Methods and compositions comprising Staphylococcal protein A (SpA) variants

Abstract

Embodiments relate to methods and compositions for preventing or treating bacterial infections, particularly Staphylococcal infections. Embodiments relate to improved non-toxigenic protein A (SpA) variants.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 847,832, filed on May 14, 2019, which is incorporated herein by reference in its entirety. background

[0003] This invention was made with government support under Grant Nos. AI038897 and AI052474 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0004] I. Technical field

[0005] The present invention relates generally to the fields of immunology, microbiology and pathology. More specifically, the present invention relates to methods and compositions comprising bacterial protein A variants, which can be used to elicit an immune response against bacteria.

[0006] II. Background

[0007] In recent years, the number of community-acquired and hospital-acquired infections has increased with the increased use of intravascular devices. Hospital-acquired (nosocomial) infections are a major cause of morbidity and mortality, particularly in the United States, infecting more than 2 million patients each year. The most common infections are urinary tract infections (33% of infections), followed by pneumonia (15.5%), surgical site infections (14.8%), and primary bloodstream infections (13%) (Emorl and Gaynes, 1993).

[0008] Nosocomial pathogens mainly include Staphylococcus aureus, coagulase-negative staphylococci (mainly Staphylococcus epidermidis), Enterococcus spp., Escherichia coli, and Pseudomonas aeruginosa. Although these pathogens cause roughly the same number of infections, the severity of illness they can produce combined with the frequency of antibiotic-resistant strains balances the ranking of S. aureus and S. epidermidis as the most important nosocomial pathogens.

[0009] Staphylococci can cause a variety of diseases in humans and other animals by producing toxins or by invading the body. Staphylococcal toxins are also a common cause of food poisoning because the bacteria can grow in improperly stored food.

[0010] Staphylococcus epidermidis is a normal skin commensal and an important opportunistic pathogen causing compromised medical device infections and surgical site infections. Medical devices infected by S. epidermidis include pacemakers, cerebrospinal fluid shunts, continuous-flow peritoneal dialysis catheters, orthopedic devices, and prosthetic heart valves.

[0011] S. aureus is the most common cause of hospital-acquired infections, with significant morbidity and mortality. It is responsible for some cases of osteomyelitis, endocarditis, septic arthritis, pneumonia, abscesses, and toxic shock syndrome. S. aureus can survive on dry surfaces, increasing the chance of transmission. Any S. aureus infection can lead to staphylococcal scalded skin syndrome, a skin reaction to exotoxins absorbed into the bloodstream. It can also cause a potentially life-threatening form of septicemia called sepsis. The problem is that methicillin-resistant S. aureus (MRSA) has become a leading cause of hospital-acquired infections.

[0012] S. aureus and S. epidermidis infections are usually treated with antibiotics, with penicillin being the drug of choice and vancomycin used for methicillin-resistant strains. The percentage of Staphylococcus strains that exhibit broad-spectrum resistance to antibiotics is becoming increasingly common, posing a threat to effective antimicrobial therapy. In addition, the recent emergence of vancomycin-resistant S. aureus strains has raised concerns that MRSA strains are emerging and spreading without effective therapy.

[0013] Currently, the use of antibodies against staphylococcal antigens as an alternative to antibiotics for the treatment of staphylococcal infections is being studied. Such therapies include the administration of polyclonal antisera (WO00 / 15238, WO00 / 12132) or treatment with monoclonal antibodies against lipoteichoic acid (WO98 / 57994).

[0014] Another method is to use active vaccination to generate an immune response against staphylococci. The staphylococcus aureus genome has been sequenced and many coding sequences have been identified (WO02 / 094868, EP0786519), which can achieve the identification of potential antigens. The same is true for Staphylococcus epidermidis (WO01 / 34809). As an improvement to this method, others have identified proteins that can be identified from the hyperimmune serum of patients infected with staphylococci (WO01 / 98499, WO02 / 059148).

[0015] Staphylococcus aureus secretes a plethora of virulence factors into the extracellular environment (Archer, 1998; Dinges et al., 2000; Foster, 2005; Shaw et al., 2004; Sibbald et al., 2006). Like most secreted proteins, these virulence factors are transported across the plasma membrane via the Sec signaling pathway. Proteins secreted via the Sec signaling pathway carry an N-terminal leader peptide that is removed by a leader peptidase once the preprotein engages the Sec translocon (Dalbey and Wickner, 1985; van Wely et al., 2001). Recent genomic analyses have shown that members of the Actinobacteria and Firmicutes phyla encode an alternative secretion system that recognizes a subset of proteins in a Sec-independent manner (Pallen, 2002). ESAT-6 (early secretory antigenic target 6 kDa) and CFP-10 (culture filtrate antigen 10 kDa) of M. tuberculosis represent the first substrates of this novel secretion system, called ESX-1 or Snm in M. tuberculosis (Andersen et al., 1995; Hsu et al., 2003; Pym et al., 2003; Stanley et al., 2003). In S. aureus, two similar ESAT-6xx-like factors, called Es A and Es B, are secreted by the Ess pathway (ESAT-6 secretion system) (Burts et al., 2005).

[0016] The first generation of vaccines against Staphylococcus aureus or the exoproteins it produces had limited success (Lee, 1996). There remains a need to develop effective vaccines against Staphylococcus infections. There is also a need for other compositions for treating Staphylococcus infections.

[0017] In this application, the term "about" is used according to its plain and ordinary meaning in the arts of cellular and molecular biology to indicate a value that includes the standard deviation of error for the device or method being employed to determine the value.

[0018] When used with the term "comprising," without a quantifier, it can mean "a," but can also be consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0019] As used herein, the terms "or" and "and / or" are used to describe multiple components that are mutually combined or mutually exclusive. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z", "(x and y) or z", "x or (y and z)", or "x or y or z". It is specifically contemplated that x, v, or z can be specifically excluded from an embodiment.

[0020] “Comprising,” “having,” “including,” “characterized by,” or “containing” are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0021] The compositions and methods of use may "comprise," "consist essentially of," or "consist of" any ingredient or step disclosed throughout the specification. The phrase "consisting of" excludes any element, step, or ingredient not specified. The phrase "consisting essentially of" limits the scope of the subject matter to the specified materials or steps, as well as those that do not materially affect the basic and novel characteristics thereof. It is contemplated that embodiments described in the context of the term "comprising" may also be implemented in the context of the term "consisting of" or "consisting essentially of."

[0022] It is specifically contemplated that any limitation discussed with respect to one embodiment of the invention may apply to any other embodiment of the invention. In addition, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or utilize any composition of the invention. Aspects of the embodiments described in the examples may also be embodiments implemented elsewhere in different examples or applications, such as embodiments in the summary of the invention, the detailed description, the claims, and the accompanying drawings.

[0023] Through the following detailed description, other purposes, features and advantages of the present invention will become apparent. However, it should be understood that the detailed description and specific examples, although indicating specific embodiments of the present invention, are given only as illustrations, because from this detailed description, various changes and modifications within the spirit and scope of the present invention will become apparent to those skilled in the art. Summary of the invention

[0024] The present invention provides compositions and methods of improved protein A variants that have reduced binding to the VH3 of immunoglobulins to reduce their toxicity while stimulating a humoral immune response that prevents staphylococcal disease. In certain embodiments, the improved protein A variants stimulate a humoral immune response that can (i) prevent colonization and (ii) lead to decolonization of actively colonized individuals.

[0025] In some embodiments, the compositions and methods relate to isolated polypeptides comprising variant protein A (SpA) having (i) lysine substitutions at glutamine residues at positions 9 and 10 corresponding to domain D in each domain A to E and (ii) glutamic acid substitutions at position 33 corresponding to domain D in each domain A to E, wherein the polypeptide does not detectably crosslink IgG and IgE in the blood or activate basophils or mast cells relative to a negative control. In some embodiments, it is believed that the variant SpA region is unable to crosslink IgG and / or IgE in the blood and / or activate basophils, thereby causing significant safety or toxicity issues to human patients or causing significant risk of anaphylactic shock in human patients. In some embodiments, the K of VH3 from human IgG is greater than that of SpA variants. A The binding affinity is reduced, wherein the SpA variant consists of replacing the glutamine residues at positions 9 and 10 in each domain A to E corresponding to domain D with lysine and replacing the aspartic acid at positions 36 and 37 in domain A to E corresponding to domain D with alanine (SpA KKAA In some embodiments, KKAA In comparison, the SpA variants had a K of 1.5 fold higher for VH3 from human IgG. A In some embodiments, K A Binding affinity can be detected by any of the methods disclosed herein. In some embodiments, binding affinity to SpA KKAA In comparison, the SpA variants had a K of 1.5 fold higher for VH3 from human IgG. A The binding affinity is reduced by at least 1 / 1.2, 1 / 1.3, 1 / 1.4, 1 / 1.5, 1 / 1.6, 1 / 1.7, 1 / 1.8, 1 / 1.9, 1 / 2, 1 / 2.1, 1 / 2.2, 1 / 2.3, 1 / 2.4, 1 / 2.5, 1 / 2.6, 1 / 2.7, 1 / 2.8, 1 / 2.9, 1 / 3 or less than 1 / 3 times (or any range derivable therefrom). KKAA In comparison, the SpA variants had a K of 1.5 fold higher for VH3 from human IgG. AThe binding affinity is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more than 300% (or any range derivable therefrom). Of course, it will be appreciated that the same or comparable assays may be used for comparison. In some embodiments, the binding affinity K of the SpA variant to the VH3 from human IgG is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more than 300% (or any range derivable therefrom). A Less than about 1×10 5 M -1 In some embodiments, the binding affinity of the SpA variant to VH3 from human IgG is K A Less than about 3x10 5 M -1 , 2.9x10 5 M -1 , 2.8x10 5 M -1 , 2.7x10 5 M -1 , 2.6x10 5 M -1 , 2.5x10 5 M -1 , 2.4x10 5 M -1 , 2.3x10 5 M -1 , 2.2x10 5 M -1 , 2.1x10 5 M -1 , 2.0x10 5 M -1 , 1.9x10 5 M -1 , 1.8x10 5 M -1 , 1.7x10 5 M -1 , 1.6x10 5 M -1 , 1.5x10 5 M -1 , 1.4x10 5 M -1 , 1.3x10 5 M -1 , 1.2x10 5 M -1, 1.1x10 5 M -1 , 1.0x10 5 M -1 , 0.9x10 5 M -1 , 0.8x10 5 M -1 , 0.7x10 5 M -1 , 0.6x10 5 M -1 , 0.5x10 5 M -1 , 0.4x10 5 M -1 , 0.3x10 5 M -1 , 0.2x10 5 M -1 , 0.1x10 5 M -1 (or any range derivable therefrom). In some embodiments, the isolated polypeptide comprising the SpA variant has no substitutions at positions 36 and 37 in domains A to E corresponding to domain D. In some embodiments, the only substitutions in the SpA variant are (i) lysine substitutions at glutamine residues at positions 9 and 10 in each domain A to E corresponding to domain D and (ii) glutamic acid substitution at position 33 in each domain A to E corresponding to domain D (referred to as SpA Q9，10K / S33E ). In some embodiments, the isolated polypeptide consists of SpA variants. In some embodiments, the isolated polypeptide consists of SpA Q9，10K / S33E composition.

[0026] In some embodiments, there is an isolated polypeptide comprising a variant protein A (SpA) having (i) a lysine substitution at the glutamine residues corresponding to positions 9 and 10 of domain D in each domain A to E and (ii) a threonine substitution at position 33 of domain D in each domain A to E, wherein the polypeptide does not detectably crosslink IgG and IgE in the blood or activate basophils or mast cells relative to a negative control. In some embodiments, it is believed that the variant SpA region is unable to crosslink IgG and / or IgE in the blood and / or activate basophils, thereby causing significant safety or toxicity issues to human patients or causing significant risk of anaphylactic shock in human patients. In some embodiments, wherein the SpA variant (SpA) consisting of replacing the glutamine residues corresponding to positions 9 and 10 in each domain A to E in domain D with lysine and replacing the aspartic acid corresponding to positions 36 and 37 in domain D in domain A to E with alanine KKAA) compared to the binding affinity K of VH3 from human IgG. A In some embodiments, the SpA KKAA In comparison, the binding affinity of SpA variants to VH3 from human IgG was K A In some embodiments, K can be detected by any method disclosed herein. A In some embodiments, the binding affinity of SpA KKAA Compared to the above, the SpA variant has a binding affinity KA of at least 1 / 1.2, 1 / 1.3, 1 / 1.4, 1 / 1.5, 1 / 1.6, 1 / 1.7, 1 / 1.8, 1 / 1.9, 1 / 2, 1 / 2.1, 1 / 2.2, 1 / 2.3, 1 / 2.4, 1 / 2.5, 1 / 2.6, 1 / 2.7, 1 / 2.8, 1 / 2.9, 1 / 3 or less than 1 / 3 (or any range derivable therefrom). In some embodiments, the SpA variant has a binding affinity KA of at least 1 / 1.2, 1 / 1.3, 1 / 1.4, 1 / 1.5, 1 / 1.6, 1 / 1.7, 1 / 1.8, 1 / 1.9, 1 / 2, 1 / 2.1, 1 / 2.2, 1 / 2.3, 1 / 2.4, 1 / 2.5, 1 / 2.6, 1 / 2.7, 1 / 2.8, 1 / 2.9, 1 / 3 or less than 1 / 3 (or any range derivable therefrom). KKAA In comparison, the binding affinity of SpA variants to VH3 from human IgG was K A %, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300% or more than 300% (or any range derivable therefrom). Of course, it will be appreciated that the same or comparable assays may be used for comparison. In some embodiments, the binding affinity K of the SpA variant to the VH3 from human IgG is A Less than about 1×10 5 M -1 In some embodiments, the SpA variant has a K of VH3 from human IgG. A The binding affinity is less than about 3x10 5 M -1 , 2.9x10 5 M -1 , 2.8x10 5 M -1 , 2.7x10 5 M -1 , 2.6x10 5 M -1 , 2.5x10 5 M -1 , 2.4x10 5 M -1, 2.3x10 5 M -1 , 2.2x10 5 M -1 , 2.1x10 5 M -1 , 2.0x10 5 M -1 , 1.9x10 5 M -1 , 1.8x10 5 M -1 , 1.7x10 5 M -1 , 1.6x10 5 M -1 , 1.5x10 5 M -1 , 1.4x10 5 M -1 , 1.3x10 5 M -1 , 1.2x10 5 M -1 , 1.1x10 5 M -1 , 1.0x10 5 M -1 , 0.9x10 5 M -1 , 0.8x10 5 M -1 , 0.7x10 5 M -1 , 0.6x10 5 M -1 , 0.5x10 5 M -1 , 0.4x10 5 M -1 , 0.3x10 5 M -1 , 0.2x10 5 M -1 , 0.1x10 5 M -1 (or any range derivable therefrom). In some embodiments, the isolated polypeptide comprising the SpA variant has no substitutions in domains A to E corresponding to positions 36 and 37 in domain D. In some embodiments, the only substitutions in the SpA variant are (i) substitutions of lysine for glutamine residues in each domain A to E corresponding to positions 9 and 10 in domain D and (ii) substitution of threonine for position 33 in domain D in each domain A to E (referred to as SpA Q9，10K / S33T). In some embodiments, the isolated polypeptide consists of SpA variants. In some embodiments, the isolated polypeptide consists of SpA Q9，10K / S33T composition.

[0027] In some embodiments, the compositions and methods relate to SpA Q9，10K / S33E Any of the embodiments discussed below in the context of SpA variants may be specifically used with SpA Q9，10K / S33E In certain embodiments, there is a method of eliciting a safe immune response against Staphylococcus aureus in a human patient, comprising administering to the human patient an effective amount of a composition comprising SpA Q9，10K / S33E In certain embodiments, there is a method of eliciting a safe immune response against Staphylococcus aureus in a subject, comprising administering to the subject an effective amount of a composition comprising SpA Q9，10K / S33E The subject may be a laboratory or industrial animal, such as cattle, pigs, sheep, or any other animal grown for human consumption and which may suffer from a staphylococcal infection, such as mastitis.

[0028] In some embodiments, the compositions and methods relate to SpA Q9，10K / S33E Any of the embodiments discussed below in the context of SpA variants may be specifically used with SpA Q9，10K / S33T In certain embodiments, there is a method of eliciting a safe immune response against Staphylococcus aureus in a human patient, comprising administering to the human patient an effective amount of a composition comprising SpA Q9，10K / S33T composition.

[0029] In some embodiments, the compositions and methods relate to an isolated polypeptide comprising a variant protein A (SpA) having (i) lysine substitutions at the glutamine residues corresponding to positions 9 and 10 in each domain A to E and (ii) at least one other amino acid substitution at position 29 and / or position 33 in each domain A to E corresponding to SEQ ID NO: 2, wherein the SpA variant has a binding affinity K of VH3 from human IgE. D Greater than 1.0x10 -4 MM. In the same or other embodiments, the SpA variant has a binding affinity K of VH3 from human IgE D Greater than 1.0x10 -6 MM.

[0030] Embodiments include generating protein A variants that are safe for use in humans, specifically variant heavy chain binding cross-linking of VH3 idiotype IgG and IgE molecules that are unable to bind to Fc receptors on the surface of immune cells, which can release immune mediators such as histamine, thereby triggering vascular leakage and allergic reactions.

[0031] In each domain A, B, C, D and E (domains A to E) of the variant SpA, an amino acid substitution is made, which means that the amino acids corresponding to the glutamine residues at positions 9 and 10 in domain D (i.e., SEQ ID NO: 2) are substituted; the same amino acid substitution is made to the corresponding amino acids in domains A, B, C and E. An embodiment relates to SpA, wherein in each domain A to E the glutamic acid residues corresponding to positions 9 and 10 in domain D have been substituted with lysine residues.

[0032] In certain embodiments, the binding affinity of the SpA variants for VH3 from human IgG is K D Greater than about 1.0x10 -4 M, 5.0x10 -4 M, 1.0x10 -3 M, 5.0x10 -3 M, 1.0x10 -2 M, 5.0x10 -2 M, 1.0x10 -1 M, 5.0x10 -1 M (or any range derivable therefrom). In some embodiments, the binding affinity of VH3 from human IgG is greater than about 1.0 x 10 -2 M or 5.0x10 -2 M. In the same or other embodiments, the binding affinity of the SpA variant for VH3 from human IgE is D Greater than about 1.0x10 -6 M, 5.0x10 -6 M, 1.0x10 -5 M, 5.0x10 -5 M, 1.0x10 -4 M, 5.0x10 -4 M, 1.0x10 -3 M, 5.0x10 -3 M, 1.0x10 -2 M, 5.0x10 -2 M, 1.0x10 -1 M or 5.0x10 -1M (or any range derivable therefrom). The affinity between SpA and its variants and Ig can be detected using purified human IgG (from pooled serum) and purified human monoclonal antibodies (trastuzumab human IgG1 VH3 clone antibody and IgE trastuzumab). ELISA and / or surface plasmon resonance can be used for detection.

[0033] In specific embodiments, variant SpA comprises an amino acid substitution corresponding to position 29 of SEQ ID NO: 2 in each domain A to E. In certain cases, the substitution corresponding to the amino acid at position 29 is alanine, leucine, proline, phenylalanine, glutamic acid, arginine, lysine, serine, threonine or glutamine. In some embodiments, variant SpA comprises a substitution corresponding to the amino acid at position 29, i.e., alanine, phenylalanine or arginine. In other embodiments, the substitution does not have one of the following amino acids: leucine, proline, glutamic acid, lysine, serine, threonine or glutamine. In some embodiments, variant SpA comprises an amino acid substitution corresponding to position 33 of SEQ ID NO: 2 in each domain A to E. In specific embodiments, the substitution corresponding to the amino acid at position 33 is alanine, phenylalanine, glutamic acid, lysine or glutamine. In specific cases, the substitution is made with phenylalanine, glutamic acid or glutamine. In other embodiments, the substitution is not made with alanine or lysine. In some SpA variants, there are substitutions corresponding to positions 29 and 33 in each domain A to E as described herein in SEQ ID NO: 2. These variants may or may not be combined with amino acid substitutions corresponding to one or both of positions 36 and 37 in each domain A to E in SEQ ID NO: 2. In some cases, there are substitutions at both positions 36 and 37. In some cases, the amino acid substitutions corresponding to positions 36 and 37 are substitutions of an alanine residue for an aspartic acid residue.

[0034] In some embodiments, the variant SpA polypeptide comprises variant domains A to E (meaning a polypeptide having variant domain A, variant domain B, variant domain C, variant domain D and variant domain E) and each variant domain has at least 70%, 75%, 80%, 85%, 90%, 95% or 96% identity with protein A domain D polypeptide (SEQ ID NO: 2), domain E (SEQ ID NO: 3), domain A (SEQ ID NO: 4), domain C (SEQ ID NO: 5), domain B (SEQ ID NO: 6). Alternatively, the variant SpA polypeptide comprises variant domains A to E (meaning a polypeptide having variant domain A, variant domain B, variant domain C, variant domain D and variant domain E) and each variant domain is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to protein A domain D polypeptide (SEQ ID NO: 2), domain E (SEQ ID NO: 3), domain A (SEQ ID NO: 4), domain C (SEQ ID NO: 5), domain B (SEQ ID NO: 6) in terms of amino acids (except those specifically expressed as having amino acid substitutions). In other words, SpA variants having substitutions at positions 9, 10 and 29 may have domains A to E that are otherwise 100% identical to the non-variant sequence. In certain embodiments, for example, the variant SpA comprises variant domains A to E that do not comprise any amino acid substitutions other than the corresponding positions 9, 10, 29, 33, 36 and / or 37 in SEQ ID NO:2.

[0035] In certain embodiments, the variant SpA comprises only amino acid substitutions corresponding to positions 9, 10 and 29 of SEQ ID NO: 2 in variant domains A to E. In certain other embodiments, the variant SpA comprises only amino acid substitutions corresponding to positions 9, 10 and 33 of SEQ ID NO: 2 in variant domains A to E. In other embodiments, the variant SpA comprises only amino acid substitutions corresponding to positions 9, 10, 29 and 33 of SEQ ID NO: 2 in variant domains A to E. In addition, other embodiments relate to variant SpA, which comprises only amino acid substitutions corresponding to positions 9, 10, 29, 36 and 37 of SEQ ID NO: 2 in variant domains A to E. In additional embodiments, the variant SpA comprises only amino acid substitutions corresponding to positions 9, 10, 33, 36 and 37 of SEQ ID NO: 2 in variant domains A to E. In other embodiments, the variant SpA comprises and consists of only the amino acid substitutions in variant domains A to E corresponding to positions 9, 10, 29, 33, 36 and 37 of SEQ ID NO:2.

[0036] In other embodiments, variant SpA is part of an isolated polypeptide. The isolated polypeptide may or may not include a region that is not from protein A. In some cases, the non-protein A fragment is a second antigenic fragment, which may or may not be a staphylococcal antigenic fragment. In certain embodiments, the fragment may include Emp, EsxA, EsxB, EsaC, Eap, Ebh, EsaB, Coa, vWbp, vWh, Hla, SdrC, SdrD, SdrE, IsdA, IsdB, IsdC, ClfA, ClfB and / or SasF fragments.

[0037] Embodiments include the use of protein A variants in methods and compositions for treating bacteria and / or staphylococcal infections. The application also provides immunogenic compositions comprising protein A variants or immunogenic fragments thereof. In some aspects, the immunogenic fragment is a protein A domain D fragment. In addition, the invention provides methods and compositions that can be used for treating (e.g., limiting the formation and / or persistence of staphylococcal abscesses in an object) or preventing bacterial infections. In some cases, the method for stimulating an immune response includes administering to an object an effective amount of a composition that includes or encodes all or part of a protein A variant polypeptide or antigen, as well as other bacterial proteins in some aspects. Other bacterial proteins include, but are not limited to, (i) secretion of virulence factors and / or cell surface proteins or peptides, or (ii) recombinant nucleic acid molecules or peptides encoding secretion of virulence factors and / or cell surface proteins.

[0038] In some embodiments, there are methods involving SpA variants. The methods include treating a staphylococcal infection in a subject, inducing an immune response against staphylococci in a subject, preventing a staphylococcal infection in a subject, preventing colonization or recolonization of staphylococci in a subject, reducing colonization or recolonization of staphylococci in a subject, treating a staphylococcal infection in a subject without significant toxicity, and / or inducing killing of staphylococci in a subject. The steps may include administering to a subject an effective amount of a SpA variant or a composition comprising a SpA variant. A subject may require treatment or prevention due to an existing infection or risk of infection.

[0039] In certain embodiments, the subject does not show any signs of toxicity from the isolated polypeptide or composition. In further embodiments, the subject does not show any signs of anaphylactic shock from the isolated polypeptide or composition. In certain embodiments, the subject is assessed for signs of toxicity, which may include signs of anaphylactic shock.

[0040] The polypeptide can be formulated into a pharmaceutically acceptable composition. The composition can also include at least or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 other Staphylococcus antigens or immunogenic fragments thereof (e.g., Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla (e.g., H35 mutant), IsdC, SasF, vWbp or vWh). Other Staphylococcal antigens that can be used in combination with protein A variants include, but are not limited to, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa (GenBank CAC80837), Aap (GenBank GenBank No. AJ249487), Ant (GenBank GenBank NP_372518), autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHCII analog (US5648240), MRPII, Npase, RNAIII activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni ABC SitC / MntC / saliva binding protein (US5,801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein (see PCT Publications WO2007 / 113222, WO2007 / 113223, WO2006 / 032472, WO2006 / 032475, WO2006 / 032500, each of which is incorporated herein by reference in its entirety). Staphylococcal antigens or immunogenic fragments can be administered simultaneously with protein A variants. Staphylococcal antigens or immunogenic fragments and protein A variants can be administered in the same composition. Protein A variants can also be recombinant nucleic acid molecules encoding protein A variants.The recombinant nucleic acid molecule may encode a protein A variant and at least one staphylococcal antigen or an immunogenic fragment thereof. As used herein, the term "modulate" includes the meanings of the words "enhance" or "inhibit". "Modulation" of an activity may be an increase or decrease in activity. The term "modulator" as used herein refers to a compound that affects the function of a portion, including upregulation, induction, stimulation, enhancement, inhibition, downregulation or inhibition of a protein, nucleic acid, gene, organism or the like.

[0041] In certain embodiments, the methods and compositions use or include or encode all or part of a protein A variant or antigen. In other aspects, a protein A variant can be used in combination with a secreted factor or surface antigen, including but not limited to one or more than one isolated polypeptides of Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp or vWh, or immunogenic fragments thereof. Other Staphylococcal antigens that can be used in combination with Protein A variants include, but are not limited to, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNA III activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni-ABC transporter, SitC / MntC / sialobinding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein.In certain embodiments, Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp, vWh, 52 kDa vitronectin binding protein (WO01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNA III activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni One, two, three, four, five, six, seven, eight, nine, ten or more of ABC transporters, SitC / MntC / saliva binding proteins (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding proteins may be specifically excluded from the formulation.

[0042] In another aspect, the isolated protein A variant is multimerized, such as dimerized or a linear fusion of two or more polypeptides or peptide segments. In certain aspects of the invention, the composition comprises polymers or concatemers of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 isolated cell surface proteins or fragments thereof. Concatemers are linear polypeptides having one or more than one repeating peptide units. SpA polypeptides or fragments may be continuous or separated by spacers or other peptide sequences, for example, one or more than one other bacterial peptide. On the other hand, other polypeptides or peptides contained in the multimer or concatemer may include, but are not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp, vWh, or immunogenic fragments thereof. Other Staphylococcal antigens that can be used in combination with Protein A variants include, but are not limited to, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNA III activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni-ABC transporter, SitC / MntC / sialobinding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein.

[0043] The term "Protein A variant" or "SpA variant" refers to a polypeptide comprising a SpA IgG domain having two or more disrupted ligands to the Fc and V domains. H 3. In certain aspects, SpA variants include variant domain D peptides, and variants of SpA polypeptides and fragments thereof that are non-toxic and stimulate an immune response against Staphylococcal protein A and / or bacteria expressing such protein.

[0044] Embodiments also include methods for inducing an immune response against Staphylococcus bacteria or Staphylococcus in a subject, the method comprising providing an effective amount of a protein A variant or a fragment thereof to the subject. In certain aspects, the method for inducing an immune response against Staphylococcus or Staphylococcus in a subject comprises providing an effective amount of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more than 19 secreted proteins and / or cell surface proteins or fragments thereof / fragments to the subject. Secreted proteins or cell surface proteins include, but are not limited to, Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp and / or vWh proteins and immunogenic fragments thereof. Other Staphylococcal antigens that can be used in combination with Protein A variants include, but are not limited to, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analogs (US5648240), MRPII, Npase, RNAIII activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni-ABC transporter, SitC / MntC / saliva binding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein.

[0045] Embodiments including method, composition and polypeptide embodiments include specific embodiments wherein the Staphylococcus comprises a WU1 or JSNZ strain of Staphylococcus aureus. In some embodiments, the Staphylococcus comprises an ST88 type isolate.

[0046] In some embodiments, the subject or patient described herein, e.g., a human patient, is a pediatric patient. A pediatric patient refers to a patient under the age of 18. In some embodiments, the patient is at least or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 85, or 90 years old (or any range derivable therefrom). In some embodiments, the pediatric patient is 2 years old or younger. In some embodiments, the pediatric patient is less than 1 year old. In some embodiments, the pediatric patient is less than 6 months old. In some embodiments, the pediatric patient is 2 months old or less. In some embodiments, the pediatric patient is 65 years old or older. In some embodiments, the human patient is a health care worker. In some embodiments, the patient is a patient who will undergo surgery.

[0047] In some embodiments, the polypeptide or composition of separation is divided into four doses and taken by the patient, and the interval between the doses is at least four weeks. In some embodiments, the polypeptide of separation is administered with 4 doses or just administered with 4 doses. In some embodiments, the polypeptide of separation or composition is administered with at least, at most or just administered with 1, 2, 3, 4, 5, 6, 7 or 8 doses. In some embodiments, the first dose is administered at 6 to 8 weeks of age. In some embodiments, all four doses are administered before 2 years of age or 2 years of age. In some embodiments, the polypeptide or composition will be administered as a series of four doses at 2 months, 4 months, 6 months and 12 months to 15 months. The first dose can be given at 6 weeks of age as early as possible. The interval between administrations can be about 4 weeks to 8 weeks. In certain embodiments, the fourth dose is administered at about 12 months to 15 months, and is administered at least 2 months after the third dose.

[0048] Embodiments include compositions comprising polypeptides, peptides or proteins that are or are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or similar to protein A, or a second protein or peptide that is a secreted bacterial protein or a bacterial cell surface protein. In additional embodiments, the composition may include a polypeptide, peptide or protein that is or is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical or similar to protein A domain D (SEQ ID NO: 2), domain E (SEQ ID NO: 3), domain A (SEQ ID NO: 4), domain C (SEQ ID NO: 5), domain B (SEQ ID NO: 6), or a nucleic acid sequence encoding a protein A domain D, domain E, domain A, domain C or domain B polypeptide. In certain aspects, the protein A polypeptide fragment will have the amino acid sequence of SEQ ID NO: 8. Similarity or identity, preferably identity is known in the art, and many different programs can be used to identify whether a protein (or nucleic acid) has sequence identity or similarity with a known sequence. Sequence identity and / or similarity are determined using standard techniques known in the art, including but not limited to the local sequence identity algorithm of Smith & Waterman (1981), the sequence identity comparison algorithm of Needleman & Wunsch (1970), the similarity search method of Pearson & Lipman (1988), the computer implementation of these algorithms (Wisconsin genetics software package Genetics Computer Group, 575 Science Drive, GAP, BESTFIT, FASTA and TFASTA in Madison, Wisconsin), the best fit sequence program described by the people such as Devereux (1984), preferably using default settings or by inspection. Preferably, the identity percentage is calculated by using a comparison tool known to those skilled in the art and easily determined. The identity percentage is basically the number of identical amino acids divided by the total number of amino acids compared multiplied by one hundred.

[0049] Additional embodiments also include methods of stimulating a protective or therapeutic immune response of a subject to Staphylococcus aureus, comprising administering to the subject an effective amount of a composition comprising (i) a SpA variant, such as a variant SpA domain A to E polypeptide or a peptide thereof; or (ii) a nucleic acid molecule encoding such a SpA variant polypeptide or a peptide thereof, or (iii) administering any combination or arrangement of SpA variant domain D polypeptides and bacterial proteins described herein. In a preferred embodiment, the composition is not Staphylococcus aureus. In certain aspects, the subject may be a human, a cow, a pig, a sheep or a goat, or any other animal grown for human consumption, and may be infected with Staphylococcus aureus, such as mastitis. On the other hand, the composition is formulated into a pharmaceutically acceptable formulation. The Staphylococcus aureus may be Staphylococcus aureus.

