cas12b" and "C2c1" are used interchangeably to refer to the sgRNA-dependent endonuclease, which is a type VB enzyme in the CRISPR system classification.

[0157] The terms "Cas12c" and "C2c3" are used interchangeably to refer to a tracrRNA:crRNA (or sgRNA)-dependent endonuclease, which is a VC-type enzyme in the CRISPR system classification.

[0158] The terms "Cas12d" and "CasY" are used interchangeably to refer to a scoutRNA:crRNA-dependent endonuclease, which is a VD-type enzyme in the CRISPR system classification.

[0159] The term "Cas12g" refers to a tracrRNA:crRNA (or sgRNA)-dependent RNase, which is a VG-type enzyme in the CRISPR system classification.

[0160] The term "Cas12i" refers to a crRNA-dependent endonuclease, which is a type VI enzyme in the CRISPR system classification.

[0161] The terms "Cas13a" and "C2c2" are used interchangeably to refer to a crRNA-dependent endonuclease, which is a type VI-A enzyme in the CRISPR system classification.

[0162] The term "Cas13b" refers to a crRNA-dependent endonuclease, which is a type VI-B enzyme in the CRISPR system classification.

[0163] The term "Cas14" refers to a tracrRNA:crRNA (or sgRNA)-dependent endonuclease, which is a VF type enzyme in the CRISPR system classification.

[0164] The terms "CasΦ" and "Cas12j" are used interchangeably to refer to a crRNA-dependent nuclease that belongs to the V-type enzyme in the CRISPR system classification.

[0165] The term "PCR" refers to "polymerase chain reaction," a method used to amplify a target DNA fragment on a large scale.

[0166] Guide RNA-reporter nucleic acid complex probe

[0167] As used herein, the terms "guide RNA-reporter nucleic acid composite probe of the present invention," "composite probe of the present invention," and "probe of the present invention" are used interchangeably to refer to probes of the present invention that can be used to detect target nucleic acid molecules, including guide RNA-reporter nucleic acid composite probes having Formula Ia or Ib. It should be understood that the term also includes various forms of the composite probe in which Z3 and Z5 form a pair, a partial pair, or no pair. For example, Formula IIa represents a state in which Z3 and Z5 form a pair in the composite probe of Formula Ia of the present invention.

[0168] In the present invention, a novel guide RNA-reporter nucleic acid composite probe is provided. A representative composite probe has the structure shown in Formula Ia,

[0169] Z1-Z2-Z3-Z4-Z5 (Formula Ia)

[0170] wherein Z1, Z2, Z3, Z4 and Z5 are as described above.

[0171] Another composite probe similar to Formula Ia is Formula Ib, wherein Z1-Z2-Z3 and Z5 are two independent molecules:

[0172]

[0173] Where Z1, Z2, Z3, Z5 and As mentioned above.

[0174] Another composite probe similar to Formula Ia is Formula Ic,

[0175] Z5-Z4-Z3-Z2-Z1 (Formula Ic)

[0176] wherein Z1, Z2, Z3, Z4 and Z5 are as described above.

[0177] Another composite probe similar to Formula Ia is a structure of Formula Id, wherein Z1-Z2-Z3 and Z5 are two independent molecules:

[0178]

[0179] Where Z1, Z2, Z3, Z5 and As mentioned above.

[0180] In the present invention, the composite probe of Formula Ic or Formula Id structure is used in conjunction with the Cas protein of the Cas13b type.

[0181] In another preferred embodiment, the labels carried by Z5 are fluorescent groups and quenching groups, and the fluorescent groups and quenching groups are independently located at the 5' end, 3' end and / or the middle of the nucleic acid probe.

[0182] Taking Cas12 as an example, the structure of a representative guide RNA-reporter nucleic acid complex probe is as follows: Figure 1 As shown in Figure 2, a DNA sequence is added to the 3' end of the guide RNA, a quencher (Q) is added in the middle, and a fluorescent group (F) is added to the 3' end. The sequence of the composite probe acts as both a guide RNA and a fluorescent probe.

[0183] For ease of understanding, taking Cas12 type as an example, the following principle is provided for reference. However, it should be understood that the protection scope of the present invention is not limited by this principle. In the present invention, in the absence of target DNA, the terminal sequence (Z5) of DNA is complementary to a portion of sequence base (Z3) of guide RNA to form a hairpin structure. When there is a specific target sequence, the composite probe of the present invention and Cas12a protein bind and bind to the target sequence, now hairpin structure (i.e., the pairing structure of Z3 and Z5 can be untied) can be opened, while activating the bypass single-stranded DNA cutting activity of Cas12a, so as to cut the DNA portion (such as Z5) of the composite probe, causing fluorescent group to be separated from quenching group, and then making quenching group lose quenching function and emit fluorescence.

