A recombinant limulus amebocyte lysate composition and method for detecting endotoxin

By expressing recombinant horseshoe crab C factor, B factor, and coagulase factor in mammalian cells HEK293, the problems of reduced horseshoe crab numbers and low activity were solved, achieving highly sensitive endotoxin detection and shortening the detection time.

CN114196657BActive Publication Date: 2025-10-28XIAMEN BIOENDO TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202111511625.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-06
Publication Date
2025-10-28
Estimated Expiration
2041-12-06

AI Technical Summary

Technical Problem

Existing technologies using horseshoe crab blood cell extracts to detect endotoxins suffer from reduced horseshoe crab numbers, and the low activity of horseshoe crab C factor expressed in mammalian cells makes it difficult to meet the requirements for high-sensitivity detection.

Method used

Recombinant horseshoe crab C factor, B factor, and coagulase factor were expressed in mammalian HEK293 cells. Their activity was enhanced through codon optimization, and they were expressed in secretible forms for endotoxin detection.

Benefits of technology

It enables rapid (within half an hour) qualitative and quantitative detection of endotoxins, improves detection sensitivity, and the expressed factor has high activity, shortening the detection time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114196657B_ABST
    Figure CN114196657B_ABST
Patent Text Reader

Abstract

This invention provides a recombinant horseshoe crab three-factor composition and its application. The composition comprises recombinant horseshoe crab factor C, recombinant horseshoe crab factor B, and recombinant horseshoe crab coagulase factor; all three factors are expressed by mammalian HEK293 cells. This allows for the expression of factors C, B, and PCE in mammalian HEK293 cells. Simultaneous expression of all three factors enhances factor C activity and improves sensitivity; furthermore, the expressed factors are secretible and possess high activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant horseshoe crab three-factor composition and a method for detecting endotoxins therein. Background Technology

[0002] Endotoxins are lipopolysaccharides found on the outer membrane of the cell walls of Gram-negative bacteria and are known to be potent pyrogens. Endotoxins are only released when bacteria die and lyse or when bacterial cells are artificially destroyed. They can activate neutrophils and other cells, causing them to release an endogenous pyrogen that acts on the body's thermoregulatory center, leading to fever, shock, or even death. Therefore, endotoxin detection is an essential procedure in pharmaceutical manufacturing and medical device production.

[0003] The horseshoe crab (LCL) test is the international gold standard for endotoxin detection, characterized by its simplicity, speed, and high sensitivity. The traditional LCL test uses horseshoe crab hemolymph extract (lysate of horseshoe crab amoebae cells). Upon contact with the lysate, factor C, a precursor to a serine protease present in the lysate, is activated to generate activated factor C. This activated factor C then activates factor B in the lysate, generating activated factor B. This activated factor B activates coagulase in the lysate, generating coagulase. The coagulase is then hydrolyzed into a coagulated protein gel or reacts with a synthetic substrate to produce a colorimetric result for endotoxin detection. However, the use of horseshoe crab hemolymph extract has led to a gradual decline in the number of horseshoe crabs in the ocean.

[0004] In related technologies, insect cells or mammalian cells are used as host cells to express factor C, factor B, and coagulogen to reconstruct the cascade reaction system. However, the expressed factor C is insoluble, non-secretory, and has low activity. Summary of the Invention

[0005] The present invention aims to at least partially solve one of the technical problems in the aforementioned technologies. To this end, the present invention proposes a recombinant horseshoe crab three-factor composition, which uses mammalian cells HEK293 to express factor C, factor B, and factor PCE. Simultaneous expression of the three factors enhances factor C activity and improves sensitivity; furthermore, the expressed factors are secretible and possess relatively high activity.

[0006] Therefore, in a first aspect of the present invention, a recombinant horseshoe crab three-factor composition is provided, comprising recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor; wherein the recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor are all expressed by mammalian cells HEK293.

[0007] According to an embodiment of the present invention, mammalian cells HEK293 are used to simultaneously express horseshoe crab C factor, horseshoe crab B factor, and horseshoe crab coagulase factor. These three factors are used for endotoxin detection, and qualitative and quantitative detection of endotoxins can be obtained in half an hour. The simultaneous expression of the three factors enhances the activity of factor C, improves sensitivity, and the expressed factor is secretible and has high activity.

[0008] Optionally, the nucleotide sequence of the recombinant horseshoe crab C factor is shown in SEQ ID NO: 1, the nucleotide sequence of the recombinant horseshoe crab B factor is shown in SEQ ID NO: 2, and the nucleotide sequence of the recombinant horseshoe crab coagulase factor is shown in SEQ ID NO: 3. This codon optimization makes the three factors more suitable for expression in mammalian cells.

[0009] Optionally, the preparation of the recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor includes the following steps:

[0010] (1) Using the gene shown in SEQ ID NO:4 as a template, PCR amplification of factor C was performed using primers SEQ ID NO:8 and SEQ ID NO:9 to obtain FactorC-his6-ApaI; using the gene shown in SEQ ID NO:5 as a template, PCR amplification of factor B was performed using primers SEQ ID NO:10 and SEQ ID NO:11 to obtain FactorB-his6-ApaI; using the gene shown in SEQ ID NO:6 as a template, PCR amplification of factor PCE was performed using primers SEQ ID NO:12 and SEQ ID NO:13 to obtain PCE-his6-ApaI; using the gene shown in SEQ ID NO:7 as a template, PCR amplification of gp67 was performed using primers SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17 to obtain KpnI-gp67-1, KpnI-gp67-2, and KpnI-gp67-3;

[0011] (2) The KpnI-gp67-1 gene fragment was ligated with the FactorC-his6-ApaI gene fragment to obtain KpnI-gp67-FactorC-his6-ApaI; the KpnI-gp67-2 gene fragment was ligated with the FactorB-his6-ApaI gene fragment to obtain KpnI-gp67-FactorB-his6-ApaI; the KpnI-gp67-3 gene fragment was ligated with the PCE-his6-ApaI gene fragment to obtain KpnI-gp67-PCE-his6-ApaI;

[0012] (3) The KpnI-gp67-FactorC-his6-ApaI gene fragment, the KpnI-gp67-FactorB-his6-ApaI gene fragment, and the KpnI-gp67-PCE-his6-ApaI gene fragment were respectively ligated to the pcDNA vector to obtain recombinant plasmids pcDNA-gp67-factorC, pcDNA-gp67-factorB, and pcDNA-gp67-PCE. The recombinant plasmids were then transfected into mammalian cells HEK293, and the purified proteins were cultured to express and obtain recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor.