[0050] Additional embodiments also include vaccines comprising separated SpA variant polypeptides or any other combination or arrangement of proteins or peptides described herein, wherein the composition is capable of stimulating an immune response against staphylococcal bacteria. The vaccine may comprise separated SpA variant polypeptides, or any other combination or arrangement of the proteins or peptides. In certain aspects of the invention, the separated SpA variant polypeptides, or any other combination or arrangement of the described proteins or peptides are multimerized, such as dimerized or concatenated. On the other hand, the vaccine composition is contaminated by other staphylococcal proteins by less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.25%, 0.05% (or any range derivable therefrom). The composition may also comprise separated non-SpA polypeptides. Typically the vaccine comprises an adjuvant. In certain aspects, the protein or peptide of the invention is connected (covalently or non-covalently) to an adjuvant, preferably the adjuvant is chemically conjugated to the protein. In some embodiments, the adjuvant comprises alum. In some embodiments, the adjuvant comprises an adjuvant as described herein.

[0051] In another embodiment, the vaccine composition is a pharmaceutically acceptable composition having a recombinant nucleic acid encoding all or part of a SpA variant polypeptide or any other combination or arrangement of proteins or peptides described herein, wherein the composition is capable of stimulating an immune response against Staphylococcus. The vaccine composition may comprise a recombinant nucleic acid encoding all or part of a SpA variant polypeptide or any other combination or arrangement of proteins or peptides described herein. In certain embodiments, the recombinant nucleic acid contains a heterologous promoter. Preferably, the recombinant nucleic acid is a vector. More preferably, the vector is a plasmid or a viral vector. In certain aspects, the vaccine comprises a recombinant non-staphylococcus containing nucleic acid. The recombinant non-staphylococcus can be Salmonella or other Gram-positive bacteria. The vaccine may comprise a pharmaceutically acceptable excipient, more preferably an adjuvant. In certain embodiments, the adjuvant comprises alum or an adjuvant described herein.

[0052] Additional embodiments include methods of stimulating a protective or therapeutic immune response of a subject to Staphylococcus bacteria, comprising administering to the subject an effective amount of a composition of a SpA variant polypeptide or fragment thereof, and further comprising one or more than one protein or peptide of Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp or vWh. In a preferred embodiment, the composition comprises non-Staphylococcus bacteria. On the other hand, the composition is formulated into a pharmaceutically acceptable formulation. The Staphylococcus aureus of the subject may be Staphylococcus aureus. The methods of the present invention also include various combinations of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more than 19 secreted virulence factors and / or cell surface proteins of the SpA variant composition, such as Eap, Ebh, Emp, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp or vWh. In certain aspects, the vaccine formulation includes Eap, Ebh, Emp, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp and vWh. In certain aspects, the antigen combination may include (1) SpA variant and IsdA; (2) SpA variant and ClfB; (3) SpA variant and SdrD; (4) SpA variant and Hla or Hla variant; (5) SpA variant and ClfB, SdrD and Hla or Hla variant; (6) SpA variant, IsdA, SdrD and Hla or Hla variant; (7) SpA variant, IsdA, ClfB and Hla or Hla variant; (8) SpA variant, IsdA, ClfB and SdrD; (9) SpA variant, IsdA, C IsdA, ClfB and SdrD and Hla or Hla variants; (10) SpA variants, IsdA, ClfB and SdrD; (11) SpA variants, IsdA, SdrD and Hla or Hla variants; (12) SpA variants, IsdA and Hla or Hla variants; (13) SpA variants, IsdA, ClfB and Hla or Hla variants; (14) SpA variants, ClfB and SdrD; (15) SpA variants, ClfB and Hla or Hla variants; or (16) SpA variants, SdrD and Hla or Hla variants.

[0053] In certain aspects, bacteria delivered with the compositions of the invention will be limited or attenuated for prolonged or sustained growth or abscess formation. In further aspects, SpA variants may be overexpressed in attenuated bacteria to additionally enhance or supplement immune responses or vaccine formulations.

[0054] The term "EsxA protein" is intended to include wild-type EsxA polypeptides isolated from Staphylococci and fragments thereof as well as variants that stimulate an immune response against Staphylococcal EsxA proteins.

[0055] The term "EsxB protein" refers to proteins including wild-type EsxB polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal EsxB proteins.

[0056] The term "SdrD protein" refers to proteins including wild-type SdrD polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal SdrD proteins.

[0057] The term "SdrE protein" is intended to include wild-type SdrE polypeptides isolated from Staphylococcus bacteria and fragments thereof, as well as variants that stimulate an immune response against the SdrE protein of Staphylococcus bacteria.

[0058] The term "IsdA protein" is intended to include isolated wild-type IsdA polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus IsdA proteins.

[0059] The term "IsdB protein" is intended to include isolated wild-type IsdB polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus IsdB protein.

[0060] The term "Eap protein" is meant to include wild-type Eap polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal Eap proteins.

[0061] The term "Ebh protein" is meant to include wild-type Ebh polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal Ebh proteins.

[0062] The term "Emp protein" is meant to include wild-type Emp polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal Emp proteins.

[0063] The term "EsxB protein" refers to proteins including wild-type EsxB polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal EsxB proteins.

[0064] The term "EsxC protein" refers to proteins including wild-type EsxC polypeptides isolated from Staphylococci and fragments thereof, as well as variants that stimulate an immune response against Staphylococcal EsxC proteins.

[0065] The term "SdrC protein" is intended to include wild-type SdrC polypeptides isolated from Staphylococcus bacteria and fragments thereof, as well as variants that stimulate an immune response against the SdrC protein from Staphylococcus bacteria.

[0066] The term "CIfA protein" is meant to include isolated wild-type CIfA polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus CIfA proteins.

[0067] The term "CIfB protein" is meant to include isolated wild-type CIfB polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus CIfB proteins.

[0068] The term "Coa protein" is meant to include isolated wild-type Coa polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus Coa protein.

[0069] The term "HIa protein" is meant to include isolated wild-type HIa polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus HIa protein.

[0070] The term "IsdC protein" is meant to include isolated wild-type IsdC polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus IsdC protein.

[0071] The term "SasF protein" is intended to include isolated wild-type SasF polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus SasF protein.

[0072] The term "vWbp protein" is intended to include isolated wild-type vWbp polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus vWbp protein.

[0073] The term "vWh protein" is meant to include isolated wild-type vWh polypeptides from Staphylococcus and fragments thereof, as well as variants that stimulate an immune response against Staphylococcus vWh protein.

[0074] An immune response refers to a humoral response, a cellular response, or both a humoral response and a cellular response in an organism. The detection of an immune response can be performed in the following ways, including but not limited to determining the presence or quantity of antibodies that specifically recognize proteins or cell surface proteins, determining T cell activation or proliferation, and / or determining the regulation of the activity or expression of one or more than one cytokine.

[0075] In certain aspects, a polypeptide or fragment may have a sequence that is at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% or more than 99% identical to the amino acid sequence of a reference polypeptide. The term "similarity" refers to a percentage of amino acid identity between the sequence of a polypeptide and a reference polypeptide or a conservative substitution consisting of a reference polypeptide.

[0076] The polypeptides described herein may include or exclude SEQ ID , 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, 30th, 31st, 32nd, 33rd, 34th, 35th, 36th, 37th, 38th, 39th, 40th, 41st, 42nd, 43rd, 44th, 45th, 46th, 47th, 48th, 49th, 50th, 51st, 52nd, 53rd, 54th, 55th, 56th, 57th, 58th, 59th, 60th, 61st, 62nd, 63rd, 64th, 65th, 66th, 67th, 68th, 69th, 70th, 71st, 72nd, 73rd, 74th, 75th, 76th, 77th, 78th, 79th, 80th, 81st, 82nd, 83rd, 84th, 85th, 86th, 87th, 88th, 89th, 90th, 91st, 92nd, 93rd, 94th, 95th, 96th, 97th, 98th, 99th, 100th, 101st, 102nd, 103rd, 104th, 105th, 106th, 107th, 108th, 109th, 110th, 111th, 112th, 113th, 114th, 115th, 116th, 117th, 118th, 119th, 120th, 121st, 122nd, 123rd, 124th, 125th, 126th, 127th, 128th, 129th, 130th, 131st, 132nd, 133rd, 134th, 135th, 136th, 137th, 138th, 139th, 140th, 141st, 142nd, 143rd, 144th, 145th, 146th, 147th, 148th, 149th, 150th, 151st, 152nd, 153rd, 154th, 155th, 156th, 157th, 158th, 159th, 160th 0th, 161st, 162nd, 163rd, 164th, 165th, 166th, 167th, 168th, 169th, 170th, 171st, 172nd, 173rd, 174th, 175th, 176th, 177th, 178th, 179th, 180th,181st, 182nd, 183rd, 184th, 185th, 186th, 187th, 188th, 189th, 190th, 191st, 192nd, 193rd, 194th, 195th, 196th, 197th, 198th, 199th, 200th, 201st, 202nd, 203rd, 204th, 205th, 206th, 207th, 208th, 209th, 210th, 211th, 212th, 213th, 214th, 215th, 216th, 217th, 218th, 219th, 220th 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 300, 400, 500, 550, 1000 or more consecutive amino acids at position 1000 or any range derivable therefrom.

[0077] A polypeptide fragment as described herein may include SEQ ID NO: 1-6 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62 , 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143 3, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168、169、170、171、172、173、174、175、176、177、178、179、180、181、182、183、184、185、186、187、188、189、190、191、192 2, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216,400, 500, 550, 1000 or more consecutive amino acids or any range derivable therefrom.

[0078] The composition may be formulated as a pharmaceutically acceptable composition. In certain aspects of the invention, the Staphylococcus is Staphylococcus aureus.

[0079] In another aspect, the composition can be administered to a subject more than once, and can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more than 20 times. Administration of the composition includes, but is not limited to, oral, parenteral, subcutaneous, intramuscular, intravenous, or various combinations thereof, including inhalation.

[0080] In other embodiments, the composition comprises a recombinant nucleic acid molecule encoding a polypeptide described herein or a fragment thereof. Typically, the recombinant nucleic acid molecule encoding the polypeptide described herein comprises a heterologous promoter. In some aspects, the recombinant nucleic acid molecule of the present invention is a vector, and in other aspects, the vector is a plasmid. In certain embodiments, the vector is a viral vector. In some aspects, the composition includes a recombinant non-staphylococcal bacteria containing or expressing the polypeptide described herein. In specific aspects, the recombinant non-staphylococcal bacteria is Salmonella or another Gram-positive bacteria. The composition is typically applied to mammals, such as human subjects, but it is worth considering the treatment of other animals that can induce an immune response. In another aspect, the staphylococcus containing or expressing the polypeptide is Staphylococcus aureus. In other embodiments, the immune response is a protective immune response.

[0081] In additional embodiments, the composition comprises all or part of a recombinant nucleic acid molecule encoding one or more than one Eap, Ebh, Emp, EsaB, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, SpA, vWbp or vWh protein or peptide, or variants thereof. Other Staphylococcal antigens that can be used in combination with the polypeptides described herein include, but are not limited to, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNA III activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni ABC transporters, SitC / MntC / saliva binding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein. In certain aspects, the bacterium is a recombinant non-staphylococcal bacterium, such as Salmonella or other Gram-positive bacteria.

[0082] The compositions of the invention are typically administered to human subjects, but administration to other animals capable of eliciting an immune response to Staphylococci, particularly cattle, horses, goats, sheep and other livestock, ie, mammals, is also contemplated.

[0083] In certain aspects, the staphylococcus is Staphylococcus aureus. In other embodiments, the immune response is a protective immune response. In still other aspects, the methods and compositions of the present invention can be used to prevent, improve, reduce or treat infections of tissues or glands, such as breasts, particularly mastitis and other infections. Other methods include, but are not limited to, prophylactically reducing the bacterial burden of subjects who do not show signs of infection, particularly those who are suspected or have the potential to be colonized by the target bacteria, for example, patients who are or will be at risk of infection or susceptible to infection during hospitalization, treatment and / or rehabilitation.

[0084] Any embodiments discussed with respect to one aspect of the invention are also applicable to other aspects of the invention. In particular, any of the embodiments discussed in the context of SpA variant polypeptides or peptides or nucleic acids can be implemented against other antigens, such as Eap, Ebh, Emp, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp, vWh, 52 kDa vitronectin binding protein (WO 01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EP, BFPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNAIII activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni ABC transporters, SitC / MntC / sialobinding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding proteins (or nucleic acids), and vice versa.It is also understood that Eap, Ebb, Emp, EsaC, EsxA, EsxB, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, Coa, Hla, IsdC, SasF, vWbp, vWh, 52 kDa vitronectin binding protein (WO01 / 60852), Aaa, Aap, Ant, autolysin glucosaminidase, autolysin amidase, Cna, collagen binding protein (US6288214), EFB (FIB), elastin binding protein (EbpS), EPB, FPBA, fibrinogen binding protein (US6008341), fibronectin binding protein (US5840846), FnbA, FnbB, GehD (US 2002 / 0169288), HarA, HBP, immunodominant ABC transporter, IsaA / PisA, laminin receptor, lipase GehD, MAP, Mg2+ transporter, MHC II analog (US5648240), MRPII, Npase, RNA III activating protein (RAP), SasA, SasB, SasC, SasD, SasK, SBI, SdrF (WO 00 / 12689), SdrG / Fig (WO 00 / 12689), SdrH (WO 00 / 12689), SEA exotoxin (WO 00 / 02523), SEB exotoxin (WO 00 / 02523), SitC and Ni One or more than one of ABC transporters, SitC / MntC / sialobinding protein (US5801234), SsaA, SSP-1, SSP-2 and / or vitronectin binding protein may be specifically excluded from the claimed composition.

[0085] Embodiments of the present invention include compositions containing or not containing bacteria. The composition may contain or not contain attenuated or live or complete Staphylococci. In some aspects, the composition contains bacteria that are not Staphylococcus bacteria or does not contain Staphylococcus bacteria. In some embodiments, the bacterial composition contains isolated or recombinantly expressed Staphylococcus protein A variants or nucleotides encoding the same. The composition can be or include recombinantly modified Staphylococci, which have been altered in a manner that specifically alters secreted virulence factors or cell surface proteins containing bacteria. For example, the bacteria can be recombinantly modified to express more virulence factors or cell surface proteins than those expressed when not modified.

[0086] The term "isolated" may refer to a nucleic acid or polypeptide that is substantially free of cellular material, bacterial material, viral material, or culture medium (when produced by recombinant DNA technology) or chemical precursors or other chemicals from which it was derived (when chemically synthesized). In addition, an isolated compound refers to a compound that can be administered to a subject as an isolated compound; in other words, if the compound adheres to a column or is embedded in an agarose gel, it cannot simply be considered "isolated". In addition, an "isolated nucleic acid fragment" or "isolated peptide" is a fragment that does not occur naturally and / or a nucleic acid or protein fragment that is not generally in a functional state.

[0087] The parts of the present invention, such as polypeptides, peptides, antigens or immunogens, can be covalently or non-covalently conjugated or connected to other parts, such as adjuvants, proteins, peptides, supports, fluorescent moieties or labels. The term "conjugate" or "immunoconjugate" is widely used to define the effective association of one part with another agent, and is not intended to refer to only any type of effective association, and is especially not limited to chemical "conjugation". Recombinant fusion proteins are particularly contemplated. The composition of the present invention may also include an adjuvant or a pharmaceutically acceptable excipient. In certain embodiments, the adjuvant includes alum or an adjuvant described herein. The adjuvant can be covalently or non-covalently coupled to the polypeptide or peptide of the present invention. In some aspects, the adjuvant is chemically coupled to the protein, polypeptide or peptide.

[0088] The term "providing" is used according to its ordinary meaning to mean "providing or providing for use". In some embodiments, the protein is provided directly by administering the protein, while in other embodiments, the protein is effectively provided by administering a nucleic acid encoding the protein. In certain aspects, the present invention contemplates compositions comprising various combinations of nucleic acids, antigens, peptides and / or epitopes.

[0089] The subject will have (e.g., be diagnosed with a staphylococcal infection), will be suspected of having or will be at risk of a staphylococcal infection. The compositions of the present invention include immunogenic compositions, wherein the content of the antigen or epitope is considered to be effective for the purpose of consideration. More specifically, an effective amount refers to the amount of active ingredient necessary to stimulate or elicit an immune response or provide resistance, improvement or alleviation to an infection. In more specific aspects, an effective amount prevents, alleviates or improves the symptoms of a disease or infection, or prolongs the survival time of a subject being treated. The determination of an effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein. For any formulation used in the methods of the present invention, the effective amount or dosage can be first estimated from in vitro studies, cell cultures and / or animal model assays. For example, a dose can be formulated in an animal model to achieve a desired immune response or circulating antibody concentration or titer. This information can be used to more accurately determine a useful dose for humans.

[0090] In some embodiments, the polypeptides of the present disclosure (SpA variants) provide less than or equal to 20%, 19.5%, 19%, 18.5%, 18%, 17.5%, 17%, 16.5%, 16%, 15.5%, 15%, 14.5%, 14%, 13.5%, 13%, 12.5%, 12%, 11.5%, 11%, 10.5%, 10%, 9.5%, 9%, 8.5%, 8%, 7.5%, 7%, 6.5%, 6%, 5.5%, 5%, 4.5%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, or 0% (or any range derivable therefrom) histamine release in a basophil histamine release assay.

[0091] The embodiments in the Examples section are to be understood as embodiments of the invention applicable to all aspects of the invention.

[0092] The term "or" used in the claims is used to mean "and / or" unless explicitly stated to refer only to alternatives or the alternatives are mutually exclusive, although the present disclosure supports a definition referring only to alternatives and "and / or." It is also contemplated that anything listed using the term "or" may also be explicitly excluded.

[0093] In this application, the term "about" is used to indicate a value that includes the standard deviation of error for the device or method being employed to determine the value.

[0094] Under long-standing patent law, unless otherwise specified, when used in conjunction with the word "comprising" in a claim or specification, the word "a" or "an" means one or more than one.

[0095] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, although indicating specific embodiments of the present invention, are given only as illustrations, because from this detailed description, those skilled in the art will understand various changes and modifications within the spirit and scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] In order to obtain and understand in detail the above-mentioned features, advantages and purposes of the present invention and other matters that will become clear, the more specific description and certain embodiments of the present invention are briefly summarized in the accompanying drawings. These drawings constitute a part of the specification. However, it should be noted that the accompanying drawings illustrate certain embodiments of the present invention and therefore should not be considered to be limited in scope.

[0097] Figure 1A to E Staphylococcus aureus ST88 isolate of the mouse pathogen WU1. (A) Domain structure and sequence homology of vwb gene products from S. aureus WU1 and S. aureus Newman (a human clinical isolate). The percent amino acid (aa) identity of vWbp with its signal peptide (S), D1 domain and D2 domain (responsible for binding and activating host prothrombin), linker (white box) and C-terminal fibrinogen binding domain (C) is shown. (B) Immunoblots of whole culture samples of S. aureus from strain Newman (WT, wild type) and its Δcoa, Δvwb, Δcoa-vwb and ΔclfA variants, strains WU1, JSNZ, USA300LAC and its Δvwb variants were analyzed for the preparation of vWbp (αvWbp), Coa (αCoa), Hla (αHla) and ClfA (αClfA) using polyclonal rabbit antibodies. (C) Polyclonal antibodies against the vWbp-C domain recognize vWbp allelic variants from strains JSNZ and WU1 as well as vWbp from strain USA300LAC. (D to E) Agglutination of Syto-9-stained Staphylococcus aureus strains in human (D) or mouse (E) plasma was examined in 12 microscopic fields as the mean size and standard error of aggregated bacteria, and statistical significance was assessed for pairwise comparisons with WT using two-way ANOVA and Sidak's multiple comparison test. ***, p<0.0001.

[0098] Figure 2A-B Staphylococcus aureus WU1 continuously colonizes the nasopharynx of C57BL / 6 mice. 8 A group of C57BL / 6 mice (n=10) were inoculated intranasally with CFU of the designated S. aureus WU1 or PBS control and the throat was swabbed weekly to calculate the bacterial load. Each point represents the number of CFU per mouse. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars.

[0099] Figure 3A-B Persistent colonization of C57BL / 6 mice requires WU1 expression of S. aureus protein A (SpA). (A) Immunoblots of S. aureus lysates of strains USA300LAC, Newman, and WU1, using SpA- (αSpA) and sortase A-specific antibodies (αSrtA) to detect the Δspa variant of WU1 without (pspa) and with (pspa) a spa-expressing plasmid. (B) Groups of C57BL / 6 mice (n=10) were inoculated intranasally with 1×10 8CFU of S. aureus WU1 or its Δspa variant, and the oropharynx of the animals were swabbed weekly to calculate the bacterial load. Each point represents the number of CFU per mouse. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars. The bacterial colonization dataset was analyzed using two-way ANOVA followed by Sidak's multiple comparison test; statistically significant differences between the two groups of animals (***p = 0.0003; ****p < 0.0001) are indicated by asterisks.

[0100] Figure 4 With SpA KKAA Immunization of C57BL / 6 mice promotes decolonization with S. aureus WU1. C57BL / 6 mice were immunized with 50 μg of purified recombinant SpAKKAA emulsified in CFA or PBS and boosted 11 days later with 50 μg of recombinant SpAKKAA emulsified in IFA or PBS. On day 0 of the colonization experiment, 1×10 8 CFU of S. aureus WU1 were intranasally inoculated into C57BL / 6 mice (n=10). The oropharynx of the animals were swabbed at weekly intervals to calculate the bacterial load. Each point represents the number of CFU per mouse. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars. The bacterial colonization dataset was analyzed using two-way ANOVA with Sidak's multiple comparison test; statistically significant differences between the two groups of animals (*p<0.05; **p<0.01) are indicated by asterisks.

[0101] Figure 5 With SpA KKAA Immunization of BALB / c mice promoted decolonization with S. aureus WU1. Immunization with 50 μg of purified recombinant SpA emulsified in CFA or PBS was simulated. KKAA BALB / c mice were immunized and 11 days later were treated with 50 μg of recombinant SpA emulsified in IFA or PBS. KKAA On day 0 of the colonization experiment, 1×10 8 CFU of S. aureus WU1 were inoculated intranasally in groups of BALB / c mice (n=10). The oropharynx of the animals were swabbed at weekly intervals to calculate the bacterial load. Each point represents the number of CFU per mouse. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars. The bacterial colonization dataset was analyzed using two-way ANOVA followed by Sidak's multiple comparison test; statistically significant differences between the two groups of animals (*p<0.05; **p<0.01; ****p<0.0001) are indicated by asterisks.

[0102] Figure 6 With SpA KKAAImmunization of BALB / c mice promoted clearance of S. aureus JSNZ from the nasopharynx. Immunization with 50 μg of purified recombinant SpA emulsified in CFA or PBS was used to simulate the effect. KKAA BALB / c mice were immunized and 11 days later were treated with 5 μg of recombinant SpA emulsified in IFA or PBS. KKAA On day 0 of the colonization experiment, 1×10 8 CFU of Staphylococcus aureus JSNZ mice inoculated intranasally in groups of BALB / c mice (n=10). The oropharynx of the animals were swabbed at weekly intervals to calculate the bacterial load. Each point represents the number of CFU per mouse. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars. The bacterial colonization data set was analyzed using two-way ANOVA with Sidak's multiple comparison test; statistically significant differences between the two groups of animals (*p<0.05; **p<0.01) are indicated by asterisks.

[0103] Figure 7A-C Improved SpA vaccines A: SpA KKAA Variant, SpA KKAA / A Variants and SpA KKAA / F Description of the variants. B: Binding affinity of the variants to human IgG. C: Binding affinity of the variants to human IgE.

[0104] Fig. 8A -B Detection of binding capacity. A: Western blot of SpA variants. B: ELISA of variants against labeled molecular variants.

[0105] Figure 9A-B Protein A is required for persistent colonization of the mouse nasal cavity by Staphylococcus aureus.

[0106] Fig.10 Protein A amino acid sequence alignment. Dark gray: amino acids that interact with human Fcγ fragments; light gray: amino acids that interact with human Fab fragments; asterisks indicate amino acids that interact with human Fcγ and Fab fragments, red: amino acids that interact with human Fcγ fragments

[0107] Fig.11 Surface plasmon resonance (SPR) analysis showed that the Z domain (G29A in the SpA B domain) was unable to bind to the F(ab)2 fragment.

[0108] Fig. 12A -B New SpA* variant targeting G29.

[0109] Fig.13 New SpA* variants targeting G29.

[0110] Fig.14 New SpA* variants targeting G29.

[0111] Fig.15 New SpA* variants targeting G29.

[0112] Fig.16 A description of the basil histamine release assay is described further in Example 2.

[0113] Fig.17A-B Staphylococcal protein A (SpA). (A) Diagram illustrating the primary structure of the SpA precursor of cell wall SpA on the bacterial surface, where the N-terminal signal peptide of the SpA precursor is cleaved by signal peptidase, the five immunoglobulin binding domains (IgBDs-designated E, D, A, B, C), the cell wall spanning domain designated region Xr, the LysM domain for peptidoglycan binding, and the C-terminal LPXTG sorting signal cleaved by sortase A), and the primary structure of the released SpA molecule released from the cell wall envelope and diffused into host tissues. (B) Secretion and sortase A-mediated cell wall anchoring of SpA and release of peptidoglycan-linked SpA from S. aureus.

[0114] Figure 18A-B SpA binding to the Fcγ domain of human IgG blocks the antibody's effector region (binding to Fc and complement receptors) and phagocytic opsonophagocytosis of S. aureus. Immune evasion properties of Staphylococcus protein A. (A) Cell wall-anchored SpA on the surface of S. aureus binds to the Fcγ of human IgG (IgG1, IgG2, and IgG4) and blocks the antibody's effector region to trigger opsonophagocytosis of the bacteria. (B) Diagram illustrating the primary structure of human IgG, its antigen-binding paratope (purple), effectors (C1q, FcγRs, FcRn), and SpA binding sites.

[0115] Figure 19A-B Immune evasion properties of Staphylococcal protein A. (A) Immune evasion function of SpA during S. aureus infection. Cell wall-anchored SpA is located on the surface of S. aureus, binds to the Fcγ of human IgG and blocks the effector region of the antibody to trigger opsonophagocytosis of the bacteria. Released SpA cross-links the V domains of human IgG and IgM (B cell receptor) H 3 idiotypic variant heavy chain to activate B cell proliferation, class switching, somatic hypermutation and V H 3 secretion of idiotypic antibodies that can be cross-linked by SpA but do not recognize S. aureus antigens, thereby preventing the development of adaptive immune responses against S. aureus and the establishment of protective immunity. (B) Diagram illustrating the interaction between SpA and V H 3-idiotypic B cell receptor (IgM) binding and cross-linking and activation of CD79AB signaling.

[0116] Figure 20A-B Recombinant SpA, SpA KKAA , SpA AA and SpA KKAA (A) The primary structure of the IgBDs of recombinant SpA with a polyhistidine tag at the N-terminus was used for Ni-NTA purification from the cytoplasm of E. coli by affinity chromatography. The amino acid sequence of the IgBD-E domain is shown below. The positions of the three α-helices of each IgBD (H1, H2, and H3) are indicated. SpA KK and SpA KKAA In Q 9，10 K(Gln 9，10 Lys) has amino acid substitution. SpA KK and SpA KKAA In D 36，37 A(Asp 36，37 Lys). Numbering refers to the position of the amino acid in the B-IgBD. (B) Amino acid sequence alignment of the five IgBDs of SpA. Conserved amino acids are indicated by a dot (.). Gaps in the alignment are indicated by a dash (-). Nonconserved amino acids are listed with a single-letter code. The SpA residues involved in IgG Fcγ binding, as reported by Graille et al. (138), are highlighted in red. H The SpA residues to which the heavy chain binds are highlighted in green. The pink residues (Q 32 ) contributes to Fcγ and V H 3. Combination.

[0117] Figure 21A-B SpA-related V H 3 Cross-linking activity and allergic reactions. (A) Diagram illustrating the structures of human activating Fcγ and Fcε receptors and their V H 3 Idiotypic IgG and IgE ligands. (B) V binding to FcγR and FcεR receptors on basophils or mast cells, respectively H SpA cross-linking of 3-idiotypic IgG or IgE triggers the release of histamine, inflammatory mediators, and cytokines that promote allergic reactions, vasodilation, and shock. Although not depicted in (B), mast cells and basophils express FcγR and FcεR receptors and respond to V bound to FcγR. H 3 Idiotypic IgG SpA cross-linking or V binding to FcεR receptor H 3 Idiotypic IgE SpA cross-linking reaction, releasing histamine, proinflammatory mediators and cytokines.

[0118] Figure 22 Allergic activity of SpA vaccine candidates in mice. μMT mice (n=5) were sensitized with VH3IgG by intradermal injection in the ear. The candidate vaccine antigen or PBS control group was injected intravenously 24 hours later, followed by injection of Evans blue. After extraction of the dye from the ear tissue after 30 minutes, the extravasation of the dye was quantified by spectrophotometric detection at 620 nm. Data are from three independent experiments. One-way ANOVA was performed using the Bonferroni multiple comparison test for statistical analysis of the data. Symbols: ns, not significant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0119] Figure 23A-B Cultured human mast cells (LAD2) were sensitized overnight with VH3 IgE to degranulate mast cells, washed, and left untreated (PBS) or exposed to SpA for 1 h as a positive control or test article SpA KKAA , SpA Q9，10K / S33E , SpA Q9，10K / S33T or SpA-KR. β-Hexosaminidase and histamine levels were measured in the cell pellet as well as in the supernatant. The percentage of β-hexosaminidase (A) and the amount of histamine (B) released are shown. One-way ANOVA was performed using the Bonferroni multiple comparison test for statistical analysis of the data. Symbols: ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

[0120] Figure 24A-E with SpA KKAA or SpA Q9，10K / S33E or SpA Q9，10K / S33T Immunization can promote progressive decolonization. 8 CFU of S. aureus WU1 were inoculated intranasally in C57BL / 6 mice (n=10). (A, B, D) The throats of mice were swabbed weekly to calculate the bacterial load. (C, E) Fecal samples were collected weekly after inoculation to calculate the bacterial load. In Figure (A), mice were inoculated with adjuvants -PBS or -SpA KKAA Animal immunization was performed. In Figures (B to C), adjuvant-SpA KKAA or-SpA Q9，10K / S33E Animals were immunized and the bacterial load was monitored in throat (B) and fecal samples (C) of the same group of animals. In Figures (D to E), animals were immunized with adjuvants -PBS or -SpA KKAA or-SpA KKAA or-SpA Q9，10K / S33E or-SpA Q9，10K / S33TAnimals were immunized; bacterial loads were monitored in throat (D) and fecal samples (E) of the same group of animals. Each square represents the number of CFU per mL or per gram of feces per throat swab. The median and standard deviation of each group of animals on a given day are represented by horizontal lines and error bars. Data were analyzed by two-way ANOVA using Sidak's multiple comparison test (*, P < 0.05). In Figures (DE), each group of data (1 to 8 per group) represents the CFU from mock, SpA, and sham control groups, respectively. KKAA , SpA Q9，10K / S33E or SpA Q9，10K / S33T In Panels B and C, no statistical differences were found between the two groups.

