Rice SNP markers and applications thereof

Abstract

The application discloses a SNP marker and application thereof. The SNP marker is T or C at the 23th base from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, or the SNP marker is A or G at the 43th base from the 5' end of the nucleotide sequence shown in SEQ ID NO:1. The SNP marker is closely related to the rice variety, and can be effectively used for qualitative or quantitative detection of the rice variety.

Description

Technical Field

[0001] This invention relates to SNP tagging and its applications. Background Technology

[0002] Daohuaxiang No. 2 was bred by breeder Tian Yongtai in the autumn of 2000 from Wuyoudao No. 1. This variety matures late and has a low yield, but it has high economic benefits. It began large-scale planting in Wuchang City in 2004 and was officially named "Wuyoudao No. 4," becoming a representative of Wuchang rice. Daohuaxiang No. 2 not only has a fragrant aroma after threshing, but the fragrance of the leaves and the rice grains can also be smelled while the rice is growing in the field.

[0003] Wuyou No. 4 rice is of high quality and rich in nutrients. Steamed rice from it is fragrant and the grains are translucent and jade-like, earning it the reputation of "century-old tribute rice" and making it highly popular among consumers. However, Wuyou No. 4 rice has a low yield and low milling rate, resulting in a relatively high price. Therefore, there are instances in the market where other rice varieties with similar grain shapes and appearances are mixed with Wuyou No. 4 rice for sale. Thus, how to easily, accurately, and quickly determine the purity of Wuyou No. 4 rice has been a persistent and challenging problem.

[0004] The general method for detecting adulteration in the Wuyou No. 4 rice variety relies on the visual observation and tasting experience of experienced rice experts. The method is as follows: First, the appearance of Wuyou No. 4 rice is distinctive; the grains are long, slightly wider at the sprouting end, and at least 80% of 100 grains should have this shape. Second, the color is not very appealing, with brown spots, unlike the yellowish-brown color of other rice varieties. Third, the surface of the rice has some cracks. However, this method relies heavily on human senses, and the accuracy depends heavily on the knowledge and experience of the person performing the test, making it prone to misjudgment. Furthermore, judging by appearance and aroma is inaccurate, making quantitative detection of adulteration in Wuyou No. 4 difficult. Additionally, grain shape is related to maturity, and the aroma of rice is affected by external environmental factors such as climate in different years; therefore, sensory detection of adulteration in Wuyou No. 4 rice has certain limitations.

[0005] Rice varieties can be identified using the SSR marker method (NY / T 1433-2014) or the SNP marker method (NY / T 2745-2015). However, these two methods are not only cumbersome and time-consuming, but they can also only determine whether the rice variety is consistent with the original variety and cannot make a quantitative judgment on adulteration.

[0006] Rice companies have a specific need for variety identification when purchasing Wuyou No. 4 rice. They hope to find a simple, easy-to-operate, and quick method to identify the rice variety to ensure that the purchased rice is indeed high-purity Wuyou No. 4. Reagents and methods for qualitative and quantitative detection of adulteration in Wuyou No. 4 rice are still needed in this field. Summary of the Invention

[0007] This invention proposes a SNP marker related to the Wuyou Rice No. 4 variety that can be effectively used for rice variety detection. Using this SNP marker, highly efficient and sensitive Wuyou Rice No. 4 rice-specific primers and probes are designed to detect sample DNA, thereby realizing the quantitative determination of the purity of Wuyou Rice No. 4 rice variety and effectively solving the problem of quantitative identification of other rice varieties mixed in with Wuyou Rice No. 4 rice variety.

[0008] Specifically, the present invention provides an isolated nucleic acid molecule from the rice slender rod gene (SPINDLY gene), which contains a first SNP marker and an optional second SNP marker, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the rice genome and is T or C, and the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome and is A or G.

[0009] In one or more embodiments, the nucleic acid molecule is a fragment of the rice slender stem gene with a length of at least 5 bp. In one or more embodiments, the nucleic acid molecule has a length of at least 10 bp, 15 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, or 1 kb. In one or more embodiments, the nucleic acid molecule has a length of 10 bp-600 bp, 50-500 bp, 100-400 bp, 150-300 bp, or 200-250 bp.

[0010] In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes at least the nucleotide sequence shown in SEQ ID NO:1, or at least the nucleotide sequence shown in SEQ ID NO:8 or 10, or at least the nucleotide sequence shown in SEQ ID NO:9 or 11.

[0011] In one or more embodiments, the nucleotide sequence of the nucleic acid molecule includes SEQ ID NO:12.

[0012] In one or more embodiments, the first SNP is labeled as: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C; the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0013] The present invention also provides primers for detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the rice genome and is T or C, and the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome and is A or G.

[0014] In one or more embodiments, the first SNP is labeled as: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C; the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0015] In one or more embodiments, the primers are selected from: (1) the sequences shown in SEQ ID NO:2 and 3 or sequences that hybridize with SEQ ID NO:8 or 10 under stringent conditions or sequences that are at least 90% identical to them; (2) the sequences shown in SEQ ID NO:4 and 3 or sequences that hybridize with SEQ ID NO:9 or 11 under stringent conditions or sequences that are at least 90% identical to them; and (3) a mixture of the sequences shown in (1) and (2).

[0016] The present invention also provides probes for detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the rice genome and is T or C, and the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome and is A or G.

[0017] In one or more embodiments, the first SNP is labeled as: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C; the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0018] In one or more embodiments, the probe includes (1) a Wuyou Rice No. 4 probe that identifies SEQ ID NO: 8 or 9 or a fragment thereof, the fragment containing the 23rd base from the 5' end of SEQ ID NO: 8, or the 100th base from the 5' end of SEQ ID NO: 9, and optionally (2) a Wuyou Rice No. 4 probe that identifies SEQ ID NO: 8 or 9 or a fragment thereof, the fragment containing the 43rd base from the 5' end of SEQ ID NO: 8, or the 130th base from the 5' end of SEQ ID NO: 9.

[0019] In one or more embodiments, the probe further includes (3) a non-Wuyou Rice No. 4 probe that identifies SEQ ID NO: 10 or 11 or a fragment thereof, the fragment containing the 23rd base from the 5' end of SEQ ID NO: 10, or containing the 100th base from the 5' end of SEQ ID NO: 11, and optionally (4) a non-Wuyou Rice No. 4 probe that identifies SEQ ID NO: 10 or 11 or a fragment thereof, the fragment containing the 43rd base from the 5' end of SEQ ID NO: 10, or containing the 120th base from the 5' end of SEQ ID NO: 11.

[0020] In one or more embodiments, the probe recognizes SEQ ID NO:9 or 11 or a fragment thereof, the fragment comprising the 100th base from the 5' end and optionally the 120th base of SEQ ID NO:9 or 11. Exemplarily, the probe comprises one or more of the following: (1) a probe recognizing SEQ ID NO:9 or a fragment thereof, the fragment comprising the 100th base from the 5' end of SEQ ID NO:9, the base being T; (2) a probe recognizing SEQ ID NO:11 or a fragment thereof, the fragment comprising the 100th base from the 5' end of SEQ ID NO:11, the base being C; (3) a complementary sequence of (1) or (2). Optionally, the probe further comprises one or more of the following: (1) a probe that recognizes SEQ ID NO:9 or a fragment thereof, the fragment comprising the 120th base from the 5' end of SEQ ID NO:9, the base being A; (2) a probe that recognizes SEQ ID NO:11 or a fragment thereof, the fragment comprising the 120th base from the 5' end of SEQ ID NO:11, the base being A or G; and (3) a complementary sequence to (1) or (2). Preferably, the probe has the nucleotide sequence shown in (1) SEQ ID NO:5 or 6, or a sequence that hybridizes to any of SEQ ID NO:8-11 under highly stringent conditions, or a mutant having 70% sequence identity with it, or (2) a complementary sequence to (1).

