A method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton and a cotton variety identification method

Abstract

The present invention provides a method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton and a cotton variety identification method, belonging to the technical field of plant variety identification. The present invention screens the approved sea island cotton varieties in Xinjiang based on capillary electrophoresis for SSR markers, wherein the capillary electrophoresis does not need to undergo complex processes such as staining and development for sample genotype analysis, which saves time and is conducive to large sample processing, and is convenient for application in variety authenticity and purity detection; the capillary electrophoresis detection method directly reads the target DNA specific target band size through a fluorescent line based on the position of the target peak of the variety to be detected and compared with the internal standard of the same capillary lane, with an accuracy of 1 bp.

Description

Technical Field

[0001] The invention relates to the technical field of plant variety identification, and in particular to a method for constructing a Xinjiang sea island cotton capillary electrophoresis DNA fingerprint and a cotton variety identification method. Background Art

[0002] Sea Island Cotton is the finest cotton fiber in the world. It was successfully planted on Saint Simon Island in Georgia in 1786, so it was named "Sea Island Cotton". The excellent characteristics of Sea Island Cotton are that its fibers are very slender and have a particularly high strength, making it the best textile fiber. Clothes woven with Sea Island Cotton have excellent touch, good air permeability and sweat absorption. Moreover, due to the luster of Sea Island Cotton and its high affinity for dyes, the colors of clothes are bright and vivid, which is incomparable to other cotton clothes.

[0003] Sea island cotton seed resources are one of the most important means of production in Xinjiang's sea island cotton production, and high-quality varieties are the basis for high and stable yields of sea island cotton. Mixed varieties and reduced purity will significantly reduce the yield and quality of sea island cotton. Therefore, the identification of the authenticity and purity of sea island cotton varieties is crucial for sea island cotton breeding.

[0004] Commonly used methods for identifying crop varieties include morphological identification, physicochemical identification, biochemical identification, and DNA molecular marker fingerprinting. Due to the development of molecular biology technology, the use of molecular marker technology to construct DNA fingerprints of crop varieties has the advantages of being fast, simple, and accurate, and has become an important technical tool for identification between varieties and seed purity detection. For example, microsatellite DNA or short tandem repeats (STR), which were created in 1991, are a type of repetitive sequence that is ubiquitous in the genome of eukaryotic organisms. The repetitive sequence is generally composed of 1 to 6 bases, and the number of repetitions is highly variable between different species or different genotypes of the same species. Most of the ends of these repetitive sequences are conserved single-copy sequences, so specific primers can be designed based on the conserved sequences, and the core repetitive sequence in the middle can be amplified by PCR technology. Its length polymorphism can be obtained by agarose electrophoresis or polyacrylamide gel electrophoresis analysis technology.

[0005] However, there are shortcomings in obtaining length polymorphism using agarose electrophoresis or polyacrylamide gel electrophoresis analysis technology. For example, the size of specific target bands cannot be detected, which makes it difficult to identify and compare multiple batches of cotton varieties. Summary of the invention

[0006] The purpose of the present invention is to provide a method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton and a cotton variety identification method. The method of the present invention is used for large sample processing and has high processing accuracy.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton, comprising the following steps:

[0009] From the known cotton SSR primers located on chromosomes, primers with polymorphism among different cotton species were selected as core primers;

[0010] Using the core primers to perform PCR amplification on approved sea island cotton varieties in Xinjiang to obtain amplified products;

[0011] The amplified product was subjected to capillary electrophoresis to obtain a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton.

[0012] Preferably, the core primers include: MGHES31, MON_CGR6812, NAU2713a, MON_CGR6012, HAU4022, NAU2631, MUSS422a, HAU2846, HAU2770, HAU0938, NAU3913, NAU6734, NAU3346b, MON_DPL0521, BNL3043, NAU3433, MON_SHIN-1585, NAU5172, MON_DPL0024, MON_SHIN-1494b, NAU2985, HAU3071a, NAU3736b, NBRI_HQ527566, BN One or more of L2535b, CCRI596a, NAU3827, NBRI_HQ526730, MON_DPL0504a, HAU1952b, NAU3298, MON_SHIN-1584, Gh330, MON_CGR5007, NAU7182, HAU1496, MON_DPL0502, HAU4748, NAU7049, BNL3031, NBRI_HQ527820, CK988221-PR-ss, HAU4483, NAU3419c, DPL0238, MON_CGR5732, HAU3193 and MON_SHIN-1481.