[0013] In a second aspect of the present invention, a method for detecting endotoxins using the above-described recombinant horseshoe crab three-factor composition is provided, comprising the following steps:

[0014] (1) Prepare at least three endotoxin standard solutions of different concentrations;

[0015] (2) The recombinant horseshoe crab C factor, recombinant horseshoe crab B factor and recombinant horseshoe crab coagulase factor are mixed with fluorescent substrate, bacterial endotoxin test water and buffer to prepare a mixture;

[0016] (3) Add the mixture and each of the endotoxin standard solutions to the microplate at a volume ratio of 1:1, and set up a negative control group at the same time;

[0017] (4) Place the microplate in a fluorescent microplate detector for detection;

[0018] (5) Plot a standard curve with the change in fluorescence intensity as the ordinate and the solubility of the endotoxin standard solution as the abscissa.

[0019] According to the method for detecting endotoxins according to embodiments of the present invention, the above-mentioned horseshoe crab three-factor composition can improve the detection sensitivity and greatly shorten the detection time.

[0020] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0021] Figure 1 This is an electrophoresis verification image after amplification according to an embodiment of the present invention;

[0022] Figure 2 The images show the genes of factors C, B, and PCE according to embodiments of the present invention, and their electrophoretic images after double enzyme digestion.

[0023] Figure 3 This is an electrophoresis image of the recombinant plasmid after double enzyme digestion according to an embodiment of the present invention;

[0024] Figure 4 The results of SDS-PAGE purification according to an embodiment of the present invention;

[0025] Figure 5 This is a graph showing the results of endotoxin detection using the dynamic turbidimetric method according to an embodiment of the present invention.

[0026] Figure 6 This is a graph showing the results of endotoxin detection using the C-factor fluorescence method according to an embodiment of the present invention;

[0027] Figure 7 Graphs showing the results of endotoxin detection by fluorescence method using factors C, B, and PCE according to an embodiment of the present invention;

[0028] Figure 8 The results of endotoxin detection by fluorescence method using factors C, B, and PCE according to another embodiment of the present invention are shown in the figure. Detailed Implementation

[0029] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0030] The following disclosure provides numerous different embodiments or examples for implementing various ways of carrying out the invention. To simplify the disclosure, specific embodiments or examples are described below. Of course, these are merely examples and are not intended to limit the invention. Furthermore, the examples of various specific processes and materials provided by the invention will allow those skilled in the art to recognize the applicability of other processes and / or the use of other materials. Unless otherwise stated, the implementation of the invention will employ conventional techniques in fields such as chemistry and molecular biology, which are within the capabilities of those skilled in the art. Additionally, unless otherwise stated, nucleic acids are written from left to right in a 5′ to 3′ orientation, and amino acid sequences are written from left to right in a direction from the amino terminus to the carboxyl terminus.

[0031] The recombinant horseshoe crab three factors of this invention are recombinant horseshoe crab factor C, horseshoe crab factor B, and horseshoe crab coagulase factor. Hereinafter, horseshoe crab factor C, horseshoe crab factor B, and horseshoe crab coagulase factor may be referred to as factor C, factor B, and factor PCE, respectively. The horseshoe crab may be the Chinese horseshoe crab, the roundtail horseshoe crab, or the American horseshoe crab.

[0032] The present invention will now be described through illustrative specific embodiments, which do not limit the scope of the invention in any way. It should be noted, in particular, that all reagents used in the present invention are commercially available unless otherwise specified.

[0033] Example 1: Preparation of recombinant C factor, B factor, and PCE factor

[0034] 1. Construct recombinant expression plasmids for horseshoe crab C, B, and PCE factor proteins.

[0035] Based on the base sequences 1 (GenBank: D90271.1), 2 (ID: MA626413.1), 3 (ID: M58366.1), and 4 (ID: X58376.1), the base sequences of factor C (SEQ ID NO: 4), factor B (SEQ ID NO: 5), factor PCE (SEQ ID NO: 6), and gp67 signal peptide (SEQ ID NO: 7) were synthesized by Sangon Biotech. Primers were designed using Premier Primer 5 based on the gene sequences:

[0036] CF: ACTACTATTATTAACATGGTGCTGGCTAGCTTTCT; (SEQ ID NO: 8)

[0037] CR: GGAGGGCCCTCAATGATGATGATGATGATGGATGAACTGCCGGATCC; (SEQ ID NO: 9)

[0038] BF:ACTACTATTATTAACATGACCTGGATCTGCGTGAT; (SEQ ID NO: 10)

[0039] BR:AGGGGGCCCTCAATGATGATGATGATGATGGTTGGTCACGGCGTGAT; (SEQ ID NO: 11)

[0040] PCE-F: ACTACTATTATTAACATGCTGGTCAACAACGTGTT; (SEQ ID NO: 12)

[0041] PCE-R: AGGGGGCCCTTAATGATGATGATGATGATGCACCATGTGCTCGGCGA; (SEQ ID NO: 13)

[0042] The gp67 signal peptide requires the design of three pairs of primer sequences, corresponding to the C factor, B factor, and PCE factor, respectively:

[0043] 1-F: CGGGGTACCATGCTACTAGTAAATCAGTC; (SEQ ID NO: 14)

[0044] 1-R: GCTAGCCAGCACCATGTTAATAATAGTAGTGTCAC; (SEQ ID NO: 15)

[0045] 2-R: GCAGATCCAGGTCATGTTAATAATAGTAGTGTCA; (SEQ ID NO: 16)

[0046] 3-R: GTGTTGACCAGCATGTTAATAATAGTAGTGTCAC; (SEQ ID NO: 17)

[0047] Using the synthesized gp67 base sequence as a template, the gp67 gene was amplified. PCR reactions were performed with primers 1-F and 1-R, 2-R, and 3-R, respectively, introducing the KpnI restriction site, resulting in PCR products named KpnI-gp67-1, KpnI-gp67-2, and KpnI-gp67-3. The amplification reaction system consisted of: 33.5 μL ddH2O, 5 μL 10*buffer, 5 μL dNTPs, 2 μL MgSO4, 1 μL KOD, 1.5 μL upstream primer, 1.5 μL downstream primer, and 0.5 μL DNA template. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 40 s, and 68℃ for 5 min (steps 2 to 4 were repeated 29 times).

[0048] Using the synthesized C factor base sequence as a template, the C factor gene was amplified. PCR was performed using primers CF and CR, introducing an ApaI restriction site and a histidine tag, resulting in a PCR product named FactorC-his6-ApaI. The amplification reaction system consisted of: 33.5 μL ddH2O, 5 μL 10* buffer, 5 μL dNTPs, 2 μL MgSO4, 1 μL KOD, 1.5 μL upstream primer, 1.5 μL downstream primer, and 0.5 μL DNA template. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 3 min, and 68℃ for 5 min (steps 2 to 4 were repeated 29 times).

