A primer for rapid detection of meat freshness in multiple scenarios and its detection method and application

Abstract

A meat freshness rapid detection primer and its detection method and application that can be used in multiple scenarios, belonging to the field of food detection technology, the invention selects the conservative sequence of the Pseudomonas genome as its specific target, designs 4 specific primer sets that can amplify the gene, and uses visualization dye and OD to detect the freshness of meat. 646 The absorbance value indicates the test result, changing from purple (negative) to blue (positive), OD 646 If it is over 0.19, it is positive. The freshness index of meat products is associated with the test results of this method. If the reaction result is positive (blue) and the absorbance value at 646nm exceeds 0.19, the sample is considered to be corrupt. If it is purple, it means that the sample is relatively fresh. This method has good specificity for Pseudomonas, is simple to operate, does not require complex instruments, and the results are easy to interpret. It can quickly (within 60 minutes) specifically detect Pseudomonas, and then indicate the freshness of meat in a variety of scenarios. It is suitable for meat quality inspection, sales sampling, and freshness testing of household purchased products.

Description

Technical Field

[0001] The present invention belongs to the technical field of food detection, and in particular, relates to a primer for rapid detection of meat freshness in multiple scenarios, a detection method and application thereof. The dominant spoilage bacteria in meat, Pseudomonas, are detected, and color reaction and absorbance detection are associated with meat product freshness indicators. A highly specific, simple and efficient Pseudomonas primer set and detection method are developed to indicate meat freshness. Background Art

[0002] The loss and waste of meat mainly occurs during the storage and transportation stage. Temperature fluctuations during cold chain transportation directly affect the quality and shelf life of fresh meat. The shelf life of fresh meat in the market is only 3-5 days, which seriously restricts the development of the meat industry. Microbial contamination is the primary factor leading to meat spoilage. The dominant spoilage bacteria in meat include: Pseudomonas, Acinetobacter, Psychrophilic Bacillus, Enterobacter, Aeromonas, etc. They can cause meat to change color, have an odor, and produce stickiness, etc.

[0003] Pseudomonas is the most typical dominant spoilage bacteria, which is directly related to the shelf life of meat. The extracellular proteases secreted by it can destroy the connective tissue between muscle fibers, allowing bacteria to penetrate into muscle tissue and better penetrate the muscle through proteolysis. It has a high proteolytic property. It also has a high cell protein synthesis capacity at low temperatures, and can secrete cold-active proteases and lipases at low temperatures and low cell densities. For example, the metalloprotease of Pseudomonas fluorescens is produced in the early stage of the growth cycle at refrigerated temperatures. Pseudomonas fragariae grows faster at low temperatures and can grow even under strict cold chain conditions, and can produce odor and mucus. The types of Pseudomonas that play a major role in the deterioration of meat products during refrigeration include Pseudomonas fragariae, Pseudomonas Lund, Pseudomonas fluorescens, and Pseudomonas putida.

[0004] The detection method of meat freshness has always been a research hotspot. Traditional freshness detection methods are mainly based on sensory and physical and chemical indicators. Although they are accurate and reliable, they are cumbersome to operate. Some existing intuitive and simple rapid detection methods, such as analyzing the apparent changes of meat during storage through electronic tongue and electronic nose, or obtaining the quality information inside meat through spectral technology, have a certain correlation with the physical and chemical indicators of meat, but these technologies require large-scale instruments and equipment and strong operational expertise, and their application scenarios are greatly limited, which is not conducive to the application of enterprises and terminal markets. Summary of the invention

[0005] The purpose of the present invention is to provide a kind of meat freshness rapid detection primers and its detection method and application for multiple scenarios in view of the above problems. The present invention designs a specific primer set, verifies its specificity through color change and electrophoresis bands, and also determines the scientificity and accuracy of this method for indicating the freshness of meat through the detection of actual samples and the correlation study with the sample freshness index.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] A primer for rapid detection of meat freshness in multiple scenarios, using the conservative sequence of the Pseudomonas genome as a template to design a primer sequence, the primer includes an outer primer and an inner primer, the outer primer includes F3 and B3, the inner primer includes FIP and BIP, and the specific sequence is as follows:

[0008] F3: CATCATGGCCCTTACGGC, as shown in SEQ ID NO: 1;

[0009] B3: ACTCCCATGGTGTGACGG, as shown in SEQ ID NO: 2;

[0010] FIP: TTAGCTCCACCTCGCGGCTT-GGGCTACACACGTGCTAC, as shown in SEQ ID NO: 3;

[0011] BIP: AGTCTGCAACTCGACTGCGTG-AAGGCCCGGGAACGTATT, as shown in SEQ ID NO:4.