[0021] Preferably, the probe that detects the second SNP marker enhances the genotyping specificity of the HRM detection method.

[0022] The present invention also provides a kit containing reagents for detecting a first SNP marker in the rice genome, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the rice genome and is either T or C.

[0023] In one or more embodiments, the first SNP is labeled as: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C.

[0024] In one or more embodiments, the kit comprises primers for detecting a first SNP marker and optionally probes for detecting a first SNP marker and optionally nucleic acid molecules having a first SNP marker.

[0025] In one or more embodiments, the kit further comprises a reagent for detecting a second SNP marker in the rice genome, wherein the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome and is either A or G.

[0026] In one or more embodiments, the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0027] In one or more embodiments, the kit comprises primers for detecting a second SNP marker and optionally probes for detecting a second SNP marker and optionally nucleic acid molecules having a second SNP marker.

[0028] In one or more embodiments, the kit comprises: primers as described in any embodiment herein, optionally probes as described in any embodiment herein, and optionally nucleic acid molecules as described in any embodiment herein.

[0029] In one or more embodiments, the kit comprises: the sequence shown in SEQ ID NO:2 and 3 or the sequence hybridizing with SEQ ID NO:8 or 10 under stringent conditions or the sequence having at least 90% identity with it or the complementary sequence thereof, and optionally a nucleic acid molecule whose nucleotide sequence includes at least the nucleotide sequence shown in SEQ ID NO:1 or the complementary sequence thereof, or at least the nucleotide sequence shown in SEQ ID NO:8 or 10 or the complementary sequence thereof, or at least the nucleotide sequence shown in SEQ ID NO:9 or 11 or the complementary sequence thereof.

[0030] In one or more embodiments, the kit further comprises: the sequence shown in SEQ ID NO:4 and 3 or a sequence hybridizing with SEQ ID NO:9 or 11 under stringent conditions or a sequence having at least 90% identity with it or a complementary sequence thereof, and optionally the nucleotide sequence shown in SEQ ID NO:5 or 6 or a sequence hybridizing with any of SEQ ID NO:8-11 under stringent conditions or a mutant having 70% sequence identity with it or a complementary sequence thereof.

[0031] The present invention also provides a method for identifying rice varieties, comprising: (1) detecting a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker and the second SNP marker are located on chromosome 8 of the rice genome, wherein the first SNP marker is located at position 27996894 on chromosome 8 and the second SNP marker is located at position 27996914 on chromosome 8; and (2) identifying the rice variety based on the first SNP and the optional second SNP, wherein if the first SNP is TT, it is identified as Wuyou Rice No. 4; otherwise, it is identified as Non-Wuyou Rice No. 4. Optionally, if the second SNP is AA, it is identified as Non-Wuyou Rice No. 4 Rice Group I; if the second SNP is GG, it is identified as Non-Wuyou Rice No. 4 Rice Group II.

[0032] In one or more embodiments, the first SNP is labeled as: the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C; or the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0033] In one or more embodiments, the method further includes identifying rice varieties based on a detected first SNP, wherein the first SNP of Wuyou Rice No. 4 is TT, and the first SNP of non-Wuyou Rice No. 4 is CC.

[0034] In one or more embodiments, the method further includes identifying rice varieties based on detected second SNPs, wherein the second SNP of non-Wuyou Rice No. 4 group I is AA and the second SNP of non-Wuyou Rice No. 4 group II is GG.

[0035] In one or more embodiments, the method further includes identifying rice varieties based on a detected first SNP and a second SNP, wherein the first SNP of Wuyou Rice No. 4 is TT, the first SNP of non-Wuyou Rice No. 4 is CC, the second SNP of non-Wuyou Rice No. 4 rice group I is AA, and the second SNP of non-Wuyou Rice No. 4 rice group II is GG.

[0036] In one or more embodiments, the detection comprises PCR, more preferably, the detection is quantitative real-time PCR or HRM detection.

[0037] The present invention also provides a method for detecting the content or purity of Wuyou Rice No. 4 in a sample, the method comprising the step of amplifying the sequences of a first SNP marker and an optional second SNP marker in the rice genome, wherein the first SNP marker and the second SNP marker are located on chromosome 8 of the rice genome, wherein the first SNP marker is located at position 27996894 on chromosome 8 and is T or C, and the second SNP marker is located at position 27996914 on chromosome 8 and is A or G.

[0038] In one or more embodiments, the first SNP is labeled as: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T; the second SNP is labeled as: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A.

[0039] In one or more embodiments, the method further includes determining the content or purity of Wuyou Rice No. 4 based on the amplification results of a first SNP marker and an optional second SNP marker. Wherein, the amplification result of the first SNP being TT indicates the content or purity of Wuyou Rice No. 4; the amplification result of the first SNP being CC indicates the content or proportion of non-Wuyou Rice No. 4. Optionally, the second SNP of Wuyou Rice No. 4 does not contain G. Optionally, the second SNP being AA indicates non-Wuyou Rice No. 4 rice group I, and GG indicates non-Wuyou Rice No. 4 rice group II.

[0040] In one or more embodiments, the amplification is quantitative real-time PCR, and the method further includes using 2... -ΔΔCT The method was used to determine the content or purity of Wuyou Rice No. 4.

[0041] More preferably, the 2 -ΔΔCT The method includes: comparing the CT values ​​of probes that identify the first SNP marker and the optional second SNP marker in the sample with the CT values ​​of the endogenous reference probe, and comparing the comparison results with the ΔCT of the control, and using the obtained ΔCT to determine the content or purity of Wuyou Rice No. 4.

[0042] Specifically, the method for detecting the content or purity of Wuyou Rice No. 4 in a sample includes: quantitative real-time PCR detection of the CT value of the probe recognizing the first SNP marker and optionally the second SNP marker, and the CT value of the probe recognizing the endogenous reference; subtracting the two values ​​to obtain the sample ΔCT; subtracting the sample ΔCT from the control ΔCT, where the control is a 100% Wuyou Rice No. 4 sample or a 100% non-Wuyou Rice No. 4 sample; and raising the negative number of ΔΔCT to the square to obtain the relative content value, which is used for quantitative determination of Wuyou Rice No. 4 and non-Wuyou Rice No. 4 in the sample. In one or more embodiments, the probe recognizing the first SNP marker and optionally the second SNP marker has the nucleotide sequence shown in SEQ ID NO: 5 or 6. In one or more embodiments, the probe recognizing the endogenous reference has the nucleotide sequence shown in SEQ ID NO: 7.

[0043] The present invention also provides reagents for detecting a first SNP marker in the rice genome and optionally reagents for detecting a second SNP marker in the rice genome for use in identifying rice varieties or detecting the content or purity of Wuyou Rice No. 4, or in preparing kits for identifying rice varieties or detecting the content or purity of Wuyou Rice No. 4, wherein the first SNP marker is located at position 27996894 on chromosome 8 of the rice genome and is T or C, and the second SNP marker is located at position 27996914 on chromosome 8 of the rice genome and is A or G.