[0049] Using the synthesized factor B base sequence as a template, the factor B gene was amplified. PCR was performed using primers BF and BR, introducing an ApaI restriction site and a histidine tag, resulting in a PCR product named FactorB-his6-ApaI. The amplification reaction system consisted of: 33.5 μL ddH2O, 5 μL 10*buffer, 5 μL dNTPs, 2 μL MgSO4, 1 μL KOD, 1.5 μL upstream primer, 1.5 μL downstream primer, and 0.5 μL DNA template. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 1 min 20 s, and 68℃ for 5 min (steps 2 to 4 were repeated 29 times).

[0050] Using the synthesized PCE factor base sequence as a template, the PCE factor gene was amplified. PCR was performed using primers PCE-F and PCE-R, introducing an ApaI restriction site and a histidine tag, resulting in a PCR product named PCE-his6-ApaI. The amplification reaction system consisted of: ddH2O 33.5 μL, 10*buffer 5 μL, dNTPs 5 μL, MgSO4 2 μL, KOD 1 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, and DNA template 0.5 μL. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 1 min 30 s, and 68℃ for 5 min (steps 2 to 4 were repeated 29 times).

[0051] After amplification, agarose gel electrophoresis was performed for verification, and the results are as follows: Figure 1 As shown, Figure 1 In the diagram, 1 represents the PCR product of KpnI-gp67-1; 2 represents the PCR product of KpnI-gp67-2; 3 represents the PCR product of KpnI-gp67-3; 4 represents the PCR product of FactorC-his6-ApaI; 5 represents the PCR product of FactorB-his6-ApaI; and 6 represents the PCR product of PCE-his6-ApaI. All of these are single bands, indicating that the PCR amplification was successful.

[0052] Subsequently, the KpnI-gp67-1 fragment and the FactorC-his6-ApaI fragment were mixed in equal amounts and then PCR spliced ​​to form the complete target fragment KpnI-gp67-FactorC-his6-ApaI. The amplification reaction system consisted of: ddH2O 33.5 μL, 10*buffer 5 μL, dNTPs 5 μL, MgSO4 2 μL, KOD 1 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, and DNA template 0.5 μL. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 4 min, and 68℃ for 10 min (steps 2 to 4 were repeated 25 times).

[0053] The KpnI-gp67-2 fragment and the FactorB-his6-ApaI fragment were mixed in equal amounts and then spliced ​​by PCR to form the complete target fragment KpnI-gp67-FactorB-his6-ApaI. The amplification reaction system consisted of: ddH2O 33.5 μL, 10*buffer 5 μL, dNTPs 5 μL, MgSO4 2 μL, KOD 1 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, and DNA template 0.5 μL. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 2 min, and 68℃ for 10 min (steps 2 to 4 were repeated 25 times).

[0054] Equal amounts of KpnI-gp67-3 and PCE-his6-ApaI fragments were mixed and then PCR spliced ​​to form the complete target fragment KpnI-gp67-PCE-his6-ApaI. The amplification reaction system consisted of: ddH2O 33.5 μL, 10*buffer 5 μL, dNTPs 5 μL, MgSO4 2 μL, KOD 1 μL, upstream primer 1.5 μL, downstream primer 1.5 μL, and DNA template 0.5 μL. The PCR reaction steps were: 94℃ for 2 min, 94℃ for 15 s, 53℃ for 30 s, 68℃ for 2 min, and 68℃ for 10 min (steps 2 to 4 were repeated 25 times).

[0055] Subsequently, the KpnI-gp67-FactorC-his6-ApaI fragment, KpnI-gp67-FactorB-his6-ApaI fragment, KpnI-gp67-PCE-his6-ApaI fragment, and pcDNA plasmid were double-digested with restriction endonucleases KpnI and ApaI. The KpnI-gp67-FactorC-his6-ApaI gene, after being double-digested with KpnI and ApaI, was then... The KpnI-gp67-FactorB-his6-ApaI and KpnI-gp67-PCE-his6-ApaI genes were inserted into the expression plasmid pcDNA, which had been digested with the same double enzymes. After screening, verification, and sequencing, recombinant eukaryotic expression vectors were obtained and named pcDNA-gp67-factorC, pcDNA-gp67-factorB, and pcDNA-gp67-PCE, respectively. Agarose gel electrophoresis verification results are shown below. Figure 2 and Figure 3 As shown, in Figure 2 In the dataset, 1 is the PCR product of KpnI-gp67-FactorC-his6-ApaI; 2 is KpnI-gp67-FactorB-his6-ApaI; 3 is KpnI-gp67-PCE-his6-ApaI; 4 is the pcDNA plasmid (double digested with KpnI and ApaI); 5 is KpnI-gp67-FactorC-his6-ApaI (double digested with KpnI and ApaI); 6 is KpnI-gp67-FactorB-his6-ApaI (double digested with KpnI and ApaI); and 7 is KpnI-gp67-PCE-his6-ApaI (double digested with KpnI and ApaI). Figure 3 In the diagram, 1 represents pcDNA-gp67-factorC (verified by HindII digestion); 2 represents pcDNA-gp67-factorB (verified by HindII digestion); and 3 represents pcDNA-gp67-PCE (verified by HindIII digestion).

[0056] 2. Transfection of the recombinant product into the expression host:

[0057] When the culture density of mammalian cells HEK293 reaches 2*10 6 Transfection experiments can only be performed when the concentration is 1 / mL and the survival rate reaches 95% or higher. Among these, 2*10 6 2 μg of plasmid (the plasmid is pcDNA-gp67-factorC, pcDNA-gp67-factorB or pcDNA-gp67-PCE obtained in step 1 above) is required per mL of cells, and the transfection reagent PEI is 3 times the mass of the plasmid.

[0058] Take two EP tubes and add 0.5 mL of serum-free culture medium to each. Add 20 μg of plasmid to one tube and 60 μg of transfection reagent to the other tube. Mix them thoroughly. Slowly add the liquid containing the transfection reagent to the EP tube containing the plasmid and let it stand at room temperature for 10–15 min to form the transfection reagent-plasmid complex.

[0059] Add 1 mL of the transfection reagent-plasmid complex evenly to a culture dish containing cells, and gently agitate the dish to disperse the complex evenly. Incubate at 37°C in a 5% CO2 incubator for 6–18 hours. Remove the complex culture medium, replace with fresh culture medium, and continue culturing. After 96 hours of culture, collect the cell supernatant. This demonstrates that the C, B, and PCE factors expressed through gene recombination can be secreted from the cell into the extracellular space and enter the cell supernatant.

