Methods for mapping rolling circle amplification products

Abstract

Provided herein are methods for mapping rolling circle amplification (RCA) products comprising unique identifier sequences. The methods generally comprise (a) generating a complex of a population of grid oligonucleotide molecules and a population of RCA products each having a unique RCA product identifier sequence, wherein the grid oligonucleotide hybridizes directly or indirectly via a splint to a complementary site in the RCA product; (b) extending the grid oligonucleotide molecules that hybridize to two RCA products to add the complements of the unique RCA product identifier sequences from the two RCA products to the grid oligonucleotide molecules; (c) sequencing the extended grid oligonucleotides; (d) analyzing the sequences to identify which pairs of complements of unique RCA product identifier sequences have been added to the grid oligonucleotides; and (e) making one or more physical maps of the immobilized RCA products using the pairs of sequences identified in (d).

Description

[0001] background

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 926,907, filed on October 28, 2019, which is incorporated herein in its entirety. Background of the Invention

[0004] Cell polarity, the bias of biomarkers toward one or more regions within or on the cell surface, is a common phenomenon but is difficult to study in a high-throughput manner. For example, while several methods exist for analyzing cell surface biomarker expression on single cells (e.g., methods involving flow cytometry or placing single cells in a compartment and then measuring the single cell), these methods do not provide any information about the spatial relationships of cell surface biomarkers on a single cell. Recent methods for analyzing the spatial relationships between biomolecules within or on cells, such as proximity-connection techniques (see, e.g.), Weinstein's diffusion-based methods (see, for example, Cell 2019 178:229-241 and US 20160265046) and array-based methods (see, for example, Vickovic et al., Nature Methods 2019 16:987-990) are either poorly adapted to the analysis of cell surface markers or do not provide any information about cell polarity. Microscopy is the gold standard for analyzing spatial relationships between markers on single cells. However, microscopy is inherently very low throughput and difficult to automate.

[0005] Given the above, there is still a need for methods to analyze cell polarity in a high-throughput manner. Invention Overview

[0007] Among other things, this paper describes a sequencing-based approach for analyzing the distribution of biomarkers that may be intracellular or on cells. This approach relies on immobilizing rolling circle amplification (RCA) products within or on a target (e.g., a cell or substrate), mapping the RCA products relative to each other, and then mapping the location and amount of the biomarker onto the RCA products via proximity assays.

[0008] In some embodiments, the method may include: (a) generating a complex comprising a population of clathrate oligonucleotide molecules and a population of RCA products, each having a unique RCA product identifier sequence, wherein the clathrate oligonucleotides hybridize directly or indirectly via a splint to complementary sites in the RCA products; (b) extending the clathrate oligonucleotide molecules hybridized with the two RCA products to add complementary sequences from the unique RCA product identifier sequences of the two RCA products to the clathrate oligonucleotide molecules; (c) sequencing the extended clathrate oligonucleotides; (d) analyzing the sequences to identify which complementary sequence pairs of the unique RCA product identifier sequences have been added to the clathrate oligonucleotides; and (e) using the sequence pairs identified in (d) to construct one or more physical maps of the immobilized RCA products. This method is conceptually as follows: Figure 2 As shown, there are several possible variations.

[0009] This method can be implemented in many different ways. For example, as Figure 13 and Figure 14 For example, the method can be implemented such that at least some of the unique RCA product identifier sequences in the RCA product in step (a) are double-stranded, and step (b) includes linking a grid oligonucleotide molecule to the end of the double-stranded region of the RCA product, thereby adding complementary sequences from the unique RCA product identifier sequences of the two RCA products to the grid oligonucleotide.

[0010] In other examples, such as Figure 6 , Figure 7 and Figures 9 to 12 By way of example, the method may be implemented such that step (a) includes hybridizing a population of clathrate oligonucleotide molecules with a population of RCA products, wherein the clathrate oligonucleotide molecules or RCA products are immobilized, wherein: (i) each of the RCA products in the RCA product population has a unique RCA product identifier sequence and a clathrate oligonucleotide binding sequence; and (ii) each of the clathrate oligonucleotide molecules contains a first terminal sequence complementary to the clathrate oligonucleotide binding sequence and a second terminal sequence complementary to the clathrate oligonucleotide binding sequence; and (iii) at least some of the clathrate oligonucleotide molecules hybridize with two neighboring RCA products. In these embodiments, extension may include gap filling and / or ligation reactions that add complementary sequences from the unique RCA product identifier sequences of two neighboring RCA products to the clathrate oligonucleotide.

[0011] In some implementations, grid oligonucleotide molecules can be prepared in situ (i.e., generated by linking two or more shorter oligonucleotides in a splint-mediated ligation reaction). See, for example, Figure 12 In other embodiments, intact grid oligonucleotide molecules hybridize to sites in the sample. See, for example, Figure 10In other embodiments, the pre-prepared RCA product hybridizes to a site in the sample, see, for example, Figure 6 and Figure 7 In other embodiments, the RCA product can be prepared in situ within or on cells. The in situ production of the RCA product has been described in various publications. For example, Soderberg et al. (Nat.Methods 2006 3:995-1000) described an in situ proximity assay (PLA) for the simultaneous binding of two antibodies attached to oligonucleotides to produce RCA products in situ; Leuchowius et al. (Cytometry A. 2009 75:833-9) described in situ PLA on the cell surface for flow cytometry; Larsson et al. (Nat.Methods. 2010 7:395-7) described the detection of mRNA in cells using padlock probes and in situ RCA; Gusev et al. (Am.J.Pathol. 2001 159:63-69) described the detection of dingle proteins in tissues and on cell surfaces by immune RCA amplification; and Lizardi et al. (Nat Genet. 1998 19:225-32) described a method for detecting point mutations in cells using in situ RCA.

[0012] In some embodiments, the method may include: (a) hybridizing a population of clathrate oligonucleotide molecules with a population of RCA products, wherein the clathrate oligonucleotide molecules or RCA products are immobilized within a cell or on one or more surfaces (e.g., a glass slide or a cell), wherein: (i) each of the RCA products in the RCA product population has a unique RCA product identifier sequence and a clathrate oligonucleotide binding sequence; and (ii) each of the clathrate oligonucleotide molecules comprises a first terminal sequence complementary to the clathrate oligonucleotide binding sequence and a second terminal sequence complementary to the clathrate oligonucleotide binding sequence; and (iii) at least some of the clathrate oligonucleotide molecules hybridize with two neighboring RCA products; (b) extending the clathrate oligonucleotide molecules hybridized with the two neighboring RCA products to add complementary sequences from the unique RCA product identifier sequences of the two neighboring RCA products to the clathrate oligonucleotides, thereby producing extended clathrate oligonucleotides; (c) sequencing the extended clathrate oligonucleotides; and (d) analyzing the sequences to identify which complementary sequence pairs of the unique RCA product identifier sequences have been added to the extended clathrate oligonucleotides.