[0013] Preferably, the approved sea island cotton varieties in Xinjiang include: Xinhaimian1, Xinhaimian2, Xinhaimian3, Xinhaimian4, Xinhaimian5, Xinhaimian6, Xinhaimian7, Xinhaimian8, Xinhaimian9, Xinhaimian10, Xinhaimian11, Xinhaimian12, Xinhaimian13, Xinhaimian14, Xinhaimian15, Xinh aimian16, aimian24、Xinhaimian25、Xinhaimian26、Xinhaimian27、Xinhaimian28、Xinhaimian29、Xinhaimian30、Xinhaimian31、Xinha imian32、Xinhaimian33、Xinhaimian34、Xinhaimian35、Xinhaimian36、Xinhaimian37、Xinhaimian38、Xinhaimian39、Xinha imian40、Xinhaimian41、Xinhaimian42、Xinhaimian43、Xinhaimian44、Xinhaimian45、Xinhaimian46、Xinhaimian47、 One or more of Xinhaimian48, Xinhaimian49, Xinhaimian50, Xinhaimian51, Xinhaimian52, Xinhaimian53, Xinhaimian54, Xinhaimian55, Xinhaimian56, Xinhaimian57, Xinhaimian58, Xinhaimian59, Xinhaimian60, Xinhaimian61, Xinhaimian62 and Xinhaimian63.

[0014] Preferably, the PCR amplification system, based on 10 μl, includes the following components: 2.5 μl DNA template, 0.16 μl forward primer, 0.16 μl reverse primer, 0.25 μl dNTP, 1 μl 10×Taq buffer, 0.8 μl MgCl2, 0.16 μl Taq enzyme and 4.97 μl ddH2O.

[0015] Preferably, the PCR amplification procedure includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 sec, annealing at 58°C for 45 sec, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0016] Preferably, after subjecting the amplified product to capillary electrophoresis, the method further includes: marking different polymorphisms generated by each pair of primers according to the relative position of the amplified product on the electrophoresis gel, calculating the site polymorphism information content, and constructing a capillary electrophoresis DNA fingerprint of Xinjiang Sea Island Cotton based on the different genotypes of each pair of primers in different materials.

[0017] The present invention also provides the application of the Xinjiang Sea Island Cotton capillary electrophoresis DNA fingerprint spectrum constructed by the construction method described in the above scheme in the identification of Xinjiang Sea Island Cotton varieties.

[0018] Preferably, the method for identifying Xinjiang Sea Island cotton varieties comprises the following steps:

[0019] Using the core primers to perform PCR amplification on the tested sea island cotton variety to obtain an amplified product; performing capillary electrophoresis on the amplified product to obtain the band size of the amplified product;

[0020] The capillary electrophoresis DNA fingerprint of Xinjiang Sea Island Cotton constructed by the construction method described in the above scheme is compared with the band size of the amplified product of the Sea Island Cotton variety to be tested to determine the Sea Island Cotton variety to be tested.

[0021] The present invention provides a method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton. The present invention screens SSR markers of approved sea island cotton varieties in Xinjiang based on capillary electrophoresis, wherein capillary electrophoresis does not need to undergo complex processes such as staining and development for sample genotype analysis, saves time and facilitates large sample processing, and is convenient for application in variety authenticity and purity detection; the capillary electrophoresis detection method directly reads the size of the target DNA specific target band through a fluorescent line based on the position of the target peak of the variety to be detected and the internal standard of the same capillary lane, with an accuracy of 1 bp. The present invention constructs SSR molecular fingerprints for Xinjiang sea island cotton varieties based on capillary electrophoresis, and since the capillary electrophoresis amplification product can read the target band accurately to 1 bp, when a certain primer has a unique specific band for a variety, the variety can be identified from other varieties, and the variety DNA fingerprint detection is simple, fast and highly accurate. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the capillary electrophoresis DNA fingerprint of Xinjiang Sea Island Cotton. DETAILED DESCRIPTION

[0023] The present invention provides a method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton, comprising the following steps:

[0024] Primers that are polymorphic among different cotton species are screened from known cotton SSR primers located on chromosomes to serve as core primers; fluorescent PCR amplification is performed on approved Xinjiang sea island cotton varieties using the core primers to obtain amplified products; capillary electrophoresis is performed on the amplified products to obtain a capillary electrophoresis DNA fingerprint map of Xinjiang sea island cotton.