[0060] 3. Isolation and purification of Factor C, Factor B, and PCE proteins

[0061] Cell separation and purification were performed using a His-Tag affinity chromatography column. The cell supernatant obtained in step 2 was centrifuged at 3000g for 5 min at 4°C, and the supernatant was collected. The nickel column was washed with 5 column volumes of endotoxin-free pure water to remove 20% ethanol. The nickel column was then equilibrated with 10 column volumes of buffer. The supernatant was then passed through the equilibrated nickel column and eluted with 10 column volumes of elution buffer. The protein eluent was collected and analyzed by SDS-PAGE. The SDS-PAGE results are shown below. Figure 4 Display. In Figure 4 In -a, 1 represents factorB and 2 represents PCE; Figure 4 In -b, 1 represents factorC.

[0062] Example 2: Detection of Endotoxins

[0063] 1. Dynamic turbidimetry

[0064] The program and template settings for dynamic photometric instruments, taking the ELx808IULALXH horseshoe crab test microbial detection system as an example: Temperature setting: incubation temperature 37℃; Vibration setting: medium speed, vibration for 5 seconds; Kinetic parameter settings: reading time 120 minutes, reading interval 30 seconds, recommended detection wavelength 630nm.

[0065] Preparation of endotoxin standard solution

[0066] Add 1 mL of water for bacterial endotoxin testing to one vial of 60 EU bacterial endotoxin standard, and vortex vigorously for 15 minutes. Further dilute the endotoxin solution with water for bacterial endotoxin testing to a 5 EU / mL endotoxin solution. Serially dilute the 5 EU / mL endotoxin standard solution to prepare 0.5 EU / mL, 0.05 EU / mL, and 0.005 EU / mL solutions. Each dilution should be vortexed for at least 1 minute before preparation.

[0067] Dissolve the natural horseshoe crab reagent in water according to the labeled amount, and gently mix to make the horseshoe crab reagent completely dissolved.

[0068] Experimental operation:

[0069] The preheated horseshoe crab test microbial detection system ELx808IULALXH was set to a detection temperature of 37℃.

[0070] Take a pyrogen-free microplate and add 100 μL each of the following solutions to the corresponding wells: water for bacterial endotoxin testing (as a negative control), endotoxin standard solution, or test solution. Repeat the test three times, adding 100 μL of Limulus amebocyte lysate (LAL) reagent to each well.

[0071] Data processing

[0072] Set up OD to start, and the software will automatically calculate the results using linear regression.

[0073] The experimental results are as follows Figure 5 As shown: Dynamic turbidimetric assay for endotoxin detection, with R obtained after 2 hours. 2 The acceptable standard curve is >0.9605.

[0074] 2. Factor C fluorescence method

[0075] The procedure and template settings for fluorescence spectrophotometry instruments, taking the FLUOROSKAN detection system as an example: Temperature setting: incubation temperature 37℃; Vibration setting: medium speed, vibration for 5 seconds; Kinetic parameter settings: reading time 60 minutes, reading interval 60 seconds, recommended excitation wavelength 390nm and emission wavelength 460nm.

[0076] Preparation of endotoxin standard solution

[0077] Add 1 mL of water for bacterial endotoxin testing to one vial of 60 EU bacterial endotoxin standard, and vortex vigorously for 15 minutes. Further dilute the endotoxin solution with water for bacterial endotoxin testing to a 5 EU / mL endotoxin solution. Serially dilute the 5 EU / mL endotoxin standard solution to prepare 0.5 EU / mL, 0.05 EU / mL, and 0.005 EU / mL solutions. Each dilution should be vortexed for at least 1 minute before preparation.

[0078] Factor C mixture

[0079] Prepare a reaction buffer of 45 μL, a bacterial endotoxin test water of 39 μL, a fluorescent substrate of 10 μL, and a purified recombinant factor C (expressed by recombinant mammalian cells HEK293 in Example 1) of 6 μL. Mix gently and set aside.

[0080] Experimental Operation

[0081] Preheat the Fluoroskan fluorescence microplate detector and set the detection temperature to 37℃.

[0082] Take a pyrogen-free microplate and add 100 μL each of the bacterial endotoxin test water (as a negative control), endotoxin standard solution or test solution to the corresponding well. Repeat the test 3 times, adding 100 μL of factor mixture to each well.

[0083] Data processing

[0084] The software automatically calculates the results using linear regression.

[0085] The experimental results are as follows Figure 6 As shown: Endotoxin detection using fluorescence method; R is obtained after 1 hour. 2 A qualified standard curve of >0.9605 indicates that factor C expressed by HEK293 mammalian cells has the activity of binding to endotoxin, and that activated factor C can react with fluorescent substrates.

[0086] 3. Fluorescence methods for factor C, factor B, and PCE factor

[0087] The procedure and template settings for fluorescence spectrophotometry instruments, taking the FLUOROSKAN fluorescence microplate analyzer as an example:

[0088] Temperature settings: Incubation temperature 37℃; Vibration settings: Medium speed, vibration for 5 seconds; Dynamic parameters settings: Reading time 60 minutes, reading interval 60 seconds, recommended excitation wavelength 390nm and emission wavelength 460nm.

[0089] Preparation of endotoxin standard solution

[0090] Add 1 mL of water for bacterial endotoxin testing to one vial of 60 EU bacterial endotoxin standard, and vortex vigorously for 15 minutes. Further dilute the endotoxin solution with water for bacterial endotoxin testing to a 5 EU / mL endotoxin solution. Serially dilute the 5 EU / mL endotoxin standard solution to prepare 0.5 EU / mL, 0.05 EU / mL, and 0.005 EU / mL solutions. Each dilution should be vortexed for at least 1 minute before preparation.

[0091] A mixture of factor C, factor B, and PCE factor

[0092] The reaction buffer environment was 45 μL, the water for bacterial endotoxin testing was 39 μL, the fluorescent substrate coumarin was 10 μL, and 6 μL of the purified recombinant factor C, recombinant factor B and recombinant factor PCE (recombinant factor C, recombinant factor B and recombinant factor PCE were expressed by recombinant mammalian cells HEK293 in Example 1) was mixed and gently mixed for later use.

[0093] Experimental Operation

[0094] Preheat the Fluoroskan fluorescence microplate detector and set the detection temperature to 37℃.

[0095] Take a pyrogen-free microplate and add 100 μL each of the bacterial endotoxin test water (as a negative control), endotoxin standard solution or test solution to the corresponding well. Repeat the test 3 times. Add 100 μL of the mixture of factor C, factor B and factor PCE to each well.

[0096] Data processing

[0097] The software automatically calculates the results using linear regression.

[0098] The experimental results are as follows Figure 7 As shown: Endotoxin detection using fluorescence method yields R after 0.5 hours. 2 The qualified standard curve >0.9605 indicates that factor C expressed by mammalian cells HEK293 has the activity of binding to endotoxin, and the activated factor C can react with fluorescent substrates. Furthermore, the addition of factor B and PCE expressed by mammalian cells HEK293 promotes the binding of factor C to endotoxin, increases the probability of factor C being activated, and thus shortens the detection time.