[0121] Figure 25A-C Protective activity of SpA vaccine candidates in a mouse model of bloodstream infection. KKAA or SpA Q9，10K / S33E or SpA Q9，10K / S33T Three-week-old BALB / c mice (n=15) were immunized with either a mock or booster immunization on day 11. On day 20, mice were bled to assess serum half-maximal antibody titers against the candidate vaccine, represented as SpA* on the v-axis. The three bars in each group represent SpA* from left to right. KKAA , SpA Q9，10K / S33E and Spa AQ9，10K / S33T (A) On day 21, 5×10 6 CFU of Staphylococcus aureus USA300 (LAC) challenged the right periorbital sinus of mice. 15 days after challenge, animals were euthanized to calculate the staphylococcal load in the kidney (B) and to count abscess lesions (C). One-way ANOVA was performed using the Bonferroni multiple comparison test for statistical analysis of the data. Symbols: ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

[0122] Figure 26A-C Interaction between SpA vaccine candidate and SpA neutralizing monoclonal antibody 3F6. KKAA or SpA Q9，10K / S33E or SpA Q9，10K / S33T Serial dilutions of 3F6 antibody, recombinant rMAb 3F6 from HEK293 F cells (A, rMAb 3F6), or mouse hybridoma monoclonal antibody (B, hMAb 3F6) were applied to ELISA plates coated with PBS or control groups. (C) Binding constants calculated using GraphPad Prism software. DETAILED DESCRIPTION

[0123] Staphylococcus aureus is a commensal bacterium of human skin and nares and is a major cause of blood, skin, and soft tissue infections (Klevens et al., 2007). The recent dramatic increase in mortality from staphylococcal disease has been attributed to the spread of methicillin-resistant Staphylococcus aureus (MRSA) strains that are generally insensitive to antibiotics (Kennedy et al., 2008). In a large retrospective study, the incidence of MRSA infection was 4.6% of all hospitalized patients in the United States (Klevens et al., 2007). The annual health care costs for the 94,300 MRSA-infected patients in the United States exceeded $2.4 billion (Klevens et al., 2007). The current MRSA epidemic has created a public health crisis that needs to be addressed by the development of a preventive vaccine (Boucher and Corey, 2008). To date, no vaccine has been licensed by the FDA to prevent S. aureus disease.

[0124] The inventors describe herein that protein A (a cell wall anchored surface protein of staphylococci) is used to produce variants that can be used as subunit vaccines. The pathogenesis of staphylococcal infection begins with the invasion of bacteria into the skin or bloodstream through trauma, surgical wounds or medical devices (Lowy, 1998). Although the invading pathogens may be engulfed and killed, staphylococci can also escape innate immune defenses and seed infections in organ tissues, inducing inflammatory responses that attract macrophages, neutrophils and other phagocytes (Lowy, 1998). The responsive invasion of immune cells to the site of infection is accompanied by liquefaction necrosis because the host attempts to prevent the spread of staphylococci and allows the clearing of necrotic tissue fragments (Lam et al., 1963). Such lesions can be observed by microscopy, including areas of cell proliferation of necrotic tissue, leukocytes and central bacterial lesions (Lam et al., 1963). Unless staphylococcal abscesses are surgically drained and treated with antibiotics, disseminated infection and sepsis can lead to death (Sheagren, 1984).

[0125] I. Staphylococcal antigens

[0126] A. Staphylococcal protein A (SpA)

[0127] Staphylococcal protein A (SpA) binds to immunoglobulins, allowing S. aureus to evade the host immune response. SpA binding to Fcγ blocks the effector region of IgG antibodies and the opsonophagocytosis of staphylococci by immune cells. H SpA cross-linking of 3 idiotypic IgM variant heavy chains triggers B cell proliferation and V H 3 clones of antibodies that cannot bind to antigenic determinants of Staphylococcus aureus. In addition, V H3 Idiotypic IgG and IgE cross-linking of SpA promotes histamine release and allergic reactions. Early work developed SpA with Fcγ and variant heavy chain binding defects KKAA When tested as a vaccine in preclinical studies, SpA KKAA The following examples show that SpA neutralizing antibodies can be elicited and protect animals from S. aureus colonization and invasive disease. KKAA Retained V H 3 idiotype IgG and IgE cross-linking activity and induce allergic reactions, indicating that it is unsafe for use in humans. We demonstrated that the lack of V H 3 Heavy chain cross-linked and allergenic SpA variants elicit SpA neutralizing antibodies and protect animals from S. aureus colonization and bloodstream infection. H The SpA variants of 3-idiotypic immunoglobulins can be used to prevent human Staphylococcus aureus colonization and invasive disease.

[0128] B. Colonization and disease caused by Staphylococcus aureus

[0129] Staphylococcus aureus colonizes the human nasopharynx and gastrointestinal tract and is found as a persistent colonizer in approximately one-third of the population (14). The remainder of the population is intermittently colonized with S. aureus (14). Almost all humans develop antibodies against certain molecular determinants of S. aureus during childhood (99). However, these immune responses do not affect S. aureus colonization or protection against invasive disease (99). Colonization is a key risk factor for S. aureus community- or hospital-acquired invasive disease, including soft tissue, wound, lung, bone, bloodstream, and surgical site infections (14, 100, 58, 6). In the United States, 3.4 million S. aureus community-acquired infections (CAIs) and 340,000 hospital-acquired infections (HAIs) require antibiotics and / or surgery (49 to 51). 7% of CAIs and 22% of HAIs are infected with antibiotic-resistant strains of S. aureus, termed MRSA (methicillin-resistant S. aureus), and are associated with treatment failure and adverse disease outcomes, including death (85). All S. aureus diseases are characterized by recurrence, with recurrent infections caused by the same strain in 4 out of 5 cases and the inability of the infected host to establish protective immunity (16). The development of staphylococcal vaccines that can block colonization and prevent invasive disease represents an urgent, unmet clinical need. Although several vaccine candidates have been tested for clinical efficacy, the products have failed to meet their clinical endpoints (59–60, 101).

[0130] C. Staphylococcal protein A (SpA) is a key immune evasion determinant

[0131] Staphylococcal protein A (SpA), a sortase A-anchored surface protein, is a key immune evasion determinant that prevents the development of protective immunity during S. aureus colonization and infection (75, 33, 102, 48). All clinical S. aureus isolates carry the gene for staphylococcal protein A (spa), which produces a precursor product consisting of an N-terminal YSIRK / GxxS signal peptide, followed by 4 to 5 immunoglobulin binding domains, region X repeats (Xr), a LysM domain, and an LPXTG sorting signal (29, 32, 103) (Figure 17A). The SpA precursor is present in the bacterial cytoplasm and enters the secretory pathway at the septum through its N-terminal YSIRK / GxxS signal peptide (68, 104). Once across the diaphragm, the C-terminal LPXTG sorting signal is cleaved by sortase A, forming a thioester intermediate between its active site cysteine ​​residue and the carboxyl group of the threonine (T) in the LPXTG motif (105 to 108) (Figure 17B). The thioester intermediate is decomposed by nucleophilic excitation of the amino group (NH2-) in lipid II [C55-(PO4)2-MurNAc(L-Ala-D-iGlu-L-Lys(NH2-Gly5)-D-Ala-D-Ala)-GlcNAc], generating an amide bond between the C-terminal threonine and the pentaglycine cross-bridge (107, 109). The SpA-lipid II intermediate is then incorporated into the transmural peptidoglycan and displayed on the bacterial surface (108, 70).

[0132] The cell wall-anchored SpA on the bacterial surface binds to the Fcγ domain of IgG and disables the effector region of the antibody, thereby protecting Staphylococci from opsonophagocytic killing (OPK) by host immune cells (48, 76) (Figure 18). During replication, Staphylococci release part of the peptidoglycan and peptidoglycan-linked SpA (herein referred to as released protein A or released SpA) into the host environment due to the cell wall lytic enzyme activity that degrades the transmural near the septum (110, 111) (Figure 17B). The released SpA is tethered to the wall peptide with the structure of L-Ala-D-iGln-L-Lys(SpA-LPET-Gly5)-D-Ala-Gly4(46). The released SpA activates VH3-idiotypic B cell receptors (BCRs or IgM), thereby promoting B cell proliferation and secretion of VH3-idiotypic IgG, IgA, IgD, IgE, and IgM through the generation of activated plasmablasts (75, 33) (Figure 19).

[0133] D. Immunoglobulin binding and toxicity properties of SpA

[0134] The N-terminal immunoglobulin binding domain (IgBD) of SpA (a triple helical fold of 72 amino acid residues from 134 to 137, referred to as E, D, A, B, and C) binds to the Fcγ domains of human IgG1, IgG2, and IgG4, respectively (112-116, 71) (Figure 20). SpA does not bind to the Fcγ domain of human IgG3, the only IgG subclass with a short plasma half-life (113, 117). Each of the five IgBDs also binds to variant heavy chains of VH3 cloned human immunoglobulins including IgM (BCR), IgG, IgE, IgD, and IgA (75, 48, 76, 118-135, 43) (Figure 19). The binding sites of the IgBDs do not overlap, allowing each SpA module to simultaneously bind to the Fcγ and VH3 heavy chains of antibodies (48) (Figure 20). A key property of SpA is its ability to interfere with the effector region (Fcγ) of antibodies, including the binding sites of the Fcγ receptor (FcγR) and C1q, which are essential for the immune cell OPK (71, 72, 136, 137) (Figure 18B). In the human immune system, 54% of IgM (lacking Fcγ) and peripheral blood B cells interact with SpA (75, 73, 74). SpA binding is limited to variant heavy chain products of the VH3 gene family, which contains 22 genes compared to other major and minor VH genes with fewer genes: VH1 [11 genes], VH2 [2 genes], VH4 [11 genes], VH5 [2 genes], VH6 [1 gene] and VH7 [1 gene] (138). During colonization and invasive disease, released SpA crosslinks VH3 clonal B cell receptors and triggers the secretion of antibodies (IgG, IgA, IgD, and IgE) that, although adapted by somatic hypermutation to improve the binding of variant heavy chains to SpA, are unable to recognize staphylococcal determinants as antigens (15) (Figure 19). This B cell superantigen activity (BCSA, i.e., the VH3 binding activity of released SpA) is responsible for preventing the development of protective immunity to S. aureus during colonization or invasive disease (102, 48, 139) (Figure 19).

[0135] The immunoglobulin binding properties of SpA are also associated with toxicity when the purified protein is injected into humans or animals. For example, 20% to 30% of guinea pig IgM interacts with SpA through its variant heavy chain (VH3-idiotype) (76); injection of purified SpA (500 μg) into the blood of guinea pigs produces anaphylactic shock, including irritability, respiratory distress, and death (140). Even at a dose of 0.01 μg, SpA causes vascular leakage in guinea pigs (140). In mice, only 5% to 10% of IgM interacts with SpA through its variant heavy chain (VH3-idiotype) (76). Mice are resistant to SpA-induced allergic reactions, but when human IgG is injected intravenously, these animals can convert and succumb to SpA injection through the release of histamine from activated basophils and mast cells (141, 142) (Figure 21). Pretreatment of animals with the H1 receptor histamine antagonist mepyramine prevents SpA-induced anaphylactic shock (140). Intravenous injection of purified SpA (0.3 μg / kg to 0.45 μg / kg) is associated with severe adverse reactions such as headache, nausea, myalgia, chest pain, fever, acute lymphocytopenia, and leukopenia (143). Therefore, purified SpA represents a bacterial toxin and is considered unsafe for humans (143, 144). The toxic activity of SpA is related to its VH3 cross-linking activity on human IgG and IgE, which bind to cognate receptors on basophils and mast cells, thereby inducing histamine and cytokine release, vasodilation, vascular leakage, and shock (140, 142, 144, 145) (Figure 21).

[0136] E.SpA KKAA

[0137] When adjuvanted with aluminum hydroxide or Freund's adjuvant and injected into mice or guinea pigs, purified SpA does not elicit an antibody response against its five IgBDs in the animals (76, 43). Similarly, S. aureus colonization or invasive disease was not associated with the development of antibodies specific to the SpA IgBDs in mice, guinea pigs, or humans (75, 102, 48, 43). Early studies developed recombinant SpA variants by first analyzing the D immunoglobulin binding domain of SpA. Kim and colleagues replaced glutamine (Q or Gln) 9 and 10 with lysine (K or Lys) and aspartic acid (D or Asp) 36 and 37 with alanine (A or Ala) to disrupt the binding of SpA-D to immunoglobulins (43). Q9K, Q10K, D36A, and D37A were introduced into recombinant polyhistidine-tagged SpA-D to generate SpA-D KKAA Finally, the purified SpA-D or SpA-D retained on Ni-NTA was analyzed by ELISA. KKAAThe ability to bind to and subsequently co-elute with human IgG or IgM. As considered, SpA-D retained both human IgG and human IgM on Ni-NTA. KKAA 5.6 (± 0.6)% (P < 0.0001) of human IgG and 75.6 (± 4.6)% (P = 0.008) of human IgM were captured (numbers in parentheses represent standard error of the mean; statistically significant differences were calculated using unpaired t-tests) (43). Q9K, Q10K, D36A, and D37A were introduced into each of the five IgBDs of recombinant, polyhistidine-tagged SpA (lacking the signal peptide, Xr, LysM, and LPXTG sorting signals of the full-length SpA precursor) to generate SpA KKAA (Figure 19)(42). When compared with polyhistidine-tagged recombinant SpA, SpA KKAA The Ni-NTA column captured 2.3 (± 0.1)% of human IgG (P = 0.0001), 2.2 (± 0.1)% of the Fcγ fragment of human IgG (Fcγ binding activity, P < 0.0001), 4.4 (± 1.0)% of the F(ab) fragment of human IgG (VH3 binding activity, P < 0.0001), and 4.2 (± 0.1)% of human IgM (VH3 binding activity, P < 0.0001) (43). KKAA SpA exhibits defects in two binding activities to human immunoglobulins, namely its binding to the Fcγ domain of IgG (IgG1, IgG2 and IgG4) and to variant heavy chains of VH3 idiotype immunoglobulins.

[0138] F.SpA KKAA As vaccine antigen

[0139] Polyhistidine-tagged recombinant SpA and SpA KKAA Purification was performed by immobilized metal affinity chromatography (IMAC) on Ni-NTA (43). The eluate was dialyzed against PBS, extracted with Triton X-114 to remove endotoxin, dialyzed, and the protein concentration (BCA assay) and purity (>90%) were determined by Coomassie-stained SDS-PAGE and HPLC (43). SpA and SpA KKAA Can be adsorbed onto aluminum hydroxide [SpA KKAA Al(OH)3] or emulsified with Freund's adjuvant, complete [SpA KKAA CFA] or incomplete [SpA KKAA IFA] (43). 50 μg SpA KKAA CFA / IFA primary boost (11-day interval) immunization of C57BL / 6 and BALB / c mice elicited responses to SpAKKAA High titer serum IgG antibodies to the antigen [9.2 μg / mL (±1.1); 1:6000 ELISA half-maximal titer] (43). KKAA Al(OH)3 was used to initially boost C57BL / 6 and BALB / c mice, producing low-titer antibodies [1:500, half-maximum titer]; AKKAA Higher titers of IgG were observed in CD1 mice immunized with Al(OH)3 (1:4000 half-maximal titer) (76). Using a 2-prime booster regimen (14 days apart) and 100 μg SpA KKAA Immunization of guinea pigs with Al(OH)3 induces resistance to SpA KKAA High titer serum IgG [1:50,000 half-maximal titer] (76). SpA KKAA Specific mouse and guinea pig IgGs bind to each of the five IgBDs of SpA and neutralize their ability to bind to mouse, guinea pig, or human IgGs through either the Fcγ or VH3 idiotypic heavy chains (76). KKAA Specific mouse and guinea pig IgG neutralize SpA bound to bacterial surface immunoglobulins and promote anticoagulation of Staphylococcus aureus Newman and MRSA USA300 LAC OPK in mouse, guinea pig, and human blood (48, 76, 43). KKAA Immunization of mice and guinea pigs protects the animals from S. aureus bloodstream infection (76, 43). Protection is based on SpA neutralizing antibodies, as intraperitoneal or intravenous injection of purified polyclonal or monoclonal antibodies against SpA IgBDs (mouse monoclonal antibody 3F6) is sufficient to prevent S. aureus bloodstream infection (increased survival, reduced bacterial load in organ tissues and reduced abscess formation) (76, 84, 146, 147). In addition, by neutralizing the BCSA (VH3 cross-linking activity) of SpA, SpA-IgBD-specific antibodies enhance the IgG response to secreted antigens in mice and guinea pigs during S. aureus bloodstream infection, rendering SpA KKAA Immunized animals are able to eliminate bacterial evaders and establish protective immunity against recurrent disease (48, 76, 43, 147). In contrast, naive or SpA-immunized animals are unable to establish protective immunity against S. aureus (48, 43).

[0140] The role of G.SpA in the colonization process of Staphylococcus aureus

[0141] Early work examining bacterial adherence to desquamated human nasal epithelial cells and colonization in mice sought to identify S. aureus factors that contribute to colonization (17, 18, 20). These include D-Ala and GlcNAc modifications of wall teichoic acid (WTA) that bind to nasal epithelial cell type F clearance receptors (SREC-I) (18, 27, 28). In addition, clumping factor B (ClfB) promotes staphylococcal adhesion to loricrin and cytokeratin-10 in nasal epithelial cells (21). Isogenic clfB mutants exhibit reduced adhesion to human volunteer nasal epithelial cells compared with wild-type S. aureus (7). Iron-regulated surface determinant cluster A (IsdA) helps scavenge iron from host hemoglobin and binds lactoferrin, inhibiting the antistaphylococcal activity of lactoferrin in nasal secretions (23, 24). S. aureus surface protein G (SasG) mediates zinc-dependent adhesion between bacterial cells during nasal tissue biofilm formation (25, 26). Thus, several factors are required for staphylococcal adhesion, biofilm formation, and colonization of nasopharyngeal tissue (78). Importantly, nasal colonization of mice with human clinical isolates requires prior antibiotic treatment of the animals to eliminate the resident microbiota and provide selection for antibiotic-resistant S. aureus (19). As a result, mice are not persistently colonized with human clinical S. aureus isolates (20). The role of staphylococcal protein A (SpA) during nasal colonization with S. aureus has been mysterious (29). When 6110 humans from Oxfordshire (UK) were analyzed, all colonized S. aureus strains expressed spa (32, 31). Although the tandem repeat structure of the spa gene promotes high-frequency recombination, human colonization selects for spa alleles, whose products retain five IgBDs, thereby conferring an effective BCSA on staphylococci (33, 32). When human volunteers who had cleared nasal carriage by mupirocin treatment were analyzed, S. aureus spa expression did not require bacterial adhesion to human nasal tissue (34).

[0142] S. aureus WU1, a member of the multilocus sequence type ST88 clade, was isolated from an outbreak of preputial gland abscesses in male C57BL / 6 mice (102). Unlike human clinical isolates, S. aureus WU1 persistently colonized the nasopharynx of C57BL / 6 and BALB / c mice in the absence of antibiotic selection and was maternally transmitted to its offspring to persist in colonization (102). In contrast to wild-type S. aureus WU1, the ΔsrtA mutant, which is unable to anchor any surface proteins to the bacterial envelope, was unable to colonize the nasopharynx of C57BL / 6 mice (102) (unpublished observations). In contrast, the Δspa mutant showed no defect in initial colonization of mice (102). Nevertheless, the Δspa mutant was unable to persist and began to be cleared from the nasopharynx of mice three weeks after initial colonization (102). Decolonization is associated with an increase in serum IgG against ClfB, IsdA, SasG, and other staphylococcal surface proteins (102). KKAA Immunization of mice with SpA-neutralizing antibodies resulted in increases in pathogen-specific IgG (including anti-ClfB, -IsdA, -SasG, -FnbA, -FnbB, -Coa), which promoted decolonization of S. aureus WU1 (102). Similarly, intraperitoneal administration of the SpA-IgBD-neutralizing mouse monoclonal antibody 3F6 promoted increases in pathogen-specific IgG and secretory IgA, as well as clearance of S. aureus from the nasopharynx and gastrointestinal tract (146). Together, these data suggest that S. aureus colonization is associated with the release of SpA into host tissues and the diversion of B cell responses, allowing the pathogen to persist on mucosal surfaces (102). SpA KKAA Vaccine-induced anti-SpA antibodies block this mechanism by promoting IgG responses against many different secreted staphylococcal antigens, which together reduce S. aureus colonization ( 102 ).

[0143] H. Use of SpA for immunoglobulin and monoclonal antibody (MAb) affinity chromatography

[0144] Recombinant SpA, either full-length or individual domains (E, D, A, B, C), has been widely used as ligands for affinity chromatography purification of monoclonal antibodies (MAbs) (147, 148). Many human MAbs developed for clinical use belong to the V H 3 idiotype IgG1. Recombinant SpA can be expressed by V H 3 variant framework and Fcγ binding to such antibodies (Figures 18 and 19), thus requiring a lower pH (pH 3.1) to elute the MAb from the SpA affinity resin (e.g., MabSelect TM). The use of lower pH values ​​for MAb elution has been associated with antibody unfolding and aggregation (149). In addition, recombinant wild-type SpA is sensitive to alkaline cleavage at Asn-Gly residues, which limits the use of SpA affinity columns in processes that require in situ cleaning with base (≥0.1 M NaOH) to remove contaminating proteins and lipids and kill contaminating microorganisms (147, 149). The Z domain is a synthetic, engineered (derived from idealized sequences of all five IgBDs of SpA) B domain with two amino acid substitutions, Ala 1 Val and Gly 29 Ala (148, 150, 151). The latter amino acid substitution removes the alkali-sensitive Asn 28 -Gly 29 Peptide bond (151, 152). Tandem repeats of two (ZZ), five (ZV), and ten (ZX) Z domains have been shown to bind antibodies and to be used to purify MAbs (130, 150). Gly 29 Ala substitution also reduced the levels of Z, ZZ, and ZZZZ (MabSelectSure TM ) and IgG1 antibody V H 3 framework, thereby lowering the pH required for elution of IgG1 (pH 3.7) (148, 151, 152). 28 -Gly 29 The key is in the naturally alkali-resistant IgBD-C domain (Thr 28 -Gly 29 ) (151). Computational analysis of the free energy change (ΔG) between folded, native and unfolded IgBD-C variants (containing one of eight amino acid substitutions at positions Ser33 or Asp36) was hypothesized to correlate with changes in thermal stability, but this hypothesis was not experimentally verified (149). It was also hypothesized that in silico reduction of ΔG would identify reduced binding to the VH3 variant heavy chain; this hypothesis was also not experimentally verified (149). Furthermore, the hypothesis that in silico predictions would identify the weakest and most stabilizing amino acid substitutions was also not verified (149). Nevertheless, by tandemly repeating five IgBD-C domains, each containing one of the amino acid substitutions Gly29Ala, Ser 33 Glu and Asp 36 Arg, and a mutant Ser with an intermediate ΔG change was selected. 33 Glu and Asp 36Arg was used for experimental studies, resulting in C-G29A.5d, C-S33A.5d, and C-D36A.5d (149). All three proteins, C-G29A.5d, C-S33E.5d, and C-D36A.5d, bound to human IgG with a binding constant K a 3×10 8 M -1 Up to 5×10 8 M -1 (149). The binding constant of wild-type protein A to human IgG is K a 1.4×10 8 M -1 (153). To examine binding to VH3 idiotype IgG, Yoshida et al. used papain treatment to generate Fab fragments from trastuzumab, a VH3 idiotype IgG1 MAb produced in Chinese hamster ovary (CHO) cells that binds to Her2 on certain breast cancer cells (149). The affinity of C-G29A.5d for trastuzumab Fab was determined to be Ka 4.4 × 10 5 M -1 The affinity of C-S33E.5d and C-D36A.5d was reduced by nearly 100 times (Ka 5×10 3 M -1 ), these values ​​are consistent with nonspecific binding ( 149 ).

[0145] Here, the inventors sought to increase SpA KKAA The safety of the vaccine is being evaluated for future clinical testing, particularly by eliminating its VH3 cross-linking activity. SpA IgBD residues Gly29, Ser33, and Asp36 are located at the edge of helix 2, which contacts and establishes critical bonds with VH3 framework residues on human immunoglobulin heavy chains, thereby cross-linking the VH3 idiotypic B cell receptor (138, 154). Early work has been done on developing SpA KKAA Asp 36，37 Therefore, the present inventors focused on the substitution of Gly in each of the five IgBDs of SpA. 29 and Ser 33 The amino acids at the Gln 9 Lys and Gln 10The contribution of Lys to binding to human immunoglobulins in the context of γ-lysine is known to attenuate the binding of SpA to Fcγ (48, 43). The ability of such SpA vaccine constructs to elicit SpA-specific antibodies and generate protection against S. aureus colonization and invasive disease was explored. To assess safety, the inventors analyzed the SpA vaccine candidate in human V in vitro and in vivo preclinical models. H The efficacy of 3 idiotypic IgG in eliciting an allergic response.

[0146] I. Staphylococcal coagulase

[0147] Coagulase is an enzyme produced by Staphylococci that converts fibrinogen into fibrin. h Activates prothrombin in the absence of proteolysis (Friedrich et al., 2003). The coagulase-prothrombin complex recognizes fibrinogen as a specific substrate and converts it directly into fibrin. The crystal structure of the active complex shows that the D1 and D2 domains bind to prothrombin and bind its Ile1-Val 2 Insertion of Ile at the N-terminus 16 Pocket, inducing a functional active site in the zymogen by conformational changes (Friedrich et al., 2003). Exosite I of α-thrombin, the fibrinogen recognition site and exosite I of prothrombin are blocked by D2 of Coa (Friedrich et al., 2003). However, binding of the tetrameric (Coa·prothrombin)2 complex binds fibrinogen at the new site with high affinity (Panizzi et al., 2006). This model explains the clotting properties of coagulase and the efficient fibrinogen conversion of thrombin (Panizzi et al., 2006).

[0148] Fibrinogen is a large glycoprotein (Mr about 340000) composed of three pairs of Aα-, Bβ- and γ-chains covalently linked to form a "dimer of trimers", where A and B represent the fibrinopeptides released by thrombin cleavage (Panizzi et al., 2006). The elongated molecule folds into three independent domains, a central fragment E containing the N-termini of all 6 chains and two flanking fragments D formed mainly by the C-termini of the Bβ and γ chains. These globular domains are connected by long triple helical structures. The coagulase-prothrombin complex converts human fibrinogen into self-polymerizing fibrin that is not targeted by circulating thrombin inhibitors (Panizzi et al., 2006). Thus, staphylococcal coagulase bypasses the physiological blood coagulation pathway.

[0149] All strains of S. aureus secrete coagulase and vWbp (Bjerketorp et al., 2004; Field and Smith, 1945). Although early work reported an important contribution of coagulase to the pathogenesis of staphylococcal infections (Ekstedt and Yotis, 1960; Smith et al., 1947), recent studies using molecular genetic tools have challenged this view by observing the absence of a virulence phenotype in mouse models of endocarditis, skin abscesses, and mastitis (Moreillon et al., 1995; Phonimdaeng et al., 1990). An isogenic variant of S. aureus Newman, a fully virulent clinical isolate (Duthie et al., 1952), was generated, and the coa mutant described herein does exhibit virulence defects in lethal bacteremia and renal abscess models in mice. In the inventors' experience, S. aureus 8325-4 is not fully virulent, and it is speculated that mutational damage in this strain may not reveal virulence defects in vivo. In addition, it was proposed that anti-Coa or vWbp antibodies partially disrupt the pathogenesis of S. aureus Newman infection, reflecting the effect of the gene deletion. Coa and vWbp contribute to the formation of staphylococcal abscesses and fatal bacteremia and may also play a role as protective antigens in subunit vaccines.

[0150] Biochemical studies have demonstrated the biological value of anti-Coa or vWbp antibodies. By binding to the antigen and blocking its binding to coagulation factors, the antibodies prevent the formation of Coa prothrombin and vWbp·prothrombin complexes. Passive transfer studies have revealed the protective effect of Coa and vWbp antibodies in experimental animals against staphylococcal abscess formation and lethal challenge. Challenge Therefore, Coa or vWbp neutralizing antibodies produce immune protection against staphylococcal diseases.

[0151] Early studies revealed that coagulase is required to resist phagocytosis in the blood (Smith et al., 1947), and the inventors observed similar phenotypes of Δcoa mutants in the blood of mice treated with lepirudin (see Example 3 below). Since vWbp has a higher affinity for human prothrombin than its mouse counterpart, it is suspected that the ΔvWbp variants in human blood may also be the case. In addition, the expression of Coa or vWbp in abscess lesions and their significant distribution around eosinophilic pseudocapsules (staphylococcal abscess communities (SAC) or peripheral fibrin walls) indicate that secreted coagulase contributes to the formation of these lesions. This hypothesis has been tested, and in fact, Δcoa mutants are defective in the establishment of abscesses. Corresponding tests (blocking Coa function with specific antibodies) produced the same effect. Therefore, it has been proposed that the coagulation of fibrin is a key event in the establishment of staphylococcal abscesses and can be used as a target for the development of protective vaccines. Due to their overlapping functions on human prothrombin, Coa and vWbp are both considered excellent candidates for vaccine development.

[0152] J. Other Staphylococcal Antigens

[0153] Research over the past few decades has identified S. aureus exotoxins, surface proteins, and regulatory molecules as important virulence factors (Foster, 2005; Mazmanian et al., 2001; Novick, 2003). Much progress has been made in the regulation of these genes. For example, staphylococci conduct bacterial surveys by secreting autoinducing peptides that bind to cognate receptors at threshold concentrations, thereby activating phospho-relay responses and transcriptional activation of many exotoxin genes (Novick, 2003). The pathogenesis of staphylococcal infections depends on these virulence factors (secreted exotoxins, exopolysaccharides, and surface adhesives). The development of staphylococcal vaccines has been hampered by the multifaceted nature of the staphylococcal invasion mechanism. It is well known that live attenuated microorganisms are very effective vaccines; the immune responses elicited by such vaccines are generally greater and last longer than those generated by non-replicating immunogens. One explanation for this may be that live attenuated strains establish limited infections in the host and mimic the early stages of natural infection. Embodiments of the present invention are compositions and methods for reducing or immunizing against infection, including variant SpA polypeptides and peptides and other immunogenic extracellular proteins, polypeptides and peptides (including secreted proteins or peptides and cell surface proteins or peptides) of Gram-positive bacteria. In a specific embodiment, the bacterium is Staphylococcus. Extracellular proteins, polypeptides or peptides include, but are not limited to, secreted proteins and cell surface proteins of target bacteria.

[0154] The human pathogen Staphylococcus aureus secretes two ESAT-6-like proteins, EsxA and EsxB, across the bacterial envelope (Burts et al., 2005, which is incorporated herein by reference). Staphylococcal esxA and esxB are clustered with six other genes in transcription order: esxA esaA essA essB essC esaC esxB. The acronyms esa, ess, and esx stand for ESAT-6 secretion accessory, systemic, and extracellular, respectively, depending on whether the encoded protein plays an auxiliary (esa) or direct (ess) role in secretion, or is secreted (esx) in the extracellular environment. The entire cluster of eight genes is referred to herein as the Ess cluster. EsxA, esxB, essA, essB, and essC are all required for the synthesis or secretion of EsxA and EsxB. Mutants unable to produce EsxA, EsxB, and EssC were defective in the pathogenesis of S. aureus murine abscesses, suggesting that this specialized secretion system could be a general strategy for human bacterial pathogenesis. Several antigens that are non-WXG100 substrates have been reported to be secreted via the ESX-1 pathway, including EspA, EspB, Rv3483c, and Rv3615c (Fortune et al., 2005; MacGurn et al., 2005; McLaughlin et al., 2007; Xu et al., 2007). Another ESX-5 pathway has been shown to secrete both WXG100 and non-WXG100 proteins in pathogenic mycobacteria (Abdallah et al., 2007; Abdallah et al., 2006).

[0155] The S. aureus Ess pathway can be viewed as a secretion module equipped with a specialized transport component (Ess), an auxiliary factor (Esa), and a cognate secretion substrate (Esx). EssA, EssB, and EssC are required for the secretion of EsxA and EsxB. Because EssA, EssB, and EssC are predicted to be transmembrane proteins, it is considered that these proteins form a secretion organization. Some proteins in the ess gene cluster can actively transport secreted substrates (acting as motors), while others may regulate transport (regulators). Regulation can be achieved, but is not limited to, transcriptional or post-translational mechanisms of secreted polypeptides, sorting of specific substrates to defined locations (e.g., extracellular medium or host cells), or the timing of secretion events during infection. At this point, it is unclear whether all secreted Esx proteins function as toxins or contribute indirectly to pathogenesis.