[0013] In some embodiments, the method may include: (a) hybridizing a population of grid oligonucleotide molecules with a population of RCA products, wherein the grid oligonucleotide molecules or RCA products are immobilized within a cell or on one or more surfaces (e.g., a slide or a cell), wherein: (i) the population of RCA products comprises: i. a first set of RCA products, each comprising a repeating sequence comprising a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and ii. a second set of RCA products, comprising repeating sequences comprising a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; (ii) grid oligonucleotide molecules Each comprises a first terminal sequence complementary to a first grid oligonucleotide binding sequence and a second terminal sequence complementary to a second grid oligonucleotide binding sequence; and (iii) at least some grid oligonucleotide molecules hybridize with two neighboring RCA products; (b) extend the grid oligonucleotide molecules hybridized with the two neighboring RCA products to add complementary sequences from unique RCA product identifier sequences from the two neighboring RCA products to the grid oligonucleotides, thereby producing extended grid oligonucleotides; (c) sequence the extended grid oligonucleotides; and (d) analyze the sequences to identify which complementary sequence pairs of unique RCA product identifier sequences have been added to the grid oligonucleotides.

[0014] In any implementation scheme (and as Figures 10 to 16 (As illustrated), grid oligonucleotide molecules can be immobilized intracellularly or on one or more surfaces via a probe. In other embodiments (and as shown in the illustration), Figure 6 , Figure 7 and Figure 9 (As illustrated), RCA products can be immobilized inside cells or on one or more surfaces via a probe.

[0015] The sequences of the sequence pairs identified in (d) can be used to create one or more physical maps (which may include overlapping and / or non-overlapping maps) of the fixed RCA product, wherein the maps provide the location of the fixed RCA product within the cell or on one or more surfaces (e.g., the cell surface). As described above, depending on how the method is implemented, the maps can be two-dimensional or three-dimensional.

[0016] As will be described in more detail below, RCA products can be immobilized via one or more binders (e.g., antibodies), wherein each binder binds (i.e., hybridizes) a sequence in the RCA product as well as an intracellular or cellular site (e.g., a cell surface marker). In these embodiments, the method may further include proximity determination between one or more binders and the RCA products to which they are bound, thereby allowing a surface binder profile to be mapped to a specific RCA product.

[0017] Once the binder spectrum has been mapped to a specific RCA product, the location and amount of individual binders can be mapped onto the physical spectrum of the fixed RCA product, as described above. The distribution of binders on the spectrum and their binding sites can then be analyzed.

[0018] Probe systems are also provided. In some embodiments, the probe system may include: (a) a population of RCA products, wherein each RCA product in the population has a unique RCA product identifier sequence and a clathrate oligonucleotide binding sequence; and (b) a population of clathrate oligonucleotide molecules, wherein the terminal sequence at one end of the clathrate oligonucleotide molecule is complementary to a clathrate oligonucleotide binding sequence, and the terminal sequence at the other end of the clathrate oligonucleotide molecule is complementary to a clathrate oligonucleotide binding sequence, wherein hybridization of (a) and (b) produces a complex in which the clathrate oligonucleotide hybridizes with a neighboring RCA product. The clathrate oligonucleotide molecule may be a single molecule (wherein the nucleotides are covalently linked to each other) or broken into one or more sequences. In these embodiments, if the clathrate oligonucleotide molecule is broken into one or more sequences, the system may further include one or more splint oligonucleotides holding the sequences together.

[0019] In some embodiments, the probe system may include: (a) a population of RCA products comprising: (i) a first set of RCA products, each comprising a repeating sequence including a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and (ii) a second set of RCA products comprising repeating sequences including a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; and (b) a population of grid oligonucleotide molecules, wherein the terminal sequence at one end of the grid oligonucleotide molecule is complementary to the first grid oligonucleotide binding sequence, and the terminal sequence at the other end of the grid oligonucleotide molecule is complementary to the second grid oligonucleotide binding sequence. In these embodiments, hybridization of (a) and (b) produces a complex in which the grid oligonucleotide hybridizes with a neighboring RCA product. Brief description of the attached diagram

[0021] Those skilled in the art will understand that the accompanying drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of this teaching in any way.

[0022] Figure 1 This illustration shows cells covered in RCA products.

[0023] Figure 2This illustration demonstrates an example of how to add a unique molecular identifier from a neighboring RCA product to a lattice oligonucleotide. In this example, using the RCA product as a template, by extending the 3' end of the lattice oligonucleotide, the complementary sequence of one of the unique molecular identifiers (e.g., UID2) can be added to the 3' end of the lattice oligonucleotide, and the complementary sequence of another unique molecular identifier (e.g., UID1) can be added to the 5' end of the lattice oligonucleotide, through, for example, gap filling / connection of an upstream oligonucleotide (e.g., ...). Figure 3 (As illustrated and described in more detail below) or by linking a grid oligonucleotide to an oligonucleotide complementary to a unique molecular identifier and hybridizing with an RCA product. In the latter embodiment, the RCA product serves as a clamp for the linker.

[0024] Figure 3 This illustration shows one method of adding UMI to grid oligonucleotides.

[0025] Figure 4 This illustration shows how unique molecular identifiers copied into a grid oligonucleotide are mapped in pairs to produce the physical map of the RCA product.

[0026] Figure 5 The illustration shows the relative sizes of UMI-labeled rolling circle amplification products, antibody-oligonucleotide probes, and cells.

[0027] Figure 6 The first embodiment of the method of the present invention is illustrated.

[0028] Figure 7 The second embodiment of the method of the present invention is illustrated.

[0029] Figure 8 Indication of usage Figure 7 The PCR amplicon generated by the method shown.

[0030] Figure 9 The third embodiment of the method of the present invention is illustrated.

[0031] Figure 10 The fourth embodiment of the method of the present invention is illustrated.

[0032] Figure 11 The fifth embodiment of the method of the present invention is illustrated.

[0033] Figure 12 The sixth embodiment of the method of the present invention is illustrated.