[0099] 4. Fluorescence methods for factor C, factor B, and PCE factor

[0100] The procedure and template settings for fluorescence spectrophotometry instruments, taking the FLUOROSKAN fluorescence microplate analyzer as an example:

[0101] Temperature settings: Incubation temperature 37℃; Vibration settings: Medium speed, vibration for 5 seconds; Dynamic parameters settings: Reading time 60 minutes, reading interval 60 seconds, recommended excitation wavelength 390nm and emission wavelength 460nm.

[0102] Preparation of endotoxin standard solution

[0103] Add 1 mL of water for bacterial endotoxin testing to one vial of 60 EU bacterial endotoxin standard, and vortex vigorously for 15 minutes. Further dilute the endotoxin solution with water for bacterial endotoxin testing to a 5 EU / mL endotoxin solution. Serially dilute the 5 EU / mL endotoxin standard solution to prepare 0.5 EU / mL, 0.05 EU / mL, and 0.005 EU / mL solutions. Each dilution should be vortexed for at least 1 minute before preparation.

[0104] A mixture of factor C, factor B, and PCE factor

[0105] Prepare a 45 μL reaction buffer, 39 μL water for bacterial endotoxin testing, 10 μL of the fluorescent substrate coumarin, and 6 μL of purified recombinant factor C, recombinant factor B, and recombinant factor PCE (factor C is expressed by mammalian HEK293 cells, while factors B and PCE are expressed by insect sf9 cells). Mix well and set aside.

[0106] Experimental Operation

[0107] Preheat the Fluoroskan fluorescence microplate detector and set the detection temperature to 37℃.

[0108] Take a pyrogen-free microplate and add 100 μL each of the bacterial endotoxin test water (as a negative control), endotoxin standard solution or test solution to the corresponding well. Repeat the test 3 times. Add 100 μL of the mixture of factor C, factor B and factor PCE to each well.

[0109] Data processing

[0110] The software automatically calculates the results using linear regression.

[0111] The experimental results are as follows Figure 8 As shown: Endotoxin detection using fluorescence method, R is obtained after 1 hour. 2 The qualified standard curve >0.9605 indicates that factor C expressed by mammalian HEK293 cells has the activity of binding to endotoxin, and the activated factor C can react with fluorescent substrates. However, compared with the direct addition of factor B and PCE expressed by mammalian HEK293 cells, the addition of factor B and PCE expressed by insect cells resulted in longer detection time and lower sensitivity.

[0112] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. The illustrative expressions of the above terms in this specification should not be construed as necessarily referring to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. In addition, those skilled in the art can combine and integrate the different embodiments or examples described in this specification.