[0156] Staphylococci rely on surface protein-mediated adhesion to host cells or invasion of tissues to evade immune defenses. In addition, S. aureus uses surface proteins to chelate iron from the host during infection. Most surface proteins involved in staphylococcal pathogenesis carry C-terminal sorting signals, i.e., they are covalently linked to the cell wall outer membrane by sortases. In addition, staphylococcal strains lacking the genes required for surface protein anchoring, i.e., sortases A and B, exhibit significant virulence defects in several different mouse models of the disease. Therefore, surface protein antigens represent a validated vaccine target, as the corresponding genes are essential for the development of staphylococcal disease and can be utilized in various embodiments of the present invention. The sortase superfamily is a Gram-positive transpeptidase responsible for anchoring surface protein virulence factors to the peptidoglycan cell wall layer. Two sortase isoforms, SrtA and SrtB, have been identified in S. aureus. These enzymes have been shown to recognize the LPXTG motif in substrate proteins. The SrtB isoform appears to be important for the acquisition of heme iron and iron homeostasis, while the SrtA isoform plays a key role in the pathogenesis of Gram-positive bacteria by regulating the ability of bacteria to adhere to host tissues through the covalent anchoring of adhesins and other proteins to the cell wall peptidoglycan. In certain embodiments, the SpA variants described herein can be used in combination with other Staphylococcal proteins, such as Coa, Eap, Ebh, Emp, EsaC, EsaB, EsxA, EsxB, Hla, SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, IsdC, SasF, vWbp and / or vWh proteins.

[0157] Certain aspects of the invention include methods and compositions involving protein compositions, including polypeptides, peptides or nucleic acids encoding SpA variants and other Staphylococcal antigens, such as other proteins or sortase substrates transported through the Ess pathway. These proteins can be modified by deletion, insertion and / or substitution.

[0158] Esx polypeptides include amino acid sequences of Esx proteins from Staphylococcus bacteria. The Esx sequence can be from a specific Staphylococcus species, such as Staphylococcus aureus, and can be from a specific strain, such as Newman. In certain embodiments, the EsxA sequence is SAV0282 from strain Mu50 (which is identical to the amino acid sequence of Newman) and can be accessed using Genbank Accession No. Q99WU4 (gi|68565539), which is incorporated herein by reference. In other embodiments, the EsxB sequence is SAV0290 from strain Mu50 (which is identical to the amino acid sequence of Newman) and can be accessed using Genbank Accession No. Q99WT7 (gi|68565532), which is incorporated herein by reference. In additional embodiments, other polypeptides transported by the Ess pathway can be used, the sequences of which can be identified by those skilled in the art using databases and Internet accessible resources.

[0159] Sorting enzyme substrate polypeptides include, but are not limited to, amino acid sequences of SdrC, SdrD, SdrE, IsdA, IsdB, ClfA, ClfB, IsdC, or SasF proteins from Staphylococcus bacteria. The sorting enzyme substrate polypeptide sequence can be from a specific Staphylococcus species, such as Staphylococcus aureus, and can be from a specific strain, such as Newman. In certain embodiments, the SdrD sequence is from strain N315 and can be accessed using Genbank Accession No. NP_373773.1 (gi|15926240), which is incorporated by reference. In other embodiments, the SdrE sequence is from strain N315 and can be accessed using Genbank Accession No. NP_373774.1 (gi|15926241), which is incorporated by reference. In other embodiments, the IsdA sequence is from SAV1130 of strain Mu50 (which is identical to the amino acid sequence of Newman) and can be accessed using Genbank Accession No. NP_371654.1 (gi|15924120), which is incorporated by reference. In other embodiments, the IsdB sequence is from SAV1129 of strain Mu50 (which is identical to the amino acid sequence of Newman) and can be accessed using Genbank Accession No. NP_371653.1 (gi|15924119), which is incorporated by reference. In additional embodiments, other polypeptides transported by the Ess pathway or processed by sortase can be used, the sequences of which can be identified by those skilled in the art using databases and internet accessible resources.

[0160] Examples of various proteins that can be used in the context of the present invention can be identified by analyzing database submissions of bacterial genomes, including but not limited to accession numbers NC_002951 (GI: 57650036 and GenBank CP000046), NC_002758 (GI: 57634611 and GenBank BA000017), NC_002745 (GI: 29165615 and GenBank BA000018), NC_003923 (GI: 21281729 and GenBank BA000033), NC_002952 (GI: 49482253 and GenBank BX571856), NC_002953 (GI: 49484912 and GenBank BX571857), NC_007793 (GI: 87125858 and GenBank CP000255), NC_007795 (GI: 87201381 and GenBank CP000253), each of which is incorporated by reference.

[0161] As used herein, "protein" or "polypeptide" refers to a molecule comprising at least ten amino acid residues. In certain embodiments, the wild-type form of the protein or polypeptide is used, however, in many embodiments of the present invention, a modified protein or polypeptide is used to generate an immune response. The above terms can be used interchangeably. "Modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, is changed relative to the wild-type protein or polypeptide. In certain embodiments, the modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide can have multiple activities or functions). It is particularly contemplated that a modified / variant protein or polypeptide may be altered in one activity or function while retaining the wild-type activity or function in other aspects such as immunogenicity.

[0162] In certain embodiments, the size of a protein or polypeptide (wild type or modified) can include, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 0, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 6 00, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 amino molecules or more than 2500 amino molecules, and any range derivable therefrom, or derivatives of the corresponding amino sequences described or referenced herein. It is contemplated that polypeptides can be mutated by truncation, making them shorter than their corresponding wild-type forms, but can also be altered by fusion or conjugation to foreign protein sequences having specific functions (e.g., for targeting or localization, for enhancing immunogenicity, for purification purposes, etc.).

[0163] As used herein, "amino molecule" refers to any amino acid, amino acid derivative, or amino acid mimetic known in the art. In certain embodiments, the residues of a protein molecule are continuous, without any non-amino molecule interrupting the sequence of amino molecule residues. In other embodiments, the sequence may contain one or more than one non-amino molecule moiety. In a specific embodiment, the sequence of residues of a protein molecule may be interrupted by one or more than one non-amino molecule moiety.

[0164] Thus, the term "protein composition" includes naturally synthesized proteins whose amino acid molecule sequence comprises at least one of the 20 common amino acids or at least one modified or unusual amino acid.

[0165] Protein compositions can be prepared by any technique known to those skilled in the art, including (i) expression of proteins, polypeptides or peptides by standard molecular biology techniques, (ii) isolation of protein compounds from natural sources, or (iii) chemical synthesis of protein materials. Currently, nucleotide and protein, polypeptide and peptide sequences of various genes have been published and can be found in recognized computer databases. One such database is the Genbank and GenPept databases of the National Center for Biotechnology Information (ncbi.nlm.nih.gov / on the World Wide Web). The coding regions of these genes can be amplified and / or expressed using techniques disclosed herein or known to those of ordinary skill in the art.

[0166] The amino acid sequence variants of SpA, coagulase and other polypeptides of the present invention may be substitution variants, insertion variants or deletion variants. Compared to the wild type, the variants of the polypeptides of the present invention may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more than 50 non-continuous or continuous amino acids of the polypeptide. Variants may comprise an amino acid sequence that is at least 50%, 60%, 70%, 80% or 90% identical to any sequence provided or referenced herein, e.g., SEQ ID NOs: 2-8 or SEQ ID NOs: 11-30, (including all values ​​and ranges therebetween), and variants may include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 replacement amino acids. Polypeptides or other surface proteins processed or secreted by the Ess pathway (see Table 1) or sortase substrates from any Staphylococcus species and strains are contemplated using the compositions and methods described herein.

[0167] Deletion variants generally lack one or more than one natural or wild-type protein residue. Single residues can be deleted or many consecutive amino acids can be deleted. Stop codons can be introduced (by substitution or insertion) into the encoding nucleic acid sequence to produce truncated proteins. Insertion mutants generally involve adding substances to the non-terminal end of the polypeptide. This can include inserting one or more than one residue. Terminal additions called fusion proteins can also be produced. These fusion proteins include polymers or concatemers of one or more than one peptide or polypeptide described or mentioned herein.

[0168] Substitution variants generally contain an exchange of one amino acid with another amino acid at one or more than one site within a protein, and can be designed to modulate one or more than one property of a polypeptide, with other functions or properties retained or lost. The substitution can be conservative, i.e., one amino acid is replaced by an amino acid with a similar shape and charge. Conservative substitutions are well known in the art and include, for example, the following changes: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glutamine to asparagine; glutamic acid to aspartic acid; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, the substitution may be non-conservative, thereby affecting the function or activity of the polypeptide. Non-conservative changes generally involve replacing a residue with a chemically different residue, such as replacing a non-polar or uncharged amino acid with a polar or charged amino acid, or vice versa.

[0169] Table 10 Exemplary surface proteins of Staphylococcus aureus strains.

[0170] SAV# SA# Surface proteins MW2 Mu50 N315 Newman MRSA252* MSSA476* SAV0111 SA0107 Spa 492 450 450 520 516 492 SAV2503 SA2291 FnBPA 1015 1038 1038 741 - 1015 SAV2502 SA2290 FWf 943 961 961 677 965 957 SAV0811 SA0742 AHr 946 935 989 933 1029 928 SAV2630 SA2423 Bf 907 877 877 913 873 905 Np Np Cn 1183 - - - 1183 1183 SAV0561 SA0519 SqF 955 953 953 947 906 957 SAV0562 SA0520 SdN 1347 1385 1385 1315 - 1365 SAV0563 SA0521 SqF 1141 1141 1141 1166 1137 1141 Np Np Pls - - - - - - SAV2654 SA2447 SsaA 2275 2271 2271 2271 1351 2275 SAV2160 SA1964 SaB 686 2481 2481 2481 2222 685 SA1577 SsaC 2186 213 2186 2186 2189 2186 SAV0134 SA0129 SdN 241 241 241 241 221 241 SAV1130 SA0977 SasE / IsdA 350 350 350 350 354 350 SAV2646 SA2439 Sf 635 635 635 635 627 635 SAV2496 SSG 1371 525 927 - - 1371 SAV0023 SA0022 SsA 772 - 772 772 786 786 SAV1731 SA1552 S i 895 891 891 891 534 895 SAV1129 SA0976 SasJ / IsdB 645 645 645 645 652 645 SA2381 S K 198 211 211 - - 197 Np S L - 232 - - - - SAV1131 SA0978 IsdC 227 227 227 227 227 227

[0171] The proteins of the present invention may be recombinant or synthesized in vitro. Alternatively, non-recombinant or recombinant proteins may be isolated from bacteria. It is also contemplated that bacteria containing such variants may be implemented in the compositions and methods of the present invention. Thus, there is no need to isolate the protein.

[0172] The term "functionally equivalent codons" as used herein relates to codons encoding the same amino acid, such as the six codons for arginine or serine, and also refers to codons encoding biologically equivalent amino acids (see Table 11 below).

[0173] Table 11 Codon table

[0174]

[0175] It is also understood that amino acid and nucleic acid sequences may include other residues, such as other N-terminal or C-terminal amino acids, or 5' or 3' sequences, respectively, but still be substantially as listed below one of the sequences disclosed herein, as long as the sequence meets the above criteria, including the maintenance of biological protein activity (e.g., immunogenicity) involved in protein expression. The addition of terminal sequences is particularly applicable to nucleic acid sequences, for example, which can include various non-coding sequences located on both sides of the coding region 5' or 3'.

[0176] The following is a discussion based on changing the amino acids of a protein to produce a variant polypeptide or peptide. For example, certain amino acids can replace other amino acids in the protein structure, regardless of whether the ability to interact with the structure is significantly lost, such as the antigen binding region of an antibody or the binding site on a substrate molecule. Since the interaction ability and properties of a protein determine the functional activity of the protein, certain amino acid substitutions can be made in the protein sequence and its underlying DNA coding sequence, but still produce a protein with the desired properties. Therefore, the inventors consider that various changes can be made in the DNA sequence of a gene.

[0177] It is contemplated that in the compositions of the present invention, there is about 0.001 mg to about 10 mg of total polypeptide, peptide and / or protein per mL. The concentration of protein in the composition can be about, at least about, or at most about 0.001 mg / mL, 0.010 mg / mL, 0.050 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1.0 mg / mL, 1.5 mg / mL, 2.0 mg / mL, 2. 0 mg / mL, 5 mg / mL, 3.0 mg / mL, 3.5 mg / mL, 4.0 mg / mL, 4.5 mg / mL, 5.0 mg / mL, 5.5 mg / mL, 6.0 mg / mL, 6.5 mg / mL, 7.0 mg / mL, 7.5 mg / mL, 8.0 mg / mL, 8.5 mg / mL, 9.0 mg / mL, 9.5 mg / mL, 10.0 mg / mL or more (or any range derivable therefrom). 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, %, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% can be SpA variants or coagulase and can be used in combination with other peptides or polypeptides (e.g., other bacterial peptides and / or antigens).

[0178] The present invention contemplates administration of variant SpA polypeptides or peptides to achieve a prophylactic therapy or therapeutic effect against the development of a disease or condition associated with infection with a Staphylococcal pathogen.

[0179] In certain aspects, combinations of staphylococcal antigens are used to produce immunogenic compositions that are effective in treating or preventing staphylococcal infections. Staphylococcal infections go through several different stages. For example, the staphylococcal life cycle involves symbiotic colonization, infection initiation by contact with adjacent tissues or bloodstream and / or anaerobic growth in the blood. Interactions between staphylococcal virulence determinants and host defense mechanisms can induce complications such as endocarditis, metastatic abscess formation, and sepsis syndrome. Different molecules on the surface of bacteria are involved in different steps of the infection cycle. Combinations of certain antigens can elicit an immune response that prevents multiple stages of staphylococcal infection. The effectiveness of the immune response can be tested in animal model experiments and / or using opsonophagocytosis assays.

[0180] K. Polypeptides and Preparation of Polypeptides

[0181] The present invention describes polypeptides, peptides and proteins and immunogenic fragments thereof for use in various embodiments of the present invention. For example, a particular polypeptide is determined or used to elicit an immune response. In a particular embodiment, all or part of the protein of the present invention may also be synthesized in solution or on a solid support according to conventional techniques. Various automatic synthesizers are commercially available and may be used according to known methods. For example, see Stewart and Young (1984); Tam et al., (1983); Merrifield (1986); and Barany and Merrifield (1979), each of which is incorporated herein by reference.

[0182] Alternatively, recombinant DNA technology may be used, wherein a nucleotide sequence encoding the peptide of the present invention is inserted into an expression vector, transformed or transfected into a suitable host cell and cultured under conditions suitable for expression.

[0183] One embodiment of the present invention includes gene transfer to cells, including microorganisms, to produce and / or present polypeptides or peptides. The gene for the polypeptide or peptide of interest can be transferred to a suitable host cell, and the cells are then cultured under suitable conditions. The preparation of recombinant expression vectors and the elements contained therein are well known in the art and are briefly discussed herein. Alternatively, the protein to be prepared can be an endogenous protein that is typically synthesized by cells that are isolated and purified.

[0184] Another embodiment of the present invention uses autologous B lymphocyte cell line, and this cell line is more specifically expressed by the viral vector transfection of expressing immunogenic product, and expresses the protein with immunogenic activity.Other examples of mammalian host cell line include but are not limited to Vero and HeLa cells, other B and T cell lines, such as CEM, 721.221, H9, Jurkat, Raji and Chinese hamster ovary cell line, W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cells.In addition, can select to regulate the host cell strain of insert sequence expression or modify and process gene product in the desired manner.This type of modification (for example, glycosylation) and processing (for example, cutting) of protein product can be important for the function of protein.Different host cells have characteristic and specific mechanism for post-translational processing and modification of protein.Suitable cell line or host system can be selected to ensure the correct modification and processing of the exogenous protein expressed.

[0185] A variety of selection systems can be used, including but not limited to the HSV thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase, and adenine phosphoribosyltransferase genes in tk-, hgprt-, or aprt- cells, respectively. In addition, antimetabolite resistance can be used as the basis for selection: for dhfr, it confers resistance to trimethoprim and methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G418; and hygro, which confers resistance to hygromycin.

[0186] Animal cells can be propagated in vitro in two ways: as anchorage-independent cells that grow in suspension throughout culture, or as anchorage-dependent cells that require attachment to a solid substrate for propagation (i.e., monolayer cell growth type).

[0187] Anchorage-independent or suspension cultures from continuously established cell lines are the most widely used means for large-scale production of cells and cell products. However, cells grown in suspension have limitations, such as potential tumorigenicity and lower protein yields than adherent cells.

[0188] Where proteins are specifically mentioned herein, reference is preferably made to natural or recombinant proteins or to proteins in which any signal sequence has been removed, as appropriate. Proteins may be isolated directly from staphylococcal strains or produced by recombinant DNA techniques. Immunogenic fragments of proteins may be incorporated into the immunogenic compositions of the invention. These are fragments comprising at least 10 amino acids, 20 amino acids, 30 amino acids, 40 amino acids, 50 amino acids or 100 amino acids (including all values ​​and ranges therebetween) obtained continuously from the amino acid sequence of the protein. In addition, such immunogenic fragments are immunoreactive with antibodies produced against staphylococcal proteins or with antibodies produced by staphylococcal infection of mammalian hosts. Immunogenic fragments also include protective or therapeutic immune responses against staphylococcal infections when administered in an effective dose (alone or as a hapten in combination with a carrier), and in some aspects, it is capable of preventing infections with Staphylococcus aureus and / or Staphylococcus epidermidis. Such immunogenic fragments may include, for example, proteins lacking an N-terminal leader sequence and / or a transmembrane domain and / or a C-terminal anchoring domain. In a preferred aspect, an immunogenic fragment according to the invention comprises substantially all of the extracellular domains of a protein having at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, or at least 97% to 99% identity (including all values ​​and ranges therebetween) to a sequence selected fragment of a polypeptide described or referenced herein.

[0189] The immunogenic compositions of the present invention also include fusion proteins composed of one or more than one staphylococcal protein or immunogenic fragment of a staphylococcal protein. Such fusion proteins can be recombinantly prepared and can include a portion of at least 1, 2, 3, 4, 5 or 6 staphylococcal proteins or fragments. Alternatively, the fusion protein may include multiple portions of at least 1, 2, 3, 4 or 5 staphylococcal proteins. These can combine different staphylococcal proteins and / or multiple of the same protein or protein fragment, or immunogenic fragments in the same protein (forming multimers or concatemers). Alternatively, the present invention also includes individual fusion proteins of staphylococcal proteins or immunogenic fragments thereof as fusion proteins with heterologous sequences, such as providers of T cell epitopes or purification tags, for example: β-galactosidase, glutathione-S-transferase, green fluorescent protein (GFP), epitope tags such as FLAG, myc tags, polyhistidine, or viral surface proteins such as influenza virus hemagglutinin, or bacterial proteins such as tetanus toxoid, diphtheria toxoid, or CRM197.

[0190] II. Nucleic Acids

[0191] In certain embodiments, the invention relates to recombinant polynucleotides encoding proteins, polypeptides, peptides of the invention, including nucleic acid sequences of SpA, coagulase and other bacterial proteins, all of which are incorporated herein by reference, and can be used to prepare peptides or polypeptides.

[0192] As used in the present application, the term "polynucleotide" refers to a recombinant or isolated nucleic acid molecule that does not contain total genomic nucleic acid. The term "polynucleotide" includes oligonucleotides (nucleic acids less than or equal to 100 residues in length), recombinant vectors (including, for example, plasmids, cosmids, phages, viruses, etc.). In some aspects, polynucleotides include regulatory sequences that are substantially separated from their naturally occurring genes or protein coding sequences. Polynucleotides can be single-stranded (coding or antisense) or double-stranded, and can be RNA, DNA (genomic, cDNA or synthetic), its analogs or combinations thereof. Other coding or non-coding sequences can be, but not necessarily, in polynucleotides.

[0193] In this regard, the term "gene", "polynucleotide" or "nucleic acid" is used to refer to a nucleic acid that encodes a protein, polypeptide or peptide (including correct transcription, post-translational modification, or localization). As will be understood by those skilled in the art, the term includes genomic sequences, expression components, cDNA sequences, and smaller engineered nucleic acid fragments that express or may be suitable for expressing proteins, polypeptides, domains, peptides, fusion proteins and mutants. A nucleic acid encoding all or part of a polypeptide may comprise the following contiguous nucleic acid sequence: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 301, 312, 323, 334, 345, 350, 360, 370, 380, 391, 401, 413, 424, 436, 447, 458, 461, 472, 483, 491, 501, 521, 530, 541, 550, 561, 572, 584, 595, 601, 613, 624, 635, 640, 651, 661, 673, 684, 696, 707, 718, 729, 730, 741, 751, 761, 774, 785, 0, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650 , 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 10 20, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000 or more than 10000 nucleotides, nucleosides or base pairs, including all values ​​and ranges therebetween. It is also contemplated that a particular polypeptide may be encoded by a nucleic acid containing variants having slightly different nucleic acid sequences, but still encoding the same or substantially similar proteins (see Table 11 above)

[0194] In particular embodiments, the invention relates to isolated nucleic acid fragments and recombinant vectors incorporating nucleic acid sequences encoding variant SpA or coagulase. The term "recombinant" may be used in conjunction with a polynucleotide or polypeptide, and generally refers to a polypeptide or polynucleotide produced and / or manipulated in vitro, or a replicated product of such a molecule.

[0195] In other embodiments, the invention relates to isolated nucleic acid fragments and recombinant vectors comprising nucleic acid sequences encoding variant SpA or coagulase polypeptides or peptides for generating an immune response in a subject. In various embodiments, the nucleic acids of the invention can be used in genetic vaccines.

[0196] The nucleic acid fragments used in the present invention can be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding fragments, etc., so that their total length can be greatly different. It is therefore contemplated that nucleic acid fragments of almost any length can be used, and the total length is preferably limited by the ease of preparation and use in the recombinant nucleic acid scheme under consideration. In some cases, the nucleic acid sequence can encode a polypeptide sequence with an additional heterologous coding sequence, such as to allow purification, transport, secretion, post-translational modification of the polypeptide, or for therapeutic benefit (e.g., targeting or effectiveness). As described above, a tag or other heterologous polypeptide can be added to the modified polypeptide coding sequence, wherein "heterologous" refers to a polypeptide different from the modified polypeptide.

[0197] In certain other embodiments, the present invention relates to isolated nucleic acid fragments and recombinant vectors that include in their sequence a nucleotide sequence from SEQ ID NO: 2 (SpA domain D) or SEQ ID NO: 4 (SpA) or any other nucleotide sequence encoding a coagulase or other secreted virulence factor and / or surface protein, including proteins transported by the Ess pathway, proteins processed by sortase, or proteins incorporated herein by reference.

[0198] In certain embodiments, the invention provides polynucleotide variants having substantial identity to the sequences disclosed herein; sequences comprising at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more sequence identity, including all values ​​and ranges therebetween, compared to the polynucleotide sequences of the invention using the methods described herein (e.g., BLAST analysis using standard parameters).

[0199] The present invention also contemplates the use of polynucleotides that are complementary to all of the above-mentioned polynucleotides.

[0200] A. Carrier

[0201] The polypeptides of the present invention may be encoded by a nucleic acid molecule contained in a vector. The term "vector" is used to refer to a carrier nucleic acid molecule that can insert a heterologous nucleic acid sequence into a cell for replication and expression. The nucleic acid sequence can be "heterologous", which means that it is foreign to the environment of the cell into which the vector is introduced or the nucleic acid into which it is incorporated, including sequences or nucleic acids that are homologous to sequences in the cell, but are in a location within the host cell or nucleic acid that is not normally found. Vectors include DNA, RNA, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). Those skilled in the art will have the ability to construct vectors by standard recombinant techniques (e.g., Sambrook et al., 2001; Ausubel et al., 1996, all incorporated herein by reference). In addition to encoding variant SpA polypeptides, vectors may also encode other polypeptide sequences, such as one or more than one other bacterial peptides, tags, or immunogenicity enhancing peptides. Useful vectors encoding such fusion proteins include the pIN vector (Inouye et al., 1985), vectors encoding a series of histidines, and the pGEX vector for production of glutathione S-transferase (GST) soluble fusion proteins for later purification and isolation or cleavage.

[0202] The term "expression vector" refers to a vector containing a nucleic acid sequence that encodes at least a portion of a gene product that is capable of transcription. In some cases, the RNA molecule is subsequently translated into a protein, polypeptide or peptide. An expression vector may contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possible translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that control transcription and translation, vectors and expression vectors may also contain nucleic acid sequences that have other functions and are described herein.

[0203] 1. Promoters and enhancers

[0204] A "promoter" is a control sequence. A promoter is typically a region of a nucleic acid sequence that controls the initiation of transcription and the rate of transcription. It may contain genetic elements to which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors. The phrases "operably positioned," "operably linked," "under control," and "under transcriptional control" refer to a promoter that is in the correct functional position and / or orientation relative to a nucleic acid sequence to control the initiation of transcription and expression of the sequence. A promoter may or may not be used with an "enhancer," which refers to a cis-acting regulatory sequence that is involved in the transcriptional activation of a nucleic acid sequence.

[0205] Of course, it can be important to use promoters and / or enhancers that effectively direct the expression of the DNA fragment in the cell type or organism selected for expression. Those skilled in the art of molecular biology are generally aware of the use of promoters, enhancers, and cell type combinations for protein expression (see Sambrook et al., 2001, incorporated herein by reference). The promoter employed can be constitutive, tissue-specific, or inducible, and in certain embodiments can direct high-level expression of the introduced DNA fragment under specific conditions, such as large-scale production of recombinant proteins or peptides.

[0206] Various elements / promoters can be used in the context of the present invention to regulate the expression of genes. Examples of such inducible elements are regions of nucleic acid sequences that can be activated in response to specific stimuli, including but not limited to immunoglobulin heavy chains (Banerji et al., 1983; Gilles et al., 1983; Grosschedl et al., 1985; Atchinson et al., 1986, 1987; ImLer et al., 1987; Weinberger et al., 1984; Kiledjian et al., 1988; Porton et al.; 1990), immunoglobulin light chains (Queen et al., 1983; Picard et al., 1990), et al., 1984), T cell receptor (Luria et al., 1987; Winoto et al., 1989; Redondo et al., 1990), HLA-DQα and / or DQβ (Sullivan et al., 1987), interferon-β (Goodbourn et al., 1986; Fujita et al., 1987; Goodbourn et al., 1988), interleukin-2 (Greene et al., 1989), interleukin-2 receptor (Greene et al., 1989; Lin et al., 1990), MHC class II 5 (Koch et al., 1989), MHC Class II HLA-DRα (Sherman et al., 1989), β-actin (Kawamoto et al., 1988; Ng et al., 1989), muscle creatine kinase (MCK) (Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989), prealbumin (transthyretin) (Costa et al., 1988), elastase I (Ornitz et al., 1987), metallothionein (MTII) (Karin et al., 1987; Culott et al., 1988). a et al., 1989), collagenase (Pinkert et al., 1987; Angel et al., 1987), albumin (Pinkert et al., 1987; Tronche et al., 1989, 1990), α-fetoprotein (Godbout et al., 1988; Campere et al., 1989), γ-globin (Bodine et al., 1987; Perez-Stable et al., 1990), β-globin (Trudel et al., 1987), proto-oncogenes (Cohen et al., 1987), Oncogene(Triesman, 1986; Deschamps et al., 1985), insulin (Edlund et al., 1985), neural cell adhesion molecule (NCAM) (Hirsh et al., 1990), α1-antitrypsin (Latimer et al., 1990), H2B (TH2B) histone (Hwang et al., 1990), mouse and / or type I collagen (Ripe et al., 1989), glucose-regulated proteins (GRP94 and GRP78) (Chang et al., 1989), rat growth hormone (Larsen et al., 1986), human serum amyloid A (SAA) (Edbrooke et al., 1989), troponin I (TN) ( I) (Yutzey et al., 1989), platelet-derived growth factor (PDGF) (Pech et al., 1989), Duchenne muscular dystrophy (Klamut et al., 1990), simian vacuolating virus 40 (Banerji et al., 1981; Moreau et al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbra et al., 1986; Kadesch et al., 1986); Wang et al., 1986; Ondek et al., 1987; Kuhl et al., 1987; Schaffner et al., 1988), polyoma virus (Swartzendruber et al., 1975; Vasseur et al., 1980; Katinka et al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell et al., 1988), retroviruses (Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Bosze et al., 1986; Miksicek et al., 1986; Celander et al., 1987; Thiesen et al., 1988; Celander et al., 1988 ; Choi et al., 1988; Reisman et al., 1989), papillomavirus (Campo et al., 1983; Lusky et al., 1983; Spandidos and Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987); Hirochika et al., 1987; Stephens et al., 1987); hepatitis B virus (Bulla et al., 1986; Jameel et al., 1986;Shaul et al., 1987; Spandau et al., 1988; Vannice et al., 1988); human immunodeficiency virus (Muesing et al., 1987; Hauber et al., 1988; Jakobovits et al., 1988; Feng et al., 1988; Takebe et al., 1988; Rosen et al., 1988; Berkhout 1989; Laspia et al., 1989; Sharp et al., 1989; Braddock et al., 1989); cytomegalovirus (CMV) IE (Weber et al., 1984; Boshart et al., 1985; Foecking et al., 1986); gibbon ape leukemia virus (Holbrook et al., 1987; Quinn et al., 1989). ;

[0207] Inducing factors include, but are not limited to, MT II-phorbol ester (TFA) / heavy metals (Palmiter et al., 1982; Haslinger et al., 1985; Searle et al., 1985; Stuart et al., 1985; Imagawa et al., 1987, Karin et al., 1987; Angel et al., 1987b; McNeall et al., 1989); MMTV (mouse mammary tumor virus)-glucocorticoids (Huang et al., 1981; Lee et al., 1981; Majors et al., 1983; Chandler et al., 1983; Lee et al., 1984; Ponta et al., 1985; Sakai et al., 1988); beta-interferon-poly (rI) x / poly (rc) (Tavernier et al., 1983); adenovirus 5E2-E1A (Imperiale et al., 1984); collagenase-phorbol ester (TPA) (Angel et al., 1987a); mitogen phorbol ester (TPA) (Angel et al., 1987b); simian vacuolating virus 40-phorbol ester (TPA) (Angel et al., 1987b); mouse MX gene-interferon, Newcastle disease virus (Hug et al., 1988); GRP78 gene-A23187 (Resendez et al., 1988) α-2-macroglobulin-IL-6 (Kunz et al., 1989); vimentin-serum (Rittling et al., 1989); MHC Class I gene H-2 b - interferon (Blanar et al., 1989); HSP70 - ElA / SV40 large T antigen (Taylor et al., 1989, 1990a, 1990b); proliferative factor - phorbol ester / TPA (Mordacq et al., 1989); tumor necrosis factor - PMA (Hensel et al., 1989); and thyrotropin alpha gene - thyroid hormone (Chatterjee et al., 1989).

[0208] It is believed that the specific promoter used to control the expression of the polynucleotide encoding the peptide or protein of the present invention is not critical, it is capable of expressing the polynucleotide in the target cell, preferably in a bacterial cell. When targeting human cells, it is preferred that the polynucleotide coding region is placed near and controlled by a promoter capable of expression in human cells. Generally speaking, such promoters can include bacterial, human or viral promoters.

[0209] In embodiments where a vector is administered to a subject to express a protein, it is contemplated that an ideal promoter for use with the vector is one that is not down-regulated by cytokines or, even if down-regulated, is sufficiently strong that it produces an effective amount of variant SpA to elicit an immune response. Examples of these non-limiting examples are CMV IE and RSV LTR. Tissue-specific promoters may be used, particularly when expression is in cells where antigen expression is desired, such as dendritic cells or macrophages. Mammalian MHC I and MHC II promoters are examples of such tissue-specific promoters.

[0210] 2. Initiation signal and internal ribosome binding site (IRES)

[0211] The effective translation of the coding sequence may also require a specific start signal. These signals include the ATG start codon or adjacent sequences. It may be necessary to provide an exogenous translation control signal, including the ATG start codon. One of ordinary skill in the art will be able to easily determine this and provide the necessary signals.

[0212] In certain embodiments of the present invention, internal ribosome entry site (IRES) elements are used to generate multi-gene or multi-cistronic information. IRES elements can bypass the ribosome scanning model of 5' methylated Cap-dependent translation and start translation at internal sites (Pelletier and Sonenberg, 1988; Macejak and Sarnow, 1991). IRES elements can be connected to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, to create multi-cistronic information. Using a single promoter / enhancer to transcribe a single message can effectively express multiple genes (see U.S. Patents 5925565 and 5935819, incorporated herein by reference).

[0213] 3. Selectable and filterable markers

[0214] In certain embodiments of the present invention, cells containing nucleic acid constructs of the present invention can be identified in vitro or in vivo by encoding screening or selectable markers in expression vectors. When transcribed and translated, the markers confer recognizable changes to the cells, allowing easy identification of cells containing expression vectors. Usually, selectable markers are markers that confer properties that allow selection. Positive selection markers are markers in which the presence of markers allows its selection, and negative selection markers are markers in which its presence prevents its selection. An embodiment of a positive selection marker is a drug resistance marker.