[0025] The present invention constructed 63 copies of all the sea island cotton varieties approved in Xinjiang from 1978 to 2018, and the varieties approved in 2018 were announced in 2021. Based on the 0.91cM high-density sea and land cotton interspecific map of 5152 pairs of SSR markers, the markers covered 26 chromosomes of the cotton genome, and 48 pairs of specific primers and combination primers for sea island cotton varieties were screened. The sea island cotton varieties to be tested were detected based on the fingerprint map constructed above and the principle of capillary electrophoresis fluorescence staining, and its specific primers and combination primers were obtained according to the size of the fragment amplified by the sea island cotton variety to be tested. Different from polyacrylamide electrophoresis PAGE (PAGE, based on the molecular sieving effect, the molecular weight is determined to obtain 0, 1 banding type), the present invention can obtain an accurate fragment size of 1bp, and use specific primers (the fragment size of the sample to be tested and the original sample is consistent) or combination primers to identify sea island cotton varieties.

[0026] In the present invention, the known cotton SSR primers located on chromosomes include primer markers located on a genetic linkage map containing 5152 markers on chromosomes constructed by Huazhong Agricultural University.

[0027] In the present invention, the core primers preferably include: MGHES31, MON_CGR6812, NAU2713a, MON_CGR6012, HAU4022, NAU2631, MUSS422a, HAU2846, HAU2770, HAU0938, NAU3913, NAU6734, NAU3346b, MON_DPL0521, BNL3043, NAU3433, MON_SHIN-1585, NAU5172, MON_DPL0024, MON_SHIN-1494b, NAU2985, HAU3071a, NAU3736b, NBRI_HQ527 566, BNL2535b, CCRI596a, NAU3827, NBRI_HQ526730, MON_DPL0504a, HAU1952b, NAU3298, MON_SHIN-1584, Gh330, MON_CGR5007, NAU7182, HAU1496, M ON_DPL0502, HAU4748, NAU7049, BNL3031, NBRI_HQ527820, CK988221-PR-ss, HAU4483, NAU3419c, DPL0238, MON_CGR5732, HAU3193 and MON_SHIN-1481.

[0028] In the present report, Xinjiang International Airport, Dinghai Island, Cotton Products Selected Comprehensive: Xinhaimian 1, Xinhai 2, Xinhai 3, Xinhai 4, Xinhai 5, Xinhai mian6 (Shinkai No. 6), Xinhaimian7 (Shinkai No. 7), Xinhaimian8 (Shinkai No. 8), Xinhaimian9 (Shinkai No. 9), Xinhaimian10 (Shinkai No. 10), Xinhaimian11 (Shinkai No. 11), Xinhaimian12 (Shinkai No. 12) ), Xinhaimian13(Xinhai No. 13), Xinhaimian14(Xinhai No. 14), Xinhaimian15(Xinhai No. 15), Xinhaimian16(Xinhai No. 16), Xinhaimian17(Xinhai No. 17), Xinhaimian18(Xinhai No. 18), Xinhaimian19(Xinhaimian No. 19), Xinhaimian20(Xinhai No. 20), Xinhaimian21(Xinhai No. 21), Xinhaimian22(Xinhai No. 22), Xinhaimian23(Xinhai No. 23), Xinhaimian24(Xinhaimian No. 24), Xinha Xinhaimian25 (Xinhai 25), Xinhaimian26 (Xinhai 26), Xinhaimian27 (Xinhai 27), Xinhaimian28 (Xinhai 28), Xinhaimian29 (Xinhai 29), Xinhaimian30 (Xinhai 30), Xinhaimian31 (Xinhai 31), Xinhaimian32 (Xinhai 32), Xinhaimian33 (Xinhai 33), Xinhaimian34 (Xinhai 34), Xinhaimian35 (Xinhai 35), Xinhaimian36 (Xinhai 36), Xinhaimian37 (Xinhai No. 37), Xinhaimian 38 (Xinhai No. 38), Xinhaimian 39 (Xinhai No. 39), Xinhaimian 40 (Xinhai No. 40), Xinhaimian 41 (Xinhai No. 41), Xinhaimian 42 (Xinhai No. 42), Xinhaimian 43 (Xinhai No. 43), Xinhaimian 44 (Xinhai No. 44), Xinhaimian 45 (Xinhai No. 45), Xinhaimian 46 (Xinhai No. 46), Xinhaimian 47 (Xinhai No. 47), Xinhaimian 48 (Xinhai No. 48), Xinhaimian 49 (Xinhai No. 49),Xinhaimian50 (Xinhai No. 50), Xinhaimian51 (Xinhai No. 51), Xinhaimian52 (Xinhai No. 52), Xinhaimian53 (Xinhai No. 53), One or more of haimian57 (Xinhai No. 57), Xinhaimian58 (Xinhai No. 58), Xinhaimian59 (Xinhai No. 59), Xinhaimian60 (Xinhai No. 60), Xinhaimian61 (Xinhai No. 61), Xinhaimian62 (Xinhai No. 62) and Xinhaimian63 (Xinhai No. 63). ,