[0184] In the present invention, even when multiple fluorescent probes are added to the same reaction system or detection system, since there is no free single-stranded DNA in the initial state, the Cas12 bypass cleavage activity activated by other targets will not chop up the composite probes that are not bound to the target, nor will they interfere with each other.

[0185] Reaction system of the present invention

[0186] In the present invention, a reaction system for detecting one or more (especially simultaneously detecting multiple) target nucleic acid molecules is provided, the reaction system comprising:

[0187] (a) n guide RNA-reporter nucleic acid complex probes of the present invention (preferably, n is 2-500 or 2-200); and

[0188] (b) Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity.

[0189] The detection system provided by the present invention can detect m types of target nucleic acid molecules to be detected, wherein m is a positive integer and m≤n.

[0190] In the present invention, the detection includes: qualitative detection or quantitative detection.

[0191] In another embodiment of the present invention, the detection system further comprises:

[0192] (d1) a polymerase for amplifying target DNA;

[0193] (d2) optionally a reverse transcriptase for reverse transcription;

[0194] (d3) optionally a transcriptase for transcription;

[0195] (d4) dNTPs for amplification reaction and / or reverse transcription reaction;

[0196] (d5) NTPs used in the transcription reaction.

[0197] Preferably, in the detection system provided by the present invention, the concentration of the target nucleic acid molecule to be detected in the detection system is 1×10 -9 nM to 1×10 3 nM; preferably 1×10 -8 nM to 1×10 2 nM.

[0198] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 1 to 1×10 15 Copies / ml, preferably 1 to 10 10 copies / ml, preferably 1 to 10 5 copies / ml.

[0199] In another preferred embodiment, the concentration of the target nucleic acid molecule to be detected in the detection system is 1 to 1000 copies / ml, preferably 1 to 100 copies / ml, and more preferably 1 to 10 copies / ml.

[0200] In another preferred embodiment, in the detection system, the molar ratio of each guide RNA-reporter nucleic acid composite probe to the corresponding target nucleic acid molecule is 1:1 to 10 14 : 1, preferably 10: 1 to 10 5 : 1, more preferably 20: 1 to 10 3 :1.

[0201] Kit of the present invention

[0202] In the present invention, a kit for detecting one or more (especially simultaneously detecting multiple) target nucleic acid molecules is provided, the kit comprising:

[0203] i) a first container and n guide RNA-reporter nucleic acid complex probes as described herein located in the first container (preferably, n is a positive integer of 2-500 or 2-200);

[0204] ii) a second container and a Cas protein located in the second container, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity;

[0205] iii) an optional third container and a buffer located in the third container.

[0206] In a preferred embodiment, the detection system further comprises a reagent for nucleic acid amplification reaction. That is, the detection system of the present invention can amplify the target nucleic acid molecule and detect the amplified target nucleic acid molecule, which has the effect of signal amplification.

[0207] In one embodiment of the present invention, the fourth container, the fifth container and the sixth container may be the same container or different containers. Preferably, two, more or all of the first to sixth containers may be the same container or different containers.

[0208] Multiplex detection

[0209] In the present invention, a method for simultaneously detecting multiple target nucleic acid molecules in a sample is provided, comprising the following steps:

[0210] (i) providing the detection system for detecting a target nucleic acid molecule according to the first aspect of the present invention, wherein the detection system further comprises a sample to be detected; and

[0211] (ii) detecting whether the guide RNA-reporter nucleic acid complex probe in the detection system is cleaved by the Cas protein, wherein the cleavage is a trans cleavage that bypasses the single-stranded nucleic acid;

[0212] Among them, if the guide RNA-reporter nucleic acid composite probe is cut by the Cas protein, it indicates that the corresponding target nucleic acid molecule exists in the sample; and if the guide RNA-reporter nucleic acid composite probe is not cut by the Cas protein, it indicates that the corresponding target nucleic acid molecule does not exist in the sample.

[0213] In the present invention, the sample to be detected includes a sample that has not been amplified and a sample that has been amplified (or nucleic acid amplified), and may also include a sample that has not been transcribed and a sample that has been transcribed.

[0214] In one embodiment of the present invention, the method of nucleic acid amplification is selected from the group consisting of PCR amplification, LAMP amplification, RPA amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription-mediated amplification, rolling circle amplification, HDA, SPIA, NEAR, TMA and SMAP2.

[0215] In a preferred embodiment, the PCR includes high temperature PCR, room temperature PCR, and / or low temperature PCR.

[0216] In a preferred embodiment of the present invention, the detection in step (ii) comprises a fluorescence detection method. Preferably, the fluorescence detection method is performed using a microplate reader or a fluorescence spectrophotometer.