[0012] The present invention also seeks protection for a rapid meat freshness detection kit for use in multiple scenarios, characterized in that it comprises the primers described above.

[0013] As a preferred technical solution of the present application, the kit further comprises: 2×LAMP reaction buffer, Bst2.0WarmStartTM DNA polymerase, and hydroxynaphthol blue (HNB).

[0014] Preferably, the 2×LAMP reaction buffer comprises: 40 mM Tris-HCl, 100 mM KCl, 20 mM (NH 4 ) 2 SO 4 , 12 mM MgSO 4 , 0.2% Tween-20, 2 mM dNTPs and pH 8.8.

[0015] The present invention also protects a method for rapid detection of meat freshness for multiple scenarios, the method comprising the following steps:

[0016] (1) placing the meat sample in sterile physiological saline and shaking it to obtain an eluent;

[0017] (2) extracting the bacterial genome in the eluate as an amplification template for the LAMP reaction system;

[0018] (3) adding the template obtained in (2) to the LAMP reaction system for isothermal amplification, measuring the absorbance and observing the color change of the system with the naked eye;

[0019] Wherein, the LAMP reaction system contains the primers described in claim 1.

[0020] As a preferred technical solution of the present application, in the step (1), the mass ratio of the meat sample to the sterile physiological saline is 1:5-9, and the bacteria on the surface of the meat are eluted by oscillation.

[0021] As a preferred technical solution of the present application, in step (2), the bacterial genome is extracted using a conventional kit or a boiling method, that is, 1 mL of the eluent is boiled in a 90-100°C metal bath for 8-10 minutes.

[0022] As a preferred technical solution of the present application, in step (3), the LAMP reaction system mainly includes: 2×LAMP reaction buffer, Bst 2.0WarmStartTM DNA polymerase, hydroxynaphthol blue (HNB) and the primer set described in claim 1.

[0023] Preferably, the 2×LAMP reaction buffer is mainly composed of 10×Isothemal Amplification Buffer, MgSO4 and dNTPs.

[0024] More preferably, the 2×LAMP reaction buffer mainly comprises: 40 mM Tris-HCl, 100 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Tween-20, 2 mM dNTPs, pH 8.8.

[0025] More preferably, the LAMP reaction system is 10-50 μL: 1 / 2 volume of 2×LAMP reaction buffer, 1 / 25 volume of inner primer FIP, inner primer BIP, outer primer F3, outer primer B3, dye hydroxynapthol blue (HNB), Bst 2.0 Warmstart DNA polymerase and genomic template, and the remaining volume is made up with enzyme-free water.

[0026] As a preferred technical solution of the present application, the concentration ratio of the outer primers F3 and B3 to the inner primers FIP and BIP is 1:10-30.

[0027] As a preferred technical solution of the present application, in the step (3), the reaction conditions are a constant temperature of 61-65°C for 40-70 minutes.

[0028] Preferably, the reaction condition is a constant temperature of 61-65° C. for 60 minutes.

[0029] As a preferred technical solution of the present application, in the step (3), an appropriate amount of LAMP reaction solution is taken to measure the absorbance at 646 nm.

[0030] Preferably, the sample DNA is amplified using the LAMP reaction system described in claims 3-8. After the reaction, the sample is blue for positive (meat spoilage) and purple for negative (meat freshness). 646 The threshold value for judging a positive LAMP reaction was 0.19, and the reaction result was considered positive if the value exceeded this value.

[0031] The present invention also protects the use of the primers, the kit, or the detection method described above in detecting Pseudomonas, which are mainly used for detecting target microorganisms in food.

[0032] The present invention also protects the use of the primers, the kit, or the detection method described above in detecting Pseudomonas to indicate the freshness of meat products.