[0029] In the present invention, the PCR amplification system preferably includes the following components in 10 μl: 2.5 μl DNA template, 0.16 μl forward primer, 0.16 μl reverse primer, 0.25 μl dNTP, 1 μl 10×Taq buffer, 0.8 μl MgCl2, 0.16 μl Taq enzyme and 4.97 μl ddH2O. In the present invention, the concentration of the DNA template is preferably 10 ng / μl; the DNA is genomic DNA; the concentrations of the forward primer and the reverse primer are preferably 25 μM, respectively; the concentration of the dNTP is preferably 10 mM; the concentration of the Taq enzyme is preferably 5 U / μl; the concentration of the MgCl2 is preferably 1.5 mmol / L.

[0030] In the present invention, the PCR amplification procedure preferably includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 sec, annealing at 58°C for 45 sec, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

[0031] In the present invention, the obtained 48 pairs of core SSR primers with polymorphism were used to carry out fingerprint analysis on the above 63 approved Xinjiang sea island cotton varieties, and 21 varieties (Xinhaimian1, 2, 3, 4, 7, 9, 14, 17, 19, 21, 22, 29, 40, 42, 45, 48, 50, 52, 54, 57, 63) had specific primers. Among them, Xinhaimian1, Xinhaimian9, Xinhaimian21, Xinhaimian54, and Xinhaimian63 had 3, 2, 2, 2, 2 pairs of specific primers, respectively, and the remaining 16 cotton varieties had only 1 pair of specific primers. 21 Xinjiang sea island cotton varieties had 22 pairs of specific primers, distributed on 15 chromosomes, and the distance between the primers on the chromosomes was distributed between 5.883 and 238.658 cM, and the amplified polymorphic band size was between 75 and 363 bp.

[0032] 33 pairs of primers were used to distinguish 42 Xinjiang island cotton varieties, of which Xinhaimian58 required 4 pairs of primers to distinguish other varieties, Xinhaimian28, Xinhaimian39, and Xinhaimian49 required 3 pairs of primers to distinguish, and the remaining 38 Xinjiang island cotton varieties only required 2 pairs of primers to distinguish. The primer combinations of 42 Xinjiang island cotton varieties were distributed on 17 chromosomes, and the distance between the primers on the chromosomes was distributed between 0 and 231.991 cM. The size of the amplified polymorphic bands ranged from 75 to 385 bp.

[0033] Combining 22 pairs of specific primers for Xinjiang sea island cotton varieties and 33 pairs of combined primers for Xinjiang sea island cotton varieties, at least 48 pairs of primers were selected to construct 63 detailed molecular fingerprints of Xinjiang sea island cotton varieties. Figure 1 As shown in Table 1 and Table 2, 42 combinations of primers of Xinjiang sea island cotton are distributed on 17 chromosomes, the distance of primers on chromosomes is distributed between 0 and 231.991 cM, and the size of amplified polymorphic bands is between 75 and 385 bp. The present invention can realize large sample processing with small-scale primers and has high processing accuracy.

[0034] Table 1 Information on approved varieties of Xinjiang sea island cotton

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048] Table 2 Primer information

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] Table 3 Nucleotide sequences of primers

[0056]

[0057]

[0058] In the present invention, the amplified product is preferably subjected to fully automatic capillary electrophoresis for 45 min on instruments Fragment Analyzer (FA) and Zero Agarose Gel (ZAG).

[0059] After the present invention performs capillary electrophoresis on the amplified product, it is preferred that the present invention further comprises: marking different polymorphisms generated by each pair of primers according to the relative position of the amplified product on the electrophoresis gel, numbering different genotypes generated by 73 pairs of core primers with high polymorphism, good stability and located on 26 chromosomes of cotton, calculating the polymorphism information content of the site, and constructing a capillary electrophoresis DNA fingerprint of Xinjiang Sea Island Cotton according to the different genotypes of each pair of primers in different materials. In the present invention, the calculation of the polymorphism information content of the site is preferably performed using the software PowerMaker V3.25.

[0060] The present invention also provides the application of the Xinjiang Sea Island Cotton capillary electrophoresis DNA fingerprint spectrum constructed by the construction method described in the above scheme in the identification of Xinjiang Sea Island Cotton varieties.