[0217] In one embodiment of the present invention, the method is an in vitro detection method. Preferably, the sample is an in vitro or ex vivo sample.

[0218] In another embodiment of the present invention, the method is non-diagnostic and non-therapeutic.

[0219] The main advantages of the present invention include:

[0220] 1) High efficiency: The multi-target detection method of the present invention can detect multiple target nucleic acid molecules simultaneously in the same detection system with extremely high sensitivity, and can detect 10 -17 M concentration of nucleic acid molecules (such as DNA).

[0221] 2) Low cost: Since multiple target nucleic acid molecules can be detected simultaneously in a very small sample, the method of the present invention can greatly save detection costs. There are no special materials or enzymes in the experiment, and the materials and reagents involved are relatively few, so micro-quantitative testing and analysis can be performed.

[0222] 3) Fast: When the test conditions are ready, it only takes about 1 hour from receiving the sample to getting the test results.

[0223] 4) Multipurpose: It can detect different nucleic acid samples, including DNA samples and RNA samples.

[0224] 5) Simple: There are no special complicated steps. Once the kit is made and the program is set, you only need to add the sample and perform other operations.

[0225] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0226] Example 1: Cas12a multi-target detection test

[0227] 1.1 Structure of the guide RNA-reporter nucleic acid complex probe

[0228] Taking Cas12a as an example, the structure of the guide RNA-reporter nucleic acid composite probe is as follows Figure 1 In this example, two probes were designed and synthesized, and their sequences are as follows:

[0229] Table 1 Exemplary guide RNA-reporter nucleic acid complex probe sequences

[0230]

[0231] *BHQ1 and BHQ2 are quenching groups; FAM and ROX are different fluorescent groups.

[0232] 1.2 Acquisition of target DNA

[0233] First, the target sequence needs to be amplified. PCR or any other amplification method can be used. In this embodiment, isothermal LAMP amplification is used.

[0234] LAMP amplification reaction: Male saliva was heated at 95°C for 10 minutes and used as a template. The total volume of each reaction system was 20 μL. Two types of primers were added to amplify the autosomal genes DNMT1-3 and the male Y chromosome-specific gene sry (sequences are shown in Primer Table 2). The specific primer amounts were 1.6 μM FIP and BIP, 0.2 μM F3 and B3, and 0.4 μM LoopF ​​and LoopB. The kit used for the LAMP reaction was LAMP Kit (NEB). The LAMP reaction procedure was 65°C for 40 min. The above products were designated as DNM and sry.

[0235] In addition, the IS6110-1 fragment was amplified using the genome of Mycobacterium tuberculosis as a template, and the amplified product was named IS-1.

[0236] 1.3 Cas12a reaction

[0237] In a 20 μL reaction system, add

[0238] 10*NEB buffer 3.1 2μL

[0239] FnCas12a 1.5 μL (final concentration 1.5 μM after addition)

[0240] Add 0.5 μL of each probe (10 μM of 3 probes)

[0241] Template 0.5 μL (product after LAMP amplification)

[0242] Add ddH2O to 20 μL and mix thoroughly.

[0243] After addition, the assay was performed in a fluorescence quantitative PCR instrument using a constant temperature of 40°C.

[0244] There are 8 samples in total, all other aspects are the same, only the added templates are different, namely 1.ddH2O; 2.DNM; 3.IS-1; 4.sry; 5.DNM+IS-1; 6.DNM+sry; 7.IS-1+sry; 8.DNM+IS-1+sry.

[0245] The results are as follows Figure 2 As shown, Figure 2 B is the Green channel, which detects FAM fluorescence targeting DNM targets, among which samples 2, 5, 6 and 8 can be detected with significant rising curves; Figure 2 C is the Orange channel, which detects ROX fluorescence targeting the sry target. Among them, samples 4, 6, 7 and 8 can be detected with significant rising curves.

[0246] The above results indicate that once the corresponding target exists in the detection system, the corresponding fluorescent signal can be detected, which is consistent with the expected result; conversely, the presence of a target can be determined based on the type of fluorescent signal detected.

[0247] Table 2 Primer sequences

[0248]

[0249] Example 2: Cas12b multi-target detection test

[0250] 2.1 Structure of the Cas12b reporter nucleic acid complex probe

[0251] 2.1.1 Synthesis of guide RNA-reporter nucleic acid composite probes

[0252] Taking AacCas12b as an example, the structure of the guide RNA-reporter nucleic acid composite probe is as follows Figure 6 As shown, it consists of tracrRNA and crRNA reporter nucleic acid probes. In this example, two probes were designed and synthesized, and the sequences are as follows:

[0253] Table 3 Exemplary guide RNA-reporter nucleic acid complex probe sequences

[0254]

[0255] *BHQ1 and BHQ2 are quenching groups; FAM and ROX are different fluorescent groups.