[0113] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Xiamen Horseshoe Crab Reagent Biotechnology Co., Ltd. <120> A recombinant horseshoe crab three-factor composition and a method for detecting endotoxins therein. <130> none <160> 17 <170> PatentIn version 3.5 <210> 1 <211> 1488 <212> DNA <213> Artificial sequence <400> 1 cggggtacca tgctactagt aaatcagtca caccaaggct tcaataagga acacacaagc 60 aagatggtaa gcgctattgt tttatatgtg cttttggcgg cggcggcgca ttctgccttt 120 gcgaaaaaaa acggctacgc ggttgactcg tcgggcaaag cgccagaatg tctactatcg 180 aactactgta acaaccaatg tactaaagtt cactacgctg acaaaggcta ctgttgtcta 240 ctaagctgtt actgttttgg ctaaacgac gacaaaaaag ttctagaaat tagcgacact 300 cgtaaaagct actgtgacac tactattatt aacatgctgg tcaacaacgt gttcagcctg 360 ctgtgcttcc cactgctgat gagcgtcgtg cggtgtagca cactgagcag acagcggaga 420 cagttcgtgt tccccgacga agaggaactg tgcagcaacc ggttcaccga agagggcaca 480 tgcaagaacg tgctggactg cagaatcctg ctgcagaaga acgactacaa cctgctgaaa 540 gagagcatct gcggcttcga gggcatcacc cctaaagtgt gctgccccaa gagcagccac 600 gtgatcagct ctacacaggc ccctccagag acaaccacca cagagaggcc tccaaagcag 660 atccctcta acctgcctga agtgtgcggc atccacaaca ccaccaccac aagaatcatc 720 ggcggcagag aagcccctat cggagcttgg ccttggatga ccgccgtgta catcaagcaa 780 ggcggcatca gatccgtgca gtgtggcgga gccctggtca ccaatagaca tgtgatcacc 840 gccagccact gcgtggtcaa ttctgccggc acagatgtga tgcccgccga cgtgttctct 900 gtgcggctgg gagagcacaa cctgtacagc accgacgacg acagcaaccc catcgattttt 960 gccgtgacca gcgtgaagca ccacgagcac tttgtgctgg ccacctacct gaacgatatc 1020 gccatcctga cactgaacga caccgtgacc ttcaccgacc ggatcagacc tatctgcctg 1080 ccttaccgga agctgagata cgacgacctg gccatgcgga agcctttcat caccggctgg 1140 ggcaccacag cctttaatgg ccctagtagc gccgtgctga gagaggtgca actgcctatt 1200 tgggagcacg aggcctgcag acaggcctac gagaaggacc tgaacatcac caacgtgtac 1260 atgtgcgccg gctttgccga tggcggaaag gatgcttgtc agggcgattc tggcggccct 1320 atgatgctgc ctgtgaaaac cggcgagttc tacctgatcg gcatcgtgtc cttcggcaag 1380 aagtgtgccc tgcctggatt ccctggcgtg tacaccaaag tgaccgagtt tctggactgg 1440 atcgccgagc acatggtgca tcatcatcat catcattaag ggccccct 1488 <210> 2 <211> 1563 <212> DNA <213> Artificial Sequence <400> 2 cggggtacca tgctactagt aaatcagtca caccaaggct tcaataagga acacacaagc 60 aagatggtaa gcgctattgt tttatatgtg cttttggcgg cggcggcgca ttctgccttt 120 gcgaaaaaaa acggctacgc ggttgactcg tcgggcaaag cgccagaatg tctactatcg 180 aactactgta acaaccaatg tactaaagtt cactacgctg acaaaggcta ctgttgcta 240 ctaagctgtt actgttttgg ctaaacgac gacaaaaaag ttctagaaat tagcgacact 300 cgtaaaagct actgtgacac tactattatt aacatgacct ggatctgcgt gatcaccctg 360 tttgccctgg cctctgccac actgggaaac aaggtgtcca gagtgggcgt gctgttcccc 420 aagaccagaa acgacaacga gtgcacagcc agaggcggcc tgaagggcag ctgtaaaagc 480 ctgatcgact gcccctctgt gctggccaca ctgaaggata gcttccccgt cgtgtgcagc 540 tggaacggca gattccagcc tatcgtgtgc tgccccgatg ctattgctcc tcctcctgtg 600 accaccaccg ccgtgacagt gatcagcacc aaagagccca agctgcccag actgcacatc 660 agcggatgcg gcaagcggaa agtgaagatc gacatcacca ccgtgggcag aagcggctct 720 cctatcctgc ctcctatcag cacccctcag aatagcacag gcggcagagg cattattgcc 780 ggcggagtgg aagccaagat tggcgcttgg ccttggatgg ccgccgtgtt cgtgaagaat 840 ttcggcatcg gcaggttcca ctgtgccggc agcatcatca gcaacaagta catcctgagc 900 gccgctcacg cctttctgat cggcggaaga aagctgaccc ctaccagact ggccgttaga 960 gtcggcggcc actacatcaa gagaggccaa gagtaccccg tgaaggacgt gatcattcac 1020 cctcactacg tcgagaaaga gaactacaac gatatcgcca tcatcgagct gaaagaggaa 1080 ctgaacttca ccgacctggt caaccccatc tgcctgcctg atcctgagac agtgaccgat 1140 cctctgaagg accggatcgt gacagctgcc ggatggggcg atctggattt cagcggacct 1200 agaagccagg tgctgcggga agtgtctatc cctgtggtgc ccgtggacaa gtgcgatcag 1260 gcctacgaga agctgaacac ccctagcctg aagaacggga tcaccaacaa ctttctgtgt 1320 gccggcctgg aagaaggcgg caaagacgct tgtcaaggcg attctggcgg ccctctgatg 1380 ctcgtgaaca acaccagatg gatcgtcgtg ggcgtcgtgt ccttcggaca caagtgtgcc 1440 gaagagggct accctggcgt gtacagcaga gtggccagct acctggactg gatcgccaaa 1500 gtgaccaaca gcctggatca cgccgtgacc aaccatcatc atcatcatca ttgagggccc 1560 cct 1563 <210> 3 <211> 1024 <212> DNA <213> Artificial sequence <400> 3 cggggtacca tgctactagt aaatcagtca caccaaggct tcaataagga acacacaagc 60 aagatggtaa gcgctattgt tttatatgtg cttttggcgg cggcggcgca ttctgccttt 120 gcgaaaaaaa acggctacgc ggttgactcg tcgggcaaag cgccagaatg tctactatcg 180 aactactgta acaaccaatg tactaaagtt cactacgctg acaaaggcta ctgttgtcta 240 ctaagctgtt actgttttgg cctaaacgac gacaaaaaag ttctagaaat tagcgacact 300 cgtaaaagct actgtgacac tactattatt aacatgctgg tcaacaacgt gttcagcctg 360 ctgtgcttcc cactgctgat gagcgtcgtg cggtgtagca cactgagcag acagcggaga 420 cagttcgtgt tccccgacga agaggaactg tgcagcaacc ggttcaccga agagggcaca 480 tgcaagaacg tgctggactg cagaatcctg ctgcagaaga acgactacaa cctgctgaaa 540 gagagcatct gcggcttcga gggcatcacc cctaaagtgt gctgccccaa gagcagccac 600 gtgatcagct ctacacaggc ccctccagag acaaccacca cagagaggcc tccaaagcag 660 atccctccta acctgcctga agtgtgcggc atccacaaca ccaccaccac aagaatcatc 720 ggcggcagag aagcccctat cggagcttgg ccttggatga ccgccgtgta catcaagcaa 780 ggcggcatca gatccgtgca gtgtggcgga gccctggtca ccaatagaca tgtgatcacc 840 gccagccact gcgtggtcaa ttctgccggc acagatgtga tgcccgccga cgtgttctct 900 gtgcggctgg gagagcacaa cctgtacagc accgacgacg acagcaaccc catcgatttt 960 gccgtgacca gcgtgaagca ccacgagcac tttgtgctgg ccacctacct gaacgatatc 1020 gcca 1024 <210> 4 <211> 3060 <212> DNA <213> Artificial Sequence <400> 4 atggtgctgg ctagctttct ggtgtctggc ctggtgctgg gaattctggc tcagcagatg 60 aggcccgtgc agtctagagg tgttgatctg ggcctgtgcg acgagacaag attcgagtgc 120 aagtgcggcg accccggcta cgtgttcaat gtgcctatga agcagtgcac ctacttctac 180 cggtggcggc cctactgcaa gccttgcgac gatctggaag ccaaggacat ctgccccaag 240 tacaagcggt gccaagagtg caaggccgga ctggatagct gcgtgacctg tcctcctaac 300 aaatacggca cctggtgcag cggcgagtgc cagtgtaaaa atggcggcat ctgcgaccag 360 agaaccggcg cctgtacctg cagagataga tatgaaggcg cccactgcga gatcctgaag 420 ggctgtccac tgctgcctag cgacagccag gttcaagaag tgcggaaccc tcctgacaac 480 cctcagacca tcgactactc ttgcagcccc ggcttcaagc tgaaaggcgt ggccagaatc 540 agctgcctgc ctaacggaca gtggtccagc tttccaccta agtgcatccg cgagtgcgcc 600 aaggtgtcct ctcctgaaca cggcaaagtg aacgccccta gcggcaacat gattgagggc 660 gccacactga gattcagctg cgactcccct tactacctga tcggccaaga gacactgacc 720 tgccaaggca atggacagtg gagcggacag atccctcagt gcaagaaact ggtgttctgc 780 cccgatctgg accccgtgaa tcacgccgag caccaagtga agatcggcgt ggaacagaag 840 tacggccagt ttcctcaggg caccgaagtg acctacacct gttccggcaa ctacttcctg 900 atgggcttca acaccctgaa gtgcaacccc gacggatctt ggagcggcag ccagccttct 960 tgtgtgaagg tggccgatag agaggtggac tgcgatagca aggccgtgga cttcctggat 1020 gatgtgggag agcctgtgcg gattcactgt cctgccggct gttctctgac agccggaact 1080 gtttggggca