[0034] Figure 13 This illustratively describes the first part of the seventh embodiment of the method of the present invention.

[0035] Figure 14This illustratively describes the second part of the seventh embodiment of the method of the present invention.

[0036] Figure 15 This illustratively describes the first part of the eighth embodiment of the method of the present invention.

[0037] Figure 16 This illustratively describes the second part of the eighth embodiment of the method of the present invention.

[0038] definition

[0039] Before describing the exemplary embodiments in more detail, the following definitions are set forth to illustrate and define the meaning and scope of the terms used in the specification.

[0040] Numerical ranges include the numbers defined for the range. Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' direction; and amino acid sequences are written from left to right in an amino to carboxyl direction.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Singleton, et al., *DICTIONARY OF MICROBIOLOGY AND MOLECULARBIOLOGY*, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, *THE HARPERCOLLINS DICTIONARY OF BIOLOGY*, Harper Perennial, NY (1991), provide general meanings to many of the terms used herein. Nevertheless, for clarity and ease of reference, certain terms are defined below.

[0042] It must be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural indicators unless the context clearly indicates otherwise. For example, the term “primer” refers to one or more primers, i.e., a single primer and multiple primers. It should also be noted that claims may be drafted to exclude any optional elements. Therefore, this description is intended to serve as a priori basis for using exclusive terms such as “unique,” ​​“only,” etc., or for using negative restrictions in relation to the statement of claim elements.

[0043] The term "nucleotide" is intended to include moieties that contain not only known purine and pyrimidine bases but also other modified heterocyclic bases. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated ribose, or other heterocycles. Furthermore, the term "nucleotide" includes moieties containing haptens or fluorescent labels and may contain not only conventional ribose and deoxyribose but also other sugars. Modified nucleosides or nucleotides also include modifications to the sugar moieties, such as the substitution of one or more hydroxyl groups with halogen atoms or aliphatic groups, or functionalization into ethers, amines, etc.

[0044] The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to describe polymers of any length, such as those composed of nucleotides (e.g., deoxyribonucleotides or ribonucleotides) of greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, up to about 10,000 or more bases, and which can be enzymatically or synthetically produced (e.g., PNA as described in U.S. Patent No. 5,948,902 and the references cited therein), which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to that of two naturally occurring nucleic acids, for example, participating in Watson-Crick base-pairing interactions. Naturally occurring nucleotides include guanine, cytosine, adenine, thymine, and uracil (G, C, A, T, and U, respectively). DNA and RNA have deoxyribose and ribose backbones, respectively, while the backbone of PNA consists of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In PNAs, various purine and pyrimidine bases are linked to the backbone via methylene carbonyl bonds. Locked nucleic acids (LNAs), often referred to as inaccessible RNAs, are modified RNA nucleotides. The ribose portion of an LNA nucleotide is modified with an additional bridge connecting the 2' oxygen and 4' carbon. This bridge “locks” the ribose in a 3'-endodont (North) conformation, which is typically found in type A duplexes. LNA nucleotides can be mixed with DNA or RNA residues in oligonucleotides when needed. The term “unstructured nucleic acid” or “UNA” is a nucleic acid containing non-natural nucleotides bound together with reduced stability. For example, an unstructured nucleic acid may contain G' and C' residues, where these residues correspond to non-natural forms of G and C, i.e., analogs of G and C, which base-pair with each other with reduced stability but retain the ability to base-pair with naturally occurring C and G residues, respectively. Unstructured nucleic acids are described in US20050233340, which is incorporated herein by reference to disclose UNA.

[0045] As used herein, the term "oligonucleotide" refers to a single-stranded nucleotide polymer of about 2 to 200 nucleotides, or up to 500 nucleotides in length. Oligonucleotides can be synthetic or enzymatically prepared, and in some embodiments, are 30 to 150 nucleotides in length. Oligonucleotides may comprise ribonucleotide monomers (i.e., may be oligoribonucleotides) or deoxyribonucleotide monomers. Oligonucleotide lengths can be, for example, 10 to 20, 21 to 30, 31 to 40, 41 to 50, 51 to 60, 61 to 70, 71 to 80, 80 to 100, 100 to 150, or 150 to 200 nucleotides.

[0046] As used herein, the term "primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of primer extensions complementary to the nucleic acid strand (i.e., in the presence of nucleotides and an inducer (e.g., DNA polymerase) and at suitable temperature and pH), can act as a starting point for synthesis. Primers can be single-stranded and must be long enough to initiate the synthesis of the desired extension in the presence of an inducer. The exact length of a primer will depend on many factors, including temperature, primer source, and the method used. For example, for diagnostic applications, oligonucleotide primers typically contain 15 to 25 or more nucleotides, depending on the complexity of the target sequence or fragment, but it may contain fewer nucleotides. The primers used herein are chosen to be substantially complementary to the different strands of a particular target DNA sequence. This means that primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence does not need to reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, while the rest of the primer sequence is complementary to the strand. Alternatively, non-complementary bases or longer sequences can be intercalated into the primers, provided that the primer sequence and the hybridized strand sequence have sufficient complementarity to form a template for synthesizing the extended product.

[0047] The term "hybridization" or "hybridization with" refers to the process by which a nucleic acid strand anneals to a second complementary nucleic acid strand under normal hybridization conditions to form a stable double helix (homogeneous or heterogeneous double helix), and does not form a stable double helix with unrelated nucleic acid molecules under the same normal hybridization conditions. Double helix formation is accomplished by annealing the two complementary nucleic acid strands during the hybridization reaction. By adjusting the hybridization conditions (often referred to as hybridization strictness), a hybridization reaction can be made highly specific so that hybridization between the two nucleic acid strands does not form a stable double helix, for example, preserving the double-stranded region under normal strict conditions unless the two nucleic acid strands contain a certain number of substantially or completely complementary nucleotides in a specific sequence. For any given hybridization reaction, "normal hybridization or normal strict conditions" is readily determined. See, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, or Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. As used in this article, the term "hybridization" refers to any process by which a strand of nucleic acid binds to a complementary strand through base pairing.

[0048] Nucleic acids are considered to "selectively hybridize" with a reference nucleic acid sequence if the two sequences specifically hybridize with each other under moderate to highly stringent hybridization and washing conditions. Moderate and highly stringent hybridization conditions are known (see, for example, Ausubel et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons 1995, and Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, 2001 ColdSpring Harbor, NY). An example of highly stringent conditions involves hybridization at approximately 42°C in 50% formamide, 5X SSC, 5X Denhardt solution, 0.5% SDS, and 100 μg / ml denatured vector DNA, followed by washing twice at room temperature in 2X SSC and 0.5% SDS, and then washing twice more at 42°C in 0.1X SSC and 0.5% SDS.