[0256] 2.1.2 Preparation of Cas12b tracrRNA:

[0257] First, the transcription template was prepared by annealing with T7-crRNA-F and the synthesized oligonucleotide Cas12b_tracrRNA (Table 3). Specifically, the paired oligonucleotides (4 μM) were annealed in 1 × PCR buffer (Transgen Biotech) with a total volume of 50 μL, and then the annealing procedure was performed: initial denaturation at 95 ° C for 5 minutes, then cooled from 95 ° C to 20 ° C, using a thermal cycler to reduce 1 ° C per minute. TracrRNA was synthesized using the T7 high-yield transcription kit, and the reaction was carried out at 37 ° C overnight (about 16h). Template DNA was treated with DNase I, and RNA was purified using an RNA purification and concentration kit and quantified with NanoDrop 2000C and stored in a -80 ° C refrigerator.

[0258] Note: Cas12b_tracrRNA (SEQ ID NO:23):

[0259] 5'-TTTTTGAGAAGCTCAACGGGCTTTGCCACCTGGAAAGTGGCCATTGGCACACCCGTTGAAAAATTCTGTCCTCTAGACCCTATAGTGAGTCGTATTA-3';

[0260] T7-crRNA-F(SEQ ID NO:24):5'-GAAATTAATACGACTCACTATAGGG-3'

[0261] 2.1.3 Cas12b tracrRNA:crRNA-reporter nucleic acid complex probe annealing reaction:

[0262] Under Tris buffer conditions (50mM Tris-HCl [pH 8.3], 75mM KCl, 3mM MgCl2), the tracrRNA:crRNA-reporter nucleic acid composite probe was mixed at a molar concentration of 2:1 (final concentrations of 10μM and 5μM, respectively), and the annealing reaction was performed on a PCR instrument. Initial denaturation was performed at 85°C for 5 minutes, then cooled from 85°C to 25°C, using a thermal cycler to reduce 3°C per minute. After annealing, the composite probe can be used in the cleavage reaction of Cas12b to detect the target nucleic acid.

[0263] 2.2 Acquisition of target DNA

[0264] First, the target sequence needs to be amplified. PCR or any other amplification method can be used. In this embodiment, the PCR amplification method is used.

[0265] PCR reaction: Salmonella genomic DNA and Escherichia coli O157 genomic DNA were extracted separately as templates for PCR amplification. The total volume of each reaction system was 20 μL, and two types of primers were added to amplify the specific fragments in Salmonella (the product was named SE) and the specific fragments in Escherichia coli O157 (the product was named O157) (sequences are shown in Primer Table 4). The PCR reaction program was 95°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 60°C for 15 seconds, and 72°C for 10 seconds. After the PCR was completed, the product was directly used for the Cas12b reaction.

[0266] 2.3 Cas12b reaction

[0267] In a 20 μL reaction system, add

[0268] 10*NEB buffer 3.1 2μL

[0269] AacCas12b 1.5 μL (final concentration 1.5 μM after addition)

[0270] 1 μL of complex probe (final concentration of each probe is 500 nM)

[0271] Add ddH2O to 19.5 μL and mix thoroughly.

[0272] After addition, place it at 48°C for 5 minutes, then add 0.5 μL of template (product after PCR amplification) to the reaction system, and place the reaction system in a fluorescent quantitative PCR instrument for detection. Use a constant temperature of 48°C to detect FAM fluorescence.

[0273] There were two reaction samples in total, the difference being that different templates were added, namely the PCR amplification products of SE and O157. The reaction system with sterile water added was used as a negative control.

[0274] The fluorescence quantitative PCR instrument used in this reaction is ABI StepOne Plus, and the detection signal is FAM fluorescence. Figure 7As shown, after subtracting the background signal (i.e., adding sterile water as the template), the FAM fluorescence signal in the reaction group with SE template was very low, while the FAM fluorescence signal in the reaction group with O157 template increased rapidly, significantly different from the signal intensity of the SE group. These results suggest that the SE template does not activate cleavage of the O157 reporter probe, while the O157 template does. Conversely, ROX fluorescence detection using a microplate reader shows that the O157 template does not activate cleavage of the SE reporter probe, while the SE template does. These results demonstrate that the presence of a corresponding fluorescent signal in the detection system is consistent with the expected results. Conversely, the presence of a specific target can be determined based on the type of fluorescent signal detected.