[0215] B. Host Cells

[0216] As used herein, the terms "cell," "cell line," and "cell culture" are used interchangeably. All of these terms also include their progeny, i.e., any and all progeny. It is understood that all progeny may not be identical due to intentional or unintentional mutations. In the context of expressing heterologous nucleic acid sequences, "host cell" refers to a prokaryotic or eukaryotic cell, including any transformable organism capable of replicating a vector or expressing a heterologous gene encoded by a vector. Host cells can and have been used as receptors for vectors or viruses. Host cells can be "transfected" or "transformed," which refers to the process by which exogenous nucleic acids, (e.g., recombinant protein coding sequences,) are transferred or introduced into host cells. Transformed cells include the primary subject cell and its progeny.

[0217] Host cells can be derived from prokaryotes or eukaryotes, including bacteria, yeast cells, insect cells, and mammalian cells, for replication of the vector or expression of part or all of the nucleic acid sequence. Many cell lines and cultures can be used as host cells, which can be obtained through the American Type Culture Collection (ATCC), an organization that serves as an archive of living cultures and genetic materials ( www.atcc.org ).

[0218] C. Expression System

[0219] There are a variety of expression systems comprising at least part or all of the above compositions. Prokaryotic and / or eukaryotic systems can be used together with the present invention to produce nucleic acid sequences, or their homologous polypeptides, proteins and peptides. Many such systems are widely used commercially.

[0220] Insect cell / baculovirus systems can produce high levels of protein expression of heterologous nucleic acid fragments, such as described in U.S. Pat. Nos. 5,871,986 and 4,879,236, both of which are incorporated herein by reference, and are available from and BACPACK TM BACULOVIRUS EXPRESSION SYSTEM FROM by 2.0 Name Purchase.

[0221] In addition to the expression system disclosed in the present invention, other embodiments of the expression system include A COMPLETE CONTROL inducible mammalian expression system, which involves a synthetic ecdysone inducible receptor, or a pET expression system, which is an E. coli expression system. Another embodiment of the inducible expression system can be obtained from It carries the T-REXTM (tetracycline regulated expression) system, an inducible mammalian expression system that uses the full-length CMV promoter. A yeast expression system, called the Pichia methanolica expression system, is also provided, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia pastoris. One skilled in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein or peptide.

[0222] III. Polysaccharides

[0223] The immunogenic compositions of the invention may also comprise capsular polysaccharides, including one or more than one PIA (also known as PNAG) and / or S. aureus type V and / or type VIII capsular polysaccharides and / or S. epidermidis type I and / or type II and / or type III capsular polysaccharides.

[0224] A.PIA(PNAG)

[0225] It is now clear that the various forms of staphylococcal surface polysaccharides identified as PS / A, PIA and SAA are the same chemical entity - PNAG (Maira-Litran et al., 2004). Therefore, the term PIA or PNAG includes all of these polysaccharides or oligosaccharides derived from them.

[0226] PIA is a polysaccharide intercellular adhesin composed of β-(1→6)-linked glucosamine polymers substituted with N-acetyl and O-succinyl components. This polysaccharide is present in Staphylococcus aureus and Staphylococcus epidermidis and can be isolated from either source (Joyce et al., 2003; Maira-Litran et al., 2002). For example, PNAG can be isolated from Staphylococcus aureus strain MN8m (WO04 / 43407). PIA isolated from Staphylococcus epidermidis is a component of biofilms. It is responsible for mediating intercellular adhesion and can also play a role in protecting growing colonies from host immune responses. The polysaccharide formerly known as poly-N-succinyl-β-(1→6)-glucosamine (PNSG) was recently shown not to have the expected structure because the identification of N-succinylation was incorrect (Maira-Litran et al., 2002). Therefore, the polysaccharide formally known as PNSG and now found to be PNAG is also included in the term PIA.

[0227] The size of PIA (or PNAG) can vary from greater than 400 kDa to between 75 kDa and 400 kDa, to between 10 kDa and 75 kDa to oligosaccharides consisting of up to 30 repeating units (β-(1→6) linked glucosamine is replaced by N-acetyl and O-succinyl components). Any size of PIA polysaccharide or oligosaccharide can be used in the immunogenic composition of the present invention. In one aspect, the polysaccharide is greater than 40 kDa. The size can be adjusted by any method known in the art, such as by microfluidization, ultrasonic radiation or by chemical cleavage (WO 03 / 53462, EP497524, EP497525). In certain aspects, PIA (PNAG) is at least or at most 40 kDa to 400 kDa, 40 kDa to 300 kDa, 50 kDa to 350 kDa, 60 kDa to 300 kDa, 50 kDa to 250 kDa and 60 kDa to 200 kDa.

[0228] PIA (PNAG) is acetylated to varying degrees due to the replacement of the amino group by acetate. The PIA produced in vitro is almost completely substituted by the amino group (95% to 100%). Alternatively, deacetylated PIA (PNAG) with acetylation less than 60%, 50%, 40%, 30%, 20%, 10% can be used. Deacetylated PIA (PNAG) is preferably used because the non-acetylated epitope of PNAG is effective in mediating opsonic killing of Gram-positive bacteria, preferably Staphylococcus aureus and / or Staphylococcus epidermidis. In certain aspects, the size of PIA (PNAG) is between 40kDa and 300kDa, and is deacetylated so that less than 60%, 50%, 40%, 30% or 20% of the amino groups are acetylated.

[0229] The term deacetylated PNAG (dPNAG) refers to a PNAG polysaccharide or oligosaccharide in which the amino group is acetylated to a degree of less than 60%, 50%, 40%, 30%, 20% or 10%. In certain aspects, PNAG is deacetylated to form dPNAG by chemically treating a natural polysaccharide. For example, natural PNAG is treated with an alkaline solution to raise the pH to above 10. For example, PNAG is treated with 0.1M to 5M, 0.2M to 4M, 0.3M to 3M, 0.5M to 2M, 0.75M to 1.5M or 1M NaOH, KOH or NH4OH. The mixture is treated at a temperature of 20°C to 100°C, 25°C to 80°C, 30°C to 60°C, 30°C to 50°C or 35°C to 45°C for at least 10 minutes to 30 minutes, or 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 10 hours, 15 hours or 20 hours. dPNAG may be prepared as described in WO 04 / 43405.

[0230] The polysaccharide may be conjugated to a carrier protein or unconjugated to a carrier protein.

[0231] B. Type 5 and Type 8 polysaccharides from Staphylococcus aureus

[0232] Most strains of Staphylococcus aureus that cause human infections contain either type 5 or type 8 polysaccharides. About 60% of human strains are type 8 and about 30% are type 5. Moreau et al. (1990) and Fournier et al. (1984) described the structures of type 5 and type 8 capsular polysaccharide antigens. Both have FucNAcp in their repeating units as well as ManNAcA, which can be used to introduce sulfhydryl groups. These structures are:

[0233] Type 5

[0234] →4)-β-D-ManNAcA(3OAc)-(1→4)-α-L-FucNAc(1→3)-β-D-FucNAc-(1→

[0235] Type 8

[0236] →3)-β-D-ManNAcA(4OAc)-(1→3)-α-L-FucNAc(1→3)-β-D-FucNAc-(1→

[0237] Recently (Jones, 2005) NMR spectroscopy revised the structure to:

[0238] Type 5

[0239] →4)-β-D-ManNAcA-(1→4)-α-L-FucNAc(3OAc)-(1→3)-β-D-FucNAc-(1→

[0240] Type 8

[0241] →3)-β-D-ManNAcA(4OAc)-(1→3)-α-L-FucNAc(1→3)-α-D-FucNAc(1→

[0242] Polysaccharides can be extracted from appropriate strains of S. aureus using methods well known to those skilled in the art, see U.S. Patent 6294177. For example, ATCC 12902 is a type 5 strain of S. aureus, and ATCC 12605 is a type 8 strain of S. aureus.

[0243] The polysaccharide has a natural size or can be sized, for example, by microfluidization, ultrasound irradiation or by chemical treatment. The invention also encompasses oligosaccharides derived from type 5 and type 8 polysaccharides of Staphylococcus aureus. The type 5 and type 8 polysaccharides contained in the immunogenic composition of the invention are preferably conjugated to a carrier protein as described below, or are unconjugated. The immunogenic composition of the invention either contains type 5 or type 8 polysaccharides.

[0244] C. Staphylococcus aureus 336 antigen

[0245] In one embodiment, the immunogenic composition of the present invention comprises the Staphylococcus aureus 336 antigen described in U.S. Pat. No. 6,294,177. The 336 antigen comprises a β-linked hexosamine, does not contain an O-acetyl group, and specifically binds to the Staphylococcus aureus 336 type antibody deposited in ATCC 55804. In one embodiment, the 336 antigen is a polysaccharide that has a natural size or can be sized, for example, by microfluidization, ultrasonic radiation, or chemical treatment. The present invention also includes oligosaccharides from the 336 antigen. The 336 antigen may not be coupled to a carrier protein or may be coupled to a carrier protein.

[0246] D. Type I, II and III polysaccharides from Staphylococcus epidermidis

[0247] One of the problems associated with using polysaccharides in vaccination is that the polysaccharide itself is a poor immunogen. Preferably, the polysaccharide used in the present invention is connected to a protein carrier, which provides help to bystander T cells to improve immunogenicity. Examples of such carriers that can be coupled to polysaccharide immunogens include diphtheria and tetanus toxoids (DT, DTCRM197 and TT, respectively), keyhole limpet hemocyanin (KLH) and purified protein derivatives of tuberculin (PPD), Pseudomonas aeruginosa exoprotein A (rEPA), protein D from Haemophilus influenzae, pneumolysin or fragments of any of the above substances. Applicable fragments include fragments containing T helper cell epitopes. In particular, protein D fragments from Haemophilus influenzae will preferably contain the N-terminal 1 / 3 of the protein. Protein D is an IgD binding protein from Haemophilus influenzae (EP 0 594 610 B1) and is a potential immunogen. In addition, Staphylococcus protein can be used as a carrier protein in the polysaccharide conjugate of the present invention.

[0248] Staphylococcal alpha toxin is a carrier protein that is particularly advantageous for use in staphylococcal vaccines. Since the coupling process reduces toxicity, the native form can be conjugated to a polysaccharide. Preferably, because the residual toxicity is low, genetically detoxified alpha toxins such as His35Leu or His35Arg variants can be used as carriers. Alternatively, the alpha toxin is chemically detoxified by treatment with a cross-linking agent, formaldehyde or glutaraldehyde. The genetically detoxified alpha toxin is optionally chemically detoxified, preferably by treatment with a cross-linking agent, formaldehyde or glutaraldehyde to further reduce toxicity.

[0249] The polysaccharide can be linked to the carrier protein by any known method, such as those described in U.S. Pat. Nos. 4,372,945, 4,474,757, and 4,356,170. Preferably, CDAP coupling chemistry is performed (see WO 95 / 08348). In CDAP, the cyanation reagent 1-cyano-dimethylaminopyridinium tetrafluoroborate (CDAP) is preferably used for the synthesis of polysaccharide-protein conjugates. The cyanation reaction can be carried out under relatively mild conditions, avoiding hydrolysis of alkali-sensitive polysaccharides. This synthesis allows direct coupling to the carrier protein.

[0250] Conjugation preferably involves creating a direct link between the carrier protein and the polysaccharide. Optionally, a spacer (eg dihydrogen adipate (ADH)) may be introduced between the carrier protein and the polysaccharide.

[0251] IV. Immune Response and Detection

[0252] As described above, the present invention relates to stimulating or inducing an immune response against variant SpA or coagulase peptides in a subject. In one embodiment, the immune response can protect or treat a subject suffering from, suspected of suffering from, or at risk of infection-related diseases, particularly diseases associated with Staphylococci. One use of the immunogenic composition of the present invention is to prevent nosocomial infections by vaccinating a subject prior to surgery in a hospital or other environment where the risk of infection is increased.

[0253] A. Immunoassay

[0254] The present invention includes the implementation of serological assays to assess whether and to what extent the compositions of the present invention induce or elicit an immune response. Various types of immunoassays can be implemented. Immunoassays included in the present invention include, but are not limited to, methods described in U.S. Pat. No. 4,367,110 (double monoclonal antibody sandwich assay) and U.S. Pat. No. 4,452,901 (Western blot). Other assays include immunoprecipitation and immunocytochemistry of labeled ligands in vitro and in vivo.

[0255] Immunoassays are typically binding assays. Certain preferred immunoassays are various types of enzyme-linked immunosorbent assays (ELISAs) and radioimmunoassays (RIAs) known in the art. Immunohistochemical assays using tissue sections are also particularly useful. In one embodiment, the antibody or antigen is fixed to a selected surface, such as a well in a polystyrene microtiter plate, a test strip, or a column rack. Then, a test composition suspected of containing the desired antigen or antibody, such as a clinical sample, is added to the well. After binding and washing to remove non-specifically bound immune complexes, the bound antigen or antibody can be detected. Detection is typically achieved by adding another antibody that is specific to the desired antigen or antibody, the antibody being connected to a detectable label. This type of ELISA is referred to as a "sandwich enzyme-linked immunosorbent assay". Detection can also be achieved by adding a second antibody that is specific to the desired antigen, and then adding a third antibody that has binding affinity to the second antibody, the third antibody being connected to a detectable label.

[0256] Competitive ELISA is also a possible embodiment, in which the test sample competes for binding with a known amount of labeled antigen or antibody. The amount of active substance in the unknown sample is determined by mixing the sample with a known labeled substance before or during incubation with the coated wells. The presence of active substance in the sample reduces the amount of labeled substance available for binding to the wells, thereby reducing the final signal. Regardless of the format, ELISA has certain common features, such as coating, incubation or binding, washing to remove non-specifically bound substances, and detecting bound immune complexes.

[0257] Antigens or antibodies can also be attached to a carrier, such as in the form of a well plate, beads, test paper, membrane or column matrix, and the sample to be analyzed is applied to the fixed antigen or antibody. When the well plate is coated with antigen or antibody, the wells of the well plate are usually incubated overnight or for a specific time with a solution of the antigen or antibody. The wells of the well plate are then cleaned to remove the material that is not fully adsorbed. Then, any remaining available surface of the well is "coated" with a nonspecific protein that is antigenically neutral for the test antiserum. These include bovine serum albumin (BSA), casein and milk powder solutions. The coating can block nonspecific adsorption sites on the fixed surface, thereby reducing the background caused by the nonspecific binding of the antiserum to the surface.

[0258] B. Diagnosis of bacterial infection

[0259] In addition to using proteins, polypeptides and / or peptides and antibodies that bind to such polypeptides, proteins and / or peptides to treat or prevent infections as described above, the present invention also contemplates using such polypeptides, proteins, peptides and / or antibodies in a variety of ways, including detecting the presence of Staphylococci to diagnose infection, whether in a patient or on medical equipment that may also be infected. According to the present invention, a preferred method of detecting infection includes the step of obtaining a sample suspected of being infected with one or more Staphylococci: for example, a sample taken from an individual, for example, from a person's blood, saliva, tissue, bone, muscle, cartilage or skin. After separation of the sample, a diagnostic assay utilizing the polypeptides, proteins, peptides and / or antibodies of the present invention can be performed to detect the presence of Staphylococci, and such assay techniques for determining such presence in a sample are well known to those skilled in the art and include methods such as radioimmunoassays, Western blot analysis and ELISA assays. Generally, according to the present invention, a method of diagnosing an infection is contemplated, wherein a sample suspected of being infected with Staphylococci has had added thereto a polypeptide, protein, peptide, antibody or monoclonal antibody according to the present invention, and the Staphylococci are detected by binding of the antibody to the polypeptide, protein and / or peptide in the sample, or the polypeptide, protein and / or peptide to the antibody.

[0260] Therefore, antibodies according to the present invention can be used to prevent staphylococcal infection (i.e., passive immunity), for the treatment of persistent infection, or as a research tool. The term "antibody" as used herein includes monoclonal, polyclonal, chimeric, single-chain, bispecific, ape- and humanized or primatized antibodies and Fab fragments, such as fragments that retain antibody binding specificity, including the product of a Fab immunoglobulin expression library. Therefore, the present invention contemplates the use of single chains, such as variable heavy chains and light chains of antibodies. The generation of any of these types of antibodies or antibody fragments is well known to those skilled in the art. Specific embodiments of antibodies produced against bacterial proteins can be found in U.S. Patent Application Publication No. 20030153022, which is incorporated herein by reference in its entirety.

[0261] Any of the above polypeptides, proteins, peptides and / or antibodies can be directly labeled with a detectable marker for identification and quantification of staphylococci. Labels used in immunoassays are generally well known to the skilled artisan and include enzymes, radioisotopes, and fluorescent, luminescent and chromogenic substances, including colored particles such as colloidal gold or latex beads. Suitable immunoassays include enzyme-linked immunosorbent assays (ELISAs).

[0262] C. Protective immunity

[0263] In certain embodiments of the present invention, the protein composition confers protective immunity to a subject. Protective immunity refers to the ability of the body to mount a specific immune response to protect a subject from a specific disease or condition involving a pathogen to which an immune response is generated. An immunogenic effective amount is capable of conferring protective immunity to a subject. As described herein in the specification and in the claims section that follows, the term polypeptide or peptide refers to a stretch of amino acids covalently linked between them by peptide bonds. According to the present invention, different polypeptides have different functions. According to one aspect, the polypeptide is derived from an immunogen designed to induce an active immune response in a recipient, but according to another aspect of the present invention, the polypeptide is derived from an antibody that stimulates an active immune response in, for example, an animal and can be used to induce a passive immune response in a recipient. However, in both cases, the polypeptide is encoded by a polynucleotide according to any codon usage. As used herein, the phrase "immune response" or its equivalent "immunological response" refers to a humoral (antibody-mediated), cellular (mediated by antigen-specific T cells or their secretory products) or humoral and cellular response in a recipient patient to a protein, peptide, carbohydrate or polypeptide of the present invention. This reaction can be an active reaction induced by administering an immunogen or a passive reaction induced by administering an antibody, a material containing the antibody, or a T cell induced. A cellular immune response is initiated by the presentation of a polypeptide epitope associated with a class I or class II MHC molecule to activate antigen-specific CD4(+) T helper cells and / or CD8(+) cytotoxic T cells. The reaction can also involve the activation of other components of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglia, eosinophils, or innate immunity. As used herein, "active immunity" refers to any immunity given to a subject by administering an antigen.

[0264] As used herein, "passive immunity" refers to any immunity given to an object without administering an antigen to the object. Therefore, "passive immunity" includes but is not limited to administering activated immune effectors, including cellular mediators or protein mediators (e.g., monoclonal antibodies and / or polyclonal antibodies) of immune response. Monoclonal antibodies or polyclonal antibody compositions can be used for passive immunity to prevent or treat infections of organisms carrying antigens recognized by antibodies. Antibody compositions can include antibodies that bind multiple antigens, which can be associated with multiple organisms. The antibody composition can be a polyclonal antiserum. In some aspects, one or more than one antibody is affinity purified from an animal or a second object that has been stimulated with one or more than one antigen. Alternatively, an antibody mixture can be used, which is a mixture of monoclonal and / or polyclonal antibodies for antigens present in the same, related or different microorganisms or organisms, such as gram-positive bacteria, gram-negative bacteria, including but not limited to staphylococci.

[0265] Passive immunity can be by applying immunoglobulin (Ig) and / or other immune factors obtained from donors or other non-patient sources with known immunoresponsiveness to the patient. In other respects, the antigen composition of the present invention can be applied to the object, which then serves as the source or donor of globulin, produced in response to the challenge of the antigen composition ("hyperimmune globulin"), which comprises antibodies or other organisms for staphylococci. The object receiving this treatment will donate plasma, then obtain hyperimmune globulin therefrom by conventional plasma separation method, then inject another object to produce resistance to staphylococcal infection or treat staphylococcal infection. Hyperimmune globulin according to the present invention is particularly suitable for immunocompromised individuals, individuals receiving invasive procedures or the situation that time does not allow individuals to produce autoantibodies to cope with vaccination. Referring to U.S. Patents 6936258, 6770278, 6756361, 5548066, 5512282, 4338298 and 4748018, each of which is incorporated herein by reference as typical methods and combinations related to passive immunity.

[0266] For the purposes of this specification and the appended claims, the terms "epitope" and "antigenic determinant" are used interchangeably to refer to a site on an antigen that B cells and / or T cells respond to or recognize. B cell epitopes can be formed by continuous amino acids or non-continuous amino acids juxtaposed by tertiary folding of the protein. Epitopes formed by continuous amino acids are usually retained when exposed to denaturing solvents, while epitopes formed by tertiary folding are usually lost when treated with denaturing solvents. Epitopes usually include at least 3, more commonly at least 5 or 8 to 10 amino acids with a unique spatial conformation. Methods for determining the spatial conformation of epitopes include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, Epitope Mapping Protocols (1996). Antibodies that recognize the same epitope can be identified in a simple immunoassay, showing the ability of one antibody to block the binding of another antibody to the target antigen. T cells recognize a continuous epitope of about 9 amino acids for CD8 cells or about 13 to 15 amino acids for CD4 cells. T cells that recognize an antigenic epitope can be identified by in vitro assays measuring antigen-dependent proliferation, such as by incorporation of 3H-thymidine as determined by priming of T cells in response to the antigenic epitope (Burke et al., 1994), antigen-dependent killing (cytotoxic T lymphocyte assay, Tigges et al., 1996), or cytokine secretion.

[0267] The presence of a cell-mediated immune response can be determined by proliferation assays (CD4(+) T cells) or CTL (cytotoxic T lymphocyte) assays. The relative contributions of humoral and cellular responses to the protective or therapeutic effect of an immunogen can be distinguished by isolating IgG and T cells, respectively, from the immunized homologous animal and testing the second subject for protective or therapeutic effect.

[0268] As used herein and in the claims, the terms "antibody" or "immunoglobulin" are used interchangeably to refer to any of several classes of structurally related proteins that function as part of an animal or recipient's immune response, including IgG IgD, IgE, IgA, IgM, and related proteins.

[0269] Under normal physiological conditions, antibodies are present in plasma and other body fluids and in the membranes of certain cells and are produced by lymphocytes of the B cell type or their functional equivalents. IgG class antibodies consist of four polypeptide chains linked together by disulfide bonds. The four chains of a complete IgG molecule are two identical heavy chains, called H chains, and two identical light chains, called L chains.

[0270] To produce polyclonal antibodies, a host, such as a rabbit or goat, is immunized with an antigen or antigen fragment, usually with an adjuvant and, if necessary, coupled to a carrier. Antibodies against the antigen are then collected from the host's serum. Polyclonal antibodies can be affinity purified against the antigen to make them monospecific.

[0271] Monoclonal antibodies can be produced in vitro by hyperimmunizing a suitable donor with the antigen or by using spleen cells or cell lines derived from the spleen (Anavi, 1998; Huston et al., 1991; Johnson et al., 1991; Mernaugh et al., 1995).

[0272] As used herein and in the claims, the phrase "immunological portion of an antibody" includes an antibody Fab fragment, an antibody Fv fragment, an antibody heavy chain, an antibody light chain, a heterodimer consisting of an antibody heavy chain and a light chain, an antibody light chain variable fragment, an antibody heavy chain variable fragment, and an antibody single chain variant, also known as scFv. In addition, the term includes chimeric immunoglobulins, which are the expression product of fusion genes from different species, one of which may be human, in which case the chimeric immunoglobulin is referred to as humanized. Typically, the immunological portion of an antibody competes with the intact antibody from which it is derived for specific binding to an antigen.

[0273] Optionally, the antibody or preferably the immunological portion of the antibody can be chemically coupled to or expressed as a fusion protein with other proteins. For the purposes of this specification and the appended claims, all such fusion proteins are included in the definition of an antibody or an immunological portion of an antibody.

[0274] As used herein, the terms "immunogenic agent" or "immunogen" or "antigen" are used interchangeably to describe a molecule capable of inducing an immune response against itself when administered to a recipient, whether alone, in combination with an adjuvant, or on a display carrier.

[0275] D. Treatment methods

[0276] The methods of the present invention include treating diseases or conditions caused by Staphylococcus pathogens. The immunogenic polypeptides of the present invention can be used to induce an immune response in a person infected with Staphylococcus or suspected of having been exposed to Staphylococcus. The methods can be used on individuals who have tested positive for exposure to Staphylococcus or individuals who are considered to be at risk of infection based on possible exposure. In particular, the present invention includes methods for treating Staphylococcus infections, especially hospital-acquired nosocomial infections. The immunogenic compositions and vaccines of the present invention are particularly advantageous for use in the context of elective surgery. Such patients will know the date of surgery in advance and can be vaccinated in advance. The immunogenic compositions and vaccines of the present invention are also advantageous for use in vaccinating health care workers.

[0277] In certain embodiments, the treatment is administered in the presence of an adjuvant or carrier or other Staphylococcus antigens. In addition, in certain instances, the treatment includes the use of other commonly used drugs to combat bacterial infections, such as one or more than one antibiotic.

[0278] Use of polypeptides in vaccination may require (but need not require) conjugation of the polypeptide to an immunological carrier protein, such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin. Methods for performing such conjugation are well known in the art.

[0279] V. Vaccine and Other Pharmaceutical Compositions and Administration

[0280] A. Vaccine

[0281] The present invention includes the method for preventing or improving staphylococcal infection, particularly hospital-acquired nosocomial infection. Therefore, the present invention contemplates the vaccine used in active and passive immunization embodiments. The immunogenic composition proposed to be suitable for use as a vaccine can be prepared by immunogenic SpA polypeptides (e.g. SpA domain D variants) or immunogenic coagulase. In other embodiments, SpA or coagulase can be used in combination with other secreted toxic proteins, surface proteins or their immunogenic fragments. In some aspects, the antigenic material is extensively dialyzed to remove unwanted small molecular weight molecules and / or lyophilized to be more easily formulated into a desired carrier.

[0282] Other options for vaccines based on proteins / peptides include the introduction of nucleic acids encoding antigens as DNA vaccines. In this regard, recent reports have described the construction of recombinant vaccinia viruses, which express 10 continuous minimal CTL epitopes (Thomson, 1996) or a combination of B cells, cytotoxic T lymphocytes (CTL) and T helper (Th) epitopes from several microorganisms (An, 1997), and successfully use such constructs to immunize mice to elicit protective immune responses. Therefore, there is sufficient evidence in the literature to successfully utilize peptides, peptide pulse antigen presenting cells (APC) and peptide encoding constructs to effectively start protective immune responses in vivo. The use of nucleic acid sequences as vaccines is illustrated in U.S. Patents 5958895 and 5620896.

[0283] The preparation of vaccines containing polypeptides or peptide sequences as active ingredients is generally well known in the art, such as U.S. Patents 4,608,251; 4,601,903; 4,599,231; 4,599,230; 4,596,792 and 4,578,770, all of which are incorporated herein by reference. Typically, such vaccines are formulated as injections of liquid solutions or suspensions, and solid forms suitable for dissolving or suspending in liquids before injection can also be prepared. The preparation can also be emulsified. The active immunogenic component is usually mixed with a pharmaceutically acceptable excipient that is compatible with the active ingredient. Suitable excipients are, for example, water, saline, glucose, glycerol, ethanol, etc. and combinations thereof. In addition, if necessary, the vaccine may contain a certain amount of auxiliary substances, such as wetting agents or emulsifiers, pH buffers, or adjuvants that enhance vaccine efficacy. In a specific embodiment, as described in U.S. Patents 6,793,923 and 6,733,754, the vaccine is formulated with a combination of substances, which are incorporated herein by reference.

[0284] The vaccine can be injected in a conventional manner, for example, subcutaneously or intramuscularly. Other formulations suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, conventional binders and carriers may include, for example, polyalkylene glycols or triglycerides: such suppositories may be formed from a mixture containing about 0.5% to about 10%, preferably about 1% to about 2% of active ingredients. Oral formulations include commonly used excipients, such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. These compositions are in the form of solutions, suspensions, tablets, pills, capsules, sustained-release formulations or powders and contain about 10% to about 95% of active ingredients, preferably about 25% to about 70%.

[0285] Polypeptides and polypeptide encoding DNA constructs can be formulated into neutral or salt form vaccines. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the peptide) and with (for example, inorganic acids such as hydrochloric acid or phosphoric acid) or (for example, organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.).

[0286] Generally, the mode of vaccination should be compatible with the dosage formulation, and the dosage should be therapeutically effective and immunogenic. The amount of administration depends on the subject being treated, including the ability of the individual's immune system to synthesize antibodies and the degree of protection required. The exact amount of active ingredient that needs to be administered depends on the judgment of the practitioner. However, a suitable dosage range is several hundred micrograms of active ingredient per vaccination. The appropriate regimen for initial administration and booster injections is also different, but is represented by an initial administration followed by subsequent vaccinations or other administrations.

[0287] The mode of application can vary widely. Any conventional method for administering the vaccine is applicable. These are considered to include oral administration in a solid physiologically acceptable matrix or parenterally, by injection, etc., in a physiologically acceptable dispersion. The dosage of the vaccine depends on the route of administration and varies according to the size and health of the subject.

[0288] In some cases, it is necessary to administer the vaccine multiple times, for example, 2 times, 3 times, 4 times, 5 times, 6 times or more than 6 times. Vaccination can be carried out at intervals of 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks to 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, including all ranges therebetween. It is necessary to regularly boost immunization every 1 year to 5 years to maintain the protection level of the antibody. As described in U.S. Patents 3791932, 4174384 and 3949064, the antibody for the antigen can be measured after the immunization process.

[0289] 1. Carrier

[0290] The immunogenicity of a given composition may vary. Therefore, it is often desirable to enhance the host immune system, which can be achieved by coupling the peptide or polypeptide to a carrier. Typical and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin may also be used as carriers. Methods for conjugating polypeptides to carrier proteins are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis-diazobenzidine.

[0291] 2. Adjuvant

[0292] The immunogenicity of a polypeptide or peptide composition can be enhanced by the use of a non-specific stimulator of the immune response (referred to as an adjuvant). Suitable adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins, or synthetic compositions. Many adjuvants can be used to enhance the antibody response to variant SpA polypeptides or coagulase or any other bacterial protein or combination contemplated herein. Adjuvants can (1) capture antigens in vivo, allowing them to be slowly released; (2) attract cells involved in the immune response to the site of administration; (3) induce proliferation or activation of immune system cells; or (4) improve the spread of antigens throughout the subject.

[0293] Adjuvants include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, mineral salts, polynucleotides, and natural substances. Specific adjuvants that can be used include IL-1, IL-2, IL-4, IL-7, IL-12, gamma-interferon, GMCSP, BCG, aluminum salts (e.g., aluminum hydroxide or other aluminum compounds), MDP compounds (e.g., thur-MDP and Nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL)). In a 2% squalene / Tween 80 emulsion, RIBI contains three components extracted from bacteria: MPL, trehalose dimycoate (TDM), and cell wall skeleton (CWS), and even MHC antigens can be used. Other adjuvants or methods are exemplified in U.S. Patents 6814971, 5084269, and 6656462, all of which are incorporated herein by reference.

[0294] In certain embodiments, the adjuvant includes an immunostimulant. Such immunostimulants may include, but are not limited to, stimulants of pattern recognition receptors: for example, Toll-like receptors, RIG-1, and NOD-like receptors (NLRs); mineral salts such as alum, alum bound to monophosphoryl lipid (MPL) A of enterobacteriaceae (e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri), or alum bound to MPL.RTM. (ASO4) or MPLA of these bacteria (e.g., E. coli, Salmonella minnesota, Salmonella typhimurium, or Shigella flexneri); saponins such as QS-21, Quil-A, ISCOMs, ISCOMATRIX; emulsions such as MF59, Montanide, ISA 51, and ISA 720, AS02 (QS21 + squalene + MPL.); liposomes and liposome preparations, such as AS01; synthetic or specially prepared microparticles and microcarriers, such as outer membrane vesicles (OMV) from bacteria such as Chlamydia gonorrhoeae and Chlamydia trachomatis, or chitosan particles; reservoir forming agents, such as Pluronic block copolymers; specially modified or prepared peptides, such as muramyl dipeptide; aminoalkyl glucosamine 4-phosphate, such as RC529; or proteins, such as bacterial toxins or toxin fragments.