[0044] In one or more embodiments, the first SNP marker of the rice genome is: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C. The second SNP marker is: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G.

[0045] In one or more embodiments, the reagent comprises primers as described in any embodiment herein and optionally probes as described in any embodiment herein and optionally nucleic acid molecules as described in any embodiment herein.

[0046] In one or more embodiments, rice varieties are identified based on the first SNP detected, wherein the first SNP of Wuyou Rice No. 4 is TT, and the first SNP of non-Wuyou Rice No. 4 is CC.

[0047] In one or more embodiments, rice varieties are identified based on the detected second SNP, wherein the second SNP of non-Wuyou Rice No. 4 group I is AA and the second SNP of non-Wuyou Rice No. 4 group II is GG.

[0048] In one or more embodiments, rice varieties are identified based on the detected first SNP and second SNP, wherein the first SNP of Wuyou Rice No. 4 is TT and the second SNP is AA, the first SNP of non-Wuyou Rice No. 4 is CC, the second SNP of non-Wuyou Rice No. 4 rice group I is AA, and the second SNP of non-Wuyou Rice No. 4 rice group II is GG. Attached Figure Description

[0049] Figure 1 : Primer and probe positions for HRM detection and fluorescence probe method in Wuyou Rice No. 4 and non-Wuyou Rice No. 4.

[0050] Figure 2 HRM classification diagram of Wuyou Rice No. 4 and other non-Wuyou Rice No. 4 rice varieties.

[0051] Figure 3 Graphs showing quantitative data of different contents of Wuyou Rice No. 4 and non-Wuyou Rice No. 4 standard samples. Graph A, from left to right: 0% non-Wuyou Rice No. 4 standard sample, 5% non-Wuyou Rice No. 4 standard sample, 10% non-Wuyou Rice No. 4 standard sample, 20% non-Wuyou Rice No. 4 standard sample; 50% non-Wuyou Rice No. 4 standard sample, 80% non-Wuyou Rice No. 4 standard sample, 90% non-Wuyou Rice No. 4 standard sample, 95% non-Wuyou Rice No. 4 standard sample, 100% non-Wuyou Rice No. 4 standard sample. Graph B, from left to right: 100% Wuyou Rice No. 4 standard sample, 95% Wuyou Rice No. 4 standard sample, 90% Wuyou Rice No. 4 standard sample, 80% Wuyou Rice No. 4 standard sample; 50% Wuyou Rice No. 4 standard sample, 20% Wuyou Rice No. 4 standard sample, 10% Wuyou Rice No. 4 standard sample, 5% Wuyou Rice No. 4 standard sample, 0% Wuyou Rice No. 4 standard sample.

[0052] Figure 4 : Purity test of Wuyou Rice No. 4 blind samples. From left to right: 0% non-Wuyou Rice No. 4 standard sample, 5% non-Wuyou Rice No. 4 standard sample, 50% non-Wuyou Rice No. 4 standard sample, 95% non-Wuyou Rice No. 4 standard sample, 100% non-Wuyou Rice No. 4 standard sample, rice sample 1, rice sample 2, rice sample 3. Detailed Implementation

[0053] The inventors used SSR high-throughput sequencing of the Wuyoudao No. 4 rice variety to identify the unique sequences that distinguish Wuyoudao No. 4 from other rice varieties. By specifically detecting the nucleic acid sequences of specific sites in Wuyoudao No. 4 compared with those of other rice varieties, they determined whether other rice varieties had been adulterated in Wuyoudao No. 4 rice. They also introduced endogenous reference genes and reference samples to conduct quantitative analysis of adulteration in Wuyoudao No. 4 rice.

[0054] Specifically, the present invention relates to SNP markers related to rice varieties, primers and kits for detecting the SNP markers, the use of the SNP markers, primers and kits in rice variety detection, and methods for detecting rice varieties.

[0055] The inventors discovered that SNP1 at position 27996894 and SNP2 at position 27996914 of chromosome 8 are associated with rice varieties. Specifically, SNP1 is the 23rd base (T or C) from the 5' end of the nucleotide sequence shown in SEQ ID NO:1; SNP2 is the 43rd base (A or G) from the 5' end of the nucleotide sequence shown in SEQ ID NO:1. The nucleotide sequence shown in SEQ ID NO:1 is as follows:

[0056] TGCCCATGATTCATAACTGTCA Y GTTACCTAATTTCAGAACT R TTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO: 1).

[0057] In this article, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level. The polymorphism exhibited by SNP usually involves only variations in a single base, such as transitions, transversions, insertions, and deletions.

[0058] In this article, rice varieties refer to rice lines with different traits that have been selected and bred. In this article, Wuyou Rice No. 4 is also known as Daohuaxiang No. 2. The inventors discovered that the SNP1 of Wuyou Rice No. 4 is homozygous TT, while the SNP1 of non-Wuyou Rice No. 4 is homozygous CC; the SNP2 of Wuyou Rice No. 4 is homozygous AA, while the SNP2 of non-Wuyou Rice No. 4 is homozygous GG and AA. Therefore, by detecting the above-mentioned SNP1 or SNP1 and SNP2 in a sample, it is possible to effectively determine whether the rice variety is Wuyou Rice No. 4 or a non-Wuyou Rice No. 4.

[0059] The term "sample" as used herein refers to any type of polynucleotide-containing sample derived from the object. Preferably, the sample described herein is derived from or contains rice plant organs, tissues, cells, nucleic acids, or products containing rice plant organs, tissues, cells, nucleic acids, including but not limited to rice leaves, roots, stems, flowers, fruits, seeds, cells, DNA, RNA, rice, broken rice, rice bran, rice husks, and processed or unprocessed rice foods such as rice noodles or rice vermicelli. The DNA may be genomic DNA.

[0060] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleotides (DNA) or ribonucleotide polymers (RNA) in single-stranded or double-stranded form, and their complements. Nucleic acids contain synthetic, non-natural, or modified nucleotide bases. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms thereof. Examples of polynucleotides considered herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA. DNA can be a coding strand or a non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining and fragmenting genomic DNA are well known in the art.

[0061] The basic building blocks of DNA are deoxyribonucleotides, which are chain-like molecules formed by phosphodiester condensation. Each deoxyribonucleotide consists of a phosphate group, a deoxyribose sugar, and a base. The main bases (bp) of DNA are adenine (A), guanine (G), cytosine (C), and thymine (T). In the double helix structure of double-stranded DNA, A and T are paired by hydrogen bonds, and G and C are paired by hydrogen bonds. DNA can take the form of cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA can be of any length, for example, 50-500 bp, 100-400 bp, 150-300 bp, or 200-250 bp.

[0062] The term "primer" as used herein refers to a nucleic acid molecule with a specific nucleotide sequence that guides the synthesis of nucleotides at the initiation of nucleotide polymerization. Primer compositions contain one or more primers. Primers are typically two artificially synthesized oligonucleotide sequences; one primer is complementary to one DNA template strand at one end of the target region, and the other primer is complementary to another DNA template strand at the other end of the target region. Their function is to serve as the initiation point for nucleotide polymerization. Artificially designed primers are widely used in polymerase chain reaction (PCR), qPCR, sequencing, and probe synthesis. Primers can be of any length, such as 5-200 bp, 10-100 bp, 20-800 bp, or 25-50 bp.