[0275] Table 4 Primer sequences

[0276] Primer name Sequence (5'-3') SEQ ID NO: SE-F TGTCACCGTGGTCCAGTTTA 25 SE-R CGACAAGACCATCACCAATG 26 O157-F3 gatgggaacgattatatcgaagg 27 O157-R2 cctgacagaatattataagctccg 28

[0277] Example 3: Cas14 multi-target detection test

[0278] 3.1 Structure of the Cas14 reporter nucleic acid complex probe

[0279] 3.1.1 Synthesis of guide RNA-reporter nucleic acid complex probes

[0280] Taking Cas14a1 as an example, the structure of the guide RNA-reporter nucleic acid complex probe is as follows Figure 6 As shown, it consists of tracrRNA and crRNA reporter nucleic acid probes. In this example, two probes were designed and synthesized, and the sequences are as follows:

[0281] Table 5 Exemplary guide RNA-reporter nucleic acid complex probe sequences

[0282]

[0283] *BHQ1 and BHQ2 are quenching groups; FAM and ROX are different fluorescent groups.

[0284] 3.1.2 Preparation of Cas14a1 tracrRNA:

[0285] First, a fragment of tracrRNA with Cas14a1 was synthesized and cloned into a pUC57 vector. T7-crRNA-F and Cas14a-tracr-R primers (Table 6) were then used to amplify the amplified product, and the amplified product was purified and used to transcribe tracrRNA. TracrRNA was synthesized using 200ng of transcription template and T7 high-yield transcription kit, and the reaction was carried out at 37°C overnight (about 16h). Template DNA was treated with DNase I, and RNA was purified using an RNA purification and concentration kit and quantified with NanoDrop 2000C and stored in a -80°C refrigerator.

[0286] Note: Cas14a-tracr-R (SEQ ID NO: 31):

[0287] 5'-AAATGAATTTGTTTCGAGGGTTAC-3'

[0288] Synthetic Cas14a1 tracrRNA sequence with T7 promoter (SEQ ID NO: 32):

[0289] 5'-GAAATTAATACGACTCACTATAGGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAATTCATTTTTC-3', the sequence marked in bold is the T7 promoter sequence, and the rest of the sequence is the Cas14a1 tracrRNA sequence.

[0290] 3.1.3 Cas14tracrRNA:crRNA-reporter nucleic acid composite probe annealing reaction:

[0291] In Tris buffer (50mM Tris-HCl [pH 8.3], 75mM KCl, 3mM MgCl2), the tracrRNA:crRNA-reporter nucleic acid complex probe was mixed at a molar concentration of 2:1 (final concentrations of 10μM and 5μM, respectively) and annealed on a PCR instrument. Initial denaturation was performed at 85°C for 5 minutes, followed by cooling from 85°C to 25°C, using a thermal cycler to reduce the temperature by 3°C per minute. After annealing, the complex probe can be used in the cleavage reaction of Cas14 to detect the target nucleic acid.

[0292] 3.2 Acquisition of target DNA

[0293] First, the target sequence needs to be amplified. PCR or any other amplification method can be used. In this embodiment, the PCR amplification method is used.

[0294] PCR reaction: Salmonella genomic DNA and Escherichia coli O157 genomic DNA were extracted separately as templates for PCR amplification. The total volume of each reaction system was 20 μL, and two types of primers were added for amplification. In each pair of primers, the 5' end of one of them was modified by phosphothioate. The above primer pairs were used to amplify the specific fragments in Salmonella (the product was named SE-ps) and the specific fragments in Escherichia coli O157 (the product was named O157-ps) (sequences are shown in Primer Table 6). The PCR reaction program was 95°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 60°C for 15 seconds, and 72°C for 10 seconds. After the PCR was completed, the product was directly used for the Cas14 reaction.

[0295] 3.3 Cas14 reaction

[0296] In a 20 μL reaction system, add:

[0297] 10*Cas14 buffer 2μL

[0298] Cas14a1 1.5 μL (final concentration after addition: 1.5 μM)

[0299] 1 μL of complex probe (final concentration of each probe is 500 nM)

[0300] Add ddH2O to 19 μL and mix thoroughly.

[0301] After addition, the reaction was incubated at 37°C for 5 minutes. 0.5 μL of template (PCR amplification product) and 0.5 μL of T7 exonuclease (10 units / μL) were then added to the reaction system. The reaction system was then placed in a fluorescence quantitative PCR instrument for detection. The reaction conditions were constant at 37°C and FAM fluorescence was detected. The reaction buffer for 10*Cas14 was: 250 mM NaCl, 200 mM HEPES, pH 7.5, 10 mM DTT, 50% glycerol, and 50 mM MgCl2.

[0302] There were two reaction samples in total, the difference being that different templates were added, namely the PCR amplification products of SE-ps and O157-ps. The reaction system with sterile water added was used as a negative control.