[0061] In the present invention, the method for identifying Xinjiang Sea Island cotton varieties comprises the following steps:

[0062] Using the core primers to perform PCR amplification on the tested sea island cotton variety to obtain an amplified product; performing capillary electrophoresis on the amplified product to obtain the band size of the amplified product;

[0063] The capillary electrophoresis DNA fingerprint of Xinjiang Sea Island Cotton constructed by the construction method described in the above scheme is compared with the band size of the amplified product of the Sea Island Cotton variety to be tested to determine the Sea Island Cotton variety to be tested.

[0064] In the present invention, three pairs of primers MGHES31, MON_CGR6812 and NAU2713a were used to scan 63 new sponge series cotton varieties. Compared with the other 62 new sponge varieties, Xinhaimian1 has specific unique fingerprint information. It can be seen that these three pairs of primers are specific primers for Xinhaimian1. Among the new sponge series cotton varieties, Xinhaimian58 needs a combination of 4 pairs of primers (MON_DPL0502, HAU3193, HAU4748, NAU7049) to be distinguished from other varieties. Xinhaimian39, Xinhaimian47, Xinhaimian50, Xinhaimian57 and Xinhaimian58 were polymorphic at fragments 106bp, 84bp and 75bp under MON_DPL0502 primer amplification; Xinhaimian58 was polymorphic at 220bp under HAU3193 primer amplification, at 198bp and 192bp under HAU4748 primer amplification, at 349bp and 319bp under NAU7049 primer amplification. Other varieties had no polymorphism under HAU3193, HAU4748 and NAU7049 primers, and Xinhaimian58 could be successfully identified using both primer combinations.

[0065] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0066] Example 1

[0067] The sea island cotton varieties approved in Xinjiang in the past forty years (conventional varieties Xinhaimian 1 to Xinhaimian 63, i.e. Xinhaimian 1 to Xinhaimian 63) were self-pollinated and the DNA of 20 whole plants was mixed and used to construct the sea island cotton variety map.

[0068] 1. Cotton DNA extraction: Extract cotton total DNA according to Bai Jing's method (Bai Jing. Screening of SSR core primers for hybrid cotton varieties and identification of authenticity and purity [M]. Huazhong Agricultural University, 2011, 45-50.).

[0069] 2. Screening of polymorphic markers

[0070] This experiment first selected 12 core germplasms representing the genetic diversity of Xinjiang cotton varieties, and screened primers with differences between different cotton species based on a high-density interspecific map of sea-upland cotton constructed by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University. 5152 pairs of SSR primers were used to screen primers with differences between different cotton species. Based on capillary electrophoresis and reading of polymorphic bands above 100bp, 176 pairs of polymorphic markers of sea-upland cotton were preliminarily screened, and finally 48 pairs of core primers with high polymorphism, good stability, and localization on 26 chromosomes of cotton (2 to 3 pairs were selected on each chromosome) were selected. The core primer information is shown in Table 3.

[0071] 3. Analysis of genetic diversity of markers

[0072] Using 48 pairs of core primers with clear bands, easy statistics, and polymorphism among different cotton species, 48 ​​polymorphic markers of Xinjiang sea island cotton were obtained, with 323 polymorphic genotype loci and an average genotype loci of 4.42.

[0073] 4. Amplification of core primers of different species

[0074] PCR amplification system

[0075]

[0076] Amplification Procedure

[0077] 94℃3min; 94℃50sec, 58℃45sec, 72℃1min, 35cycles; 72℃10min; 4℃10min

[0078] 5. Amplification product detection

[0079] The amplified products were subjected to fully automated capillary electrophoresis on the Fragment Analyzer (FA) and Zero Agarose Gel (ZAG) instruments for 45 min.

[0080] 6. Construction of the fingerprint of Xinjiang Sea Island cotton varieties

[0081] According to the relative position of the PCR amplification product on the electrophoresis gel, the different polymorphisms generated by each pair of primers were marked, and the different genotypes generated by 48 pairs of core primers with high polymorphism, good stability and located on 26 chromosomes of cotton (2 to 3 pairs were selected on each chromosome) were numbered, and the polymorphism information content of the site was calculated using the software PowerMaker V3.25. According to the different genotypes of each pair of primers in different materials, a DNA molecular fingerprint map was constructed.

[0082] 48 pairs of SSR core primers (see Table 3) were used to perform fingerprint analysis on 63 new sponge varieties. 21 Xinjiang island cotton varieties had specific primers, of which Xinhaimian1, Xinhaimian9, Xinhaimian21, Xinhaimian54, and Xinhaimian63 had 3, 2, 2, 2, and 2 pairs of specific primers, respectively, and the remaining 16 cotton varieties had only 1 pair of specific primers. 21 Xinjiang island cotton varieties had 22 pairs of specific primers, distributed on 15 chromosomes, and the distance between primers on the chromosomes was distributed between 5.883 and 238.658 cM. The amplified polymorphic band size was between 75 and 363 bp.