[0295] Various methods of achieving vaccine adjuvant effects include the use of agents such as aluminum hydroxide or phosphate (alum), typically used as about 0.05% to about 0.1% solutions in phosphate-buffered saline, synthetic polymers of sugars, The mixture is used as an approximately 0.25% solution, and the proteins in the vaccine are aggregated by heat treatment at a temperature range of about 70°C to about 101°C for 30 seconds to 2 minutes, respectively. Aggregation is achieved by reactivation of (Fab) albumin antibodies treated with pepsin; mixtures with bacterial cells (e.g., C. parvum), endotoxins or lipopolysaccharide components of gram-negative bacteria; emulsions in physiologically acceptable oil carriers (e.g., mannitol monooleate (Aracel A)); or solutions using 20% ​​perfluorocarbons. Emulsions used as block replacements can also be used to produce auxiliary effects.

[0296] Examples of often preferred adjuvants include complete Freund's adjuvant (a nonspecific immune response stimulator containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvant, and aluminum hydroxide.

[0297] In certain aspects, it is preferred that the adjuvant selected is a preferential inducer of a Th1 or Th2 type response. High levels of Th1 type cytokines tend to induce a cell-mediated immune response to a particular antigen, while high levels of Th2 type cytokines tend to induce a humoral immune response to the antigen.

[0298] The distinction between Th1 and Th2 type immune responses is not absolute. In practice, individuals will support immune responses that are described as predominantly Th1 or predominantly Th2. However, it is often convenient to refer to the cytokine families described by Mosmann and Coffman (Mosmann and Coffman, 1989) in mouse CD4+ T cell cloning. Traditionally, Th1 type responses are associated with the production of INF-γ and IL-2 cytokines by T lymphocytes. Other cytokines that are often directly associated with the induction of Th1 type immune responses are not produced by T cells, such as IL-12. In contrast, Th2 type responses are associated with the secretion of IL-4, IL-5, IL-6, and IL-10.

[0299] In addition to the adjuvant, it may be necessary to co-administer a biological response modifier (BRM) to enhance the immune response. BRMs have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, cimetidine (CIM; 1200 mg / d) (Smith / Kline, PA); or low-dose cyclophosphamide (CYP; 300 mg / m 2) (Johnson / Mead, NJ) and cytokines (such as gamma interferon, IL-2 or IL-12) or genes encoding proteins involved in immune helper functions, such as B-7.

[0300] B. Lipid Components and Lipid Fractions

[0301] In certain embodiments, the present invention relates to compositions comprising one or more than one lipid associated with a nucleic acid or polypeptide / peptide. Lipids are substances that are insoluble in water and can be extracted with organic solvents. In addition to the compounds described herein, other compounds are understood by those skilled in the art to be lipids and are included in the compositions and methods of the present invention. The lipid component and the non-lipid can be covalently or non-covalently linked to each other.

[0302] Lipid can be naturally occurring lipid or synthetic lipid.However, lipid is usually biological substance.Biological lipid is well known in the art, and comprises for example neutral fat, phospholipid, phosphoglyceride, steroid, terpene, lysolipid, glycosphingolipid, glycolipid, sulfolipid, lipid and polymerizable lipid with ether and ester connected fatty acid, and their combination.

[0303] The nucleic acid molecules or polypeptides / peptides coupled to lipids can be dispersed in a solution containing lipids, dissolved with lipids, emulsified with lipids, mixed with lipids, bound to lipids, covalently bonded to lipids, contained in lipids in the form of a suspension, or otherwise bound to lipids. The lipids or lipid-poxvirus-related compositions of the present invention are not limited to any particular structure. For example, they can also be simply dispersed in a solution and can form aggregates of uneven size or shape. In another embodiment, they can exist in a bilayer structure, micelles, or "folded" structures. In another non-limiting embodiment, liposomes (Gibco BRL)-poxvirus or Superfect (Qiagen)-poxvirus complexes are also contemplated.

[0304] In certain embodiments, the composition may comprise about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100% 6%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84 %, about 85%, about 86%, about 87%, ab about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or any range therebetween of a particular lipid, lipid type or non-lipid component, such as an adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid or other material disclosed herein or known to those skilled in the art. In a non-limiting embodiment, the composition may comprise about 10% to about 20% neutral lipids, about 33% to about 34% cerebrosides and about 1% cholesterol. In another non-limiting embodiment, the liposomes may comprise about 4% to about 12% terpenes, wherein about 1% of the micelles are specifically lycopene, and the remaining about 3% to about 11% of the liposomes comprise other terpenes; about 10% to about 35% phosphatidylcholine and about 1% non-lipid components. Thus, it is contemplated that the compositions of the present invention may contain any lipid, lipid type, or other component in any combination or percentage range.

[0305] C. Combination therapy

[0306] The compositions and related methods of the invention, particularly the administration of secreted virulence factors or surface proteins, including variant SpA polypeptides or peptides, and / or other bacterial peptides or proteins to a patient / subject, may also be combined with the administration of conventional therapies. These include, but are not limited to, the administration of antibiotics, such as streptomycin, ciprofloxacin, doxycycline, gentamicin, chloramphenicol, trimethoprim, sulfamethoxazole, ampicillin, tetracycline, or a combination of various antibiotics.

[0307] On the one hand, it is considered that polypeptide vaccine and / or therapy are used in combination with antimicrobial therapy.Or, treatment can be spaced a few minutes to a few weeks before or after other medicaments are treated.In the embodiment that other medicaments and / or protein or polynucleotide are used separately, usually it is ensured that there is no very long time period between each delivery, so that reagent and antigen composition can still play a favorable combination effect to object.In such case, it is considered that two kinds of modes can be used in about 12 to 24 hours or in about 6 to 12 hours.In some cases, it may be necessary to significantly extend the application time, wherein between each application, a few days (2,3,4,5,6 or 7) to a few weeks (1,2,3,4,5,6,7 or 8) are spaced.

[0308] Various combinations may be used, for example antibiotic treatment is "A" and an immunogenic molecule, such as an antigen, given as part of an immunotherapy regimen is "B":

[0309] A / B / AB / A / BB / B / AA / A / BA / B / BB / A / AA / B / B / BB / A / B / B

[0310] B / B / B / AB / B / A / BA / A / B / BA / B / A / BA / B / B / AB / B / A / A

[0311] B / A / B / AB / A / A / BA / A / A / BB / A / A / AA / B / A / AA / A / B / A

[0312] Administration of the immunogenic compositions of the invention to patients / subjects will follow the general regimen for administration of such compounds, taking into account the toxicity, if any, of the SpA compositions or other compositions described herein. It is expected that treatment cycles will be repeated as needed. It is also contemplated that various standard therapies, such as hydration, may be used in conjunction with the described therapies.

[0313] D. General pharmaceutical composition

[0314] In certain embodiments, a pharmaceutical composition is administered to a subject. Different aspects of the invention relate to administering an effective amount of a composition to a subject. In certain embodiments of the invention, a staphylococcal antigen, a member of the Ess pathway, including a polypeptide or peptide of the Esa or Esx class, and / or a member of a sortase substrate may be administered to a patient to prevent infection by one or more than one staphylococcal pathogen. Alternatively, an expression vector encoding one or more than one such polypeptide or peptide may be administered to a patient as a preventive treatment. In addition, such compounds may be administered in combination with an antibiotic or antibacterial agent. Such compositions are typically dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.

[0315] In addition to compounds formulated for parenteral administration, e.g., for intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; sustained release capsules; and any other forms currently used, including creams, lotions, mouthwashes, inhalants, and the like.

[0316] The active compounds of the invention can be formulated for parenteral administration, for example, for injection by intravenous, intramuscular, subcutaneous or even intraperitoneal routes. The preparation of aqueous compositions comprising one or more than one compound that increases the expression of MHC class I molecules will be known to those skilled in the art in light of the present disclosure. Typically, such compositions can be prepared as liquid solutions or suspensions; they can also be prepared in solid form, which is used to prepare solutions or suspensions to which liquids are added prior to injection; the preparations can also be emulsified.

[0317] Solutions of the active compound as free bases or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0318] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid for easy syringability. It should also be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0319] The protein composition can be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed from free amino groups of the protein) and salts formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid), etc. Salts formed with free carboxyl groups can also be derived from inorganic bases, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide, and organic bases, such as isopropylamine, trimethylamine, histidine, procaine, etc.

[0320] Carrier can also be a solvent or dispersion medium containing water, ethanol, polyol (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.), its appropriate mixture and vegetable oil. Suitable fluidity can be maintained by, for example, using coatings such as lecithin, maintaining the required particle size in the case of dispersion, and by using a surfactant in this way. The effect of microorganisms can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, isotonic agents are preferably included, such as sugar or sodium chloride. The absorption of injectable compositions can be extended by using delayed absorption agents such as aluminum monostearate and gelatin in the composition.

[0321] Sterile injectable solutions can be prepared by mixing the required amount of active compound with the various other ingredients listed above in an appropriate solvent as required and then sterilizing by filtration. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile carrier, which includes a basic dispersion medium and the required other ingredients listed above. Regarding the preparation of sterile powders for sterile injections, the preferred preparation methods are vacuum drying and freeze drying techniques, which will produce powders of the active ingredients and any other ingredients required for the previously sterile filtered solution.

[0322] The composition according to the present invention will usually be administered by any common route. This includes but is not limited to oral, nasal or oral. Alternatively, it can be administered by in situ, intradermal, subcutaneous, intramuscular, intraperitoneal, intranasal or intravenous injection. In certain embodiments, the vaccine composition can be inhaled (e.g., U.S. Patent 6651655, which is specifically incorporated by reference). Such compositions are usually administered as pharmaceutically acceptable compositions, including physiologically acceptable carriers, buffers or other excipients. As used herein, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms suitable for contact with human and animal tissues within the scope of reasonable medical judgment, which do not have excessive toxicity, irritation, allergic reactions or other problems commensurate with reasonable benefit / risk ratios when in contact. The term "pharmaceutically acceptable carrier" refers to pharmaceutically acceptable materials, compositions or carriers, such as liquid or solid fillers, diluents, excipients, solvents or encapsulating materials, which participate in carrying or transporting chemical reagents.

[0323] For example, for the administration of an aqueous solution for intravenous injection, if necessary, the solution should be properly buffered, and the liquid diluent should first be isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, according to the present disclosure, it can be known to those skilled in the art to use sterile aqueous media. For example, a dose can be dissolved in an isotonic NaCl solution, then added to a subcutaneous injection or injected into the infusion site of the suggestion, (e.g., referring to Remington's Pharmaceutical Sciences, 1990). Depending on the subject, some changes will inevitably occur in the dosage. In any case, the person responsible for administration will determine the appropriate dosage for the individual subject.

[0324] The effective amount of the therapeutic or preventive composition is determined based on the objective in mind. The term "unit dose" or "dose" refers to physically discrete units suitable for a subject, each unit containing a predetermined amount of the composition, calculated to produce the desired response discussed above in connection with its administration, i.e., the appropriate route and regimen. The amount administered depends on the desired protection, depending on the number of treatments and the unit dose.

[0325] The precise amount of the composition also depends on the judgment of the practitioner and varies from person to person. Factors affecting dosage include the physical and clinical state of the subject, the route of administration, the desired goal of treatment (alleviation of symptoms versus cure), and the potency, stability, and toxicity of the particular composition.

[0326] After formulation, the solution will be administered in a therapeutically or prophylactically effective amount and in a manner compatible with the dosage formulation. The formulation is easily administered in a variety of dosage forms, such as the type of injection solution described above.

[0327] E. In vitro, ex vivo or in vivo administration

[0328] As used herein, the term in vitro administration refers to manipulations performed on cells removed from a subject or in vitro, including but not limited to cells in culture. The term ex vivo administration refers to cells that have been manipulated in vitro and subsequently administered to a subject. The term in vivo administration includes all manipulations performed in a subject.

[0329] In certain aspects of the invention, the composition can be administered in vitro, in vitro or in vivo. In certain in vitro embodiments, an autologous B lymphocyte cell line is incubated with the viral vector of the present invention for 24 to 48 hours, or with variant SpA and / or coenzyme and / or any other composition described herein for 2 hours. The transduced cells can then be used for in vitro analysis, or for in vitro administration. U.S. Patents 4690915 and 5199942 (both incorporated herein by reference) disclose in vitro methods for the manipulation of blood mononuclear cells and bone marrow cells for therapeutic applications.

[0330] F. Antibodies and Passive Immunity

[0331] Another aspect of the invention is a method for preparing an immunoglobulin for preventing or treating a staphylococcal infection, comprising the steps of immunizing a recipient or donor with the vaccine of the invention and isolating the immunoglobulin from the recipient or donor. Another aspect of the invention is an immunoglobulin prepared by the method. Another aspect of the invention is a pharmaceutical composition comprising an immunoglobulin of the invention and a pharmaceutically acceptable carrier, which can be used to prepare a medicament for treating or preventing staphylococcal disease. Another aspect of the invention is a method for treating or preventing a staphylococcal infection, comprising the step of administering to a patient an effective amount of a pharmaceutical formulation of the invention.

[0332] Inoculum for the preparation of polyclonal antibodies is usually prepared by dispersing the antigen composition in a physiologically tolerable diluent (e.g., saline or other adjuvants suitable for human use), thereby forming an aqueous composition. An immunostimulating amount of the inoculum is administered to a mammal, and then the inoculated mammal is maintained for a sufficient time to induce protective antibodies in the antigen composition.

[0333] Antibodies can be isolated to the desired extent by well-known techniques such as affinity chromatography (Harlow and Lane, 1988). Antibodies can include antiserum preparations from a variety of commonly used animals, such as goats, primates, donkeys, pigs, horses, guinea pigs, mice or humans.

[0334] The immunoglobulins produced according to the present invention may include complete antibodies, antibody fragments or subfragments. Antibodies may be complete immunoglobulins of any class (e.g., IgG, IgM, IgA, IgD or IgE), chimeric antibodies or hybrid antibodies having dual specificity for two or more antigens of the present invention. They may also be fragments including hybrid fragments (e.g., F(ab')2, Fab', Fab, Fv, etc.). Immunoglobulins also include natural, synthetic or genetically engineered proteins that act as antibodies by binding to specific antigens to form complexes.

[0335] The vaccine of the present invention can be injected into a recipient, who then serves as a source of immunoglobulins, which are produced in response to the challenge from the specific vaccine. The subject so treated will donate plasma, from which hyperimmune globulins are obtained by conventional plasma fractionation methods. The hyperimmune globulins will be administered to another subject to confer resistance or treat staphylococcal infection. The hyperimmune globulins of the present invention are particularly suitable for the treatment or prevention of staphylococcal diseases in infants, immunocompromised individuals, or individuals who need treatment and do not have time to respond to vaccination to produce antibodies.

[0336] Another aspect of the invention is a pharmaceutical composition comprising more than two monoclonal antibodies (or fragments thereof; preferably human or humanized) reactive to at least two components of the immunogenic composition of the invention, () which can be used to treat or prevent infection with Gram-positive bacteria, preferably Staphylococcus, more preferably Staphylococcus aureus or Staphylococcus epidermidis. Such pharmaceutical compositions contain monoclonal antibodies that can be complete immunoglobulins of any kind, chimeric antibodies, or hybrid antibodies specific for two or more antigens of the invention. They can also be fragments (e.g., F(ab')2, Fab', Fab, Fv, etc.), including hybrid fragments.

[0337] Methods for preparing monoclonal antibodies are well known in the art and may include fusion of spleen cells with myeloma cells (Kohler and Milstein, 1975; Harlow and Lane, 1988). Alternatively, monoclonal Fv fragments may be obtained by screening appropriate phage display libraries (Vaughan et al., 1998). Monoclonal antibodies may be humanized or partially humanized by known methods.

[0338] VI. Examples

[0339] The following examples are given to illustrate various embodiments of the present invention and are not intended to limit the present invention in any way. Those skilled in the art will readily appreciate that the present invention is well suited for achieving the stated objectives and obtaining the objects and advantages mentioned, as well as those objects, purposes and advantages inherent herein. The present examples and the methods described herein currently represent preferred embodiments, are typical, and are not intended to limit the scope of the present invention. Those skilled in the art will appreciate that variations therein and other uses contained within the spirit of the present invention as defined by the scope of the claims.

[0340] Example 1 Staphylococcal protein A contributes to the persistent colonization of mice with Staphylococcus aureus

[0341] Staphylococcus aureus continuously colonizes the nasopharynx of approximately one-third of the population, thereby promoting community-acquired and hospital-acquired infections. Antibiotics are currently used to decolonize individuals at increased risk of infection. However, the efficacy of antibiotics is limited by recolonization and selection of resistant strains. Nasal colonization triggers IgG responses against staphylococcal surface antigens, but these antibodies cannot prevent subsequent colonization or disease. This example describes the ST88 isolate of the multi-site sequence type, Staphylococcus aureus WU1, which continuously colonizes the nasopharynx of mice. It is reported that the continued presence of Staphylococcus aureus WU1 in the nasopharynx requires Staphylococcal protein A (SpA). Compared with animals colonized with wild-type Staphylococcus aureus, mice colonized with Δspa variants have increased IgG responses to Staphylococcus colonization determinants. Immunization of mice with avirulent SpA variants (which cannot cross-link B cell receptors and transfer antibody responses) elicits protein A neutralizing antibodies, which promote IgG responses to colonized Staphylococcus aureus and reduce the persistence of pathogens.

[0342] A. Results

[0343] 1. Staphylococcus aureus WU1

[0344] An outbreak of preputial gland infection in male C57BL / 6 mice was observed in an animal breeding colony. Samples were collected from the preputial gland adenitis (PGA) and nasopharynx of male and female C75BL / 6J mice and analyzed by growth on mannitol salt agar (MSA) and Baird-Parker agar (BPA). Multilocus sequence typing and spa genotyping indicated that the animals had been colonized with S. aureus ST88 spa genotype t186, which was responsible for the PGA in male mice. S. aureus CC88 with spa genotype t186 has been reported as a stable colonizing isolate of laboratory mice in the United States (37). Other spa genotypes include t325, t448, t690, t755, t786, t2085, t2815, t5562, t11285, and t12341 (37). The New Zealand JSNZ isolate carries a unique spa genotype, t729 (37). Nevertheless, both S. aureus JSNZ and WU1 share the type 8 capsular polysaccharide gene but lack the mecA gene and the mobile genetic element (MGE) encoding the T-cell superantigen (37). In addition, the hlb-transforming phage expressing the human-specific immune evasion cluster 1 (IEC1) genes sak (staphylokinase), chp (CHIPS, chemotaxis inhibitory protein of S. aureus), and scn (SCIN-A, staphylococcal complement inhibitor A) are missing from the WU1 genome, resulting in a complete α-hemolysin encoding gene (hlb) (38). Notably, the WU1-encoded IEC2 carries the scn homologs scb / scc (SCIN-B / -C) as well as hla (α-hemolysin) and ssl12-14 (staphylococcal superantigen-like 12-14) (39). Unlike other CC88 isolates that stably colonized mice (37), the genome of WU1 contained the blaZ gene. When genes encoding sortase-anchored surface proteins were analyzed, S. aureus WU1 was observed to carry genes for determinants associated with prior nasal colonization, including ClfB, IsdA, SdrC, SdrD, and SasG (Table 1).

[0345]

[0346] The formation of Staphylococcus aureus abscesses is associated with the determinants of fibrin bacterial agglutination (40, 41). Agglutination requires two S. aureus secretory products to activate host prothrombin to convert fibrinogen into fibrin: coagulase (Coa) and von Willebrand factor binding protein (vWbp) (40). Coagulation factor A (ClfA) binds to fibrinogen and wraps Staphylococci with fibrinogen fibrils produced by coagulase, thereby interfering with the uptake and killing of S. aureus host phagocytes (41, 42). The clfA gene is identical in S. aureus WU1 and JSNZ, but shows allele-specific differences with clfA from S. aureus Newman (Table 1), a CC8 human clinical isolate commonly used in mouse laboratory challenge experiments (43). However, the observed clfA differences are branch-specific, as they can be found in CC88 strains isolated from human or mouse hosts (data not shown). The coa gene products of S. aureus WU1, JSNZ and Newman are almost the same (Table 1). In contrast, the vwb gene products of S. aureus WU1 and JSNZ are significantly different from S. aureus Newman, which has the largest sequence variants of prothrombin binding D1 and D2 domains (Figure 1A), and are not recognized by polyclonal antibodies produced against Newman's Wbp (Figure 1B). The vWbp secreted by the two CC88 strains can be recognized by sera cultured against the conserved C-terminal domain of USA300 strain vWbp (Figure 1C). Compared with S. aureus Newman, which secretes a large amount of Coa and rapidly agglutinates human and mouse plasma, S. aureus WU1 and JSNZ secrete less Coa and are more likely to agglutinate mouse plasma (Figure 1B, Figure 1D, Figure 1E). The coagulase activity of S. aureus Newman depends on the expression of coa and vwb, because the corresponding Δcoa, Δvwb and Δcoa, Δvwb mutants showed agglutination defects in mouse and human plasma (Figure 1D, Figure 1E). Taken together, these data indicate that the ST88 allele of the vwb gene in S. aureus WU1 and JSNZ can promote efficient prothrombin-mediated coagulation and fibrin aggregation in mouse plasma, which can support the pathogenesis of invasive diseases such as PGA.

[0347] 2. S. aureus WU1 persistently colonizes the nasopharynx of mice.

[0348] To analyze the colonization ability of S. aureus WU1 in mice, throat swabs and fecal material were spread on BPA and analyzed from 10 female C57BL / 6 mice (PBA). 8Naive animals lacking bacterial growth on BPA were anesthetized and inoculated with a phosphate-buffered saline (PBS) suspension of CFU S. aureus WU1 inhaled into the right nostril. Animal colonization analysis was performed by swabbing the oropharynx at weekly intervals, 7, 14, 21, 28, 35, and 42 days after inoculation. Swabs were applied to BPA, cultured for colony formation, and counted (Figure 2A). Even without prior antibiotic treatment or antibiotic selection, S. aureus WU1 colonized the oropharynx at a rate of 1.2 log per swab over 42 days. 10 CFU to 2.9log 10 The load of CFU colonized the experimental animals (Figure 2A). To verify the continued colonization of S. aureus WU1, colonies obtained after 42 days were subjected to genotyping analysis by MLST and spa. The data showed that the mice were still colonized with ST88 spa t186, indicating that S. aureus WU1 continued to colonize the nasopharynx of C57BL / 6 mice. As a control group, a group of C57BL / 6J animals in separate cages were housed in the same animal facility room and the same cage racks as animals colonized with S. aureus WU1, and their simulated PBS inoculation did not result in staphylococcal colonization of the nasopharynx (Figure 2A). Fecal samples from mice on day 42 were homogenized in PBS and plated on mannitol salt agar (MSA) for CFU counting (Figure 2B). Fecal samples from mice colonized with S. aureus WU1 contained 5.1 log10 CFU g-1 to 7.3 log10 CFU g-1 feces, indicating that the S. aureus WU1 strain colonized the gastrointestinal (GI) tract of mice. As a control, fecal samples from mock (PBS)-inoculated mice were devoid of S. aureus (Figure 2B).

[0349] Colonization with S. aureus WU1 triggers serum IgG responses in mice. Earlier work generated an S. aureus antigen matrix consisting of 25 conserved secreted proteins. Each of the 25 recombinant affinity-tagged proteins was purified and immobilized on a membrane filter (44). To examine host immune responses during colonization, blood was collected from naive or S. aureus WU1-colonized animals 15 days after inoculation and serum IgG responses were analyzed by incubation with the S. aureus antigen matrix. IgG binding was detected using IRDye 680-conjugated goat anti-mouse IgG (LI-COR) and quantified by infrared imaging. This experiment showed that colonization with S. aureus WU1 resulted in an increase in serum IgG against the sortase-anchored surface proteins ClfA, ClfB, IsdA, and IsdB, as well as the giant extracellular matrix-binding protein (Ebh), a cell size and peptidoglycan synthesis determinant of S. aureus (45) (Table 2).

[0350]

[0351] 3. S. aureus WU1 requires staphylococcal protein A for sustained colonization.

[0352] Similar to S. aureus Newman SpA, the spa gene product of S. aureus WU1 consists of five IgBDs and carries a single amino acid substitution within a 278-residue domain. Immunoblotting experiments showed that S. aureus strains Newman and WU1 produced comparable amounts of SpA (Figure 3A). Using allelic recombination, the inventors generated a Δspa mutant of S. aureus WU1. SpA production was abolished in the Δspa mutant as detected by immunoblotting, and this defect was restored by expression of plasmid-borne wild-type spa (pSpA) (Figure 3A). Immunoblotting using antibodies against sortase A (SrtA) was used as a loading control (Figure 3A). When the mutant was inoculated into the right nostril of mice and colonization was analyzed by oropharyngeal swabs on day 7, the Δspa mutant initially colonized C57BL / 6J animals in a manner similar to wild-type strain WU1 (Figure 3B). However, at later time points, particularly at days 35 and 42, the Δspa mutant colonized fewer animals than the wild-type strain WU1 (Figure 3B). During bacterial growth, S. aureus releases SpA attached to peptidoglycan fragments into the surrounding environment (46). In a mouse model of intravenous S. aureus injection, the released SpA activates B cell proliferation and enhances the secretion of VH3-idiotypic IgM and IgG molecules (33). However, the amplified VH3-idiotypic IgG does not recognize staphylococcal antigens (33). The molecular basis of this B cell superantigenic activity is based on SpA-mediated cross-linking of the VH3-idiotypic B cell receptor, which triggers B cell proliferation in a CD4 T helper cell and RIPK2 kinase-dependent manner (33, 47). Animals infected with Δspa mutant staphylococci lack VH3-idiotypic immunoglobulin expansion and show a large increase in pathogen-specific IgG, thereby triggering an immunogenic response that is protective against subsequent S. aureus infection (48). One then wondered whether colonization with the Δspa mutant of WU1 was associated with altered serum IgG responses. Sera from animals that had been colonized for 15 days were analyzed for IgG binding to S. aureus antigenic matrix components (Table 2). This experiment showed an increase in antibodies against ClfB, IsdA, and SasG in animals that were subsequently decolonized, but not in animals colonized with the Δspa mutant (Table 2). Taken together, these data indicate that nasopharyngeal colonization of C57BL / 6 mice with Δspa mutant Staphylococci is associated with an increase in IgG responses against key colonization determinants, which appears to facilitate decolonization of Δspa mutant S. aureus from the nasopharynx.

[0353] 4. Protein A neutralizing antibodies affect the persistent colonization of Staphylococcus aureus.

[0354] Immunization of mice with wild-type protein A did not elicit IgG serum antibodies capable of binding and neutralizing the five IgBD-binding Fcγ domains of IgG molecules or the VH3 idiotypic immunoglobulin heavy chain variants (44). KKAA is a variant with 20 amino acid substitutions in the five IgBDs of SpA that abolish Fcγ binding and reduce binding to VH3 idiotype immunoglobulins (44). KKAA The overall α-helical content and antigenic structure of protein A are retained. KKAA Immunization of mice elicits high titers of protein A neutralizing IgG (44). These antibodies block the anti-opsonization and B cell superantigen activities of protein A during S. aureus infection, broadly enhance IgG responses against staphylococcal antigens, and promote the development of protective immunity (44). To test whether protein A neutralizing antibodies affect S. aureus colonization, adjuvanted SpA KKAA or adjuvant alone to immunize C57BL / 6 mice. Compared with mock-immunized animals, SpA KKAA Treated animals elicited high titers of protein A neutralizing antibodies (Table 3). To test whether protein A neutralizing antibodies affect S. aureus colonization, when inoculated with S. aureus WU1, mock and SpA KKAA All immunized animals were initially colonized in a similar manner, as oropharyngeal swabs showed no significant differences in mean colonization burden between days 7 and 14 post-vaccination ( Figure 4 ). However, starting from day 21, SpA KKAA Immunized mice were more frequently decolonized than mock-immunized animals ( Figure 4 When serum IgG responses were examined and compared to naive mice, S. aureus WU1 colonization in mock-treated animals resulted in antibody responses against ClfB, IsdA, IsdB, SasD, and SasF (Table 3). KKAA Immunization resulted in antibody responses against ClfA, Coa, vWBP, and Hla (Table 3). KKAA Compared with C57BL / 6J mice that were decolonized, animals that were subsequently decolonized showed elevated serum IgG against ClfA, ClfB, fibronectin binding protein A (FnBPA) and B (FnBPB), IsdB, Coa, and SasG (Table 3). Together, these data suggest that SpA KKAAVaccination induced enhanced serum IgG responses in mice colonized with S. aureus. KKAA The vaccine induces antibodies against many different staphylococcal antigens, including known colonization factors (ClfB, IsdA, and SasG). KKAA Vaccine-induced IgG responses against colonizing staphylococci appear to promote decolonization of the nasopharynx.

[0355]

[0356] Colonization of BALB / c mice with S. aureus WU1. To test whether colonization of S. aureus WU1 is limited to C57BL / 6 mice, the inventors isolated 1×10 8 CFU of S. aureus WU1 were inoculated into the right nostril of a group of naive BALB / c mice (n=20), and nasopharyngeal colonization was detected by swab culture. Similar to C57BL / 6 mice, S. aureus WU1 persisted in BALB / c mice ( Figure 5 ). Use SpA KKAA Immunization of BALB / c mice did not affect initial colonization with S. aureus WU1. However, compared with mock-immunized animals, vaccination with SpA KKAA Promoted decolonization of BALB / c mice ( Figure 5 ).

[0357] 5.SpA KKAA Vaccine affects colonization of mice with Staphylococcus aureus JSNZ.

[0358] People then wondered whether protein A neutralizing antibodies also affect mouse colonization of S. aureus JSNZ. Unlike the Newman and WU1 strains, the spa gene products of S. aureus JSNZ contain only four IgBDs (37). Earlier studies have shown that SpA variants with four IgBDs, compared with the five IgBDs typically associated with human nasopharyngeal S. aureus colonization, are associated with attenuated B cell superantigen activity (33). When inoculated into the right nostril of anesthetized mice, S. aureus JSNZ effectively colonized the nasopharynx of BALB / c mice for 42 days ( Figure 6 ). SpA KKAA Vaccination did not affect initial colonization with S. aureus JSNZ. However, BALB / c mice with serum neutralizing protein A antibodies were more frequently decolonized with S. aureus JSNZ starting from day 21 compared with mock-immunized mice ( Figure 6 Together, these data suggest that S. aureus JSNZ also requires protein A-mediated B cell superantigen activity for persistent colonization in mice.

[0359] B. Materials and Methods

[0360] 1. Culture medium and bacterial growth conditions.

[0361] S. aureus strains were cultured in Tryptic Soy Broth (TSB) or Tryptic Soy Agar (TSA) at 37°C. For experiments investigating nasopharyngeal colonization in mice, throat swab samples were cultured on Baird-Parker agar at 37°C as indicated. For experiments investigating gastrointestinal colonization of S. aureus, fecal samples were grown on mannitol salt agar at 37°C as indicated. E. coli strains DH5α and BL21(DE3) were grown in Luria broth (LB) or agar at 37°C. Ampicillin (100 μg / mL for E. coli) and chloramphenicol (10 μg / mL for S. aureus) were used for plasmid selection.

[0362] 2. Genotyping of Staphylococcus aureus.

[0363] S. aureus isolate WU1 was obtained from nasopharyngeal and preputial gland abscess lesions of mice in the inventors' animal facility. Mouse S. aureus strain JSNZ was provided by Dr. Siouxsie Wiles (36). Staphylococcal genomic DNA was isolated using the Wizard genomic DNA purification kit (Promega). Spa genotyping and multilocus sequence typing (MLST) were performed as described previously (85). Briefly, for spa typing, genomic DNA of S. aureus strain WU1 was PCR amplified using primers 1095F (5′AGACGATCCTTCGGTGAGC3′) and 1517R (5′GCTTTTGCAATGTCATTTACTG3′) (86). PCR products were purified using Nucleospin Gel and PCR Clean-up kit, sequenced using primers 1095F and 1517R, and analyzed using Ridom software. For MLST typing, primers arc-up (5′TTGATTCACCAGCGCGTATTGTC3′), arc-dn (5′AGGTATCTGCTTCAATCAGCG3′), aro-up (′5ATCGGAAATCCTATTTCACATTC3′), arc-dn (5′GGTGTTGTATTAATAACGATATC3′), glp-up (5′CTAGGAACTGCAATCTTAATCC3′), glp-dn (5′TGGTAAAATCGCATGTCCAATTC3′), gmk-up (5′ATCGTTTTATCGGGACCATC3′), and gmk-dn (5′ATCGTTTTATCGGGACCATC3′) were used. 'TCATTAACTACAACGTAATCGTA3'), pta-up (5'GTTAAAATCGTATTACCTGAAGG3'), pta-dn (5'GACCCTTTTGTTGAAAAGCTTAA3'), tpi-up (5'TCGTTCATTCTGAACGTCGTGA3'), tpi-dn (5'TTTGCACCTTCTAACAATTGTAC3'), yqi-up (5'CAGCATACAGGACACCTATTGGC3') and yqi-dn (5'CGTTGAGGAATCGATACTGGAAC3') were PCR amplified from genomic DNA of S. aureus WU1. PCR products were purified using NucleoSpin gel and PCR clean-up kit, PCR amplified and sequenced, and analyzed using online software (see, e.g., saures.mLst.net / ). Dr. Silva Holtfreter provided a complete genome sequence file of S. aureus strain JSNZ.The genomic DNA of S. aureus WU1 was sequenced using Truseq DNA-seq library preparation and Illumina MiSeq sequencing using the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory. Sequences were analyzed using Geneious software.