[0303] The fluorescence quantitative PCR instrument used in this reaction is ABI StepOne Plus, and the detection signal is FAM fluorescence. Figure 8As shown, after subtracting the background signal (i.e., adding sterile water as the template), the FAM fluorescence signal in the reaction group with the SE-ps template was low, while the FAM fluorescence signal in the reaction group with the O157-ps template increased rapidly, significantly different from the signal intensity of the SE-ps group. These results suggest that the SE-ps template does not activate cleavage of the O157-ps reporter probe, while the O157-ps template does. Conversely, ROX fluorescence detection using a microplate reader shows that the O157-ps template does not activate cleavage of the SE-ps reporter probe, while the SE-ps template does. These results demonstrate that the presence of a corresponding fluorescent signal in the detection system is consistent with the expected results. Conversely, the presence of a specific target can be determined based on the type of fluorescent signal detected.

[0304] Table 6 Primer sequences

[0305] Primer name Sequence (5'-3') SEQ ID NO: SE-F tgtcaccgtggtccagttta 25 SE-R-ps c*g*a*c*aagaccatcaccaatg 33 O157-F-ps c*a*g*t*agggaagcgaacagag 34 O157-R2 cctgacagaatattataagctccg 28

[0306] Note: Except for the phosphorothioate modification (marked with *), the rest of the sequence is consistent with the amplification primer of Cas12b.

[0307] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto. Sequence Listing <110> Shanghai Tolo Biotechnology Co., Ltd. <120> CRISPR multi-target detection method and kit <130> P2021-2952 <150> CN201910673246.8 <151> 2019-07-24 <160> 34 <170> PatentIn version 3.5 <210> 1 <211> 54 <212> DNA / RNA <213> artificial sequence <400> 1 gaauuucuac uguuguagau cugauggucc augucuguua cucctctaac agac 54 <210> 2 <211> 55 <212> DNA / RNA <213> artificial sequence <400> 2 aauuucuacu guuguagauu cucuugcau ggccuguaau uuccttatta caggc 55 <210> 3 <211> 20 <212> DNA <213> artificial sequence <400> 3 gtgaacgttc ccttagcact 20 <210> 4 <211> 19 <212> DNA <213> artificial sequence <400> 4 gggagggcag aactagtcc 19 <210> 5 <211> 41 <212> DNA <213> artificial sequence <400> 5 cgccacttga caggcgagta actgccactt attgggtcag c 41 <210> 6 <211> 39 <212> DNA <213> artificial sequence <400> 6 gcgtgttccc cagagtgact tagcagcttc ctcctcctt 39 <210> 7 <211> twenty two <212> DNA <213> artificial sequence <400> 7 aggaaacatt aacgtactga tg 22 <210> 8 <211> twenty one <212> DNA <213> artificial sequence <400> 8 ttccttttat ttcccttcag c 21 <210> 9 <211> 19 <212> DNA <213> artificial sequence <400> 9 tctctgtgca tggcctgta 19 <210> 10 <211> 20 <212> DNA <213> artificial sequence <400> 10 aacagtaaag gcaacgtcca 20 <210> 11 <211> 40 <212> DNA <213> artificial sequence <400> 11 gcagctggga taccagtgga agtgcctcct ggaagaatgg 40 <210> 12 <211> 40 <212> DNA <213> artificial sequence <400> 12 tctctagagc catcttgcgc ctgaagcgac ccatgaacgc 40 <210> 13 <211> twenty two <212> DNA <213> artificial sequence <400> 13 tgcttactga agccgaaaaa tg 22 <210> 14 <211> twenty one <212> DNA <213> artificial sequence <400> 14 tgatcgcgag accacacgat g 21 <210> 15 <211> 16 <212> DNA <213> artificial sequence <400> 15 cgccgccaac tacggt 16 <210> 16 <211> 16 <212> DNA <213> artificial sequence <400> 16 cggcgctgga cgagat 16 <210> 17 <211> 39 <212> DNA <213> artificial sequence <400> 17 gcatctggcc acctcgatgc cttacggtgc ccgcaaagt 39 <210> 18 <211> 38 <212> DNA <213> artificial sequence <400> 18 acggctgatg accaaactcg gcggctgtgg ccggatca 38 <210> 19 <211> 18 <212> DNA <213> artificial sequence <400> 19 tcacggttca gggttagc 18 <210> 20 <211> 20 <212> DNA <213> artificial sequence <400> 20 aagcccgcag gaccacgatc 20 <210> twenty one <211> 53 <212> DNA / RNA <213> artificial sequence <400> twenty one aauuucuacu guuguagauu gaacuuuauu ggcgguauuu cggctaatac cgc 53 <210> twenty two <211> 53 <212> DNA / RNA <213> artificial sequence <400> twenty two aauuucuacu guuguagauc acuaccacca aauaacuggu cggctccagt tat 53 <210> twenty three <211> 97 <212> DNA <213> artificial sequence <400> twenty three tttttgagaa gctcaacggg ctttgccacc tggaaagtgg ccattggcac acccgttgaa 60 aaattctgtc ctcttagaccc tatagtgagt cgtatta 97 <210> twenty four <211> 25 <212> DNA <213> artificial sequence <400> twenty four gaaattaata cgactcacta taggg 25 <210> 25 <211> 20 <212> DNA <213> artificial sequence <400> 25 tgtcaccgtg gtccagttta 20 <210> 26 <211> 20 <212> DNA <213> artificial sequence <400> 26 cgacaagacc atcaccaatg 20 <210> 27 <211> twenty three <212> DNA <213> artificial sequence <400> 27 gatgggaacg attatatcga agg 23 <210> 28 <211> twenty four <212> DNA <213> artificial sequence <400> 28 cctgacagaa tattataagc tccg 24 <210> 29 <211> 50 <212> DNA / RNA <213> artificial sequence <400> 29 gacgaaugaa ggaaugcaac ugaacuuuau uggcgguauu tttaccgcca 50 <210> 30 <211> 51 <212> DNA / RNA <213> artificial sequence <400> 30 gacgaaugaa ggaaugcaac cacuaccacc aaauaacugg ggtgttattt g 51 <210> 31 <211> twenty four <212> DNA <213> artificial sequence <400> 31 aaatgaattt gtttcgaggg ttac 24 <210> 32 <211> 168 <212> DNA <213> artificial sequence <400> 32 gaaattaata cgactcacta tagggcttca ctgataaagt ggagaaccgc ttcaccaaaa 60 gctgtccctt aggggattag aacttgagtg aaggtgggct gcttgcatca gcctaatgtc 120 gagaagtgct ttcttcggaa agtaaccctc gaaacaaatt catttttc 168 <210> 33 <211> 20 <212> DNA <213> artificial sequence <400> 33 cgacaagacc atcaccaatg 20 <210> 34 <211> 20 <212> DNA <213> artificial sequence <400> 34 cagtagggaa gcgaacagag 20