[0063] The primers of this invention are used for the detection of SNPs. The primers may be nucleic acid molecules that recognize any of SEQ ID NO:8-11. In some embodiments, the primers have (1) the nucleotide sequence shown in any of SEQ ID NO:2-4 or a mutant having at least 70% sequence identity with it, or (2) the complementary sequence of (1). In one or more embodiments, the primers are primer pairs having sequences shown in SEQ ID NO:2 and 3 or SEQ ID NO:3 and 4, respectively. When discussing primers, the “recognition” primers described herein hybridize with the template sequence under stringent or highly stringent conditions, and the fragment amplified by the paired primers covers the 23rd and / or 43rd base from the 5' end of SEQ ID NO:8 or 10, or covers the 100th and / or 120th base from the 5' end of SEQ ID NO:9 or 11. The stringent conditions for nucleic acid hybridization described herein are known to those skilled in the art. Preferably, the conditions are such that the sequences are at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other, generally maintaining hybridization. A non-limiting example of stringent hybridization conditions is hybridization at 65°C in a high-salt buffer containing 6xSSC, 50mM Tris-HCl (pH 7.5), 1mM MEDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg / ml denatured salmon sperm DNA, and optionally washing once or twice at 50°C in 0.2xSSC and 0.01% BSA.

[0064] This invention can also employ probes to detect the SNPs described herein. The term "probe" as used herein refers to a nucleic acid sequence (DNA or RNA) that recognizes a target sequence (complementary to the target sequence). The probe binds to the target gene through molecular hybridization, generating a hybridization signal that reveals the target gene. The probe may include the entire target sequence or a fragment of the target sequence. The probe may be DNA or RNA transcribed from it. Typically, the probe carries a detection label, such as a fluorescent label. Such fluorescent labels include, but are not limited to, FAM, CY5, and VIC. Fluorescent labels suitable for the probes described herein and methods for ligating them to the probes are known in the art.

[0065] In this document, the probe includes a Wuyou Rice No. 4 probe that identifies SEQ ID NO: 8 or 9 or a fragment thereof, said fragment containing the 23rd base from the 5' end of SEQ ID NO: 8, optionally containing the 43rd base, or the 100th base from the 5' end of SEQ ID NO: 9, optionally containing the 120th base. Optionally, the probe may also include a non-Wuyou Rice No. 4 probe that identifies SEQ ID NO: 10 or 11 or a fragment thereof, said fragment containing the 23rd base from the 5' end of SEQ ID NO: 10, optionally containing the 43rd base, or the 100th base from the 5' end of SEQ ID NO: 11, optionally containing the 120th base.

[0066] In one or more embodiments, the probe includes (1) a Wuyou Rice No. 4 probe that identifies SEQ ID NO: 8 or 9 or a fragment thereof, the fragment containing the 23rd base from the 5' end of SEQ ID NO: 8, or the 100th base from the 5' end of SEQ ID NO: 9, and optionally (2) a Wuyou Rice No. 4 probe that identifies SEQ ID NO: 8 or 9 or a fragment thereof, the fragment containing the 43rd base from the 5' end of SEQ ID NO: 8, or the 130th base from the 5' end of SEQ ID NO: 9. The probe may also include (3) a non-Wuyou Rice No. 4 probe that identifies SEQ ID NO: 10 or 11 or a fragment thereof, the fragment containing the 23rd base from the 5' end of SEQ ID NO: 10, or the 100th base from the 5' end of SEQ ID NO: 11, and optionally (4) a non-Wuyou Rice No. 4 probe that identifies SEQ ID NO: 10 or 11 or a fragment thereof, the fragment containing the 43rd base from the 5' end of SEQ ID NO: 10, or the 120th base from the 5' end of SEQ ID NO: 11.

[0067] Exemplarily, the probe includes one or more of the following: (1) a probe that recognizes SEQ ID NO:9 or a fragment thereof, the fragment containing the 100th base from the 5' end of SEQ ID NO:9, the base being T; (2) a probe that recognizes SEQ ID NO:11 or a fragment thereof, the fragment containing the 100th base from the 5' end of SEQ ID NO:11, the base being C; and (3) a complementary sequence of (1) or (2). In another embodiment, the probe further includes one or more of the following: (1) a probe that recognizes SEQ ID NO:9 or a fragment thereof, the fragment containing the 120th base from the 5' end of SEQ ID NO:9, the base being A; (2) a probe that recognizes SEQ ID NO:11 or a fragment thereof, the fragment containing the 120th base from the 5' end of SEQ ID NO:11, the base being A or G; and (3) a complementary sequence of (1) or (2). Preferably, the probe has (1) the nucleotide sequence shown in SEQ ID NO:5 or 6 or a mutant having 70% sequence identity with it, or (2) the complementary sequence of (1). When discussing the probe, “identification” as used herein refers to hybridization of the probe with the template sequence under stringent or highly stringent conditions, and said hybridization covers the 23rd and / or 43rd base from the 5' end of SEQ ID NO:8 or 10, or covers the 100th and / or 120th base from the 5' end of SEQ ID NO:9 or 11.

[0068] The term "variant" or "mutant" in this document refers to a polynucleotide whose nucleic acid sequence is altered compared to a reference sequence by the insertion, deletion, or substitution of one or more nucleotides while retaining its ability to hybridize with other nucleic acids. Mutants described in any embodiment of this document include nucleotide sequences having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity with a reference sequence (such as SEQ ID NO: 1-12 described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, NCBI's BLASTn. Mutants also include nucleotide sequences having one or more mutations (insertions, deletions, or substitutions) in the reference sequence and nucleotide sequences while still retaining the biological activity of the reference sequence. The multiple mutations typically refer to 1-10, for example 1-8, 1-5, or 1-3. Substitutions can be substitutions between purine nucleotides and pyrimidine nucleotides, or substitutions between purine nucleotides or between pyrimidine nucleotides. Substitutions are preferably conserved substitutions. For example, in the art, conservative substitution with nucleotides of similar or identical properties generally does not alter the stability and function of polynucleotides. Conservative substitutions include, for example, the interchange of purine nucleotides (A and G) and pyrimidine nucleotides (T or U and C). Therefore, replacing one or more sites in the polynucleotides of the present invention with residues from the same source will not substantially affect their activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% sequence identity with the primers (e.g., SEQ ID NO: 2-4) or probes (e.g., SEQ ID NO: 5-7) described in the present invention, preferably, these mutants can hybridize with the corresponding DNA sequences containing SEQ ID NO: 8, 9, 10, or 11 under highly stringent conditions. These highly stringent conditions may be hybridization and washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0069] Another aspect of the present invention provides a method for detecting rice varieties in a sample, comprising identifying or quantifying the rice variety by detecting the SNP markers described herein in the sample to be tested. The method further comprises: (1) extracting DNA from the sample to be tested; (2) identifying or quantifying the genotype of the SNP markers described herein in the DNA using primers and / or probes described herein; and (3) identifying or quantifying the rice variety based on the result of (2). Wherein, the rice variety with the first SNP being TT is Wuyou Rice No. 4, and Wuyou Rice No. 4 can be detected and identified using conventional methods for detecting SNPs in the art, such as quantitative fluorescent probe assay or high-resolution melting curve assay (HRM), the procedures and reagents used in these methods are well known in the art. Furthermore, since the rice variety with the second SNP containing G is not Wuyou Rice No. 4, combining the second SNP can more accurately genotype non-Wuyou Rice No. 4 varieties, for example, using the high-resolution melting curve assay (HRM). In one implementation, the HRM high-resolution melting curve method is used to detect the first and second SNPs to classify non-Wuyou Rice No. 4 into group I, group II, and Wuyou Rice. Group I of non-Wuyou Rice No. 4 is characterized by a first SNP of CC and a second SNP of AA. Group II of non-Wuyou Rice No. 4 is characterized by a first SNP of CC and a second SNP of GG.