[0083] 33 pairs of primers were used to distinguish 42 Xinjiang island cotton varieties, of which Xinhaimian58 required 4 pairs of primers to distinguish other varieties, Xinhaimian28, Xinhaimian39, and Xinhaimian49 required 3 pairs of primers to distinguish, and the remaining 38 Xinjiang island cotton varieties only required 2 pairs of primers to distinguish. The primer combinations of 42 Xinjiang island cotton varieties were distributed on 17 chromosomes, and the distance between the primers on the chromosomes was distributed between 0 and 231.991 cM. The size of the amplified polymorphic bands ranged from 75 to 385 bp.

[0084] Therefore, combining 22 pairs of characteristic primers of Xinjiang Sea Island cotton varieties and 33 pairs of combined primers of Xinjiang Sea Island cotton varieties, at least 48 pairs of primers can be selected to construct detailed molecular fingerprints of 63 new sea island cotton varieties. On the one hand, the identification of 21 Xinjiang Sea Island cotton varieties has unique characteristic fingerprint information of different specific primers. On the other hand, it is difficult to distinguish individual varieties, and multiple pairs of combined primers are required, which further reflects the rich variation of Xinjiang Sea Island cotton. The 48 pairs of primers of Xinjiang Sea Island cotton are distributed on 26 chromosomes, and the distance between the primers on the chromosomes is distributed between 0 and 238.658 cM. The size of the amplified polymorphic bands is between 75 and 385 bp.

[0085] Example 2

[0086] 1) Specific primer identification

[0087] Three pairs of primers, MGHES31, MON_CGR6812 and NAU2713a, were used to scan 63 Xinhaimian cotton varieties. Compared with the other 62 Xinhaimian varieties, Xinhaimian1 had specific unique fingerprint information. It can be seen that these three pairs of primers are specific primers for Xinhaimian1.

[0088] 2) Primer combination identification

[0089] Among the Xinhaimian series of cotton varieties, Xinhaimian58 requires a combination of four primer pairs (MON_DPL0502, HAU3193, HAU4748, and NAU7049) to be distinguished from other varieties. Xinhaimian39, Xinhaimian47, Xinhaimian50, Xinhaimian57 and Xinhaimian58 were polymorphic at fragments 106bp, 84bp and 75bp under MON_DPL0502 primer amplification; Xinhaimian58 was polymorphic at 220bp under HAU3193 primer amplification, at 198bp and 192bp under HAU4748 primer amplification, at 349bp and 319bp under NAU7049 primer amplification. Other varieties had no polymorphism under HAU3193, HAU4748 and NAU7049 primers, and Xinhaimian58 could be successfully identified using both primer combinations.