[0033] The present invention selects the conservative sequence of the Pseudomonas genome as its specific target, designs 4 specific primer sets that can amplify the gene at 61-65°C, and uses a visual dye to indicate the test result, which changes from purple (negative, representing fresh meat) to blue (positive, representing meat corruption). It can also be measured by OD 646 The absorbance value further confirmed the test results, and the OD 646 The value 0.19 was used as the threshold for determining a positive LAMP reaction. If the value exceeded this value, the reaction result was considered positive.

[0034] Beneficial effects:

[0035] The present invention provides a rapid meat freshness detection primer, a kit, a detection method and an application thereof for multiple scenarios, which have the following beneficial effects compared with the prior art:

[0036] 1. Strong specificity: The above primer set can only amplify Pseudomonas, and the detection results of other spoilage bacteria such as Serratia, Shewanella and Citrobacter, which are common in meat systems, are all negative.

[0037] 2. Convenient and reliable indication: OD can be observed and measured by color 646 The test result can be determined by the absorbance value, and can also be judged by naked eye observation under limited conditions. The color reaction and absorbance threshold are completely consistent with the changing trends of indicators such as the total number of fresh meat colonies during the shelf life, which can indicate whether the meat product is spoiled.

[0038] 3. Simple and practical: DNA templates can be obtained by simple boiling, and the reaction system only needs simple operation and gradual addition. No professional operation technology and equipment are required. Only a simple constant temperature device such as a water bath or metal bath is needed.

[0039] 4. Fast and efficient: Results available within 60 minutes. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 LAMP reaction specific detection. (a) and (b) are the color change diagram and agarose gel electrophoresis diagram of the Pseudomonas genome as template and non-Pseudomonas genome as template, respectively. 1-21 are Pseudomonas, 22-59 are non-Pseudomonas, and NTC is the blank control.

[0041] Figure 2 The results of LAMP test, total colony count, number of Pseudomonas, volatile basic nitrogen and pH changes of fresh chicken eluate of groups A, B and C are shown in Figure 1. Figure 2-1 A. Figure 2-1 B. Figure 2-1 C are the LAMP test results in the eluates of chicken samples from groups A, B, and C respectively. Figure 2-2 , Pseudomonas count; Figure 2-3 , total colony count; Figure 2 -4, volatile basic nitrogen.

[0042] Figure 3 The parallel detection results of Pseudomonas count, total colony count and LAMP in three scenarios: laboratory, market and home, were obtained for chicken, beef and pork samples. DETAILED DESCRIPTION

[0043] The present invention is further described below in conjunction with the examples, and the reagents or instruments used without indicating the manufacturer are all considered to be conventional products that can be purchased on the market. However, the protection scope of the present invention is not limited thereto.

[0044] Example 1 Establishment of Pseudomonas-specific LAMP detection method

[0045] 1. Bacterial DNA Extraction

[0046] 21 strains of Pseudomonas and 38 strains of non-Pseudomonas were inoculated into specific liquid culture medium and cultured for 24 hours. 1 mL of bacterial solution was used to extract the genomes of 21 strains of Pseudomonas and 38 strains of non-Pseudomonas using a bacterial genome centrifugal column DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP 302-02). The strains used in the experiment are shown in Table 1, all of which were isolated from corrupt chilled chicken and preserved in the National Meat Quality Safety Control Engineering Technology Research Center of Nanjing Agricultural University. The culture medium and culture conditions are shown in Table 2.

[0047] Table 1 Strain numbers and names

[0048]

[0049]

[0050] Table 2 Classification and conditions of microbial culture

[0051]

[0052] 2. LAMP reaction

[0053] The LAMP reaction system is 25 μL, as follows:

[0054]

[0055] Among them, 2×LAMP reaction buffer was in Bst 2.0WarmStart TM The 10×Isothemal Amplification Buffer included with the DNA polymerase contains MgSO4 and dNTPs, and the composition is as follows (12.5 μL):

[0056]

[0057] The primer sequences are as follows:

[0058] F3: CATCATGGCCCTTACGGC, as shown in SEQ ID NO: 1;

[0059] B3: ACTCCCATGGTGTGACGG, as shown in SEQ ID NO: 2;

[0060] FIP: TTAGCTCCACCTCGCGGCTT-GGGCTACACACGTGCTAC, as shown in SEQ ID NO: 3;

[0061] BIP: AGTCTGCAACTCGACTGCGTG-AAGGCCCGGGAACGTATT, as shown in SEQ ID NO:4.