[0070] In one or more embodiments, the non-Wuyou Rice No. 4 group I includes: Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 3, Nanjing 9108, and Xudao 9. In one or more embodiments, the non-Wuyou Rice No. 4 group II includes: Liaoxing 1, Longyang 11, Longyang 16, Longdao 18, Jihong 6, Liuyouxiang, Taiyou 390, and Meixiangzhan 2.

[0071] In this paper, the method for extracting DNA from samples is not particularly limited, and DNA extraction methods known in the art and applicable to this paper are applicable.

[0072] The SNP marker detection methods known in the art and applicable to this paper include, but are not limited to: sequencing, single-strand conformation polymorphism polymerase chain reaction (PCR-SSCP), real-time quantitative PCR with high-resolution melting curve analysis (HRM), fluorescent probe-based quantitative PCR, restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP), and time-of-flight mass spectrometry. Other reagents required for SNP marker detection methods, besides primers and / or probes, are also known in the art.

[0073] According to some specific examples of the present invention, a method for determining or quantifying rice varieties by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; performing quantitative real-time PCR on the DNA using primers SEQ ID NO: 2 and 3 to obtain amplification products; performing HRM analysis on the amplification products to obtain the genotype of the SNP markers described herein in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP markers.

[0074] According to other specific examples of the present invention, a method for determining or quantifying rice varieties by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; performing quantitative real-time PCR on the DNA using primers SEQ ID NO:3 and 4, probes SEQ ID NO:5 and 6, and a reference probe SEQ ID NO:7; analyzing the PCR results to obtain the genotype of the SNP markers described herein in the DNA; and determining or quantifying the rice variety based on the genotype of the SNP markers.

[0075] For example, a method for detecting the content or purity of Wuyou Rice No. 4 in a sample includes: quantitative real-time PCR detection of the CT value of a probe recognizing a first SNP marker and an optional second SNP marker, and the CT value of a probe recognizing an endogenous reference; subtracting the CT values ​​from the CT values ​​to obtain the sample ΔCT; subtracting the sample ΔCT from the control ΔCT, where the control is a 100% Wuyou Rice No. 4 sample or a 100% non-Wuyou Rice No. 4 sample; and raising the negative ΔCT to the square to obtain a relative content value, used for quantitative determination of Wuyou Rice No. 4 and non-Wuyou Rice No. 4 in the sample. In one or more embodiments, the probe recognizing the first SNP marker and the optional second SNP marker has the nucleotide sequence shown in SEQ ID NO: 5 or 6. In one or more embodiments, the probe recognizing the endogenous reference has the nucleotide sequence shown in SEQ ID NO: 7.

[0076] The present invention also provides a kit containing reagents for detecting a first SNP marker in the rice genome of the present invention, wherein the first SNP marker in the rice genome is: the 100th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is T or C; or the 23rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is T or C. Optionally, the kit further contains reagents for detecting a second SNP marker in the rice genome of the present invention, wherein the second SNP marker is: the 120th nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:4 and 3 as primers, which is A or G; or the 43rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using rice genomic DNA as a template and SEQ ID NO:2 and 3 as primers, which is A or G. The reagents may be the primers and / or probes described in any embodiment of this invention. Optionally, the kit may also include the nucleic acid molecules (i.e., amplification products) described in this invention, which may be used as internal standards or positive controls. Preferably, the primers are selected from: (1) the sequences shown in SEQ ID NO:2 and 3 or sequences having at least 90% identity with them; (2) the sequences shown in SEQ ID NO:4 and 3 or sequences having at least 90% identity with them; and (3) a mixture of the sequences shown in (1) and (2). The probes are selected from: (1) the sequences shown in SEQ ID NO:5 and 6 or sequences having at least 90% identity with them; (2) complementary sequences of the sequences shown in (1); optionally, the probes may also include the sequence shown in SEQ ID NO:7 or sequences having at least 90% identity with them, and / or their complementary sequences. Preferably, the probes are fluorescently labeled, such as by FAM fluorescence, VIC fluorescence, and CY5 fluorescence, respectively. The kit may also contain various reagents required for PCR, such as buffers, enzymes, dNTPs, etc.

[0077] In a preferred embodiment, the kit of the present invention contains the primer sequences shown in SEQ ID NO:2 and 3. In another preferred embodiment, the kit of the present invention contains the primer sequences shown in SEQ ID NO:4 and 3; the probe shown in SEQ ID NO:5, which is labeled with FAM fluorescence; the probe shown in SEQ ID NO:6, which is labeled with VIC fluorescence; and the probe shown in SEQ ID NO:7, which is labeled with CY5 fluorescence.

[0078] Advantages of the SNP tag and its application in this invention:

[0079] This invention can qualitatively or quantitatively detect the adulteration of other rice varieties in the Wuyoudao 4 rice variety. It utilizes molecular biology methods to quantitatively detect adulteration in Wuyoudao 4 rice, applicable to rice seeds, rice, and rice flour. DNA is rapidly extracted from the sample, and quantitative real-time PCR amplification is performed using a developed, highly efficient, and sensitive Wuyoudao 4-specific fluorescent probe and primers. By setting an endogenous reference gene and a reference sample, the amplification data is quantitatively analyzed to quantitatively determine the purity of Wuyoudao 4. The results are intuitive and objective, avoiding human judgment. The operation is convenient and quick, with a quantification limit of 5%, greatly reducing the probability of misjudgment. It is unaffected by variety, region, or environment, making the detection more sensitive and efficient.

[0080] The present invention will be described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the invention. Materials, reagents, and methods not specifically described in the embodiments are not conventional materials, reagents, and methods in the art.

[0081] Example

[0082] Example 1: Materials and Methods

[0083] 1. Materials

[0084] The seeds of Wuyou Rice No. 4, other rice varieties, and samples of commercially available rice were all provided by Wilmar (Shanghai) Biotechnology R&D Center Co., Ltd.

[0085] 2. Enzymes and reagents

[0086] Enzymes were purchased from Kangwei Century Co., Ltd. and Bio-Rad Co., Ltd., reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., and a Bio-Rad CFX96 real-time PCR instrument was used. Primers and probes used in the experiment were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0087] 3. Experimental Methods

[0088] 3.1 DNA extraction from rice seeds (rice samples)

[0089] Grind 20 grams of rice seeds (rice sample) using a grinder. Weigh 50 mg of the powder into a 2 mL sample lysis tube, add 500 μL of Buffer 1, vortex to mix for 30 seconds, and incubate at 52°C for 30 minutes at 1200 rpm. Add 500 μL of Buffer 2, vortex to mix for 30 seconds, centrifuge the mixture for 5 minutes (12000 rpm), and collect 500 μL of the supernatant for later use. Dilute the extracted DNA solution 10 times with sterile pure water to obtain template DNA, and store in a sample dilution tube for later use. Store at 4°C for short-term storage and at -20°C for long-term storage. Alternatively, extract DNA from rice seeds or rice samples according to the instructions of the Wuyou No. 4 Rice Purity Quantitative Detection Kit.