[0090] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Shihezi University <120> A method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton and a cotton variety identification method <160> 96 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 aagttagcgg cttcttgtgg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gggtcagaac tggacaagga 20 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <400> 3 ttgaacgagc tgtgaaagac a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ggacacttct cttcgaacgc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 cggtttcaat ggatataggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tatttgcttg aggcatttca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 atgtgccttg tcctcttcca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 gggatgtgag ggcatcatag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 aatgccgata ctcctccccc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 tgttcgccac agcttcacaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 cgatacacaa aagcagcaac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 acaggctatt tcagcactcc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 tggttttgcc catctttacg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 gaaagggaag atgaggaggg 20 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <400> 15 gaaatggctg aattgaaaag gtaagg 26 <210> 16 <211> twenty three <212> DNA <213> Artificial Sequence <400> 16 ccatttcaga caccagctgt tgc 23 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 tttggcggcg aaaacaaccg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 agaggccaag taaacggcgg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 tataaggcct tcagctgtcc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 ccctaggttc atccttagca 20 <210> twenty one <211> 20 <212> DNA <213> Artificial Sequence <400> twenty one gtgtaacagt gcggtatgga 20 <210> twenty two <211> 20 <212> DNA <213> Artificial Sequence <400> twenty two aaggcagaga tggagtagga 20 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence <400> twenty three tttacgcctc ttgccctcct 20 <210> twenty four <211> twenty one <212> DNA <213> Artificial Sequence <400> twenty four gtttgccatc cgatctctcc a 21 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <400> 25 ccgttccatg tttttgtgta 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 acctgaacctgaatgtccac 20 <210> 27 <211> twenty four <212> DNA <213> Artificial Sequence <400> 27 cctttattct gaatgtatcc gtcc 24 <210> 28 <211> twenty two <212> DNA <213> Artificial Sequence <400> 28 attgaatatg gaattcggac cc 22 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 gttcagcaaa acaaccccat 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <400> 30 tgcaaggttt tcagaggctt 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <400> 31 gcactgtgtt caagcttctg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <400> 32 agcttgtctc cttttggcta 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <400> 33 attggcaatt tgacccacat 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 agttgcaacc ttcaccgttc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <400> 35 tccctctcta accctttcct 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <400> 36 gcagacgtgt aacgttatgg 20 <210> 37 <211> twenty four <212> DNA <213> Artificial Sequence <400> 37 agtgcctagt aaagcaggat ctga 24 <210> 38 <211> twenty three <212> DNA <213> Artificial Sequence <400> 38 gtgtcatgtg tgagtaagca tgg 23 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 taacggagat gggtttcgac 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <400> 40 cacaaccgtc catttcctct 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <400> 41 aatgtgattc ccaaaggaga 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 aaaaccccgc atattattca 20 <210> 43 <211> twenty three <212> DNA <213> Artificial Sequence <400> 43 tcctcggaat cttcgagtag cga 23 <210> 44 <211> twenty four <212> DNA <213> Artificial Sequence <400> 44 acgacaaacg tcaaccataa gaca 24 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 catgtgcatt tcatcctgtc 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 ccaagtgaga ggcattttct 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 gaagaacctg cacatcgtca 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <400> 48 agacggtgtt cgaagaggaa 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <400> 49 ggccgtccat tagggttagt 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <400> 50 tgcatgacac tcgtcagtca 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <400> 51 aattgggtaa accaaacccg 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 gccgacggat tcaagaaata 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 atgcttcacg aaaagcctac 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <400> 54 taccgtagta atgcgtgtgg 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <400> 55 tgtctgggtc accaaattca 20 <210> 56 <211> 26 <212> DNA <213> Artificial Sequence <400> 56 aaaatcaaaa cattagcatt gaactc 26 <210> 57 <211> twenty three <212> DNA <213> Artificial Sequence <400> 57 cctacaccca atgtgaaata gga 23 <210> 58 <211> twenty four <212> DNA <213> Artificial Sequence <400> 58 actaaagcca gagccatagg aact 24 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <400> 59 taccatcatc cccttgactt 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <400> 60 gttttgcttt ggagtccagt 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <400> 61 agaaggaaac acctgtacgc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <400> 62 ccgctttagc tctctctcac 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <400> 63 ccttcgtcct cctcttcctt 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <400> 64 tcgtcgtcgt tgtcttcttg 20 <210> 65 <211> twenty four <212> DNA <213> Artificial Sequence <400> 65 gatcatttca agcccatagt gtgc 24 <210> 66 <211> twenty two <212> DNA <213> Artificial Sequence <400> 66 gttcagggct tcaaagaggc tc 22 <210> 67 <211> 19 <212> DNA <213> Artificial Sequence <400> 67 gggtggagaa gacgagagc 19 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <400> 68 tggcgactga acaacaaaga 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <400> 69 ccacttaggt tcattttaag 20 <210> 70 <211> 19 <212> DNA <213> Artificial Sequence <400> 70 cccactagaa acccaaata 19 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <400> 71 ctcggctatc tctcttccaa 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <400> 72 acccctgtag aacacacgat 20 <210> 73 <211> twenty four <212> DNA <213> Artificial Sequence <400> 73 cctcaacagt catcagtttc aatc 24 <210> 74 <211> twenty four <212> DNA <213> Artificial Sequence <400> 74 tggcttgttc taatccaggt aaac 24 <210> 75 <211> twenty two <212> DNA <213> Artificial Sequence <400> 75 agagcttttg cttccattaa ca 22 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <400> 76 cgtggttccg acccgtaaaa 20 <210> 77 <211> 19 <212> DNA <213> Artificial Sequence <400> 77 aggtacctct cctgactct 19 <210> 78 <211> 19 <212> DNA <213> Artificial Sequence <400> 78 aatcttcttg aaatcgaac 19 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <400> 79 aggctgaccc tttaaggagc 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <400> 80 aaccaacttt tccaacaccg 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <400> 81 gcggcctaag ccaaatatac 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <400> 82 agacaagcgt gaatcccatc 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <400> 83 aacaactggc cttacaccgt 20 <210> 84 <211> twenty one <212> DNA <213> Artificial Sequence <400> 84 cattcgagga ctccacagca g 21 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <400> 85 cagaagactg caggggatgc 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <400> 86 tctgcttgtc ggggatccat 20 <210> 87 <211> 20 <212> DNA <213> Artificial Sequence <400> 87 agaatctgca accacattga 20 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <400> 88 cggttaagct tccagacatt 20 <210> 89 <211> twenty four <212> DNA <213> Artificial Sequence <400> 89 gtggaggtgt atttctatcg atcc 24 <210> 90 <211> twenty three <212> DNA <213> Artificial Sequence <400> 90 gttgctaaca ggcgagacat aaa 23 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <400> 91 gccaaggttc attcctgaaa 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <400> 92 tatagggctc atcagggtgg 20 <210> 93 <211> twenty three <212> DNA <213> Artificial Sequence <400> 93 aggtaattca agagatgggt tca 23 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <400> 94 tccgaagtgg gtttgagccg 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <400> 95 gcaaccgtag tgcctgagat 20 <210> 96 <211> 18 <212> DNA <213> Artificial Sequence <400> 96 ccctactccg ccctcttt 18