[0049] As used herein, the term “sequencing” refers to a method for obtaining the identity of at least 10 consecutive nucleotides of a polynucleotide (e.g., at least 20, at least 50, at least 100, or at least 200 or more consecutive nucleotides).

[0050] The term "next-generation sequencing" refers to so-called parallel synthesis sequencing or ligation sequencing platforms currently used by companies such as Illumina, Life Technologies, BGI Genomics (Complete Genomics technology), and Roche. Next-generation sequencing methods may also include nanopore sequencing methods or electron detection-based methods, such as the Ion Torrent technology commercialized by Life Technologies.

[0051] As used herein, the term “double-stranded” or “double-stranded” describes two complementary polynucleotides that have paired (i.e., hybridized together).

[0052] The terms “determine,” “measure,” “assess,” “evaluate,” “determine,” and “analyze” are used interchangeably herein to refer to the form of measurement and include determining the presence or absence of an element. These terms include quantitative and / or qualitative determinations. Evaluations can be relative or absolute.

[0053] As used herein, the term "linkage" refers to the enzymatic linking of the 5' terminal nucleotide of a first DNA molecule to the 3' terminal nucleotide of a second DNA molecule.

[0054] The terms “multiple,” “group,” and “cluster” are used interchangeably to refer to things that contain at least two members. In some cases, a multiple may have at least 10, at least 100, at least 10,000, or at least 100,000 members.

[0055] A "primer binding site" is a site in a target polynucleotide or fragment where an oligonucleotide hybridizes. If an oligonucleotide "provides" a primer binding site, the primer can hybridize with that oligonucleotide or its complementary sequence.

[0056] As used in this article, the term "chain" refers to a nucleic acid composed of nucleotides covalently linked together by covalent bonds (e.g., phosphodiester bonds).

[0057] As used in this article, the term "extension" refers to the process of extending a primer by adding nucleotides using a polymerase. If a primer that has been annealed with a nucleic acid is extended, that nucleic acid serves as a template for the extension reaction.

[0058] As used herein, the term “rolling circle amplification” or simply “RCA” refers to isothermal amplification that produces linear multiple copies of a circularized nucleic acid template using a strand displacement polymerase. RCA is well-known in the field of molecular biology and has been described in numerous publications, including but not limited to Lizardi et al. (Nat. Genet. 1998 19:225-232), Schweitzer et al. (Proc. Natl. Acad. Sci. 2000 97:10113-10119), Wiltshire et al. (Clin. Chem. 2000 46:1990-1993) and Schweitzer et al. (Curr. Opin. Biotech 2001 12:21-27), which are incorporated herein by reference.

[0059] As used herein, the term "rolling circle amplification product" refers to the multiple product of a rolling circle amplification reaction. As used herein, the term "fluorescently labeled rolling circle amplification product" refers to a rolling circle amplification product that has been fluorescently labeled by, for example, hybridizing a fluorescently labeled oligonucleotide with the rolling circle amplification product or by other means (e.g., incorporating a fluorescent nucleotide into the product during amplification).

[0060] As used herein, the term "surface" refers to any solid material (e.g., glass, metal, ceramic, organic polymer surface, or gel) that may contain cells or any combination of cell-derived biomolecules (e.g., proteins, nucleic acids, lipids, oligosaccharides / polysaccharides, biomolecular complexes), organelles, cell debris, or excretions (exosomes, microvesicles), etc. Tissue blots, Western blots, and glass slides are examples of solid materials having surfaces. Cells, such as mammalian cell suspensions, are another example of a surface.

[0061] As used in this article, the term "splint" refers to an oligonucleotide that hybridizes with the ends of two other oligonucleotides and brings those ends together to produce a linkable node.

[0062] Definitions of other terms may appear throughout the specification.

[0063] Description of exemplary implementation schemes

[0064] Before describing the various embodiments, it should be understood that the teachings of this disclosure are not limited to the specific embodiments described, and are equally, of course, subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of this teaching will be limited only by the appended claims.

[0065] The chapter headings used herein are for structuring purposes only and should not be construed as limiting the subject matter in any way. Although this teaching is described in conjunction with various embodiments, it is not intended to be limited to those embodiments. Rather, this teaching includes various alternatives, modifications, and equivalents that will be understood by those skilled in the art.

[0066] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this teaching, only exemplary methods and materials are described here.

[0067] References to any publication refer to its publication prior to the filing date and should not be construed as an admission that the claims of this application are not entitled to precede such publication by virtue of a prior invention. Furthermore, the publication date provided may differ from the actual publication date, which requires independent verification.

[0068] As will be apparent to those skilled in the art upon reading this disclosure, each individual embodiment described and illustrated herein has discrete components and features that can be readily separated from or combined with features of any of the other several embodiments without departing from the scope or spirit of this teaching. Any enumerated methods may be implemented in the order of the enumerated events or in any other logically possible order.

[0069] All patents and publications mentioned herein, including all sequences disclosed therein, are expressly incorporated herein by reference.

[0070] The following disclosure provides a method for mapping adjacent RCA products. The map produced by this method can be a three-dimensional or two-dimensional map, depending on how the method is implemented. For example, if the RCA product is immobilized within a cell (e.g., generated in situ within a cell), the resulting map may be three-dimensional. In other embodiments, for example, if the RCA product is immobilized on one or more surfaces (e.g., the surface of one or more cells that may be suspended or mounted on a support), the map produced by this method may be two-dimensional. While this method can be applied to cells (as described below), it is suitable for mapping adjacent RCA products immobilized on any surface (e.g., a slide that may have a tissue imprint or a Western blot, etc.). Similarly, while RCA products or clathrate oligonucleotide molecules that RCA products may bind to can be anchored to sites within or on cells or on cell surfaces via antibodies (e.g., antibodies conjugated to oligonucleotides having sequences complementary to sequences in the RCA product or clathrate oligonucleotide molecule), RCA products or clathrate oligonucleotide molecules can be immobilized using any type of interaction (e.g., direct or indirect, covalent or non-covalent interactions). For example, in some embodiments, RCA products or clathrate oligonucleotide molecules can be bound to cells via a binding agent (e.g., aptamers, antibodies, or oligonucleotides, etc.), wherein the binding agent binds to sequences in the RCA product or clathrate oligonucleotide molecule and sites within the cell or on one or more cell surfaces. In some embodiments, RCA products or clathrate oligonucleotide molecules can be immobilized via hybridization with oligonucleotides (which also hybridize with nucleic acids (e.g., cellular RNA)), or the RCA product can be non-covalently immobilized to the site via electrostatic interactions, via streptavidin / biotin interactions, or via covalent bonds (e.g., via click coupling).