Claims

1. A detection system for detecting a target nucleic acid molecule, characterized in that: The detection system comprises: (a) n guide RNA-reporter nucleic acid composite probes, wherein the guide RNA-reporter nucleic acid composite probe has a structure as shown in Formula Ia, Ib, Ic or Id, Z1-Z2-Z3-Z4-Z5 (Formula Ia) Z5-Z4-Z3-Z2-Z1 (Formula Ic) in, Z1 is the first stem-loop structure region, the stem-loop structure in Z1 is a crRNA stem-loop structure, which is used to bind or anchor the Cas protein, and the length of Z1 is 10-300 nt; Z2 is null or nucleic acid linking region; Z3 is a guide RNA region, wherein Z3 contains a nucleic acid sequence that can guide the Cas protein to specifically bind to the target nucleic acid molecule, and the length of Z3 is 15-50 nt; Z5 is a single-stranded nucleic acid to be cleaved with a detectable label, wherein the detectable label presents different detection states when the single-stranded nucleic acid to be cleaved is cleaved and when it is not cleaved, thereby being detected; Wherein, when the target nucleic acid is not present in the detection system, Z3 and Z5 form a complementary double-stranded structure region; and when the target nucleic acid is present in the detection system, Z3 and Z5 do not form the complementary double-stranded structure region; Z4 is none, or is a chemical bond or connecting region for connecting Z3 and Z5; Hydrogen bonds for complementary base pairing; And, n is a positive integer n≥1; and (b) a Cas protein, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity; Furthermore, the detection system can detect m types of target nucleic acid molecules to be detected, wherein m is a positive integer and m≤n.

2. The detection system according to claim 1, characterized in that The Cas protein is selected from the following group: Cas12 type, Cas14 type, or a combination thereof.

3. The detection system according to claim 1, characterized in that The Cas protein is selected from the following group: Cas13a type, Cas13b type, or a combination thereof.

4. The detection system according to claim 1, characterized in that In the system: (i) n ≥ 2, and n is a positive integer; (ii) the detectable label is a fluorescent group, and Z5 carries a fluorescent group, and Z4 and / or Z5 also carries a quenching group, and when and only when the single-stranded nucleic acid to be cleaved is cleaved, a fluorescent signal emitted by the fluorescent group can be detected; and / or (iii) Among the n guide RNA-reporter nucleic acid composite probes, the fluorescent groups are different from each other and can be distinguished.

5. The detection system according to claim 1, characterized in that When the target nucleic acid is not present in the detection system, the guide RNA-reporter nucleic acid composite probe is of formula IIa: In the formula, Z1, Z2, Z3, Z4 and Z5 are as described above, Hydrogen bonds for complementary base pairing.