[0062] The Pseudomonas genome was used as a positive template, the non-Pseudomonas genome was used as a negative template, and sterile ultrapure water was used as a blank control. The LAMP system was amplified at a constant temperature of 61-65°C for 60 minutes. The experimental results were evaluated by color development and agarose gel electrophoresis ( Figure 1 ).

[0063] Figure 1(a) reflects that only Pseudomonas was significantly amplified in the amplified sample, while Figure 1 (b) shows that after the reaction, the sample is blue for positive and purple for negative, and only Pseudomonas shows a blue result; the above results indicate that the primer set and reaction system of the present application have a specific amplification effect on Pseudomonas.

[0064] Example 2 Specific primer screening

[0065] In the present invention, four LAMP primer sets (Table 3) were designed for the conserved sequences of the Pseudomonas genome, each set of primers respectively having outer primers F3 and B3, inner primers BIP and FIP, and six strains of bacteria were selected, two strains of Pseudomonas (numbered 1 and numbered 2 in Table 1) and four strains of non-Pseudomonas (numbered 23, numbered 49, and Aeromonas salmonicida and Aeromonas salmonicida in Table 1, all separated from corrupt chilled chicken and preserved in the National Meat Quality Safety Control Engineering Technology Research Center of Nanjing Agricultural University), and the genome was extracted using a bacterial genome centrifugal column DNA extraction kit, and independent amplification detection was performed respectively. After the amplification was completed, the agarose gel electrophoresis test was performed, and if a ladder-like band appeared, the LAMP reaction was positive, otherwise it was negative, and the appropriate LAMP primers were preliminarily screened according to the band information.

[0066] Table 3 LAMP primers

[0067]

[0068]

[0069] According to the electrophoresis results, the primer set of the present application (Group 4) only amplifies the genome of Pseudomonas, but not the genome of non-Pseudomonas. It is preliminarily determined that its specificity meets the requirements. The primers of other groups will amplify the genome of non-Pseudomonas, with poor specificity, and do not meet the requirements of this experiment, so they are excluded. Therefore, the primer set of the present application is selected for the subsequent LAMP experiment.

[0070] Example 3: Verification of the accuracy of LAMP technology in detecting freshness

[0071] The sensory evaluation was completed by 10 trained students, and quantitative grading and scoring were performed from four aspects: overall acceptance, color, smell and stickiness. The count was performed with reference to the standard GB4789.2-2016 "Determination of total colony count" [and SN / T 4044-2014 "Technical methods for Pseudomonas in exported meat and meat products"]; the determination of volatile basic nitrogen was based on the semi-micro nitrogen determination method in GB5009.228-2016 "National Food Safety Standard Determination of Volatile Basic Nitrogen in Food".

[0072] The meat sample was placed in sterile physiological saline and shaken to obtain an eluate. The bacterial genome in the eluate was extracted as an amplification template for the LAMP reaction system. The same reaction conditions as in Example 1 were used to perform independent amplification detection. The results are shown in FIG. Figure 2 , Figure 3 shown.

[0073] Performance test results

[0074] Figure 1 It is a LAMP reaction specific detection. (a) and (b) are the color change diagram and agarose gel electrophoresis diagram of the Pseudomonas genome as template and the non-Pseudomonas genome as template, respectively. 1-21. Pseudomonas, 22-59. Non-Pseudomonas, NTC. Blank control. The results are shown in Figure 1 As shown, the LAMP reaction results using the Pseudomonas strain genome as a template were all blue, with step-like electrophoresis bands, and the LAMP reaction results were positive; the LAMP reaction results using the non-Pseudomonas genome as a template were all purple, with no electrophoresis bands, and the LAMP reaction results were negative, indicating that the designed primers can achieve specific detection of Pseudomonas bacteria.