[0364] 3. Staphylococcus aureus mutants.

[0365] The spa gene of S. aureus WU1 was deleted using recombination of alleles from plasmid pKOR1 (87). To construct the Δspa mutant, two 1-kb DNA fragments upstream and downstream of the spa gene were amplified from the chromosome of S. aureus WU1 using primers ext1F ext1F (5′GGGGACCACTTTGTACAAGAAAGCTGGGTCATTTAAGAAGATTGTTTCAGATTTATG 3′), ext1R (5′ATTTGTAAAGTCATCATAATATAACGAATTATGTATTGCAATACTAAAATC 3′), ext2F (5′CGTCGCGAACTATAATAAAAACAAACAATACACAACGATAGATATC 3′), and ext2R (5′GGGGACAAGTTTGTACAAAAAAGCAGGCAACGAACGCCTAAAGAAATTGTCTTTGC 3′). The two flanking regions were fused together in a subsequent PCR, and the final PCR product was cloned into pKOR1 using the BP Clonase II kit (Invitrogen). The resulting plasmids were serially transferred into E. coli DH5α, S. aureus strain RN4220, and S. aureus strain WU1, and the temperature was adjusted to 40°C to prevent plasmid replication and promote their insertion into the chromosome (87). Growth at 30°C was used to promote allelic replacement. The mutation in the spa gene was verified by DNA sequencing of the PCR amplification products.

[0366] 4. Agglutination test.

[0367] Agglutination experiments were performed as described previously (88). Briefly, overnight cultures of S. aureus strains were diluted 1:100 in fresh TSB and incubated at 37°C for 6 h. 6004.0) were incubated with SYTO 9 (1:500) (Invitrogen) for 15 minutes, washed twice with 1 mL PBS, and then suspended in 1 mL PBS. The bacteria were mixed with citrate-treated human plasma or mouse plasma at 1:1 and incubated on a microscope slide for 30 minutes. The samples were observed and images were captured on an IX81 live cell total internal reflection fluorescence microscope using a 20x objective (Olympus). At least 10 images were collected for each sample. The area of ​​the agglutination complex in each image was detected and quantified using ImageJ software.

[0368] 5. Immunoblotting.

[0369] Overnight cultures of S. aureus strains were diluted 1:100 into fresh TSB (with chloramphenicol in the presence of plasmids) and grown at 37°C to an OD of 6000.5 to 1.0. The cells from 1 mL of culture were centrifuged, suspended in PBS, and incubated with 20 μg / mL lysogeny staphylococci (AMBI) at 37°C for 1 hour. The proteins in the whole cell lysate were precipitated with 10% trichloroacetic acid and 10 μg deoxycholic acid, washed with ice-cold acetone, air-dried, suspended in 100 μL 0.5 mM TrisHCl (pH 6.8) and 100 μL SDS-PAGE sample buffer [100 mMTris HCl (pH 6.8), 4% SDS, 0.2% bromophenol blue, 200 mM dithiothreitol] and boiled for 10 minutes. The proteins were separated on 12% SDS-PAGE and electrotransferred to a PVDF membrane. The PVDF membrane was blocked with 5% milk in Tris-buffered saline containing Tween-20 (TBST) [20 mM Tris HCl (pH 7.6), 137 mM NaCl, 0.1% Tween-20]. ClfA was detected with mouse anti-ClfA 2A12.12 monoclonal antibody (1:2000 dilution) and horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Cell Signaling, 1:10000 dilution). Coa was detected with rabbit anti-Coa polyclonal antibody (1:1000 dilution) and HRP-conjugated anti-rabbit IgG (1:10000 dilution). Two different rabbit anti-vWbp polyclonal antibodies (1:1000 dilution), recognizing the full-length vWbp or the C-terminal domain of vWbp from Staphylococcus aureus Newman, respectively, and vWbp was detected using HRP-conjugated anti-rabbit IgG (1:10000 dilution). SpA was detected with HRP-conjugated human IgM in TBST (1:10000 dilution). SrtA was detected with rabbit anti-SrtA polyclonal antibody (1:10000 dilution) and HRP-conjugated anti-rabbit IgG (1:10000 dilution). The antibody-stained membrane was washed with TBST and incubated with SuperSignal West Pico chemiluminescent substrate (Thermo Scientific) and developed on Amersham Hyperfilm ECL high-performance chemiluminescent film (GE Healthcare).

[0370] 6. Purification of recombinant protein.

[0371] E. coli BL21(DE3) containing pET15b+ plasmid for expression of SpA with His tag KKAA, and 24 staphylococcal antigens (ClfA, ClfB, FnBPA, FnBPB, IsdA, IsdB, SasA, SasB, SasD, SasF, SasG, SasI, SasK, SdrC, SdrD, SdrE, EsxA, EsxB, SCIN, Eap, Efb, Hla, Coa, vWbp, and Ebh), grown overnight, diluted 1:100 in fresh medium, and grown at 37°C to approximately OD 600 The culture was induced with 1 mM isopropyl-β-d-thiogalactopyranoside and grown for an additional 3 hours. The cells were pelleted, resuspended in column buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl), and crushed by French Press at 14,000 lb / in 2 The lysate was broken under a pressure of 1.5 ℃. The membrane and insoluble components were removed by ultracentrifugation at 40,000 × g. The clarified lysate was subjected to Ni-NTA affinity chromatography and the protein was eluted in column buffer containing successively higher concentrations of imidazole (100 to 500 mM). The eluate was dialyzed against PBS and the protein purity was verified by Coomassie-stained SDS-PAGE. The protein concentration was determined by the BCA method (Thermo Scientific).

[0372] 7. Colonization of the nasopharynx of mice.

[0373] Overnight cultures of S. aureus strain WU1 and its Δspa mutant were diluted 1:100 into fresh TSB and grown for 2 h at 37°C. Cells were centrifuged, washed, and suspended in PBS. Seven-week-old female BALB / c, C57BL / 6J, or B6.129S2-Ighm tm1Cgn / J mice (Jackson Laboratory) were anesthetized by intraperitoneal injection of 100 mg / mL ketamine and 20 mg / mL xylazine per kg body weight. 8 CFU of Staphylococcus aureus (volume 10 μL) was transferred into the right nostril of each mouse. On days 7, 14, 21, 28, 35, and 42 after inoculation, the oropharynx of the mice was swabbed and the swab samples were incubated on Baird-Parker agar for bacterial counts. On day 15 after inoculation, the mice were bled by periorbital venipuncture to obtain serum for antibody response analysis using a staphylococcal antigen matrix. On day 42 after inoculation, fecal samples were collected and homogenized in PBS. The homogenate was plated on mannitol salt agar and incubated for bacterial counts. All mouse experiments were performed in accordance with institutional guidelines after review and approval of the experimental protocols by the Institutional Biosafety Committee (IBC) and the Institutional Animal Care and Use Committee (IACUC) of the University of Chicago. Animal experiments were repeated at least once to ensure the reproducibility of the data.

[0374] 8. Active immunization.

[0375] Four-week-old mice were injected subcutaneously with 50 μg of SpA emulsified in complete Freund's adjuvant (CFA; Difco). KKAA Immunization was performed and boosted 11 days after the initial immunization with 50 μg of the same antigen emulsified in incomplete Freund's adjuvant (IFA). On day 21, immunized mice were bled by periorbital venipuncture to obtain serum for ELISA. On day 24, mice were inoculated intranasally with 1×10 8 aureus strain WU1 or JSNZ and monitor nasopharyngeal colonization.

[0376] 9. Staphylococcal antigen matrix.

[0377] Nitrocellulose membranes were blotted with 2 μg of affinity-purified staphylococcal antigens. The membranes were blocked with 5% degranulated milk and incubated with diluted mouse serum (1:10,000 dilution) and IRDye 680-conjugated goat anti-mouse IgG (LI-COR). Signal intensity was quantified using the Odyssey infrared imaging system (LI-COR).

[0378] 10. Statistical analysis.

[0379] Two-way ANOVA was performed to analyze the statistical significance of the data for nasopharyngeal colonization, ELISA, and antigen matrix using Sidak's multiple comparison test (GraphPad Software).

[0380] Example 2 Staphylococcal protein A variants

[0381] The following assays can be used to assess the efficacy of the SpA variants described herein in the methods and compositions of the present disclosure.

[0382] A. Experiment

[0383] Vaccine protection in mouse abscess, mouse lethal infection and mouse pneumonia models. Three animal models for studying Staphylococcus aureus infectious diseases have been established. These models can be used to detect the level of protective immunity provided by the production of protein A-specific antibodies. Mouse abscess-BALB / c mice (24-day-old females, 8 to 10 mice per group, Charles River Laboratories, Wilmington, MA) can be immunized by intramuscular injection of purified protein into the hind legs (Chang et al., 2003; Schneewind et al., 1992). Purified SpA and / or SpA variants can be administered on day 0 (emulsified 1:1 with complete Freund's adjuvant) and day 11 (emulsified 1:1 with incomplete Freund's adjuvant). Blood samples can be drawn by retro-orbital bleeding on days 0, 11 and 20. The IgG titer of the serum is examined by ELISA to understand the specific binding activity of the variant. On day 21, 100 μL of Staphylococcus aureus Newman or Staphylococcus aureus USA300 suspension (1x10 7 cfu) to challenge the immunized animals. For this purpose, an overnight culture of S. aureus Newman can be diluted 1:100 into fresh tryptic soy broth and incubated at 37°C for 3 hours. Staphylococci can be centrifuged, washed twice and diluted in PBS to make A 600 0.4 (1x10 per m liter 8 cfu). Dilutions can be experimentally verified by agar flat-well plates and colony formation. Mice can be anesthetized by intraperitoneal injection of 80 mg to 120 mg of ketamine and 3 mg to 6 mg of xylazine per kg body weight and infected by retro-orbital injection. On day 5 or 15 after challenge, mice can be euthanized by inhalation of compressed CO2. Kidneys can be removed and homogenized in 1% Triton X-100. Aliquots can be diluted and plated on agar medium to determine cfu in triplicate. For histology, kidney tissue can be incubated in 10% formalin for 24 hours at room temperature. Tissue can be embedded in paraffin, sectioned, stained with hematoxylin, and examined by microscopy.

[0384] Murine lethal infection - BALB / c mice (24-day-old females, 8 to 10 mice per group, Charles River Laboratories, Wilmington, MA) can be immunized by intramuscular injection of purified SpA or SpA variants into the hind legs. The vaccine can be administered on day 0 (emulsified 1:1 with complete Freund's adjuvant) and day 11 (emulsified 1:1 with incomplete Freund's adjuvant). Blood samples can be drawn by retro-orbital bleeding on days 0, 11, and 20. The IgG titer with variant-specific binding activity in the serum can be examined by ELISA. A 100 μL S. aureus Newman or S. aureus USA300 suspension (15×10 7 cfu) to challenge the immunized animals. For this purpose, an overnight culture of S. aureus Newman can be diluted 1:100 into fresh tryptic soy broth and incubated at 37°C for 3 hours. Staphylococci can be centrifuged, washed twice, and diluted to A in PBS. 600 0.4 (1 x 10 per ml 8 cfu) and concentrated. The dilution can be verified experimentally by agar flat-well plates and colony formation. Mice can be anesthetized by intraperitoneal injection of 80mg to 120mg ketamine and 3mg to 6mg xylazine per kg body weight. On day 21, 2x10 10 cfu of Staphylococcus aureus Newman or 3x10 9 cfu to 10x10 9 Immunized animals are challenged with cfu of clinical S. aureus isolates. Animals can be monitored for 14 days and lethal disease can be recorded.

[0385] Murine pneumonia model - S. aureus strains Newman or USA300 (LAC) can be grown in tryptic soy broth / agar at 37°C to an OD of 660 A 50-mL culture aliquot can be centrifuged, washed in PBS, and then suspended in 750 μL PBS for mortality studies (3×10 8 CFU to 4x10 8 CFU) or 1250 μL PBS (2x10 per 30-μL volume 8CFU)) for bacterial load and histopathology experiments. For lung infection, 7-week-old C57BL / 6J mice (Jackson Laboratory) can be anesthetized before 30 μL of S. aureus suspension is inoculated into their left nostril. Animals can be placed in a cage in a supine position for recovery and observed for 14 days. For active immunization, 4-week-old mice can receive 20 μg of SpA variants in CFA by the im route on day 0, and then boosted with 20 μg of variants in incomplete Freund's adjuvant (IFA) on day 10. Animals can be challenged with S. aureus on day 21. Serum can be collected before immunization and on day 20 to evaluate the production of specific antibodies. For passive immunization studies, 7-week-old mice can be injected with 100 μL of NRS (normal rabbit serum) or SpA variant-specific rabbit antiserum by ip 24 hours before being challenged. In order to evaluate the pathological relevance of pneumonia, infected animals can be killed by forced inhalation of CO2 before removing both lungs. The right lung can be homogenized to calculate the lung bacterial load. The left lung can be embedded in 1% formalin paraffin, sectioned, stained with hematoxylin-eosin, and analyzed under a microscope.

[0386] Rabbit Antibodies - Purified SpA variants can be used as immunogens for the production of rabbit antiserum. The protein can be emulsified with CFA for injection on day 0, followed by booster injections with IFA emulsified protein on days 21 and 42. Rabbit antibody titers can be determined by ELISA. Purified antibodies can be obtained by affinity chromatography of rabbit serum on SpA-type agarose. 280 The concentration of the eluted antibody can be detected by measuring the absorbance at 400 nm, and the specific antibody titer can be determined by ELISA.

[0387] Active immunization using SpA variants. In order to determine vaccine efficacy, animals can be actively immunized with purified SpA variants. As a control group, animals can be immunized with adjuvant alone. SpA variants can be used as antigens to determine antibody titers against protein A preparations. Using the above-mentioned infectious disease model, any reduction in bacterial load (rat abscesses and pneumonia), histopathological evidence of staphylococcal disease (rat abscesses and pneumonia), and protection against lethal disease (rat lethal challenge and pneumonia) can be detected.

[0388] Passive immunization using affinity purified rabbit polyclonal antibodies produced for SpA variants. In order to determine the protective immunity of protein A specific rabbit antibodies, mice were passively immunized with purified SpA variant derived rabbit antibodies. Both antibody preparations were purified by affinity chromatography using immobilized SpA variants. As a control group, animals were passively immunized with rV10 antibodies (a plague protective antigen that has no effect on the results of staphylococcal infection). SpA variants were used as antigens to determine the antibody titers for all protein A preparations. Using the above-mentioned infectious disease model, the reduction of bacterial load (rat abscesses and pneumonia), histopathological evidence of staphylococcal disease (rat abscesses and pneumonia) and the protection of lethal diseases (rat lethal excitation and pneumonia) can be detected.

[0389] Bacterial strains and growth. Staphylococcus aureus strains Newman and USA300 can be grown in tryptic soy broth (TSB) at 37°C. Escherichia coli strains DH5α and BL21(DE3) can be grown in the presence of 100 μg mL -1 The cells were grown in Luria-Bertani (LB) broth containing ampicillin at 37°C.

[0390] Rabbit antibodies. SpA variants can be prepared according to standard recombinant techniques or synthetic protocols, and purified antigens can be covalently attached to HiTrap NHS-activated HP columns (GE Healthcare). Antigen-matrix can be used for affinity chromatography of 10 mL to 20 mL rabbit serum at 4°C. The charged matrix can be washed with 50 column volumes of PBS, and the antibody is eluted with elution buffer (1 M glycine, pH 2.5, 0.5 M NaCl) and immediately neutralized with 1 M Tris-HCl, pH 8.5. The purified antibody can be dialyzed against PBS at 4°C overnight.

[0391] F(ab)2 fragments. Affinity purified antibodies can be mixed with 3 mg of pepsin at 37°C for 30 minutes. The reaction can be quenched with 1 M Tris-HCl, pH 8.5, and the F(ab)2 fragments can be affinity purified using HiTrap NHS-activated HP columns coupled to specific antigens. Purified antibodies can be dialyzed against PBS at 4°C overnight, loaded onto SDS-PAGE gels and visualized with Coomassie blue staining.

[0392] Active and passive immunization. BALB / c mice (3 weeks old, female, Charles River Laboratories) can be immunized with 50 μg of protein emulsified in complete Freund's adjuvant (Difco) by intramuscular injection. For booster immunization, protein can be emulsified in incomplete Freund's adjuvant and injected 11 days after the primary immunization. On day 20 after immunization, 5 mice can be bled to obtain sera for specific antibody titers by enzyme-linked immunosorbent assay (ELISA).

[0393] Affinity purified antibodies in PBS can be injected into the peritoneal cavity of BALB / c mice (6 weeks old, female, Charles River Laboratories) at a concentration of 5 mg / kg body weight of the experimental animal 24 hours before challenge with S. aureus. Animal blood can be collected by periorbital venipuncture. Heparinized microhematocrit capillaries (Fisher) can be used to remove blood cells, and Z-gel serum separation microtubes (Sarstedt) can be used to collect and detect antigen-specific antibody titers by ELISA.

[0394] Mouse kidney abscess. Overnight cultures of Staphylococcus aureus Newman or USA300 (LAC) can be diluted 1:100 into fresh TSB and incubated at 37°C for 2 hours. Staphylococci can be grown at OD 600 0.4 (about 1×10 8 CFU mL -1 ) were precipitated, washed, and suspended in PBS. The inoculum can be quantified by plating aliquots of the sample on TSA and counting the colonies formed. BALB / c mice (6 weeks old, female, Charles River Laboratories) can be anesthetized by intraperitoneal injection of 100 mg / mL ketamine and 20 mg / mL xylazine per kg body weight. 1×10 7 CFU of Staphylococcus aureus Newman or 5 × 10 6 CFU of Staphylococcus aureus USA300 are infected with mice. On the 4th day after challenge, mice can be killed by inhalation of CO2. Both kidneys can be removed and the Staphylococcal load in one organ can be analyzed by homogenizing the kidney tissue with PBS, 1% Triton X-100. Serial dilutions of the homogenate are applied to TSA and incubated for bacterial counts. The remaining organs can be examined by histopathology. In brief, the kidneys can be fixed in 10% formalin for 24 hours at room temperature. The tissue can be embedded in paraffin, sectioned, stained with hematoxylin-eosin, and examined by light microscopy to enumerate abscess lesions. All mouse experiments can be performed in accordance with institutional guidelines after review and approval of the experimental protocols by the Institutional Biosafety Committee (IBC) and the Institutional Animal Care and Use Committee (IACUC) of the University of Chicago.

[0395] Protein A Binding. For human IgG binding, a Ni-NTA affinity column can be preloaded with 200 μg of purified protein (SpA variant) in column buffer. After washing, 200 μg of human IgG (Sigma) can be loaded onto the column. Protein samples can be collected from the wash and elution and subjected to SDS-PAGE gel electrophoresis followed by Coomassie blue staining. The purified protein (SpA variant) can be coated onto MaxiSorp ELISA plates (NUNC) at a concentration of 1 μg / mL in 0.1 M carbonate buffer (pH 9.5) overnight at 4°C. The plates can then be blocked and developed with 5% whole milk and then incubated for one hour with a series of dilutions of human peroxidase-conjugated human IgG, Fc, or F(ab)2 fragments. The plates can be washed and developed using OptEIA ELISA reagent (BD). The reaction can be quenched with 1 M phosphoric acid and A 450 Readouts were used to calculate half-maximal titers and percent binding.

[0396] Von Willebrand Factor (vWF) Binding Assay. Coating and blocking of purified protein (SpA variant) can be performed as described above. The developed wells can be incubated with 1 μg mL -1 The plates can be incubated with human vWF for two hours, followed by washing and blocking with human IgG for one hour. After washing, the developed plates can be incubated with serial dilutions of peroxidase-conjugated antibodies against human vWF for one hour. The plates can be washed and developed using OptEIA ELISA reagents (BD). The reaction can be quenched with 1M phosphoric acid, A 450 Readouts can be used to calculate half-maximal titers and percent binding. For inhibition assays, the plates can be incubated with affinity-purified F(ab)2 fragments specific for the SpA variant at 10 μg mL -1 Incubate for one hour.

[0397] Apoptosis of spleen cells. Affinity-purified proteins (150 μg SpA variants) can be injected into the peritoneal cavity of BALB / c mice (6 weeks old, female, Charles River Laboratories). Four hours after injection, animals were killed by inhalation of CO2. Their spleens can be removed and homogenized. Cell debris can be removed using a cell strainer, and suspended cells can be transferred to ACK lysis buffer (0.15M NH4Cl, 10mM KHCO3, 0.1mM EDTA) to lyse red blood cells. Leukocytes can be precipitated by centrifugation, suspended in PBS and stained with 1:250 diluted R-PE-coupled anti-CD19 monoclonal antibody (Invitrogen) in an ice bath and in the dark for one hour. Cells can be washed with 1% FBS and fixed overnight at 4°C with 4% formalin. The next day, cells can be diluted in PBS and analyzed by flow cytometry. The remaining organs can be examined histopathologically. In short, the spleen can be fixed in 10% formalin for 24 hours at room temperature. Tissues can be embedded in paraffin, sectioned, stained with an apoptosis detection kit (Millipore), and examined by light microscopy.

[0398] Antibody quantification. Sera can be collected from healthy human volunteers or BALB / c mice that have been infected with S. aureus Newman or USA300 for 30 days or have been immunized with the above SpA variants. Human / mouse IgG (Jackson Immunology Laboratories), SpA variants and CRM 197 Can be blotted onto nitrocellulose membranes. Membranes can be blocked with 5% whole milk and then incubated with human or mouse serum. IRDye 700DX coupled to affinity purified anti-human / mouse IgG (Rockland) can be used with Odyssey TMInfrared imaging system (Li-cor) quantitative signal intensity. The protocols involved in the experiments with human volunteer blood were reviewed, approved and implemented under the regulatory supervision of the Institutional Review Board (IRB) of the University of Chicago. Statistical analysis. Renal abscess, ELISA, B cell superantigen data can be statistically analyzed using a two-tailed t test. The variants described herein (such as the variants shown in Figures 12 to 15) can be tested by using these experiments. Additional analysis, such as SPR analysis, can be performed to determine the binding affinity of the new SpA variant to human VH3-IgG and human VH3-IgE compared to SpA, SpA / KKAA and SpA / KKAA / F (SpA*31) control groups. Manufacturability (the yield of purified SpA* variants / 1 gram of E. coli cells) can also be tested. CD spectroscopy can detect the α-helix content compared to SpA and SpA / KKAA. Protein stability during purification and storage at variable temperatures (4°C, 25°C and 37°C, 1 day to 7 days) can also be determined.

[0399] To test the safety and effectiveness of a drug, a basil histamine release test ( Fig.16 ) This test is known in the art (see, e.g., Kowal, K et al., 2005. Allergy and Asthma Proc. Vol. 26, No. 6). Briefly, human serum and / or basophils can be incubated at 37°C for 60 minutes. Histamine release can be detected from stimulated (by adding SpA variants) and unstimulated cells, and the results can be expressed as a percentage of histamine release to total histamine content. In certain aspects, histamine release> 16.5% is a positive test result in children and adult patients.

[0400] Example 3 SPA vaccine variants with improved safety

[0401] B. Results

[0402] 1. Gly of SpA vaccine candidate 29 Amino acid substitutions

[0403] The present inventors attempted to identify Gly 29 The amino acid substitutions at positions 1 and 2 result in the expression of IgG and SpA in humans. KK The largest reduction in affinity between the five IgBDs (EDABC) also carries the amino acid substitution Gln 9、10 Lys, which disrupts the interaction between SpA and Fcγ (48). To this end, the inventors constructed nineteen different plasmids encoding SpA with an N-terminal polyhistidine tag. Q9，10K / G29X, where X is any of the 19 natural amino acids (except glycine) provided by the genetic code. Q9，10K / G29X The proteins were purified by affinity chromatography on Ni-NTA resin, eluted, dialyzed, the concentration determined by BCA assay, and bound to the Bio-Rad ProteOn HTGchip at equal concentrations (250 nM). Each chip was subjected to surface plasmon resonance experiments using serially diluted human IgG or PBS control groups. The binding of human IgG to the SpA candidate vaccine loaded on the chip was recorded and the data were transformed to derive the binding constants for each protein (Table 4). As a control group, the inventors quantified wild-type SpA (K A 1.081×10 8 M -1 ) and SpA KKAA Human IgG (K A 5.022×10 5 M -1 ) binding constant. Q9，10K / G29X Protein, Gly 29 Four amino acid substitutions at position 1 resulted in a significant increase in the binding constant: Gly 29 Ser(K A 9.398×10 5 M -1 ), Gly 29 Lys(K a 9.738×10 5 M -1 ), Gly 29 Ile(K A 10.070×10 5 M -1 ) and Gly 29 Ala(K A 11.310×10 5 M -1 ), indicating that these variants bind to the vh3 variant heavy chain of human IgG better than SpA KKAA Closer (Table 4). SpA Q9，10K / G29A The observations were surprising to us. Gly in the ZZZZ construct used for commercial antibody purification (MabSelectSureTM) 29 Ala substitution reduced binding to VH3-IgG (150), while Gly 29 AlaGln in SpA-IgBD 9、10 The background of Lys may promote the V H 3-Moderate increase in IgG affinity. KKAA In comparison, Gly 29The 10 amino acid substitutions at the position did not result in significant differences in the following binding constants: Gly 29 Thr、Gly 29 Leu, Gly 29 Glu, Gly 29 pro、Gly 29 phe, Gly 29 Met、Gly 29 Val, Gly 29 Trp、Gly 29 Asp、Gly 29 Arg、Gly 29 Asn and Gly 29 Tyr (Table 4). Gly 29 Substitution of three additional amino acids at the KKAA In comparison, Gly 29 His(K a 1.435×10 5 M -1 ), Gly 29 Cys(K a 1.743×10 5 M -1 ) and Gly 29 Gln(K a 2.057×10 5 M -1 ) on human IgG (Table 4). 29 The amino acid substitution at Gly does not have a general effect on the binding of SpA-IgBD to human IgG. 29 Certain amino acid substitutions on the IgG and SpA Q9，10K / G29X , while other amino acid substitutions were neutral (no significant effect) or decreased affinity.

[0404] 2. Amino acid substitution at Ser33 of SpA vaccine candidate

[0405] To identify the causes of human IgG and SpA KK The position of SpA-IgBD with the greatest decrease in affinity between 33 The inventors constructed 19 different plasmids encoding N-terminal polyhistidine-tagged SpA Q9，10K / S33X , where X is any one of the 19 natural amino acids (except serine) provided by the genetic code. SpA Q9，10K / S33XProteins were purified by Ni-NTA resin affinity chromatography, eluted, dialyzed, concentration determined by BCA assay, and bound to Bio-Rad ProteOn HTG chips at equal concentrations (250 nM). Surface plasmon resonance experiments were performed on each chip with serially diluted human IgG and PBS controls. Binding of human IgG to the SpA candidate vaccine loaded on the chip was recorded and the data converted to binding constants for each protein (Table 5). 33 Two amino acid substitutions at Ser resulted in increased affinity for human IgG: 33 Gly(K A 11.180×10 5 M -1 ) and Ser 33 Ala(K A 10.540×10 5 M -1 ), indicating that these variants have a higher affinity for human IgG than for SpA KKAA (May be due to the V H 3 variants with increased affinity for the heavy chain) (Table 5). 33 The 14 amino acid substitutions at 33 Tyr, Ser 33 Leu, Ser 33 Trp, Ser 33 Val, Ser 33 His, Ser 33 Asn、Ser 33 Met, Ser 33 Arg, Ser 33 Asp, Ser 33 phe, Ser 33 Gln, Ser 33 pro、Ser 33 Cys and Ser 33 Lys (Table 5). Ser 33 The three amino acid substitutions at Q9，10K / S33X Affinity: Ser 33 Thr(K A 0.386×10 5 M -1 )、Ser 33 Glu(K A 0.496×10 5 M -1 ) and Ser 33 Ile(K A 1.840×10 5 M -1)(Table 5). Therefore, Ser 33 Certain amino acid substitutions at the Q9，10K / S33X , while the others were neutral (no significant effect) or reduced binding to human IgG. Among those that reduced affinity between human IgG, Ser 33 Glu and Ser 33 Thr showed the greatest decrease in binding constant (Table 5).

[0406] 3. Combining amino acid substitutions of Gly29, Ser33 and Asp36,37 in SpA vaccine candidates

[0407] With Ser 33 Compared with the single amino acid substitution at 29 , Ser 33 or Asp 36、37 Does the combination of amino acid substitutions at Ser cause a further decrease in affinity for human IgG, or do multiple substitutions have contradictory effects, which can also increase the affinity between the two proteins? To address this question, the inventors compared the amino acid substitutions at Ser 33 Binding constants of three proteins with amino acid substitutions at Q9，10K / S33E (reduced affinity), SpA Q9，10K / S33F (affinity is not affected) and SpA Q9，10K / S33Q (affinity is not affected) - in Gly 29 and / or Asp 36，37 Those carrying additional amino acid substitutions at the same position (Table 6). Q9，10K / S33E (K A 0.496×10 5 M -1 , no addition of replacement Gly was observed 29 Ala(K A 1.265×10 5 M -1 ), Gly 29 phe(K A 1.575×10 5 M -1 ), Asp 36，37 Ala(K A 0.568×10 5 M -1 ), Gly 29 Ala / Asp 36，37 Ala(K A 1.892×10 5 M -1 ) or Gly 29 Arg(KA 4.840×10 5 M -1 ) additional effect. However, 36、37 Ala and Gly 29 phe(K A 14.850×10 5 M -1 ) or Gly 29 Arg(K A 10.240×10 5 M -1 ) combination increases SpA Q9，10K / S33E Affinity for human IgG (Table 6). Q9，10K / S33F (K A 3.902×10 5 M -1 ) when its binding constant is similar to SpA KKAA The binding constants of Asp36, 37Ala and Gly 29 phe(SpA Q9，10K / S33Q / D36，37A / Gly29F K A 12.470×10 5 M -1 ) combination, no substitution changes SpA Q9，10K / S33F The affinity of SpA-IgBD to human IgG increased again, which increased the affinity of the parent vaccine to human IgG (Table 6). 29 , Ser 33 and Asp 36、37 The combination of amino acid substitutions at these sites does not reduce affinity for human IgG. In each case, the affinity of the recombinant SpA vaccine candidate needs to be determined experimentally.

[0408] SpA-KR is SpA KKAA A variant with two additional amino acid substitutions in the E domain of IgBD and a six-residue extension at its N-terminus with the amino acid sequence ADAQQN (International Patent Application WO 2015 / 144653AI). Inventors - Fabio Bagnoli, Luigi Fiaschi and Maria Scarselli (Glaxo-SmithKline INC.) - speculated that SpA KKAA The two glutamine (QQ) residues in the hexapeptide extension of the E domain of IgG may constitute an additional binding site for human IgG, but it is not specified where these residues may bind to immunoglobulins, i.e., Fcγ or V H When analyzing its affinity for human IgG, SpA-KR (KA 5.464×10 5 M -1 ) and SpA KKAA There was no significant difference in the binding constants between SpA-KR and V H 3-IgG showed cross-linking activity (Table 6). SpA RRVV It is a SpA vaccine variant described in patent application EP3101027A1 (OLYMVAX INC.). KKAA Similar, SpA RRVV Gln in each of the five IgBDs in SpA 9、10 and Asp 36、37 There are amino acid substitutions in all of the 5 genes, although these substitutions replace Gln with arginine (Arg or R). 9、10 , valine (Val or R) replaces Asp 36、37 When its affinity for human IgG was analyzed, SpA RRVV (K A 5.609×10 5 M -1 ) and SpA KKAA similarity, indicating that SpA RRVV It may also show V H 3- Cross-linking activity of IgG (Table 6).