[0071] For clarity, the phrase “hybridizing a population of lattice oligonucleotide molecules with a population of RCA products, wherein the lattice oligonucleotide molecules or RCA products are immobilized” is intended to cover the following implementation: (a) hybridizing lattice oligonucleotides with immobilized RCA products (in which case the RCA products are first immobilized or generated in situ prior to lattice oligonucleotide hybridization), such as Figure 6 , Figure 7 and Figure 9 As illustrated, or (b) the RCA product hybridizes with immobilized grid oligonucleotides (in which case the grid oligonucleotides are first immobilized or generated in situ before the RCA product hybridizes), such as Figures 10 to 12 and Figures 14 to 16 exemplified.

[0072] In any embodiment, the RCA product or grid oligonucleotide molecule may be immobilized intracellularly or on cells in solution, intracellularly or on cells on a support (e.g., a glass slide), intracellularly or on cells in a three-dimensional sample of tissue, or intracellularly or on cells in a tissue section. For example, a sample containing cells in solution may be a sample of cultured cells that have already been grown as a cell suspension. In other embodiments, dissociated cells may be used (these cells can be generated by dissociating cultured cells using trypsin or cells in solid tissues (such as soft tissues such as the liver or spleen)). In a particular embodiment, the RCA product may be immobilized on cells present in blood, such as cells in whole blood or a subset thereof. Cell subsets in whole blood include platelets, erythrocytes (red blood cells), and leukocytes (i.e., peripheral blood leukocytes, composed of neutrophils, lymphocytes, eosinophils, basophils, and monocytes). These five types of white blood cells can be further divided into two groups: granulocytes (also known as polymorphonuclear leukocytes, and including neutrophils, eosinophils, and basophils) and monocytes (including monocytes and lymphocytes). Lymphocytes can be further divided into T cells, B cells, and NK cells. Peripheral blood cells are present in the blood circulation pool and are not isolated in the lymphatic system, spleen, liver, or bone marrow. If cells fixed to a support are used, samples can be prepared, for example, by culturing cells on a planar surface, depositing cells on a planar surface (e.g., by centrifugation), cutting a three-dimensional object containing cells into sections, and embedding the sections onto the planar surface (i.e., producing tissue sections). In an alternative embodiment, the surface can be prepared by absorbing cellular components onto the surface.

[0073] In any implementation, the method may include immobilizing thousands, tens of thousands, hundreds of thousands, or at least one million RCA products (each having a unique identifier) ​​onto a population of cells (e.g., via an antibody) to cover individual cells with RCA products. Figure 1 This diagram illustrates cells encapsulated in RCA products. Clearly, this is a schematic diagram; the cells are not perfectly spherical as shown, and the RCA products are not perfectly spherical either, being either uniform in size or evenly distributed in a regular pattern. RCA products can be obtained via antibodies (e.g., such as...). Figure 6 , Figure 7 , Figure 9 and Figure 10 (as illustrated) or via nucleic acid probes (e.g., such as Figure 11 (As illustrated) anchored to cells, but other methods are also possible. In some cases, RCA products can be immobilized in cells by hybridization with grid oligonucleotides, such as... Figure 10As shown below, each RCA product has a unique identifier sequence and a sequence for hybridization with a grid oligonucleotide. The grid oligonucleotide and RCA product hybridize to produce a matrix containing both the RCA product and the grid oligonucleotide, wherein the grid oligonucleotide hybridizes with a neighboring RCA product. After hybridization, the unique identifier sequence of the neighboring RCA product is copied from the RCA product to the grid oligonucleotide. The grid oligonucleotide can be sequenced, as will be described in more detail below. A physical map of the RCA product can be constructed based on the sequence added to the grid oligonucleotide.

[0074] like Figure 2 As illustrated, in the first step of this method, clathropoietin 2 (i.e., a population of clathropoietin molecules) can hybridize with a population of RCA products, wherein either the clathropoietin or the RCA product can be immobilized on one or more cells. This step can be implemented using a single clathropoietin (i.e., a population of clathropoietin molecules having the same sequence, with an optional degenerate (e.g., random) sequence in the middle of the clathropoietin that can be used as a molecular identifier). As described in the Examples section, the method can be implemented using a population of RCA products that are identical in all respects except for the unique identifier sequence. However, in other embodiments, the method can be implemented using two or more types of RCA products that differ at least in their unique identifier sequences and their clathropoietin binding sequences. The latter embodiment is described in... Figure 2 The illustrated embodiment shows that the RCA product group includes: i. a first group of RCA products 4, each comprising a repeat sequence including a unique RCA product identifier sequence (“UID1”, as shown) and a first grid oligonucleotide binding sequence (“GOBS1”, as shown); and ii. a second group of RCA products 6, comprising a repeat sequence containing a unique RCA product identifier sequence (“UID2”, as shown) and a second grid oligonucleotide binding sequence (“GOBS2”, as shown). The first group may contain at least 100, at least 1,000, or at least 10,000 RCA products, and the second group may contain a similar number (i.e., at least 100, at least 1,000, or at least 10,000 RCA products), wherein each RCA product has a unique RCA product identifier sequence. The first and second groups of RCA products are interleaved, such that an RCA product from the first group may be adjacent to at least one, but sometimes two, three, or four, RCA products from the second group.

[0075] Figure 2In the diagram, RCA products appear as spherical. RCA products are compact, nearly spherical particles, typically ranging in diameter from 0.1 to 1 μm. If desired, the size of the RCA products used in this method can be reduced by adding compressed oligonucleotides that hybridize to two or more sites within each RCA product, thus decreasing the product size. Smaller RCA products improve the resolution of the maps generated by this method. Compressed oligonucleotides are described, for example, by Clausson (SciRep. 2015; 5:12317). Figure 2 The fact that the RCA product appears round does not mean that the DNA of the RCA product itself is round, even though RCA is performed using a round template.