ccgccatcta ccacgagctg agcagtgtgt gtagagccgc cattcacgcc 1140 ggcaagctgc ctaattctgg cggagctgtg cacgtggtca acaacggccc ttacagcgat 1200 ttcctgggca gcgacctgaa cggcatcaag agcgagcaac tgaagtccct ggccagaagc 1260 ttcagattcg actacgtgtc cagcagcacc gccggcagat ctggatgtcc tgatggatgg 1320 ttcgaggtgg aagagaactg cgtgtacgtg accagcaagc agagcctg ggaaagagca 1380 cagggcgtct gcaccaatat ggccgctaga ctggccgtgc tggacaagga tctgatcccc 1440 agcagcctga ccgagactct gagaggcaag ggcctgacca caacatggat cggcctgcac 1500 agactggacg ccgagaagcc atttgtgtgg gagctgatgg accgcagcaa cgtggtgctg 1560 aacgaaacc tgaccttttg ggcctctggc gagcccggca aggagaaa ttgcgtgtac 1620 ctggacatcc gggaccagct gcagcccgtg tggaaaacaa agagctgctt ccagcctagc 1680 agcttcgcct gcatgatgga cctgagcgac cggaacaagg ccaagtgtga cgatcccgga 1740 cctctggaaa acggccatgc cacactgcac ggacagagca tcgatggctt ttacgccggc 1800 agcagcatcc ggtacagctg cgaagtgctg cactacctgt ctggcaccga aaccgtgacc 1860 tgcaccacca atggaacttg gagcgcccct aagcctcggt gcatcaaagt gatcacctgt 1920 cagaaccctc cagtgcctag ctacggcagc gtggaaatca agcctcctag ccggaccaac 1980 agcatcagca gagtgggcag cccattcctg agactgccta gacttcctct gccactggcc 2040 agagccgcta agcctcctcc aaagcctaga agctctcagc ccagcacagt ggacctggcc 2100 tccaaagtga agctgcctga gggccactac agagtgggaa gcagagccat ctacacatgc 2160 gagagccggt actacgagct gctgggatct cagggcagaa gatgcgacag caacggcaat 2220 tggagtggca gacctgccag ctgtatcccc gtgtgtggca gaagcgatag ccctagaagc 2280 cccttcatct ggaacggcaa cagcaccgag atcggacaat ggccatggca ggccggcatc 2340 tctagatggc tggccgacca caatatgtgg tttctgcagt gcggcggcag cctgctgaat 2400 gagaagtgga ttgtgaccgc cgctcactgc gtgacatact ctgccacagc cgagatcatc 2460 gaccctagcc agtttaagat ctacctgggc aagtactacc gggacgacag cagggacgac 2520 gattacgtgc aagttcgcga ggccctggaa atccacgtga accccaatta cgaccctggc 2580 aacctgaact tcgatatcgc cctgatccag ctgaaaaccc ctgtgactct gaccaccaga 2640 gtgcagccca tctgcctgcc aaccgatatc accacaagag agcacctgaa agagggcacc 2700 ctggccgttg tgacaggctg gggactgaac gagaacaaca cctacagcga gatgatccag 2760 caggcagtgc tgcctgtggt ggccgcctct acatgtgaag agggctacaa agaggccgac 2820 ctgcctctga ccgtgaccga gaatatgttc tgcgccggct acaagaaggg cagatacgac 2880 gcctgtagcg gcgatagcgg aggccctctg gtgtttgccg atgactctag aaccgagcgg 2940 agatgggtgc tcgagggcat tgtgtcttgg ggaagcccta gcggatgcgg caaggccaat 3000 cagtacggcg gctttacaaa agtcaacgtg ttcctgagct ggatccggca gttcatctga 3060 <210> 5 <211> 1203 <212> DNA <213> Artificial sequence <400> 5 atgacctgga tctgcgtgat caccctgttt gccctggcct ctgccacact gggaaacaag 60 gtgtccagag tgggcgtgct gttccccaag accagaaacg acaacgagtg cacagccaga 120 ggcggcctga agggcagctg taaaagcctg atcgactgcc cctctgtgct ggccacactg 180 aaggatagct tccccgtcgt gtgcagctgg aacggcagat tccagcctat cgtgtgctgc 240 cccgatgcta ttgctcctcc tcctgtgacc accaccgccg tgacagtgat cagcaccaaa 300 gagcccaagc tgcccagact gcacatcagc ggatgcggca agcggaaagt gaagatcgac 360 atcaccaccg tgggcagaag cggctctcct atcctgcctc ctatcagcac ccctcagaat 420 agcacaggcg gcagaggcat tattgccggc ggagtggaag ccaagattgg cgcttggcct 480 tggatggccg ccgtgttcgt gaagaatttc ggcatcggca ggttccactg tgccggcagc 540 atcatcagca acaagtacat cctgagcgcc gctcacgcct ttctgatcgg cggaagaaag 600 ctgaccccta ccagactggc cgttagagtc ggcggccact acatcaagag aggccaagag 660 taccccgtga aggacgtgat cattcaccct cactacgtcg agaaagagaa ctacaacgat 720 atcgccatca tcgagctgaa agaggaactg aacttcaccg acctggtcaa ccccatctgc 780 ctgcctgatc ctgagacagt gaccgatcct ctgaaggacc ggatcgtgac agctgccgga 840 tggggcgatc tggatttcag cggacctaga agccaggtgc tgcgggaagt gtctatccct 900 gtggtgcccg tggacaagtg cgatcaggcc tacgagaagc tgaacacccc tagcctgaag 960 aacgggatca ccaacaactt tctgtgtgcc ggcctggaag aaggcggcaa agacgcttgt 1020 caaggcgatt ctggcggccc tctgatgctc gtgaacaaca ccagatggat cgtcgtgggc 1080 gtcgtgtcct tcggacacaa gtgtgccgaa gagggctacc ctggcgtgta cagcagagtg 1140 gccagctacc tggactggat cgccaaagtg accaacagcc tggatcacgc cgtgaccaac 1200 tga 1203 <210> 6 <211> 1128 <212> DNA <213> Artificial Sequence <400> 6 atgctggtca acaacgtgtt cagcctgctg tgcttcccac tgctgatgag cgtcgtgcgg 60 tgtagcacac tgagcagaca gcggagacag ttcgtgttcc ccgacgaaga ggaactgtgc agcaaccggt tcaccgaaga gggcacatgc aagaacgtgc tggactgcag aatcctgctg cagaagaacg actacaacct gctgaaagag agcatctgcg gcttcgaggg catcacccct aaagtgtgct gccccaagag cagccacgtg atcagctcta cacaggcccc tccagagaca 300 360. accaccacag agaggcctcc aaagcagatc cctcctaacc tgcctgaagt gtgcggcatc 420. aatcatcggc ggcagagag cccctatcgg agcttggcct tggatgaccg ccgtgtacat caagcaaggc ggcatcagat ccgtgcagtg tggcggagcc 480 ctggtcacca atagacatgt gatcaccgcc agccactgcg tggtcaattc tgccggcaca 540 gatgtgatgc ccgccgacgt gttctctgtg cggctgggag agcacaacct gtacagcacc 660. gcgacgac gcaaccccat cgattttgcc gtgaccagcg tgaagcacca cgagcacttt gtgctggcca cctacctgaa cgatatcgcc atcctgacac tgaacgacac cgtgaccttc accgaccgga tcagacctat ctgcctgcct taccggagc tgagatacga cgacctggcc 780 atgcggaagc ctttcatcac cggctggggc accacagcct ttaatggccc tagtagcgcc gtgctgagag aggtgcaact gcctatttgg gccgagg cctgcagaca ggcctacgag aaggacctga acatcaccaa cgtgtacatg tgcgccggct ttgccgatgg cggaaaggat gcttgtcagg gcgattctgg cggccctatg atgctgcctg tgaaaaccgg cgagttctac ctgatcggca tcgtgtcctt cggcaagaag tgtgccctgc ctggattccc tggcgtgtac 1080 accaaagtga ccgagtttct ggactggatc gccgagcaca tggtgtaa <210> 7 <211> 327 <212> DNA <213> The snowstorm <400> 7 atgctactag taaatcagtc acaccaaggc ttcaataagg aacacacaag caagatggta agcgctattg ttttatatgt gctttttggcg gcggcggcgc attctgcctt tgcgaaaaaa 120 aacggctacg cggttgactc gtcgggcaaa gcgccagaat gtctactatc gaactactgt 240. aacaaccaat gtactaaagt tcactacgct gacaaaggct actgttgtct actagctgt 300. tactgttttg gcctaaacga cgacaaaaaa gttctagaa ttagcgacac tcgtaaaagc tactgtgaca ctactattat taactaa 327 <210> 8 <211> 35 <212> DNA <213> Artificial sequence <400> 8 actactatta ttaacatggt gctggctagc tttct 35 <210> 9 <211> 35 <212> DNA <213> Artificial sequence <400> 9 actactatta ttaacatggt gctggctagc tttct 35 <210> 10 <211> 35 <212> DNA <213> Artificial sequence <400> 10 actactatta ttaacatgac ctggatctgc gtgat 35 <210> 11 <211> 47 <212> DNA <213> Artificial sequence <400> 11 aggggggccct caatgatgat gatgatgatg gttggtcacg gcgtgat 47 <210> 12 <211> 35 <212> DNA <213> Artificial sequence <400> 12 actactatta ttaacatgct ggtcaacaac gtgtt 35 <210> 13 <211> 47 <212> DNA <213> Artificial sequence <400> 13 agggggccct taatgatgatgatgatg caccatgtgc tcggcga <210> 14 <211> 29 <212> DNA <213> The snowstorm <400> 14 29. cggggtacca tgctactagt aaatcagtc <210> 15 <211> 35 <212> DNA <213> The snowstorm <400> 15 gctagccagc accatgttaa taatagtagt gtcac <210> 16 <211> 34 <212> DNA <213> The snowstorm <400> 16 gcagatccag gtcatgttaa taatagtagt gtca <210> 17 <211> 35 <212> DNA <213> The snowstorm <400> 17 gttgttgacc agcatgttaa taatagtagt gtcac