[0409] 4. Cross-linking activity of SpA vaccine variants against VH3-idiotype and Fab fragments of human IgG

[0410] A key safety issue in the clinical development of SpA vaccines is the lack of V on the surface of basophils and mast cells. H 3-Idiotypic IgE and IgG cross-linking activity, which would otherwise trigger histamine release and allergic reactions (140, 142, 145). To quantify the VH3 cross-linking activity of SpA vaccine candidates, the inventors used purified human IgG (54% VH3 idiotypic variant heavy chains) cleaved with papain and SpA KK V purified by affinity chromatography on (75) H 3-cloned Fab fragments (Table 7). When the affinity to SpA and its variants was tested using surface plasmon resonance (SPR), the IgBD of wild-type protein A (SpA) showed efficient cross-linking activity (K A 1.44×10 7 M -1 , Table 7). SpA KKAA (K A 8.27×10 4 M -1) and SpA-KR (K A 6.42×10 4 M -1 ) for V H 3-Fab has a reduced affinity, although it binds to SpA Q9，10K / S33E (K A 41.24M -1 ) and SpA Q9，10K / S33T (K A 43.55M -1 ) compared to SpA (Table 7). Q9，10K / S33E and SpA Q9，10K / S33T The results showed similar binding properties to those of the PBS control group (i.e., the values ​​obtained when no ligand was added). 33 Glu and Ser 33 Thr respectively eliminated the candidate vaccine SpA Q9，10K / S33E and SpA Q9，10K / S33T V H 3-IgE and V H 3-IgG cross-linking activity.

[0411] 5. Fcγ binding activity of SpA vaccine variants

[0412] Deisenhofer solved the crystal structure of the SpA B domain (IgBD-B) bound to human Fcγ and determined the interface between the two molecules (154). Four hydrogen bonds promote the interaction between SpA (B domain numbering, Figure 20B) and Fcγ: Gln 9 (IgG Ser 254 )、Gln 10 (IgG Gln 311 ), Asn 11 (IgG Asn 434 ) and Tyr 14 (IgG Leu 432 )(54). These B domain residues are conserved in all five IgBDs (Figure 20), suggesting a common mechanism of Fcγ binding (43). Earlier work showed that replacement of Gln in all five IgBDs of IgBD-D or SpA 9、10 Lys reduces SpA KK (SpA Q9，10K ) binds to human, mouse, and guinea pig IgG Fcγ (76, 43). Q9，10K / S33E and SpA Q9，10K / S33T Gln is retained in its five IgBDs 9、10The inventors speculated that these variants should also show obvious defects in binding to human Fcγ. To verify this hypothesis, the inventors used purified human IgG cleaved with papain and purified the resulting Fcγ fragments (Table 8). When the affinity detection of SpA and its variants was examined using biolayer interferometry (BLI), the IgBD of wild-type protein A had no significant effect on Fcγ (K A 5.17×10 7 M -1 ) showed high affinity. SpA KKAA (K A 32.68M -1 )、SpA-KR(K A 39.12M -1 ), SpA Q9，10K / S33E (K A 32.68M -1 ) and SpA Q9，10K / S33T (K A 39.91M -1 ) were respectively eliminated. 33 Glu and Ser 33 Thr substitution does not interfere with Gln 9、10 Lys to SpA Q9，10K / S33E and SpA Q9，10K / S33T The effect of Fcγ binding in helix 1 of β-catenin was investigated (Table 8).

[0413] 6. Mouse Model of Allergic Activity of SpA Vaccine Candidates

[0414] Clinical and experimental studies have shown that vascular hyperpermeability is a hallmark of allergic reactions (155, 156). Activated mast cells or basophils release vasoactive mediators, including histamine and platelet-activated factor, which induce allergic reactions of vascular hyperpermeability by causing vasodilation and endothelial barrier disruption (156). These events can be detected in a mouse model of allergic vascular hyperpermeability because extravasation of the intravenously administered dye Evans blue at the experimental site (ear tissue) is prevented 24 hours before intradermal injection of 2 μg of human V H 3-idiotypic IgG was prepared (157). Vascular leakage of Evans blue into ear tissue was then quantified (ng dye / mg tissue) in cohorts of five animals, mean and standard deviation (SD) calculated, and data analyzed for statistically significant differences. Plasma from wild-type C57BL / 6 mice contains only 5% to 10% of V H 3-idiotypic variant heavy chain immunoglobulins (48). Thus, compared with guinea pigs (20% to 30% of V H3-idiotypic variant heavy chain) are different, mice are resistant to SpA-induced anaphylactic shock (140). Therefore, the inventors chose μMT mice for their studies; these animals lack functional IgM B cell receptors, arrest B cell development at the pre-B cell stage, and cannot produce plasma IgG (158). μMT mice were used as recipients and 2 μg of human V H 3-Idiotypic IgG was injected intradermally into the ear tissue. 24 hours later, 200 μg of SpA, SpA vaccine variants, or a buffer control group (PBS) were injected intravenously into the mice. 5 minutes after SpA treatment, a 2% Evans blue solution was injected intravenously into the mice to assess vascular permeability in the ear tissue. 30 minutes later, the animals were euthanized, and the ear tissue was excised, dried, and extracted with formamide for spectrophotometric quantification of the dye. Compared with the PBS control group [34.73 (±) 8.474 ng Evans blue / mg ear tissue], SpA treatment caused allergic vascular hyperpermeability, releasing 124.9 ng / mg (± 26.54 ng / mg) Evans blue (PBS vs. SpA, P < 0.0001) (Figure 22). After intradermal injection of human V H In the 3-IgG pretreated group, SpA was injected i.v. KKAA It also caused vascular hyperpermeability [70.31 ng / mg (±23.04 ng / mg); PBS vs. SpAKKAA, P < 0.01], although the level was lower than that of wild-type SpA (SpA vs. SpA KKAA , P < 0.0001) (Figure 22). In contrast, intravenous injection of 200 μg SpA Q9，10K / S33E [38.57ng / mg (±15.07ng / mg); SpA Q9，10K / S33E Compared with PBS, no significant Q9，10K / S33T [41.43ng / mg (±13.15ng / mg); SpA Q9，10K / S33T Compared with PBS, there was no significant difference in the number of μMT mice treated with V H 3-Idiotypic human IgG treated sites did not cause vascular hyperpermeability (Figure 22). In comparison, the SpA-KR candidate vaccine induced the same KKAA Similar allergic vascular hyperpermeability (Figure 22). KKAA Different, SpA and SpA KKAA By cross-linking V bound to FcεRI on activated mast cells and basophils H 3 Idiotypic IgG or FcγR on other effector cells triggers vascular hyperpermeability, but SpA Q9，10K / S33E and SpA Q9，10K / S33T Cannot crosslink V H3 idiotypic IgG to promote μMT mice in V H 3- Allergic reaction occurred at the site pretreated with idiotypic human IgG.

[0415] 7.V H 3-IgE cross-linking of SpA vaccine candidates

[0416] Basophils and mast cells are two major effector cells of allergic reactions and secrete proinflammatory mediators upon antigen-mediated cross-linking of IgE to their surface receptor FcεRI. Staphylococcus aureus Cowan I strain expressing large amounts of SpA or soluble purified SpA can activate basophils to induce histamine release. This stimulatory effect depends on the Fab binding activity of protein A (145). To investigate the potential cross-linking effects of SpA vaccine candidates with circulating IgE or IgG bound to the surface of basophils, vaccine variants purified in PBS were added to freshly drawn human blood anticoagulated with EDTA for 30 minutes. Wild-type SpA was used as a positive control group. PBS was used as a negative control group. Cells were stained with anti-CD123, anti-CD203c, anti-HLA-DR (to remove dendritic cells and monocytes), and anti-CD63. SSC low CD203c + / CD123 + / HLA-DR- cells were gated to identify basophils. CD123 basophil activation was expressed as a ratio of CD63 and corrected for negative and positive controls. SpA or SpA KKAA CD63 + The number of activated basophils increased significantly, to 32.05% (PBS vs. SpA, P < 0.0001) and 10.66% (PBS vs. SpA, P < 0.0001). KKAA , P<0.01) (Table 9). KKAA In contrast, SpA Q9，10K / S33E [5.38%; SpA Q9，10K / S33T Relative to SpA KKAA , P<0.05] or SpA Q9，10K / S33T [4.57%; SpA Q9，10K / S33T Relative to SpA KKAA , P < 0.01] failed to activate basophils and behaved similarly to the PBS control group (Table 9). In this experiment, SpA-KR [8.15%] and SpA RRVV [10.16%] Candidate vaccines show efficacy against SpA KKAA Similar basophil activation. Therefore, SpA Q9，10K / S33E and SpA Q9，10K / S33TIt is unable to cross-link circulating IgE in the blood and cannot sensitize basophils by binding to the high-affinity receptor FcεRI. Q9，10K / S33 and SpA Q9，10K / S33 Different, SpA KKAA , SpA-KR and SpA RRVV The candidate vaccine retained significant IgE cross-linking activity, thereby triggering unwanted systemic allergic reactions.

[0417] The functional response of mast cells was detected by antigen-triggered β-hexosaminidase and histamine release. The human mast cell line LAD2 was used in this experiment. Mast cells (2x10 5 Cells / mL) were sensitized after overnight incubation with 100 ng / mL VH3 IgE, and then stimulated with SpA vaccine variants (10 μg) for 30 minutes, and the release of β-hexosaminidase (Figure 23A) or histamine (Figure 23B) was detected. Incubation with wild-type SpA induced the release of about 35% of β-hexosaminidase. SpA KKAA The SpA-KR and SpA-KR vaccines induced the release of 10.32% and 9.87% of β-hexosaminidase, respectively, with no significant difference (SpA-KR vs. SpA KKAA , not significant). These decreases were significant compared to SpA wild type (SpA relative to SpA KKAA , P < 0.0001; SpA vs. SpA-KR, P < 0.0001). However, SpA KKAA The SpA-KR vaccine retained the β-hexosaminidase release activity above the level of the negative control group (SpA KKAA P < 0.0001 vs. PBS; P < 0.0001 for SpA-KR vs. PBS) (Fig. 23A). Q9，10K / S33E [6.46%; SpA Q9，10K / S33E Relative to SpA KKAA , P<0.01] and SpA Q9，10K / S33T [4.43%; SpA Q9，10K / S33T Relative to SpA KKAA , P<0.0001] and the release of β-hexosaminidase and SpA KKAA Compared with the previous study, SpA Q9，10K / S33E and SpA Q9，10K / S33T The release of β-hexosaminidase was similar to that of the PBS control group ( FIG. 23A ).

[0418] Similar results were obtained when assessing histamine release (Figure 23B). SpA stimulated the highest level of histamine release; Sp AKKAA The SpA-KR vaccine retained histamine release activity above the level of the PBS control group, and SpAQ9，10K / S33E and SpA Q9，10K / S33T All behaved like the negative control PBS [SpA relative to PBS or SpA KKAA or SpA-KR or SpA Q9，10K / S33E or SpA Q9，10K / S33T , P<0.0001; SpA KKAA Relative to SpA-KR or SpA Q9，10K / S33E , not significant; SpA KKAA Relative to SpA Q9，10K / S33T or PBS, P < 0.05; SpA Q9，10K / S33T Compared with SpA-KR, P<0.01].

[0419] In conclusion, SpA Q9，10K / S33E and SpA Q9，10K / S33T Has lost activation V H 3-idiotypic IgE-sensitized mast cells and represents a vaccine candidate with a safety profile suitable for human clinical trials.

[0420] 8. Immunogenicity and efficacy of SpA vaccine candidates in a Staphylococcus aureus colonization model

[0421] Compared with C57BL / 6 mice immunized with adjuvant alone (mock), SpA KKAA or SpA Q9，10K / S33E or SpA Q9，10K / S33T Immunization produced SpA neutralizing antibodies (Figure 25A). As expected, SpA KKAA Immunization induced decolonization of S. aureus WU1 from the nasopharynx and gastrointestinal tract of C57BL / 6 mice starting 21 days after intranasal colonization (Figure 24AB-C). In addition, in decolonized mice, SpA KKAA Immunization was associated with increased pathogen-specific IgG (including anti-ClfB, anti-IsdA, anti-IsdB, and anti-SasG) antibodies, which have been associated with decolonization with S. aureus [(102) and data not shown]. Q9，10K / S33E Similar results were observed after immunization of C57BL / 6 mice. Compared with the mock control group, SpA Q9，10K / S33E Vaccination and SpA KKAA Vaccination similarly promoted decolonization of the nasopharynx and gastrointestinal tract of C57BL / 6 mice with S. aureus WU1 (Fig. 24BC). Q9，10K / S33E Vaccination was associated with an increase in pathogen-specific IgG (including anti-ClfB, anti-IsdA, anti-IsdB, and anti-SasG; data not shown). KKAA Compared with immunized animals, SpA Q9，10K / S33EVaccination induced similar levels of S. aureus decolonization, indicating that both vaccines exhibited similar protective efficacy in the mouse colonization model. Q9，10K / S33 T vaccination triggers a link with SpA KKAA and SpA Q9，10K / S33E When SpA was administered on the same day, similar levels of S. aureus decolonization were achieved (data not shown). KKAA or SpA Q9，10K / S33 E or SpA Q9，10K / S33 When the animals were immunized with T, approximately 50% of the animals were decolonized in the nasopharynx and gastrointestinal tract, whereas all animals that received only the adjuvant (mock) remained colonized ( Fig.24D E). The data also demonstrated that all three vaccine candidates performed similarly in a model of colonization with S. aureus.

[0422] 9. Efficacy of SpA vaccine candidate in a mouse model of Staphylococcus aureus bloodstream infection

[0423] Early work showed that SpA KKAA Immunization of BALB / C mice elicited SpA-specific antibodies that protected the animals from intravenous MRSA USA300 LAC bloodstream challenge and subsequent formation of abscess lesions in renal tissue (43). Compared with mock (adjuvant alone) immunized mice, SpA KKAA , SpA Q9，10K / S33E or SpA Q9，10K / S33 T immunity can significantly produce SpA KKAA , SpA Q9，10K / S33E or SpA Q9，10K / S33 When SpA was analyzed by ELISA, the KKAA In BALB / c mice, SpA KKAA The SpA-specific antibody titers induced by immunization were significantly higher than those of SpA Q9，10K / S33E or SpA Q9，10K / S33T The analysis results (SpA KKAA Relative to SpA Q9，10K / S33E , P<0.0001; SpA KKAA Relative to SpA Q9，10K / S33T , P < 0.0001). In a similar manner, when SpA was analyzed by ELISA Q9，10K / S33E When SpA Q9，10K / S33 The SpA-specific antibody titer induced by E immunization was significantly higher than that of SpA KKAA or SpA Q9，10K / S33T (SpA KKAA Relative to SpA Q9，10K / S33E , P<0.001; SpA Q9，10K / S33ERelative to SpA Q9，10K / S33T , P < 0.05) analysis results, while SpA was analyzed by ELISA Q9，10K / S33T In BALB / c mice, SpA Q9，10K / S33T The SpA-specific antibody titers induced by immunization were significantly higher than those of SpA KKAA or SpA Q9，10K / S33E The analysis results (SpA KKAA Relative to SpA Q9，10K / S33T , P<0.05; SpA Q9，10K / S33E Relative to SpA Q9，10K / S33 T, P<0.05) (Fig. 25A). These results indicate that SpA Q9，10K / S33E and SpA Q9，10K / S33T Epitopes of antibodies generated by vaccination, similar to those of SpA KKAA The epitopes of antibodies generated by vaccination differed only in some but not all epitopes, and vice versa. As reported earlier (43), SpA KKAA Vaccination reduced the bacterial load of MRSAUSA300 LAC and the number of abscess lesions in BALB / c mice (Figure 25B; P < 0.0001). KKAA Compared with vaccination, SpA Q9，10K / S33E and SpA Q9，10K / S33T Vaccination resulted in similar protection against MRSA USA300 LAC bloodstream infection compared with mock-immunized animals. Q9，10K / S33E and SpA Q9，10K / S33T Immunization reduced the bacterial load and the number of abscess lesions in BALB / c mice (Fig. 25C; P < 0.0001). Q9，10K / S33E and SpA Q9，10K / S33T Vaccination elicited similar protection against MRSA USA300 LAC bloodstream infection and associated abscess formation in mice as previously reported for SpA KKAA Candidate vaccines (43).

[0424] 10. Combination of SpA vaccine candidate with SpA neutralizing monoclonal antibody 3F6

[0425] Mouse hybridoma monoclonal antibody (hMAb) 3F6 (IgG2a) was generated using KKAA-immunized BALB / c mice (84). The gene for hMAb 3F6 was sequenced and cloned into an expression vector used to purify recombinant rMAb 3F6 from HEK293 F cells (146). Both hMAb3F6 and rMAb 3F6 bind to the triple helical fold of each of the five SpA IgBDs (E, D, A, B, and C) and neutralize their ability to bind to human IgG or IgM (84, 146). Intravenous injection of hMAb3F6 or rMAb 3F6 at a dose of 5 mg / kg protected BALB / c mice from S. aureus bloodstream infection associated with renal abscess formation and bacterial replication (bacterial load) (84, 146). In addition, intravenous injection of rMAb 3F6 (5 mg / kg) into C57BL / 6 mice induced decolonization of the nasopharynx and gastrointestinal tract of pre-implanted animals with S. aureus WU1 (146). Here, the inventors asked whether rMAb 3F6 could bind to SpA KKAA Binds SpA with similar affinity Q9，10K / S33 E or SpA Q9，10K / S33T , SpA KKAA is the homologous antigen from which the monoclonal antibody was derived (84). When tested by ELISA using a fixed concentration of ligand and serial dilutions of rMAb 3F6, the present inventors deduced that SpA KKAA (K a 1.51×10 10 M -1 ), SpA Q9，10K / S33E (K a 1.42×10 10 M -1 ) and SpA Q9，10K / S33T (K a 1.34×10 10 M -1 ) binding affinity constants of the SpA candidate vaccine ( FIG. 26 ). These data suggest that amino acid substitutions of Ser 33 Glu and Ser 33 Thr did not affect the binding of SpA-neutralizing rMAb 3F6. 33 Glu and Ser 33 Thr does not disrupt the protective SpA epitope determined by rMAb 3F6 binding.

[0426] C. Discussion

[0427] The inventors show here that when the F(ab)2 fragment of human IgG is used as a ligand, the Staphylococcus aureus vaccine candidate - SpA KKAA and SpA-KR-retained with V H 3- Significant binding of idiotypic immunoglobulins.H When analyzed with 3-IgG coated human mast cells (LAD2 cells), SpA KKAA and SpA-KR will trigger V H 3-Ig cross-linking, as measured by the release of β-hexosaminidase and histamine (145). In a mouse model of allergic vascular hyperpermeability, the biological effects of this histamine release were visualized by the expression of Evans blue dye in μMT mice. H 3-IgG was measured as extravasation to the anatomical site of administration. Together, these observations raise concerns about the safety of SpA vaccine candidates as potential activators of allergic responses in humans.

[0428] To solve the problem of SpA vaccine, the inventors designed two new antigens SpA Q9，10K / S33E and SpA Q9，10K / S33T , with higher security. SpA Q9，10K / S33E and SpA Q9，10K / S33T V H 3-Idiotypic immunoglobulins lack affinity for V H 3-IgE-coated human mast cells have reduced or no activity in releasing histamine and do not promote Evans blue dye extravasation in response to V in μMT mice H 3-IgG injection. With SpA Q9，10K / S33 E and SpA Q9，10K / S33T Immunization of BALB / c mice induced SpA KKAA Similar levels of SpA-specific IgG responses were observed in mice when the vaccine efficacy was analyzed. Q9，10K / S33E or SpA Q9，10K / S33T Available with SpA KKAA The vaccine provided similar levels of protection against S. aureus colonization or invasive bloodstream infection (43). In addition, amino acid substitutions of Ser 33 Glu and Ser 33 Thr does not interfere with the protective IgBD epitope defined by the monoclonal antibody 3F6 that protects against S. aureus colonization and invasive disease (84, 146). Based on these observations, the inventors hypothesized that the candidate S. aureus vaccine SpA Q9，10K / S33E and SpA Q9，10K / S33T May be suitable for development into a clinical-grade vaccine for clinical safety and efficacy testing against S. aureus colonization and invasive disease.

[0429] D. Materials and Methods

[0430] Bacterial strains and growth conditions. Staphylococcus aureus strains USA300 (LAC) and WU1 were grown in tryptic soy broth (TSB) or tryptic soy agar (TSA) at 37°C. Escherichia coli strains DH5α and BL21 (DE3) were grown in lysogeny broth (LB) medium containing 100 μg / mL ampicillin and 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) at 37°C for the production of recombinant proteins.

[0431] Construction of SpA variants. The coding sequence of the SpA variant was synthesized by Integrated DNA Technologies, Inc. The sequence and plasmid pET15b+ were digested by NdeI and BamHI, respectively. The two digestion products were then ligated and transformed into E. coli DH5α to generate clones expressing N-terminal hexahistidine (His6)-tagged recombinant proteins. Candidate clones were verified by DNA sequencing. The correct plasmid was transformed into E. coli BL21 (DE3) for the production of SpA candidate variants.

[0432] Purification of protein. E. coli culture (2 liters) grown in LB supplemented with ampicillin and IPTG was centrifuged (10,000 × g, 10 minutes) with an absorbance of 2.0 at 600 nm (A600). The precipitated cells were suspended in buffer A (50 mM Tris-HCl [pH 7.5], 150 mM NaCl), and the resulting suspension was lysed in a cell disruptor at a pressure of 14,000 lb / in2 (Thermo Spectronic, Rochester, NY). Unbroken cells were removed by centrifugation (5,000 × g for 15 minutes), and the crude lysate was subjected to ultracentrifugation (100,000 × g, 1 hour at 4°C). Soluble recombinant proteins were chromatographed on Ni-NTA agarose (QIAGEN) by gravity flow, with a filling volume of 1 mL, pre-equilibrated with buffer A. The column was washed with 20 bed volumes of buffer A containing 10 mM imidazole and eluted with 6 mL of buffer A containing 500 mM imidazole. An aliquot of the eluted portion was mixed with an equal volume of sample buffer and separated on a 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. The recombinant protein was dialyzed against phosphate buffered saline (PBS) and its concentration was determined using the bicinchoninic acid assay (Pierce). For animal immunization studies and incubation with cell lines, the recombinant protein preparation was passed through an endotoxin removal spin column (Pierce) to eliminate contaminating LPS. Sample purity was tested using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript).

[0433] Purification of antibodies. To purify VH3 IgG, human plasma (20 mL) prepared from whole human blood was subjected to affinity chromatography on protein G resin (Genscript) to remove human IgM, IgD, and IgA. The immunoglobulins eluted from the protein G resin were subjected to a second affinity chromatography, and SpA KK - Coupling resin to enrich VH3 IgG [SpA KK It is unable to bind to the Fcγ domain of IgG (48). Protein G resin and SpA KK The coupled resin was washed with 20 column volumes of PBS, and the bound protein was eluted with 0.1M glycine, pH 3.0, neutralized with 1M Tris-HCl, pH 8.5, and dialyzed with PBS overnight. For VH3IgE purification, the human cell line HEK293F was used to transiently express pVITRO1-Transtuzumab-IgE-κ. Cells were grown in DMEM / high glucose medium containing 10% FCS, 2mM glutamine, penicillin (5000U / mL) and streptomycin (100μg / mL). Cells transfected with pVITRO1-Transtuzumab-IgE-κ were incubated at 37°C in a 5% CO2 atmosphere using PE. For stable expression of IgE, cells were cultured in Freestyle 293 medium for 7 days and then harvested at 12000xg for 20 minutes. The supernatant was purified with 2mL protein L resin (Genscript). The resin was washed with 20 column volumes of PBS, and the bound VH3IgE was eluted with 0.1 M glycine, pH 3.0, neutralized with 1 M Tris-HCl, pH 8.5, and dialyzed against PBS overnight.

[0434] Surface plasmon resonance (SPR) technology. The SPR experiments shown in Tables 4, 5, 6, and 8 were performed using the ProteOnHTG chip on the ProteOn TM The results were carried out on XPR36. The running buffer was PBS containing 0.05% Tween-20. The sensor chip surface was activated with 2mM nickel sulfate and regenerated with 300mM EDTA. 500nM of the test sample (SpA wild type or variant) was fixed at a flow rate of 25μL / min. In order to detect the interaction with wild-type SpA, ligands (purified immunoglobulins) were used at concentrations of 500nM, 400nM, 300nM, 200nM and 100nM. In order to detect the interaction with SpA variants, the ligand concentrations used were 4μM, 3μM, 2μM, 1μM and 0.5μM. The binding and dissociation rates were detected at a continuous flow rate of 30μL / min and analyzed using a two-state reaction model. The binding constant was determined by three independent experiments.

[0435] Biolayer interferometry (BLI). The BLI experiments shown in Table 8 were performed using a BLItz biolayer interferometer. Test candidates (25nM-50nM) were immobilized on a Ni-NTA sensor for 120 seconds. The sensor was balanced with PBS for 80 seconds, then immersed in a solution containing ligands at concentrations of 20μM, 15μM, 10μM and 0μM for 120 seconds (binding phase), then immersed in PBS for 120 seconds (dissociation phase). Data were collected using BLI data acquisition software 9.0 (FortéBIO) and analyzed using data analysis software 9.0.0.14 (FortéBIO). The reported binding values ​​were calculated from the curve fitting model.

[0436] Enzyme-linked immunosorbent assay (ELISA). Purified antigens were coated overnight at 4°C in 0.1M carbonate buffer at 1 μg / mL (to detect antibody titers in test sera) or 0.5 μg / mL (to detect interactions with 3F6 antibodies) in microtiter plates (NUNC MaxiSorp) (pH 9.5). The wells were blocked and incubated with test sera or 3F6 antibodies before incubation with mouse or human IgG (1 μg / mL, Jackson ImmunoResearch) coupled to horseradish peroxidase (HRP). All plates were incubated with mouse HRP-coupled specific secondary antibodies (Fisher Scientific) and developed using OptEIA reagents (BD Biosciences). Half-maximum titers were calculated using GraphPad Prism software. Binding constants were calculated from the nonlinear regression (curve fitting) model in GraphPad Prism software. All experiments were repeated three times to calculate the mean and standard error of the mean, and repeated to test their repeatability.

[0437] Allergic reactions in μMT mice. Mice with μMT mutations were purchased from Jackson Laboratories and raised at the University of Chicago. Groups of 5 6-week-old female mice were sensitized by intradermal injection of ...

Claims

1. An isolated polypeptide consisting of a SpA variant, the SpA variant comprising variant domains A to E, wherein the domain D polypeptide is as shown in SEQ ID NO: 2, the domain E polypeptide is as shown in SEQ ID NO: 3, the domain A polypeptide is as shown in SEQ ID NO: 4, the domain C polypeptide is as shown in SEQ ID NO: 5, and the domain B polypeptide is as shown in SEQ ID NO: 6, wherein the SpA variant: (i) having lysine substitutions at the glutamine residues at positions 7 and 8 of SEQ ID NO: 4 in domain A; having lysine substitutions at the glutamine residues at positions 7 and 8 of SEQ ID NO:6 in domain B; having lysine substitutions at the glutamine residues at positions 7 and 8 of SEQ ID NO:5 in domain C; having lysine substitutions at the glutamine residues at positions 9 and 10 of SEQ ID NO: 2 in domain D; having lysine substitutions at the glutamine residues at positions 6 and 7 of SEQ ID NO: 3 in domain E; and (ii) having a glutamic acid substitution at position 31 of SEQ ID NO: 4 in domain A; In domain B, SEQ ID NO:6 has a glutamic acid substitution at position 31; SEQ ID NO:5 has a glutamic acid substitution at position 31 in domain C; In domain D, position 33 of SEQ ID NO: 2 has a glutamic acid substitution; having a glutamic acid substitution at position 30 of SEQ ID NO:3 in domain E; and wherein the isolated polypeptide does not detectably crosslink IgG and IgE in blood or activate basophils or mast cells relative to a negative control, and wherein the only substitutions in the SpA variant are (i) and (ii).

2. The isolated polypeptide according to claim 1, wherein the isolated polypeptide has a K of VH3 from human IgG. A The binding affinity is less than 1x10 5 M -1 .

3. The isolated polypeptide of claim 1, wherein the SpA variant has a K of VH3. D Binding affinity greater than 1.0x10 -2 M.

4. A composition comprising the isolated polypeptide of any one of claims 1 to 3.

5. The composition of claim 4, wherein the composition comprises less than 1% by weight of protein excluding the isolated polypeptide based on the amount of total protein.

6. The composition of claim 4, wherein the composition further comprises an adjuvant.

7. The composition of claim 6, wherein the isolated polypeptide is coupled to an adjuvant.

8. The composition of claim 6, wherein the adjuvant comprises alum.

9. The composition according to claim 4, further comprising a pharmaceutically acceptable excipient.

10. Use of the composition according to claim 4 in the preparation of a vaccine for eliciting a safe immune response against Staphylococcus, wherein an effective amount of the composition according to claim 4 is administered to a human patient.

11. The use according to claim 10, wherein the Staphylococcus aureus comprises the WU1 or JSNZ strain of Staphylococcus aureus.

12. The use according to claim 10, wherein the Staphylococcus comprises an ST88 type isolate or any other human Staphylococcus now adapted to animals.

13. The use according to any one of claims 10 to 12, wherein the human patient is a pediatric patient.

14. The use according to claim 13, wherein the pediatric patient is 2 years old or younger.

15. The use according to any one of claims 10 to 12, wherein the human patient is 65 years old or older.

16. Use according to any one of claims 10 to 12, wherein the human patient is a healthcare worker.

17. The use according to any one of claims 10 to 12, wherein the isolated polypeptide or composition is administered in four doses, and wherein the interval between doses is at least four weeks.

18. Use according to claims 10 to 12, wherein the composition further comprises an adjuvant.

19. The use according to claim 18, wherein the isolated polypeptide is coupled to an adjuvant.

20. The use according to claim 18, wherein the adjuvant comprises alum.

21. The use according to claim 18, wherein the composition further comprises a pharmaceutically acceptable excipient.

22. Use of the composition of claim 4 in the preparation of a vaccine for treating or preventing a Staphylococcal infection in a subject.

23. The use according to claim 22, wherein the Staphylococcus aureus comprises the WU1 or JSNZ strain of Staphylococcus aureus.

24. The use according to claim 22, wherein the Staphylococcus comprises an ST88 type isolate or any other human Staphylococcus now adapted to animals.

25. The use according to claim 22, wherein the subject is a human patient.

26. The use according to claim 25, wherein the human patient is a pediatric patient.

27. The use according to claim 26, wherein the pediatric patient is 2 years old or younger.

28. The use according to claim 25, wherein the human patient is 65 years old or older.

29. The use according to claim 25, wherein the human patient is a health care worker.

30. The use according to any one of claims 22 to 24, wherein the isolated polypeptide or composition is administered in four doses, and wherein the interval between doses is at least four weeks.

31. The use according to claim 22, wherein the Staphylococcus aureus is Staphylococcus aureus.

32. Use according to claim 31, wherein the Staphylococcus is resistant to one or more than one treatment.

33. The use according to claim 32, wherein the Staphylococcus aureus is resistant to methicillin.

34. The use according to any one of claims 22 to 24, wherein the isolated polypeptide or composition is administered to the subject more than once.

35. The use according to any one of claims 22 to 24, wherein the composition is administered orally, parenterally, subcutaneously, intramuscularly or intravenously.

36. The use of any one of claims 22 to 24, wherein a composition comprising a second Staphylococcus antigen is administered to the subject.

37. The use according to claim 36, wherein the second Staphylococcal antigen is one or more than one of Emp, EsxA, EsxB, EsaC, Eap, Ebh, EsaB, Coa, vWbp, vWh, Hla, SdrC, SdrD, SdrE, IsdA, IsdB, IsdC, ClfA, ClfB and SasF.

38. The use according to any one of claims 22 to 24, wherein the subject is a mammal.

39. The use according to any one of claims 22 to 24, wherein the subject does not show any signs of toxicity from the isolated polypeptide or composition.

40. The use according to claim 39, wherein the subject does not show any signs of anaphylactic shock from the isolated polypeptide or composition.

41. Use of the composition according to claim 4 in the preparation of a medicament for decolonizing Staphylococcus or preventing Staphylococcus colonization or recolonization in a subject, wherein an effective amount of the composition is administered to the subject.

Images