[0076] RCA products can be prepared, for example, by synthesizing an initial oligonucleotide with a degenerate sequence, cyclizing the initial oligonucleotide using a clip, or amplifying the cyclized oligonucleotide via RCA. In some embodiments, the initial oligonucleotide may contain a degenerate (e.g., random) sequence of 6 to 10 nucleotides, or even more random nucleotides, depending on the desired number of unique RCA products. Amplification of the cyclized oligonucleotide with the degenerate sequence should produce a population of RCA products, each with a unique identifier (i.e., a sequence different from other RCA products in the population). Methods for generating RCA products with unique identifiers are described, for example, by Wu et al. (Nat. Comm. 2019 10:3854) and US20160281134, and these methods are readily applicable herein. In some embodiments, different oligonucleotides for preparing the first and second groups of RCA products are prepared separately and then mixed together. In other embodiments, the different oligonucleotides may be prepared in parallel on a planar support in the form of an array and then cleaved from the array. Examples of such methods are described, for example, by Cleary et al. (Nature Methods 2004 1:241-248) and LeProust et al. (Nucleic Acids Research 2010 38:2522-2540).

[0077] like Figure 2 As shown, the grid oligonucleotide molecules used in this method may each contain a first terminal sequence complementary to the first grid oligonucleotide binding sequence (GOBS1) and a second terminal sequence complementary to the second grid oligonucleotide binding sequence (GOBS2). At least some grid oligonucleotide molecules hybridize with two neighboring RCA products via those sequences. Figure 2This shows a lattice oligonucleotide that hybridizes with two neighboring RCA products. Assuming the distance between consecutive bases is approximately 0.3 nm, theoretically a 100-mer lattice oligonucleotide should be able to stretch 30 nm, a 200-mer lattice oligonucleotide should be able to stretch 60 nm, and a 500-mer lattice oligonucleotide should be able to stretch 150 nm. Therefore, the RCA products hybridizing with the lattice oligonucleotide molecule can be less than 100 nm or less than 50 nm apart.

[0078] In the next step of the method, the clathrate oligonucleotide molecule hybridized with two neighboring RCA products is extended to add a complementary sequence from the unique RCA product identifier sequences of the two neighboring RCA products to the end of the clathrate oligonucleotide, thereby producing extended clathrate oligonucleotide 8. Figure 2 In the example shown, UID1' (i.e., the complementary sequence of UID1) is added to one end of the grid oligonucleotide, and UID2' (the complementary sequence of UID2) is added to the other end. In some embodiments, the grid oligonucleotide can be extended using a gap-filling / ligation reaction (see, for example, Mignardi et al., Nucleic Acids Res. 2015 43:e151), which adds complementary sequences from unique RCA product identifier sequences of two adjacent RCA products to the grid oligonucleotide. In other embodiments, the addition can be accomplished by ligation as described above.

[0079] A method for adding complementary sequences of unique RCA product identifier sequences from two neighboring RCA products to a grid oligonucleotide is shown in Figure 3 However, other methods can be used. For example... Figure 3 As shown, the UID sequence can be added to a grid oligonucleotide using the following system, in which: (a) a first set of rolling circle amplification (RCA) products contains at least a first type of RCA product containing repeat sequences in a 5' to 3' order comprising: a first neighboring probe binding sequence (PPBS1, as shown), a first unique RCA product identifier sequence (UMI1, as shown), and a first grid oligonucleotide binding sequence (GOBS1, as shown); and (b) a second set of RCA products contains at least a second type of RCA product containing repeat sequences in a 5' to 3' order comprising: a second grid oligonucleotide binding sequence (GOBS2, as shown), a second unique RCA product identifier sequence (UMI2, as shown), and a second neighboring probe binding sequence (PPBS2, as shown). Figure 3As shown, the clathrate oligonucleotide used in this embodiment has a 5' end sequence complementary to the second clathrate oligonucleotide binding sequence (GOBS2) and a 3' end sequence complementary to the first clathrate oligonucleotide binding sequence (GOBS1) upstream of the first unique RCA product identifier sequence. This embodiment utilizes a first neighboring probe having a 5' end sequence complementary to the first neighboring probe binding sequence (PPBS1); and a second neighboring probe having a 3' end sequence complementary to the second neighboring probe binding sequence (PPBS2). Figure 3 As shown, these components hybridize together to form a complex in which the first and second unique RCA product identifier sequences can be replicated via a gap-filling / ligation reaction by extending the 3' ends of the grid oligonucleotide and the second neighboring probe, respectively. Clearly, in this embodiment, the first set of RCA products may include at least 1000, at least 10,000, at least 100,000, at least 1M, at least 10M, at least 100M, at least 1B, or at least 10B rolling circle amplification (RCA) products, wherein each RCA product in the first set contains a repetitive sequence comprising, in a 5' to 3' order: a first neighboring probe binding sequence (PPBS1), a unique sequence identifying the RCA product (UMI, as shown), and a first grid oligonucleotide binding sequence (GOBS1). The second group of RCA products in (a) and (b) may contain at least 1,000, at least 10,000, at least 100,000, at least 1M, at least 10M, at least 100M, at least 1B, or at least 10B rolling circle amplification (RCA) products, wherein each RCA product in the second group contains a repeat sequence in 5' to 3' order: a second grid oligonucleotide binding sequence (GOBS2), a unique sequence identifying the RCA product (UMI, as shown), and a second neighboring probe binding sequence (PPBS2).

[0080] like Figure 3As shown, UMI can be added to a clathrate oligonucleotide in a reaction involving: (a) generating a complex in which: (i) the 5' end of a first neighboring probe hybridizes to a first neighboring probe binding sequence (PPBS1) of a first RCA product; and (ii) the 3' end sequence of a second neighboring probe hybridizes to a second neighboring probe binding sequence (PPBS2) of a second set of RCA products upstream of unique sequences identifying RCA products (UMI1 and UMI2, respectively); and (iii) the 3' and 5' end sequences of the clathrate oligonucleotide hybridize to the first and second clathrate oligonucleotide binding sequences (GOBS1 and GOBS2) of the first and second RCA products, respectively; and (b) treating the complex of (a) with polymerase and ligase to copy (via gap filling / ligation) complementary sequences of the first and second unique RCA product identifier sequences to the 3' ends of the clathrate oligonucleotide and the second neighboring probe, respectively, and generating a product molecule (extended clathrate oligonucleotide) containing complementary sequences of the first and second unique RCA product identifier sequences.