[0075] Figure 2 The results of LAMP test, total colony count, number of Pseudomonas and changes in volatile basic nitrogen in the eluent of chicken samples from groups A, B and C are shown in Table 1. Figure 2-1 A. Figure 2-1 B. Figure 2-1 C are the LAMP test results of the eluates of chicken samples from groups A, B and C respectively. Figure 2-2 , changes in the number of Pseudomonas; Figure 2-3 , changes in total colony count; Figure 2 -4, changes in volatile basic nitrogen. According to Pseudomonas counts ( Figure 2-2 ) and LAMP reaction color change results ( Figure 2-1 ), the number of Pseudomonas in samples of groups A, B and C exceeded 5.40 log CFU / g on the 3rd, 3rd and 2nd day of storage, respectively. At the same time, the LAMP reaction solution turned blue (positive), and the absorbance exceeded the positive threshold of 0.19, indicating that the shelf life of samples of groups A, B and C was 2 days, 2 days and 1 day, respectively. The total number of colonies ( Figure 2-3 ) and sensory evaluation results, it was determined that the shelf life of samples in groups A, B and C were 2 days, 2 days and 1 day respectively. The results of LAMP test were consistent with those of shelf life test. Volatile basic nitrogen ( Figure 2 -4) The overall trend of the change is basically consistent with the test results. In summary, the quantitative number of Pseudomonas based on LAMP technology can indirectly complete the detection of the freshness of meat products. That is, if the reaction result is blue and OD 646 If it exceeds 0.19, the sample is considered corrupt.

[0076] Figure 3 The results of the LAMP parallel testing of the changes in the number of Pseudomonas in chicken, beef and pork, the total number of colonies and the simulated laboratory, market and home modes. Figure 3 As a result, after one day of storage, only the number of Pseudomonas in samples B1, B3 and C1 exceeded 5.4Log CFU / g, and the LAMP test results were blue (positive). At the same time, only the total colony count of these three groups of samples exceeded 6.0Log CFU / g specified in the national standard, and they were in the corruption stage, which was consistent with the LAMP test results. After three days of storage, the number of Pseudomonas in most samples was above 5.4Log CFU / g, and the total colony count exceeded 6.0Log CFU / g, and they were in the corruption stage, which was consistent with the corresponding LAMP test results, which were all blue (positive).

[0077] Table 4 is the correlation analysis between Pseudomonas and various indicators. The Pearson correlation coefficient is represented by the letter r, and its value is between -1 and 1, indicating a complete negative correlation to a complete positive correlation. The relationship between the number of Pseudomonas and other physical and chemical indicators was explored based on the Pearson correlation coefficient. As shown in Table 4, the total colony count and odor in the same group of samples have a stronger correlation with the number of Pseudomonas. Combining the sensory and physical and chemical index results of the three groups of meat products, the freshness of fresh meat is most accurately evaluated based on the total colony count and odor attributes, and the number of Pseudomonas has the strongest correlation with these two indicators. Therefore, it is scientific and accurate to infer the freshness of chilled chicken by the number of Pseudomonas.

[0078] Table 4 Correlation analysis between Pseudomonas count and various indicators

[0079]

[0080] Note: **. Extremely significant correlation (P<0.01); *. Significant correlation (P<0.05).

[0081] Application Example 1

[0082] The laboratory end is mainly suitable for scientific research and production laboratory testers to accurately test the freshness of samples, such as production line quality inspection and random inspection by third-party testing agencies. In continuous industrial production, bacteria in the environment can easily contaminate meat products. The products on the production line of poultry production and processing factories, the surface of production equipment, or the cooling water in the pre-cooling pool in the slaughterhouse are the test objects. Usually, enterprises or testing agencies have basic laboratory equipment, including pipettes, balances, measuring cylinders, water baths, ELISA instruments, etc. Taking the product testing on the production line as an example, 10g of sample was weighed, put into a sterile homogenizing bag and added with 90mL sterile water, and placed on a shaker at 250r for 10min; 1mL of eluate was taken, boiled at 100℃ for 10min as the genomic crude extract, and cooled for use; the standard LAMP system (25μL) was proportionally expanded by 1 times to 50μL: 25μL of 2×LAMP reaction buffer, 2μL of inner primer FIP, 2μL of inner primer BIP, 2μL of outer primer F3, 2μL of outer primer B3, 2μL of dye hydroxynaphthol blue (HNB), 2μL of Bst2.0Warmstart DNA polymerase, 11μL of enzyme-free water, and 2μL of DNA crude extract. Keep the temperature at 61℃ for 1h; observe the color change of the reaction solution, and take 46μL to measure the absorbance value at 646nm.