6. The detection system according to claim 1, characterized in that When the target nucleic acid is not present in the detection system, the guide RNA-reporter nucleic acid composite probe is of formula IIc: In the formula, Z1, Z2, Z3, Z4 and Z5 are as described above, Hydrogen bonds for complementary base pairing.

7. The detection system according to claim 1, characterized in that The length of Z1 is 19-100 nt.

8. The detection system according to claim 1, characterized in that The length of Z1 is 19-91 nt.

9. The detection system according to claim 1, characterized in that The Z2 is a nucleic acid linking region with no or a length of 0-20 nt.

10. The detection system according to claim 1, characterized in that The length of Z3 is 16-40 nt.

11. The detection system according to claim 1, characterized in that The length of Z3 is 16-34 nt.

12. The detection system according to claim 1, characterized in that The Z1, Z2 and Z3 are all RNA nucleic acid sequences.

13. The detection system according to claim 1, characterized in that The Z4 is a DNA and / or RNA nucleic acid sequence.

14. The detection system according to claim 1, characterized in that The Z5 is a single-stranded DNA nucleic acid sequence, or a single-stranded RNA nucleic acid sequence, or a nucleic acid sequence having both RNA and DNA.

15. The detection system according to claim 1, characterized in that The length of Z5 is 3-50 nt.

16. The detection system according to claim 1, characterized in that The length of Z5 is 4-30 nt.

17. The detection system according to claim 1, characterized in that The length of Z5 is 6-12 nt.

18. The detection system according to claim 1, characterized in that The detection system also contains m types of target nucleic acid molecules to be detected, wherein m is a positive integer and m≤n.

19. The detection system according to claim 1, characterized in that The detection includes: qualitative detection or quantitative detection.

20. A kit for detecting a target nucleic acid molecule, characterized in that: The kit comprises: i) a first container and n guide RNA-reporter nucleic acid composite probes having a structure as shown in Formula Ia, Ib, Ic or Id located in the first container, Z1-Z2-Z3-Z4-Z5 (Formula Ia) Z5-Z4-Z3-Z2-Z1 (Formula Ic) in, Z1 is the first stem-loop structure region, the stem-loop structure in Z1 is a crRNA stem-loop structure, which is used to bind or anchor the Cas protein, and the length of Z1 is 10-300 nt; Z2 is null or nucleic acid linking region; Z3 is a guide RNA region, wherein Z3 contains a nucleic acid sequence that can guide the Cas protein to specifically bind to the target nucleic acid molecule, and the length of Z3 is 15-50 nt; Z5 is a single-stranded nucleic acid to be cleaved with a detectable label, wherein the detectable label presents different detection states when the single-stranded nucleic acid to be cleaved is cleaved and when it is not cleaved, thereby being detected; Wherein, when the target nucleic acid is not present in the detection system, Z3 and Z5 form a complementary double-stranded structure region; and when the target nucleic acid is present in the detection system, Z3 and Z5 do not form the complementary double-stranded structure region; Z4 is none, or is a chemical bond or connecting region for connecting Z3 and Z5; Hydrogen bonds for complementary base pairing; And, n is a positive integer n≥1; ii) a second container and a Cas protein in the second container, wherein the Cas protein is a Cas protein having bypass single-stranded nucleic acid cleavage activity; iii) a third container and a buffer solution in the third container; Furthermore, the kit can detect m types of target nucleic acid molecules to be detected, wherein m is a positive integer and m≤n.

21. The kit according to claim 20, characterized in that The kit also includes: iv) a fourth container and a polymerase for amplifying the target DNA in the fourth container; v) a fifth container and a reverse transcriptase for reverse transcription and / or a transcriptase for transcription located in the fifth container; vii) a sixth container and dNTPs for amplification reaction and / or reverse transcription reaction and / or NTPs for transcription reaction located in the sixth container.

22. A non-diagnostic and non-therapeutic method for detecting a target nucleic acid molecule in a sample, characterized in that: The following steps are involved: (i) providing a detection system for simultaneously detecting multiple target nucleic acid molecules as described in claim 1, wherein the detection system further comprises a sample to be detected; and (ii) detecting whether the guide RNA-reporter nucleic acid composite probe in the detection system is cleaved by the Cas protein, wherein the cleavage is a trans cleavage of the single-stranded nucleic acid; Among them, if the guide RNA-reporter nucleic acid composite probe is cut by the Cas protein, it means that the corresponding target nucleic acid molecule exists in the sample; and if the guide RNA-reporter nucleic acid composite probe is not cut by the Cas protein, it means that the corresponding target nucleic acid molecule does not exist in the sample.

23. The method of claim 22, wherein: The sample to be detected is a sample obtained through amplification.

Images