[0081] In these embodiments, the first and second sets of RCA products interpenetrate and are immobilized on the cell. The 5' end sequence of the first neighboring probe hybridizes with the first neighboring probe binding sequence of the first set of RCA products, and the 3' end sequence of the second neighboring probe hybridizes with the second neighboring probe binding sequence of the second set of RCA products (upstream of the unique sequence identifying the RCA product). Furthermore, the 3' and 5' end sequences of the clathrate oligonucleotide hybridize with the first and second clathrate oligonucleotide binding sequences of a pair of adjacent RCA products. Similarly, treatment of the complex with polymerase, dNTPs, and ligase allows the unique sequence pair identifying the neighboring RCA products to be copied to the ends of the clathrate oligonucleotide and the second neighboring probe, producing a product molecule (referred herein to as an extended clathrate oligonucleotide) that includes the complementary sequence to the unique sequence pair identifying the neighboring RCA products.

[0082] like Figure 2 As shown, after the grid oligonucleotides have been extended to add the UID from neighboring RCA products to their ends, the extended grid oligonucleotides are sequenced and then analyzed to determine which complementary sequence pairs of unique RCA product identifier sequences have been added to the grid oligonucleotides. This process is as follows: Figure 4 Example. like Figure 4 As illustrated, each extended grid oligonucleotide should have a complementary sequence at one end to a first unique RCA product identifier sequence (e.g., UID1) and at the other end to a complementary sequence to a first unique RCA product identifier sequence (e.g., UID3). These sequences can be analyzed to compile a list of paired RCA product identifier sequences (e.g., UID1-UID3, UID1-UID13, etc.), which can be used to create a two-dimensional map of RCA products on the cell surface. Figure 4For example, the method may include using a sequence list of paired RCA product identifier sequences to create one or more physical maps (relationship maps) of fixed RCA products. Obviously, this map may be a map of the surface of one or more cells. In some cases, the physical map may include overlapping and / or non-overlapping maps.

[0083] In any implementation, the extended grid oligonucleotide can be amplified by PCR prior to sequencing. In some of these implementations, the binding sites of the PCR primers can be added to the 3' and 5' tails of the first and second adjacent probes, respectively, as shown below. Figure 3 As illustrated, or theoretically, the binding site of the PCR primer can be encoded into the RCA product and replicated to the ends of the grid oligonucleotide during the extension reaction.

[0084] In addition to mapping RCA products, this method may include proximity assays between one or more binding agents (e.g., antibodies binding to cell surface markers) at sites intracellular or on the cell surface. In these embodiments, a unique RCA product identifier sequence may be copied into an oligonucleotide linked to a trapping agent. In some embodiments, the trapping agent is an antibody-oligonucleotide conjugate, such as… Figure 6 , Figure 7 , Figure 9 and Figure 10 As illustrated, in other embodiments, the trapping agent may be an oligonucleotide probe (such as...) Figure 11(As illustrated). In these embodiments, the terms "antibody-oligonucleotide conjugate" and "oligonucleotide-linked capture agent" refer to a capture agent, such as an antibody or aptamer, that is non-covalently (e.g., via streptavidin / biotin interaction) or covalently (e.g., via click reaction, etc.) linked to a single-stranded oligonucleotide in a manner in which the capture agent can still bind to its binding site. The oligonucleotide and capture agent can be linked via a number of different methods, including methods using maleimide or halogen groups, which are cysteine-reactive. The capture agent and oligonucleotide can be linked proximal to or at the 5' end of the oligonucleotide, proximal to or at the 3' end of the oligonucleotide, or anywhere in between. In some embodiments, the oligonucleotide can be linked to the capture agent via a linker that separates the oligonucleotide from the capture agent. Oligonucleotides can be conjugated to the capture agent using any convenient method (see, for example, Gong et al., Bioconjugate Chem. 2016 27:217–225 and Kazane et al., Proc Natl Acad Sci 2012 109:3731-3736). In many embodiments, the oligonucleotide sequence conjugated to the binder uniquely identifies the epitope or sequence to which the binder binds. For example, if the method is performed using 10 different antibodies, each antibody is tethered to a different sequence identifying the epitope to which the antibody binds. This feature allows the method to be multiplexed, and in some embodiments, at least 5, at least 10, at least 20, or at least 50 different antibodies that bind to different markers intracellularly or on the cell surface can be used in the method. Each antibody is conjugated to a different antibody identifier sequence, and the antibody identifier sequence allows mapping of a specific antibody binding event. Such tagged antibodies are described, for example, by Wu et al. (Nat.Comm.2019 10:3854) and US20160281134.

[0085] like Figure 6 , Figure 7 and Figures 9 to 16 For example, proximity assays can be performed in a variety of different ways. In any embodiment, a proximity assay can produce a product containing a complementary sequence of a binding agent identifier sequence and a complementary sequence of a unique RCA product identifier sequence. In some embodiments, the product of the proximity assay (the extended proximity probe) can be a molecule separate from the extended lattice oligonucleotide (e.g., Figure 6 (Example). In other embodiments, the product of proximity assay (extended proximity probe) may be part of an extended grid oligonucleotide (see, for example) Figure 7 and Figure 9 In any embodiment, a portion of the trapping agent used in the assay may be attached to the 5' end of the oligonucleotide, while the remainder of the trapping agent may be attached to the 3' end of the oligonucleotide (e.g., ...). Figure 7 and Figure 9(Example). For example, in some embodiments, the method may utilize a mixture comprising one or more antibody-oligonucleotide conjugates, wherein in some embodiments, a portion (e.g., 30%-70% of the antibody molecule) that binds to a specific cell surface marker is conjugated to the 5' end of the oligonucleotide, while the remaining portion of the antibody that binds to the cell surface marker is conjugated to the 3' end of the oligonucleotide. In these embodiments, the oligonucleotide may each contain a PCR primer binding site (at either end of the oligonucleotide linked to the antibody), and the product generated by the assay can be amplified by PCR, such as... Figure 8 exemplified.