Claims

1. A method for constructing a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton. The application of the constructed capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton in the identification of Xinjiang sea island cotton varieties is characterized in that: The construction method comprises the following steps: The core primers were used to perform PCR amplification on the approved sea island cotton varieties in Xinjiang, and the amplified products of the approved sea island cotton varieties in Xinjiang were obtained; The amplified products of the approved Xinjiang sea island cotton varieties are subjected to capillary electrophoresis to obtain a capillary electrophoresis DNA fingerprint of Xinjiang sea island cotton; The core primers are: MGHES31, MON_CGR6812, NAU2713a, MON_CGR6012, HAU4022, NAU2631, MUSS422a, HAU2846, HAU2770, HAU0938, NAU3913, NAU6734, NAU3346b, MON_DPL0521, BNL3043, NAU3433, MON_SHIN-1585, NAU5172, MON_DPL0024, MON_SHIN-1494b, NAU2985, HAU3071a, NAU3736b, NBRI_HQ527566, B NL2535b, CCRI596a, NAU3827, NBRI_HQ526730, MON_DPL0504a, HAU1952b, NAU3298, MON_SHIN-1584, Gh330, MON_CGR5007, NAU7182, HAU1496, MON _DPL0502, HAU4748, NAU7049, BNL3031, NBRI_HQ527820, CK988221-PR-ss, HAU4483, NAU3419c, DPL0238, MON_CGR5732, HAU3193 and MON_SHIN-1481; The nucleotide sequences of the core primers are shown in SEQ ID NO.1 to SEQ ID NO.96; The Xinjiang Sea Island Cotton variety identification comprises the following steps: Using core primers to perform PCR amplification on the Sea Island cotton variety to be tested, to obtain an amplification product of the Sea Island cotton variety to be tested; performing capillary electrophoresis on the amplification product of the Sea Island cotton variety to be tested, to obtain the band size of the amplification product of the Sea Island cotton variety to be tested; Comparing the capillary electrophoresis DNA fingerprint of Xinjiang Sea Island cotton with the band size of the amplified product of the Sea Island cotton variety to be tested, and determining the Sea Island cotton variety to be tested; The approved Xinjiang sea island cotton varieties and Xinjiang sea island cotton varieties are: Xinhaimian1, Xinhaimian2, Xinhaimian3, Xinhaimian4, Xinhaimian5, Xinhaimian6, Xinhaimian7, Xinhaimian8, Xinhaimian9, Xinhaimian10, Xinhaimian11, Xinhaimian12, Xinhaimian13, Xinhaimian14, Xinhaimian15 , , , , , , 2. The use according to claim 1, characterized in that: The PCR amplification system, based on 10 μl, includes the following components: 2.5 μl of DNA template, 0.16 μl of forward primer, 0.16 μl of reverse primer, 0.25 μl of dNTP, 1 μl of 10×Taq buffer, 0.8 μl of MgCl 2 , 0.16 μl of Taq enzyme and 4.97 μl of ddH 2 O.

3. The use according to claim 1 or 2, characterized in that: The PCR amplification procedure includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 50 sec, annealing at 58°C for 45 sec, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 10 min.

4. The use according to claim 1, characterized in that: After the amplification products in the construction method are subjected to capillary electrophoresis, the method also includes: marking different polymorphisms generated by each pair of primers according to the relative position of the amplification products on the electrophoresis gel, calculating the site polymorphism information content, and constructing a capillary electrophoresis DNA fingerprint map of Xinjiang Sea Island Cotton based on the different genotypes of each pair of primers in different materials.

Images