SNPs closely related to purple stripes in pepper fruit, specific CAPS primers and their application

By constructing the F2 isolation population in peppers and developing the specific CAPS labeled CAPS690-01 primer, the efficient detection problem of purple striped traits of capsicum fruits was solved, and accurate selection of seedling stage was achieved, breeding efficiency was improved and cost reduction was reduced.

CN114350840BActive Publication Date: 2025-06-06INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210028836.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-01-11
Publication Date
2025-06-06
Estimated Expiration
2042-01-11

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently detect and select purple striped traits of capsicum fruits, affecting breeding efficiency and cost.

Method used

By constructing the F2 isolation population, using the BSA-seq-bound population mapping method, finely locate the purple stripes related genes of green pepper fruits, and developing a specific CAPS marker CAPS690-01 primer, combined with TaqI enzyme digestion and agarose gel electrophoresis, the efficient detection of the purple stripes traits of peppers is achieved.

Benefits of technology

The selection of purple striped traits of capsicum fruit with accuracy of up to 100% during the seedling stage was achieved, which significantly improved breeding efficiency and reduced breeding costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003465554430000041
    Figure BDA0003465554430000041
  • Figure HDA0003465554440000011
    Figure HDA0003465554440000011
  • Figure HDA0003465554440000012
    Figure HDA0003465554440000012
Patent Text Reader

Abstract

The present invention belongs to the technical field of pepper molecular breeding, and discloses SNPs, specific CAPS primers and applications that are closely related to purple stripes on pepper green fruits. The SNP site described in the present invention is located at position 184,011,859 of the pepper P10 chromosome. When the base is T, the pepper green fruit has purple stripes, and when the base is G, the pepper green fruit does not have the purple stripe feature. The present invention also provides a specific CAPS primer CAPS690-01 for detecting purple stripes on pepper green fruits, which can accurately detect whether pepper green fruits have purple stripe characteristics at the seedling stage, with high accuracy, significantly improving breeding efficiency and reducing breeding costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of pepper molecular breeding, and in particular to SNPs closely related to purple stripes of pepper green fruits, specific CAPS primers and applications. Background Art

[0002] Color is one of the most important quality traits of pepper fruit, and it has an irreplaceable contribution to its sensory quality and nutritional quality. The color of pepper fruit varies from green to mature stage. Among them, purple pepper fruit is rich in anthocyanins, which is beneficial to human health. In addition, anthocyanins are an important antioxidant substance, which also plays an important role in pepper disease resistance, stress resistance and fruit storage stability.

[0003] Two genes that regulate the accumulation of purple color in immature pepper fruits have been identified in pepper, namely CaAn2 and Ca3gt. The CaAn2 gene encodes an R2R3-MYB transcription factor. There is no difference in the coding region of this gene in purple pepper and green pepper. The reason why purple pepper can accumulate anthocyanins is that a 4.3kb non-long terminal repeat sequence retrotransposon is inserted into the promoter region of the CaAn2 gene to activate the expression of the CaAn2 gene, which enables pepper to accumulate anthocyanins. Based on the differences in the promoter region of the CaAn2 gene, a genetic marker A_SCAR (F: 5'CACTCCGACTTGTCTTTACGG 3', P1R: 5'TAACTTGAGCCGGGGGTCT 3', P2R: 5'CACG GAAGGAGGCTAGTCAA3') that is completely co-segregated with the CaAn2 gene was obtained, which can accurately identify the CaAn2 genotype purple pepper germplasm. The Ca3gt gene encodes an anthocyanin transport gene, which is located downstream of the CaAn2 gene on the pepper Chr10 chromosome and obtained a tightly linked marker CAPS-78-708 (F: 5'CATGCCACAAGAAGTTGTAGCACAT 3', R: 5'ACTTTCATCAGAATTAACATCTGAAATAA 3'). The phenotypic characteristics of this genotype of pepper are that anthocyanins are accumulated only in immature fruits and appear purple.