[0090] 3.2 Design of specific primers and probes for Wuyou Rice No. 4

[0091] Primer5 was designed to target specific fragment sequences of the Wuyoudao No. 4 rice variety.

[0092] HRM high-resolution melting curve method for primer detection:

[0093] DHX-HRM-F1: 5'-TGCCCATGATTCATAACTGT-3' (SEQ ID NO: 2);

[0094] DHX-HRM-R1: 5'-GATCTGATGATATCACTTCTGTCC-3' (SEQ ID NO: 3);

[0095] Primers for probe detection:

[0096] DHX1-wholeF: 5'-TGGAACTTACTGGTCATACG-3' (SEQ ID NO: 4);

[0097] DHX-HRM-R1: 5'-GATCTGATGATATCACTTCTGTCC-3' (SEQ ID NO: 3);

[0098] Design probes:

[0099] FDHX-MGB-FAM-P3: 5'-FAM–CTGAAATTAGGTAAcgTGACAG–MGB-3' (SEQ ID NO: 5);

[0100] DHX-MGB-VIC-P2: 5'-VIC–CTGAAATTAGGTAAcaTGACAG–MGB-3' (SEQ ID NO: 6).

[0101] DHX-Refgene-cy5-P4: 5'-CY5-CAAGTTAGGAACAATGGCATGCAGG-BHQ2-3' (SEQ ID NO: 7).

[0102] HRM high-resolution melting curve method for detecting primer amplification fragment 70bp:

[0103] Nucleic acid sequence of Wuyou Rice No. 4:

[0104] TGCCCATGATTCATAACTGTCA T GTTACCTAATTTCAGAACT ATTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO:8, Figure 1 )

[0105] Other rice nucleic acid sequences:

[0106] TGCCCATGATTCATAACTGTCA C GTTACCTAATTTCAGAACTA(G)TTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO: 10, Figure 1 )

[0107] The probe detection method primer amplification fragment is 147bp:

[0108] Nucleic acid sequence of Wuyou Rice No. 4:

[0109] TGGAACTTACTGGTCATACGGCAAATAACAAGTTAGGAACAATGGCATGCAGGCCTGCTCCTATTCAGGTACCTTTGTGCCCATGATTCATAACTGTCATGTTACCTAATTTCAGAACTATTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO: 9, Figure 1 )

[0110] Other rice nucleic acid sequences:

[0111] TGGAACTTACTGGTCATACGGCAAATAACAAGTTAGGAACAATGGCATGCAGGCCTGCTCCTATTCAGGTACCTTTGTGCCCATGATTCATAACTGTCACGTTACCTAATTTCAGAACTA(G)TTTGGACAGAAGTGATATCATCAGATC (SEQ ID NO: 11, Figure 1 )

[0112] Example 2: Real-time quantitative PCR detection using HRM high-resolution melting curve method

[0113] Using extracted DNA as a template, real-time quantitative PCR amplification of primer pairs DHX-HRM-F1 and DHX-HRM-R1 was performed using the HRM high-resolution melting curve method. The PCR reaction volume was 20 μL, containing SsoAdvanced™ 10 μL Green Supermix, 0.5 μL each of DHX-HRM-F1 and DHX-HRM-R1 primers (10 μM), 2 μL template DNA (50-100 ng / μL), and sterile water to a final volume of 20 μL. The blank control was prepared using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds; 60°C annealing extension for 1 minute, for a total of 45 cycles.

[0114] After real-time fluorescence PCR amplification, the amplified products were directly read using Bio-Rad for high-resolution HRM melting curve reading. The HRM high-resolution melting curve melting process was as follows: 95℃ for 1 min, 70℃ for 1 min, and then the temperature was increased from 70℃ to 95℃ at a rate of 0.2℃ / 0.1s. The melting curve data were collected and used for HRM high-resolution melting curve typing in Precision Melt Analysis Software.

[0115] Using DNA extracted from different rice varieties as templates, real-time quantitative PCR amplification of primer pairs DHX-HRM-F1 and DHX-HRM-R1 was performed using the HRM high-resolution melting curve method. HRM high-resolution melting curves were then read, and HRM high-resolution melting curve typing was performed using Precision Melt Analysis Software. The results showed ( Figure 2 The Wuyou Rice No. 4 variety has a unique HRM curve, which is different from the HRM classification of other rice varieties. Other non-Daohuaxiang rice varieties in Group I include: Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 3, Nanjing 9108 and Xudao 9; Other rice varieties in Group II include: Liaoxing 1, Longyang 11, Longyang 16, Longdao 18, Jihong 6, Liuyouxiang, Taiyou 390 and Meixiangzhan 2.

[0116] Example 3: Real-time quantitative PCR detection using probe method

[0117] Using the extracted DNA as a template, the Wuyou Rice No. 4 probe method primers were used for detection: DHX1-wholeF and DHX-HRM-R1, Wuyou Rice No. 4 specific probe DHX-MGB-VIC-P2, and non-Wuyou Rice No. 4 specific probe FDHX-MGB-FAM-P3, and the endogenous reference gene DHX-Refgene-cy5-P4 probe were used for real-time fluorescent PCR detection. The PCR reaction volume was 20 μL, containing 10 μL of 2×GoldStar Best MasterMix, 0.8 μL of DHX1-wholeF and DHX-HRM-R1 primers (10 μM), 0.25 μL each of DHX-MGB-VIC-P2 probe (10 μM), 0.125 μL each of FDHX-MGB-FAM-P3 probe (10 μM), 0.2 μL of DHX-Refgene-cy5-P4 probe (10 μM), 2 μL of template DNA, and sterile water to a final volume of 20 μL. The blank control was performed using sterile water instead of template DNA. Each reaction was performed in triplicate. The PCR amplification program used a two-step method: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; and 58℃ annealing extension for 45 s, for a total of 45 cycles.

[0118] First, specificity analysis was performed on the probe method. The specific probe DHX-MGB-VIC-P2 for Wuyou Rice 4 showed amplification signals only in Wuyou Rice 4, and no amplification signals in other rice varieties. The non-Wuyou Rice 4 probe FDHX-MGB-FAM-P3 showed amplification signals in non-Wuyou Rice 4 rice varieties, but no amplification signal in Wuyou Rice 4. Analysis of the quantitative real-time PCR data allowed for the quantification of Wuyou Rice 4 and non-Wuyou Rice 4 content in rice samples. Gene expression data processing employed a 2... -ΔΔCT The method involves using the rice DHX-Refgene-cy5-P4 probe as an endogenous reference gene. The CT values ​​of the DHX-MGB-VIC-P2 and FDHX-MGB-FAM-P3 probes in the sample are subtracted from the CT value of the DHX-Refgene-cy5-P4 probe. This result is then subtracted from the ΔCT of a reference sample containing 100% Wuyou Rice No. 4 or 100% non-Wuyou Rice No. 4. The negative number of the resulting ΔCT is raised to the square to obtain a relative content value, which is used to quantitatively determine the content of Wuyou Rice No. 4 and non-Wuyou Rice No. 4 rice varieties in the rice sample.