Claims

1. A recombinant horseshoe crab three-factor composition, characterized in that, Including recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor; The recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor were all expressed in mammalian cells HEK293. The preparation of the recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor includes the following steps: (1) Using the gene shown in SEQ ID NO:4 as a template, SEQ ID NO:8 and SEQ ID NO:9 were used as primers to amplify factor C by PCR to obtain FactorC-his6-ApaI; using the gene shown in SEQ ID NO:5 as a template, SEQ ID NO:10 and SEQ ID NO:11 were used as primers to amplify factor B by PCR to obtain FactorB-his6-ApaI; using the gene shown in SEQ ID NO:6 as a template, SEQ ID NO:12 and SEQ ID NO:13 were used as primers to amplify the recombinant horseshoe crab coagulase factor by PCR to obtain PCE-his6-ApaI; using the gene shown in SEQ ID NO:7 as a template, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17 were used as primers to amplify gp67 by PCR to obtain KpnI-gp67-1, KpnI-gp67-2 and KpnI-gp67-3; (2) The KpnI-gp67-1 gene fragment was ligated with the FactorC-his6-ApaI gene fragment to obtain KpnI-gp67-FactorC-his6-ApaI; the KpnI-gp67-2 gene fragment was ligated with the FactorB-his6-ApaI gene fragment to obtain KpnI-gp67-FactorB-his6-ApaI; the KpnI-gp67-3 gene fragment was ligated with the PCE-his6-ApaI gene fragment to obtain KpnI-gp67-PCE-his6-ApaI; (3) The KpnI-gp67-FactorC-his6-ApaI gene fragment, the KpnI-gp67-FactorB-his6-ApaI gene fragment, and the KpnI-gp67-PCE-his6-ApaI gene fragment were respectively ligated to the pcDNA vector to obtain recombinant plasmids pcDNA-gp67-factorC, pcDNA-gp67-factorB, and pcDNA-gp67-PCE. The recombinant plasmids were then transfected into mammalian cells HEK293, and the purified proteins were cultured to express and obtain recombinant horseshoe crab C factor, recombinant horseshoe crab B factor, and recombinant horseshoe crab coagulase factor.

2. The recombinant horseshoe crab three-factor composition as described in claim 1, characterized in that, The nucleotide sequence of the recombinant horseshoe crab C factor is shown in SEQ ID NO: 1, the nucleotide sequence of the recombinant horseshoe crab B factor is shown in SEQ ID NO: 2, and the nucleotide sequence of the recombinant horseshoe crab coagulase factor is shown in SEQ ID NO:

3.

3. A method for detecting endotoxins using the recombinant horseshoe crab three-factor composition as described in claim 1 or 2, characterized in that, Includes the following steps: (1) Prepare at least three endotoxin standard solutions of different concentrations; (2) The recombinant horseshoe crab C factor, recombinant horseshoe crab B factor and recombinant horseshoe crab coagulase factor are mixed with fluorescent substrate, bacterial endotoxin test water and buffer to prepare a mixture; (3) Add the mixture and each of the endotoxin standard solutions to the microplate at a volume ratio of 1:1, and set up a negative control group at the same time; (4) Place the microplate in a fluorescent microplate detector for detection; (5) Plot a standard curve with the change in fluorescence intensity as the ordinate and the concentration of the endotoxin standard solution as the abscissa.

Citation Information

Patent Citations

  • Recombinant limulus three-factor reagent and method for detecting endotoxin with same

    CN105866080A

  • High-purity limulus reagent, endotoxin concentration measuring kit, and endotoxin concentration measuring method

    JP2015141088A

  • Method for producing limulus reagent, and method for measuring endotoxin

    JP2019004705A