[0004] The purple stripe trait of green pepper fruits involved in the present invention begins to show unevenly distributed purple longitudinal stripes on the fruits of peppers in the young fruit stage, similar to the "bamboo silk eggplant" among eggplants, and the purple stripe coloring is not significantly induced by light. Among the Solanaceae vegetables, except for the "bamboo silk eggplant" whose fruit skin shows purple stripes, it is uncommon for tomatoes and peppers to have purple stripes. Therefore, it is of great significance to use pepper materials with this purple stripe trait to carry out pepper quality breeding, and it also enriches the theory of anthocyanin synthesis and regulation mechanism of peppers and provides a new case for the study of purple trait of peppers. Summary of the invention

[0005] The purpose of the present invention is to provide a reagent for detecting SNP sites closely related to purple stripes of pepper green fruit, and use the reagent in breeding of purple stripes of pepper green fruit.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The present invention is to compare the green fruit purple stripe material 'bamboo thread pepper Chen12' (purchased from Hubei Shugu Agricultural Technology Co., Ltd.) and the green fruit non-purple stripe pepper '16ZX101-M-1 Line pepper' (Li Ning, Gong Liyuan, Gao Shenghua, Yin Yanxu, Yu Chuying, Wang Fei, Chen Cai, Wu Jun, Jiao Chunhai, Yao Minghua. Molecular marker detection of resistance genes in pepper germplasm [J]. Chinese Vegetables, 2020(08):19-32) Construction of F 2 The isolated population was used to precisely locate and identify the candidate genes regulating the purple stripes of green pepper fruits by using BSA-seq combined with population mapping methods. Based on the differences in candidate genes between the purple striped and non-purple striped parents, the candidate segment of genes related to the purple striped trait of green fruit was located in the physical position 184,002,197 to 184,365,711 interval of pepper chromosome P10 (pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ); based on the gene annotation information of the reference genome CM334, the candidate genes controlling the purple stripe characteristics of pepper were determined within the located interval. Finally, a SNP site related to the purple stripe trait of pepper was screened out. The SNP site was located at position 184,011,859 of the pepper P10 chromosome (pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ). When the base was T, the green pepper fruit had purple stripes, and when the base was G, the green pepper fruit did not have the purple stripe feature.

[0008] The protection content of the present invention includes: the use of a reagent for detecting a SNP site closely related to the purple stripes of pepper green fruit in the breeding of pepper green fruit purple stripes; the SNP site is at position 184,011,859 of the pepper P10 chromosome, the pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / .

[0009] In the above application, preferably, the reagent is a primer;

[0010] In the above application, preferably, the applicant designs primers for CAPS marker CAPS690-01 for the above SNP site, F: 5'-TGGATTCGTCGAACTCACTCAA-3'; R: 5'-ACGCAGTGAAGGGTATGGTC-3'. PCR amplification is performed using the primers, and then the PCR product is digested with TaqI, and the digested product is detected by 1% agarose gel electrophoresis:

[0011] If the enzyme cleavage product is about 200 bp fragment, the green fruit of the pepper material to be tested has purple stripes;

[0012] If the enzyme cleavage products are approximately 200 bp and 392 bp fragments, the green fruit of the pepper material to be tested has purple stripes;

[0013] If the enzyme cleavage product contains only a 392 bp fragment, the green fruit of the pepper material to be tested does not have purple stripes.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The molecular marker developed by the present invention can provide an effective technical means for auxiliary selection breeding of pepper fruit color quality. The development of this marker makes it possible to select the purple stripe trait of pepper fruit at the seedling stage with high accuracy of 100%, which significantly improves breeding efficiency and reduces breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Example 1 Phenotypic characteristics of both parents;

[0017] Among them: a is the plant of the purple striped parent 'Bamboo Thread Pepper Chen12', b is the flower and fruit of the purple striped parent 'Bamboo Thread Pepper Chen12', c is the non-purple striped parent '16ZX101-M-1 Plants of 'Line Pepper', d is the non-purple striped parent '16ZX101-M-1 Flowers and fruits of 'Pepper');

[0018] Figure 2 The CaPS gene was preliminarily located using BSA-seq.

[0019] Figure 3 Fine positioning of candidate intervals.

[0020] Figure 4 Enzyme digestion detection of gene marker CAPS690-01 between parents.

[0021] Figure 5Gene marker SCAR690-01 to F 2 Genotype detection of some individual plants in the population. DETAILED DESCRIPTION

[0022] The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood to be illustrative rather than limiting the scope of the present invention.

[0023] The experimental methods used in the following examples are conventional methods unless otherwise specified; the instruments, materials and reagents used are all commercially available unless otherwise specified.