[0119] Using DNA extracted from standard samples with different concentrations as templates, real-time fluorescence PCR was performed using primers DHX1-wholeF and DHX-HRM-R1, the specific probe for Wuyou Rice No. 4 DHX-MGB-VIC-P2, and the non-Wuyou Rice No. 4 specific probe FDHX-MGB-FAM-P3, along with the endogenous reference gene probe DHX-Refgene-cy5-P4. The results of the quantitative PCR analysis showed that... Figure 3 Nine standards were selected: 0% non-Wuyou Rice No. 4, 5% non-Wuyou Rice No. 4, 10% non-Wuyou Rice No. 4, 20% non-Wuyou Rice No. 4, 50% non-Wuyou Rice No. 4, 80% non-Wuyou Rice No. 4, 90% non-Wuyou Rice No. 4, 95% non-Wuyou Rice No. 4, and 100% non-Wuyou Rice No. 4. The relative gene expression levels of these nine standards also increased with increasing non-Wuyou Rice No. 4 content. These standards can be used to quantify the content of non-Wuyou Rice No. 4 in unknown samples. Figure 3 A). Nine standards were used: 100% Wuyou Rice No. 4, 95% Wuyou Rice No. 4, 90% Wuyou Rice No. 4, 80% Wuyou Rice No. 4; 50% Wuyou Rice No. 4, 20% Wuyou Rice No. 4, 10% Wuyou Rice No. 4, 5% Wuyou Rice No. 4, and 0% Wuyou Rice No. 4. The content of Wuyou Rice No. 4 in these nine standards decreased in that order, and the relative gene expression levels also decreased accordingly. These standards can be used to quantify the content of Wuyou Rice No. 4 in unknown samples. Figure 3 B).

[0120] Example 4: Purity Detection of Wuyou Rice No. 4 (Blind Sample)

[0121] Three blind samples of Wuyoudao No. 4 rice products were tested. DNA extraction, quantitative PCR amplification, and data analysis were performed according to the instructions of the Wuyoudao No. 4 rice variety purity test kit. The results showed that ( Figure 4 The content of Wuyou Rice No. 4 in the blind samples was as follows: 100% in sample 1, 11% in sample 2, and 38% in sample 3. The test results and ratios of the three blind samples were basically consistent. The ratios of the contents were: 100% Wuyou Rice No. 4 in sample 1, 10% in sample 2, and 40% in sample 3.

[0122] Conclusion: This invention utilizes molecular biology methods to quantitatively detect adulteration in Wuyou Rice No. 4. DNA is rapidly extracted from rice samples, and quantitative real-time PCR amplification is performed using a developed, highly efficient, and sensitive fluorescent probe and primers specific to Wuyou Rice No. 4. By setting an endogenous reference gene and a reference sample, the amplification data is then quantitatively analyzed to determine the purity of Wuyou Rice No. 4. The results are intuitive, the operation is convenient and fast, and it is not affected by variety, region, or environment, making the detection more sensitive and efficient. sequence list <110> Wilmar (Shanghai) Biotechnology R&D Center Co., Ltd. <120> Rice SNP markers and their applications <130> 199044 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 70 <212> DNA <213> Artificial Sequence <400> 1 tgcccatgat tcataactgt caygttacct aatttcagaa ctrtttggac agaagtgata 60 tcatcagatc 70 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tgcccatgat tcataactgt 20 <210> 3 <211> twenty four <212> DNA <213> Artificial Sequence <400> 3 gatctgatga tatcacttct gtcc 24 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 tggaacttac tggtcatacg 20 <210> 5 <211> twenty two <212> DNA <213> Artificial Sequence <400> 5 ctgaaattag gtaacgtgac ag 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <400> 6 ctgaaattag gtaacatgac ag 22 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 caagttagga acaatggcat gcagg 25 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <400> 8 tgcccatgat tcataactgt catgttacct aatttcagaa ctatttggac agaagtgata 60 tcatcagatc 70 <210> 9 <211> 147 <212> DNA <213> Artificial Sequence <400> 9 tggaacttac tggtcatacg gcaaataaca agttaggaac aatggcatgc aggcctgctc 60 ctattcaggt acctttgtgc ccatgattca taactgtcat gttacctaat ttcagaacta 120 tttggacaga agtgatatca tcagatc 147 <210> 10 <211> 70 <212> DNA <213> Artificial Sequence <400> 10 tgcccatgat tcataactgt cacgttacct aatttcagaa ctrtttggac agaagtgata 60 tcatcagatc 70 <210> 11 <211> 147 <212> DNA <213> Artificial Sequence <400> 11 tggaacttac tggtcatacg gcaaataaca agttaggaac aatggcatgc aggcctgctc 60 ctattcaggt acctttgtgc ccatgattca taactgtcac gttacctaat ttcagaactr 120 tttggacaga agtgatatca tcagatc 147 <210> 12 <211> 501 <212> DNA <213> Artificial Sequence <400> 12 tttcttcaat tgaaaattat ttaggcagat gccaagaccc ttcgattcaa ggataaggta 60 ttaaaaaagg gtgggttgtg gagagatata tatggtattg atgaaaagaa ggttgctagc 120 ttggtaagag aggacaaagt ggatatactt gtggaactta ctggtcatac ggcaaataac 180 aagttaggaa caatggcatg caggcctgct cctattcagg tacctttgtg cccatgattc 240 ataactgtca tgttacctaa tttcagaact atttggacag aagtgatatc atcagatcat 300 tatgttctga aaccagcttc ttctgatctt gctaacatga ttgcttcctt ttcactctag 360 tcaatgaaac tattcaagtg tctaataata aatgattatc tgactattct actatgtgat 420 tagtgaactg acaggggctt cttttacttg aattgcctgc acaggttaca tggattggct 480 accctaatac aacaggtctg c 501

Claims

1. A method for identifying a rice variety, characterized by, The method comprises: (1) detecting a first SNP molecular marker in the genome of the rice, wherein the SNP site of the first SNP molecular marker is located at the 23rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base T or C; (2) identifying the rice variety according to the first SNP molecular marker, wherein if the genotype of the first SNP molecular marker is TT, the rice variety is identified as Wu You Dao 4, otherwise, the rice variety is identified as non-Wu You Dao 4.

2. The method of claim 1, wherein: the step (1) further comprises detecting a second SNP molecular marker; wherein the SNP site of the second SNP molecular marker is located at the 43rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base A or G; the step (2) further comprises further identifying the rice variety according to the amplification result of the second SNP molecular marker; wherein if the genotype of the second SNP molecular marker is AA, the rice variety is identified as a rice variety selected from the group consisting of Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 3, Nangjing 9108 and Youdao 9; if the genotype of the second SNP molecular marker is GG, the rice variety is identified as a rice variety selected from the group consisting of Liaoxing 1, Longyang 11, Longyang 16, Longdao 18, Jihong 6, Liuyouxian, Taiyou 390 and Meixiazhan 2.