[0083] Judgment method: If the reaction solution is purple and OD 646 Less than 0.19, indicating that the meat is fresh; if the premix is ​​blue and OD 646 Greater than 0.19 indicates that the meat is spoiled.

[0084] Application Example 2

[0085] The market side is mainly suitable for sales personnel to conduct freshness testing on retail samples, mainly including logistics distribution, quality supervisors or warehouse managers in wholesale stores and retail supermarkets. Usually, the market platform is equipped with simple experimental instruments and equipment, including balances, measuring cylinders, constant temperature devices, thermometers, etc. This method provides LAMP reaction solution (12.5μL of 2×LAMP reaction buffer, 1μL of inner primer FIP, 1μL of inner primer BIP, 1μL of outer primer F3, 1μL of outer primer B3, 1μL of dye hydroxynaphthol blue (HNB), 1μL of Bst2.0Warmstart DNA polymerase), sterile measuring cup (120mL), and sterile syringe (needle number: 0.5). The goods on the shelves of supermarkets are used as the detection objects. The quality of meat products is affected by temperature fluctuations or packaging damage during transportation and sales during the shelf life. Weigh 5 g of sample, put it into a sterile measuring cup and add 45 mL of sterile water, and shake it manually for 30 seconds; boil the measuring cup in 100°C water for 10 minutes, take the supernatant as the crude genomic extract, and cool it for later use; use a syringe to draw 1 mL of the crude extract, add a drop of the crude extract (about 5-6 μL) to the LAMP premix, mix well, and keep it at a constant temperature of 61-65°C for 1 hour and observe the color change.

[0086] Judgment method: If the reaction liquid is purple, it indicates that the meat is fresh; if the reaction liquid is blue, it indicates that the meat is rotten.

[0087] Application Example 3

[0088] The home end is mainly suitable for consumers to test the freshness of samples. The meat products purchased and stored by the family are used as the test objects. The storage method and time are closely related to the changes in meat quality. Usually, the family does not have the basic instruments required for testing. Therefore, this method provides LAMP reaction solution (12.5 μL of 2×LAMP reaction buffer, 1 μL of inner primer FIP, 1 μL of inner primer BIP, 1 μL of outer primer F3, 1 μL of outer primer B3, 1 μL of dye hydroxynapthol blue (HNB), 1 μL of Bst 2.0 Warmstart DNA polymerase), sterile measuring cup (120 mL), proportional module (3×3×3 cm), and sterile syringe (needle number: 0.5). Cut the meat into specific sizes according to the modular ratio (3×3×3cm) and quickly transfer it to a graduated measuring cup; add 45-48mL of sterile water to the measuring cup and shake it manually for 30s; boil the measuring cup at 100℃ for 10min, take the supernatant as the crude genomic extract, and cool it for later use; draw 1mL of the crude extract with a syringe, add a drop of the crude extract (about 5-6μL) to the LAMP premix and mix well, keep it at a constant temperature of 61-65℃ for 1h and observe the color change.

[0089] Judgment method: If the reaction liquid is purple, it indicates that the meat is fresh; if the reaction liquid is blue, it indicates that the meat is rotten.

[0090] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims. Sequence Listing <110> Nanjing Agricultural University <120> A primer for rapid detection of meat freshness in multiple scenarios and its detection method and application <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 catcatggcc cttacggc 18 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 actcccatgg tgtgacgg 18 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <400> 3 ttagctccac ctcgcggctt gggctacaca cgtgctac 38 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <400> 4 agtctgcaac tcgactgcgt gaaggcccgg gaacgtatt 39

Claims

1. A primer for rapid detection of meat freshness in multiple scenarios, characterized in that: The conserved sequence of the Pseudomonas genome was used as a template to design primer sequences, wherein the primers include outer primers and inner primers, wherein the outer primers include F3 and B3, and the inner primers include FIP and BIP, and the specific sequences thereof are as follows: F3: GTCCATGGCCCTTACGGC; B3:TCACCCATGGTGTGACGG; FIP:ATTGCTCCACCTCGCGGCTTGGGCTACACACGTGCTAC; BIP: TGACTGCAACTCGACTGCGTGAAGGCCCGGGAACGTATT.