[0024] Embodiment 1:

[0025] The acquisition of CAPS molecular markers related to the purple stripe trait of pepper green fruit specifically includes the following steps:

[0026] 1. Construction of the segregating population for the purple stripe trait of pepper and acquisition of parental materials

[0027] In this embodiment, the green fruit purple stripe material 'Bamboo Thread Pepper Chen12' is used as the female parent (specifically, Figure 1 As shown in a and 1b, purchased from Hubei Shugu Agricultural Technology Co., Ltd.), green fruit non-purple striped pepper '16ZX101-M-1 Line pepper' is the male parent (specifically Figure 1 As shown in c and d, Li Ning, Gong Liyuan, Gao Shenghua, Yin Yanxu, Yu Chuying, Wang Fei, Chen Cai, Wu Jun, Jiao Chunhai, Yao Minghua. Molecular marker detection of resistance genes in pepper germplasm [J]. Chinese Vegetables, 2020(08):19-32), hybridization obtained F 1 Generation, F 1 F 2 generation, a population for genetic analysis and gene mapping of the purple stripe trait.

[0028] 2. Genetic analysis of the purple stripe trait

[0029] F 1 Obvious purple stripes can be observed on the fruit surface of the 20 plants in the first generation, which is consistent with the phenotype observed on the parent 'Bamboo-thread pepper Chen12', indicating that the purple stripe trait is a dominant trait. 2 The 161 plants of the first generation showed obvious separation, purple stripes were observed in 128 plants, and purple stripes were not observed in 33 plants. The separation ratio of plants with and without purple stripes was 3.88:1. The chi-square test was χ2 at the p = 0.05 level. 2 =0.377<χ 20.05=3.841, which is consistent with the genetic segregation ratio of a dominant single gene, indicating that the trait of purple stripes on green fruit in peppers is a dominant single gene inheritance.

[0030] 3. Mixed pool construction and preliminary positioning

[0031] According to 156 F 2 The phenotypic identification results of individual plants were as follows: 2 Thirty plants with obvious purple stripe characteristics and 30 plants with green fruits were selected from the population, and genomic DNA was extracted from each plant. After equal mixing, purple stripe mixed pools (P pool) and green mixed pools (G pool) were constructed respectively; DNA of both parents was extracted at the same time, and resequencing of both parents was performed. Taking pepper CM334 as the reference genome, the BSA-seq mixed pool sequencing method was used to analyze the differences in allele frequencies between mixed pools in Δ(SNP-index) to detect the candidate interval of the target gene related to the purple stripe trait. Results The candidate interval was located on pepper chromosome P10, and the specific information is as follows Figure 2 According to the resequencing data of both parents, 20 pairs of CAPS markers were designed on chromosome P10 to evenly cover chromosome P10. The results of the analysis of these markers in 156 F 2 The genotypes of individual plants in the population were initially located, and the phenotypic data from field observations were used to screen and exchange individual plants. As a result, the candidate segment of the gene related to the purple stripe trait of green fruit was preliminarily located between CAPS markers M15 and M16, and the physical position interval 174,751,143 to 188,371,382.

[0032] 4. Fine-mapping and development of molecular markers closely linked to the purple stripe feature

[0033] Based on the resequencing data of both parents, CAPS markers were further designed within the interval of markers M15 and M16 to expand the F 2 The number of individual plants in the segregating population (914 plants) was further genotyped and analyzed in combination with phenotypic data. The candidate segments of the genes related to the purple stripe trait of green fruit were initially located in the interval of physical positions 184,002,197 to 184,365,711.

[0034] 5. Development of specific CAPS markers

[0035] Many CAPS markers were developed in the candidate interval, and finally the CAPS690-01 marker was selected (Table 1). The fragment amplified by this specific marker in the purple stripe parent 'Bamboo Chili Chen12' has a T at the 201st base, which can be recognized and digested by TaqI enzyme; The 200th base in the 'Line Pepper' is G, which cannot be digested by TaqI. The PCR product was digested with TaqI, and the purple striped parent 'Bamboo Thread Pepper Chen12' obtained 192bp and 221bp fragments, and the non-purple striped parent '16ZX101-M-1 The line pepper cannot be cut by endonucleases. Compared with the reference genome (Capsicum CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ), the SNP site is located at position 184,011,859 of the pepper P10 chromosome. When the base is T, the pepper fruit has purple stripes, and when the base is G, the pepper fruit does not have the purple stripe feature.

[0036] Table 1

[0037]

[0038] 6. Detection

[0039] The PCR amplification system was as follows: 25 μL in total, 1.0 μL of 50 ng / μL DNA, 13.0 μL of 2× Taq Master Mix, 1.0 μL of 10 μmol mixed primers (i.e. forward primer + reverse primer), ddH 2 O margin.