3. The method of claim 1, wherein, The detection comprises performing PCR.

4. The method of claim 3, wherein, The detection is fluorescence quantitative PCR or HRM detection.

5. A method for detecting the content or purity of Wuyou Rice No. 4 in a sample, characterized in that, The method comprises: (1) amplifying the sequence containing the first SNP molecular marker in the genome of the rice, wherein the SNP site of the first SNP molecular marker is located at the 23rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base T or C, (2) determining the content or purity of Wu You Dao 4 according to the amplification result of the first SNP molecular marker, wherein the amplification result of the genotype of the first SNP molecular marker being TT indicates the content or purity of Wu You Dao 4; The amplification is fluorescent quantitative PCR, and the method further comprises using 2 -ΔΔCT The method is used for determining the content or purity of Wu You Da 4, wherein the 2 -ΔΔCT The method comprises: comparing the CT value of the probe for identifying the first SNP molecular marker with the CT value of the endogenous reference probe in the sample, comparing the comparison result with the ΔCT of the control, taking the negative of the obtained ΔΔCT to the power of 2 to obtain the relative content value, and using the relative content value to determine the content or purity of Wu You Da 4; wherein the control is a 100% Wu You Da 4 sample or a 100% non-Wu You Da 4 sample.

6. The method of claim 5, wherein: the step (1) further comprises amplifying the sequence containing the second SNP molecular marker in the genome of the rice; wherein the SNP site of the second SNP molecular marker is located at the 43rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the the step (2) further comprises further identifying the rice variety according to the amplification result of second SNP molecular marker; wherein the amplification result of the genotype of the second SNP molecular marker being AA indicates that the rice variety is a rice variety selected from the group consisting of Suijing 18, Yanfeng 48, Songjing 22, Beidao 7, Tongyuanxiang 518,Fuerdao 1, Longqingdao 3, Nangjing 9108 and You 9; the amplification result of the genotype of the second SNP molecular marker being GG indicates that the rice variety is a rice variety selected from the group consisting of Liaoxing 1, Longyang 11, Longyang 16, Longdao 18, Jihong 6, Liuyouxuan, Taiyou 390 and Meixiazhan 2. The step (2) further comprises that the 2 -ΔΔCT The method further comprises comparing the CT value of the probe identifying the second SNP molecular marker with the CT value of the endogenous reference probe in the sample, comparing the comparison result with the ΔCT of the control, taking the negative of the obtained ΔΔCT to the power of 2 to obtain a relative content value, and using the relative content value to determine the content or purity of Wu You Rice No.

4.

7. Use of an agent that detects a first SNP molecular marker in the genome of rice in identifying a rice variety or in detecting the presence or purity of Wu You Dao 4 in rice, wherein, The SNP site of the first SNP molecular marker is located at the 23rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base T or C; if the genotype of the first SNP molecular marker is TT, the rice is identified as Wuyou 4, otherwise, the rice is identified as non-Wuyou 4; The method for detecting the content or purity of Wuyou 4 in the sample comprises: detecting the CT value of the probe for recognizing the first SNP molecular marker and the CT value of the probe for recognizing the endogenous reference by fluorescence quantitative PCR, subtracting the two to obtain sample ΔCT, subtracting the ΔCT of the control from the sample ΔCT to obtain ΔΔCT, the control is a 100% Wuyou 4 or 100% non-Wuyou 4 sample, and the negative of ΔΔCT is squared to obtain a relative content value, which is used for quantitative determination of Wuyou 4 and non-Wuyou 4 in the sample.

8. Use according to claim 7, characterized in that, The reagent comprises a primer.

9. The use of claim 7, characterized in that: The reagent further comprises: a reagent for detecting a second SNP molecular marker in the rice genome; wherein the SNP site of the second SNP molecular marker is located at the 43rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base A or G; if the genotype of the second SNP molecular marker is AA, the rice variety is identified as a rice variety selected from the group consisting of Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 3, Nanjing 9108 and Choudao 9; if the genotype of the second SNP molecular marker is GG, the rice variety is identified as a rice variety selected from the group consisting of Liaoxing 1, Long 15, Yang 11, Longyang 16, Longdao 18, Jihong 6, Liuyouxian, Taiyou 390 and Meixiang 2; The method for detecting the content or purity of Wuyou 4 in the sample comprises: detecting the CT value of the probe for recognizing the second SNP molecular marker and the CT value of the probe for recognizing the endogenous reference by fluorescence quantitative PCR, subtracting the two to obtain sample ΔCT, subtracting the ΔCT of the control from the sample ΔCT to obtain ΔΔCT, the control is a 100% Wuyou 4 or 100% non-Wuyou 4 sample, and the negative of ΔΔCT is squared to obtain a relative content value, which is used for quantitative determination of Wuyou 4 and non-Wuyou 4 in the sample.

10. Use of a reagent for detecting a first SNP molecular marker in a rice genome in the manufacture of a kit for identifying a rice variety or detecting the presence or purity of Wu You Dao 4 in a rice, wherein, The SNP site of the first SNP molecular marker is located at the 23rd position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 2, and the polymorphism is base T or C; if the genotype of the first SNP molecular maker is TT, the rice is identified as Wuyou 4, otherwise, the rice is not identified as Wuyou 4; The method for detecting the content or purity of Wuyou Rice No. 4 in the sample comprises the following steps: detecting the CT value of a probe for recognizing a first SNP molecular marker and the CT value of a probe for recognizing an endogenous reference, subtracting the CT value of the probe for recognizing the endogenous reference from the CT value of the probe for recognizing the first SNP molecular marker to obtain sample ΔCT, subtracting the ΔCT of a control from the sample ΔCT to obtain ΔΔCT, wherein the control is a 100% Wuyou Rice No. 4 sample or a 100% non-Wuyou Rice No. 4 sample, and taking the negative of ΔΔCT to the power of 2 to obtain a relative content value, which is used for quantitatively judging Wuyou Rice No. 4 and non-Wuyou Rice No. 4 in the sample.

11. Use according to claim 10, characterized in that, The reagent comprises a primer.

12. The use according to claim 10, characterized in that: The kit further comprises: a reagent for detecting a second SNP molecular marker in the rice genome; wherein the SNP site of the second SNP molecular marker is located at the 43th position from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and the polymorphism is base A or G; When the genotype of the second SNP molecular marker is AA, the rice variety is identified as a rice variety selected from the group consisting of Suijing 18, Yanfeng 47, Songjing 22, Beidao 7, Tongyuanxiang 518, Fuerdao 1, Longqingdao 3, Nanjing 9108 and Choudao 9; When the genotype of the second SNP molecular marker is GG, the rice variety is identified as a rice variety selected from the group consisting of Liaoxing No. 1, Long 15, Yang 11, Longyang 16, Longdao 18, Jihong No. 6, Liuyouxian, Taiyou 390 and Meixiazhan No. 2; The method for detecting the content or purity of Wuyou Rice No. 4 in the sample comprises the following steps: detecting the CT value of a probe for recognizing a first SNP molecular marker and the CT value of a probe for recognizing an endogenous reference, subtracting the CT value of the probe for recognizing the endogenous reference from the CT value of the probe for recognizing the first SNP molecular marker to obtain sample ΔCT, subtracting the ΔCT of a control from the sample ΔCT to obtain ΔΔCT, wherein the control is a 100% Wuyou Rice No. 4 sample or a 100% non-Wuyou Rice No. 4 sample, and taking the negative of ΔΔCT to the power of 2 to obtain a relative content value, which is used for quantitatively judging Wuyou Rice No. 4 and non-Wuyou Rice No. 4 in the sample.

Images