2. A meat freshness rapid detection kit for multiple scenarios, characterized in that: Comprising the primer according to claim 1; The kit also includes: 2×LAMP reaction buffer, Bst 2.0WarmStart TM DNA polymerase, hydroxynaphthol blue; the 2×LAMP reaction buffer comprises: 40 mM Tris-HCl, 100 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Tween-20, 2 mM dNTPs and pH 8.

8.

3. A method for rapid meat freshness detection in multiple scenarios, characterized in that: The steps of this method are as follows: (1) placing the meat sample in sterile physiological saline and shaking it to obtain an eluent; (2) extracting the bacterial genome in the eluate as an amplification template for the LAMP reaction system; (3) adding the template obtained in (2) to the LAMP reaction system for isothermal amplification, measuring the absorbance and observing the color change of the system with the naked eye; Wherein, the LAMP reaction system contains the primers according to claim 1; The LAMP reaction system of step (3) comprises: 2×LAMP reaction buffer, Bst 2.0WarmStart TM DNA polymerase, hydroxynaphthol blue and the primer according to claim 1; The 2×LAMP reaction buffer comprises: 40 mM Tris-HCl, 100 mM KCl, 20 mM (NH4)2SO4, 12 mM MgSO4, 0.2% Tween-20, 2 mM dNTPs, pH 8.8; in, The method for extracting the genome of bacteria in the eluate at the laboratory end is as follows: weigh 10 g of sample, put it into a sterile homogenizing bag and add 90 mL of sterile water, place it on a shaker at 250 r for 10 min, take 1 mL of the eluate, and boil it at 100 °C for 10 min as the crude genome extract; The method for extracting the genome of bacteria in the eluate at the market end is as follows: weigh 5 g of sample, put it into a sterile measuring cup and add 45 mL of sterile water, shake it manually for 30 seconds, boil the measuring cup in 100°C water for 10 minutes, and take the supernatant as the crude genome extract; The method for extracting the genome of bacteria in the eluate at home is as follows: cut the meat into specific sizes according to the modular ratio of 3×3×3cm, quickly transfer it to a graduated measuring cup, add 45-48mL of sterile water to the measuring cup, shake it manually for 30s, boil the measuring cup at 100℃ for 10min, and take the supernatant as the crude genome extract.

4. The method for rapid meat freshness detection in multiple scenarios according to claim 3 is characterized in that: In the step (1), the mass ratio of the meat sample to the sterile physiological saline is 1:5-9, and the bacteria on the surface of the meat are eluted by oscillation.

5. The method for rapid meat freshness detection for multiple scenarios according to claim 3 is characterized in that: In step (2), the bacterial genome is extracted using a conventional kit or a boiling method, i.e., 1 mL of the eluate is boiled in a 90-100° C. metal bath for 8-10 minutes.

6. The method for rapid meat freshness detection in multiple scenarios according to claim 3, characterized in that: The LAMP reaction system is 10-50 μL: 1 / 2 volume of 2×LAMP reaction buffer, 1 / 25 volume of inner primer FIP, inner primer BIP, outer primer F3, outer primer B3, dye hydroxynaphthol blue, Bst 2.0 Warmstart DNA polymerase and genomic template, and the remaining volume is filled with enzyme-free water.

7. The method for rapid meat freshness detection applicable to multiple scenarios according to claim 3 is characterized in that: The concentration ratio of the outer primers F3 and B3 to the inner primers FIP and BIP is 1:10-30.

8. The method for rapid meat freshness detection in multiple scenarios according to claim 3 is characterized in that: The reaction conditions in step (3) are constant temperature at 61-65° C. for 40-70 minutes.

9. The method for rapid meat freshness detection applicable to multiple scenarios according to claim 3, characterized in that: In step (3), take an appropriate amount of the LAMP reaction solution and measure the absorbance at 646 nm.

10. The method for rapid meat freshness detection applicable to multiple scenarios according to claim 9, characterized in that: The sample DNA is amplified using the LAMP reaction system described in claim 3. After the reaction, the sample is blue for positive and purple for negative. 646 The threshold value for judging a positive LAMP reaction was 0.19, and the reaction result was considered positive if the value exceeded this value.

11. Use of the primer according to claim 1, or the kit according to claim 2, or the detection method according to any one of claims 3 to 10 in detecting Pseudomonas to indicate the freshness of meat.

Images