[0040] The PCR amplification program was as follows: pre-denaturation at 94°C for 1 min 30 s, denaturation at 94°C for 20 s, annealing at 56°C for 20 s, extension at 72°C for 30 s, 35 cycles, extension at 72°C for 5 min, and storage at 16°C for 10 min.

[0041] CAPS digestion system: 10 μL in total, 5.0 μL PCR product, 1.0 μL 2× TaqI buffer, 0.2 μL TaqI, ddH 2 O residue; digest at 65℃ for 1.5h and store at 16℃ for 10min.

[0042] The PCR amplification products were electrophoresed by 1% agarose gel. Due to the limited resolution of agarose gel, 192 bp and 221 bp could not be completely separated. It was observed that the purple striped parent 'Bamboo Thread Pepper Chen12' detected a band of about 200 bp, while the non-purple striped parent '16ZX101-M-1 If the pepper cannot be cut by endonuclease, a band of 392 bp is detected. Figure 4 As shown, CAPS marker CAPS690-01 can identify the purple striped parent.

[0043] Embodiment 2:

[0044] The CAPS690-01 marker was used to identify the purple stripe phenotype at the seedling stage. The specific process is as follows:

[0045] The primer CAPS690-01 was used to PCR amplify the F in Example 1. 2 The purple stripe individual and the non-purple stripe individual in the population were PCR amplified to obtain the product; the PCR amplification system was: 25 μL in total, 1.0 μL of 50 ng / μL DNA, 13.0 μL of 2× Taq Master Mix, 1.0 μL of 10 μmol mixed primers (i.e., forward primer + reverse primer), and ddH 2 O residue; PCR amplification program was: 94℃ pre-denaturation for 1min30s, 94℃ denaturation for 20s, 56℃ annealing for 20s, 72℃ extension for 30s, 35 cycles, 72℃ extension for 5min, and 16℃ storage for 10min.

[0046] CAPS digestion system: 10 μL in total, 5.0 μL PCR product, 1.0 μL 2× TaqI buffer, 0.2 μL TaqI, ddH 2 O residue; digest at 37℃ for 1.5h and store at 16℃ for 10min.

[0047] The PCR amplification products were subjected to gel electrophoresis. Due to the length of the paper, the test results of some materials are shown in the following figure. Figure 5 As shown: In the figure, from left to right are F 2 Population individual plant, Marker, F 2 Individual plant in the population, blank lane, F 1 , the purple striped parent 'Bamboo Chili Chen12' and the non-purple striped parent '16ZX101-M-1 As can be seen from the figure, CAPS690-01 can effectively distinguish between purple stripe materials and non-purple stripe materials. Specifically, purple stripe materials can detect a band of about 200 bp, or two bands of 200 bp and 392 bp; while the band of non-purple stripe materials is 392 bp.

[0048] It should be pointed out that the above embodiments are only explanations of the present invention rather than limitations of the invention, and any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Institute of Economic Crops, Hubei Academy of Agricultural Sciences <120> SNPs closely related to purple stripes in pepper fruit, specific CAPS primers and their application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial Sequence <400> 1 tggattcgtc gaactcactc aa 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 acgcagtgaa gggtatggtc 20

Claims

1. Application of a reagent for detecting a SNP site closely related to purple stripes on pepper green fruit in breeding of pepper green fruit purple stripes; the SNP site is located at position 184,011,859 of pepper P10 chromosome, pepper CM334 reference genome, V1.55, ftp: / / ftp.solgenomics.net / genomes / Capsicum_annuum / C.annuum_cvCM334 / ; The reagents are primers: F: 5'-TGGATTCGTCGAACTCACTCAA-3'; R: 5'-ACGCAGTGAAGGGTATGGTC-3'; The peppers are bamboo peppers Chen12, 16ZX101-M-1 The parent of the pepper is bamboo pepper Chen12 and 16ZX101-M-1 A group of bell peppers; The judgment criteria are: PCR amplification is performed using the above primers, and then the PCR product is digested with TaqI, and the digested product is detected by 1% agarose gel electrophoresis: If the enzyme digestion products are 192 bp and 221 bp fragments, the green fruit of the pepper material to be tested has purple stripes; If the enzyme digestion products are 192bp, 221bp and 392bp fragments, the green fruit of the pepper material to be tested has purple stripes; If the enzyme cleavage product contains only a 392 bp fragment, the green fruit of the pepper material to be tested does not have purple stripes.

Citation Information

Patent Citations

  • Development and application of purple gene marker for controlling capsicum green fruit

    CN109628635A