[0086] like Figures 10 to 16 For example, in some embodiments, grid oligonucleotide molecules may be immobilized on a cell surface prior to the addition of RCA products. In these embodiments, the method may include (a) hybridizing a population of RCA products with a population of grid oligonucleotide molecules immobilized on one or more surfaces, wherein: (i) each RCA product in the RCA product population has a unique RCA product identifier sequence and a grid oligonucleotide binding sequence; and (ii) each grid oligonucleotide molecule contains a first terminal sequence complementary to the grid oligonucleotide binding sequence and a second terminal sequence complementary to the grid oligonucleotide binding sequence; and (iii) at least some grid oligonucleotide molecules hybridize with two neighboring RCA products; (b) extending the grid oligonucleotide molecules hybridized with the two neighboring RCA products to add complementary sequences from the unique RCA product identifier sequences of the two neighboring RCA products to the grid oligonucleotide, thereby producing extended grid oligonucleotides; (c) sequencing the extended grid oligonucleotides; and (d) analyzing the sequences to determine which complementary sequence pairs of the unique RCA product identifier sequences have been added to the grid oligonucleotides. Figure 12 As shown, in some embodiments, the clathrate oligonucleotide itself can be a product of a proximity ligation assay. In these embodiments, the clathrate oligonucleotide can be broken such that each moiety hybridizes to a different probe. In these embodiments, a complete clathrate oligonucleotide is produced only when the two moiety of the clathrate oligonucleotide are adjacent to each other and can be ligated to each other in a splice ligation reaction. Therefore, in some embodiments, the method may include using unique RCA identifier sequence pairs identified by analyzing sequence reads to create a physical map of a fixed RCA product, and also mapping the binding agent map to the physical map of the fixed RCA product by analyzing which unique RCA product identifier sequences and which binding agent identifier sequences are present in the product. Figure 7 and Figure 9As shown, complementary sequences of the binder identifier sequence and the unique RCA product identifier sequence can be incorporated into the extended grid oligonucleotide. In other embodiments, complementary sequences of the binder identifier sequence and the unique RCA product identifier sequence are incorporated into the assay product separate from the extended grid oligonucleotide. Analysis of the unique RCA product identifier sequence replicated into the assay product in adjacent assays allows mapping the binding site profiles of individual traps binding to cells onto specific RCA products. Specifically, each binding event can be mapped onto an RCA product because the unique RCA identifier sequence of that RCA product is added to an oligonucleotide tethered with the binder adjacent to that RCA product. The binder can then be placed on the aforementioned RCA product profile, thereby providing a two-dimensional profile of the binding events, where the two dimensions correspond to the surface of one or more cells. Similar methods can be used to generate two-dimensional profiles of binding events.

[0087] Clearly, each RCA product contains multiple copies of the same sequence; therefore, multiple binding events can be mapped to a single RCA product, providing a method for quantifying RCA products. For example, if one hundred antibody-oligonucleotide conjugates bind to all sites adjacent to a particular RCA product, then all one hundred binding sites can potentially be mapped to a single RCA product. Mapping binding sites to an RCA product map that is itself plotted in two dimensions provides a method for examining the distribution of binding sites within or on the cell surface. This, in turn, provides a method for examining cell polarity without microscopy.

[0088] This document also provides probe systems. In some embodiments, the probe system may comprise (a) a population of RCA products comprising: (i) a first set of RCA products, each RCA product comprising a repeating sequence containing a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and (ii) a second set of RCA products comprising repeating sequences containing a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; and (b) a population of grid oligonucleotide molecules, wherein the terminal sequence at one end of the grid oligonucleotide molecule is complementary to the first grid oligonucleotide binding sequence, and the terminal sequence at the other end of the grid oligonucleotide molecule is complementary to the second grid oligonucleotide binding sequence. As described above, hybridization of (a) and (b) produces a complex in which the grid oligonucleotide hybridizes with a neighboring RCA product, such as Figure 2As shown. The first and second groups of RCA products each contain at least 10 members (e.g., at least 100, at least 1,000, at least 1,000, at least 10,000, at least 100,000, at least 1M, at least 10M, at least 100M, at least 1B, or at least 10B members). In some embodiments, the clathrate oligonucleotide binding sequence in the RCA product is adjacent to the unique RCA product identifier sequence in the RCA product, and the ends of the clathrate oligonucleotide molecule hybridize to the clathrate oligonucleotide binding sequence, but not to the unique RCA product identifier sequence. Further details of the probe system are provided in the Methods section above.

[0089] Groups of RCA products, each possessing a unique sequence of RCA product identifiers, are also provided, wherein at least some of the unique RCA product identifier sequences are double-stranded with single-stranded gaps in between. Examples of such groups are as follows: Figure 13 As shown, this population can be prepared by: amplifying the RCA template as described above, denaturing the RCA product, hybridizing two or more oligonucleotides to the product, where one oligonucleotide hybridizes to a site upstream of the unique RCA product identifier sequence and the other oligonucleotide hybridizes to a site downstream of the unique RCA product identifier sequence, and then ligating the oligonucleotides via a gap-fill-ligation reaction. This closes the gap between the oligonucleotides and makes the unique RCA product identifier sequence in the RCA product double-stranded. As shown, the ends of the double-stranded portion of the product can be ligated to a grid oligonucleotide, such as... Figure 14 Example.

[0090] A population of RCA products is also provided, comprising: (ii) a first group of RCA products, each RCA product comprising a repeating sequence containing a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence (of a length of at least about 10, 12, or 15 nucleotides); and (ii) a second group of RCA products comprising a repeating sequence containing a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence (of a length of at least about 10, 12, or 15 nucleotides). In these embodiments, the grid oligonucleotide binding sequence in the RCA product may be adjacent to the unique RCA product identifier sequence. In any embodiment, the first and second groups of RCA products in the population of RCA products each comprise at least 10, at least 100, at least 1,000, at least 1,000, at least 10,000, at least 100,000, at least 1M, at least 10M, at least 100M, at least 1B, or at least 10B members.

[0091] This disclosure also provides kits for carrying out the subject methods as described above. In some embodiments, the kit may contain components of a probe system or starting products to prepare a product. The kit may additionally contain ligases, nucleotides, strand displacement polymerases for rolling circle amplification, and / or polymerases for nick-fill ligation reactions. Depending on the requirements, the various components of the kit may be present in separate containers, or certain compatible components may be pre-assembled into a single container. In addition to the components described above, the subject kit may also include instructions for carrying out the subject methods using the components of the kit.

[0092] Implementation Plan

[0093] Implementation Scheme 1. A method for identifying adjacent rolling circle amplification (RCA) products, comprising:

[0094] (a) Hybridizing a population of grid oligonucleotide molecules with a population of RCA products immobilized on one or more cells, wherein: (i) each of the RCA products in the RCA product population has a unique RCA product identifier sequence and a grid oligonucleotide binding sequence; and (ii) each of the grid oligonucleotide molecules contains a first terminal sequence complementary to the grid oligonucleotide binding sequence and a second terminal sequence complementary to the grid oligonucleotide binding sequence; and (iii) at least some of the grid oligonucleotide molecules hybridize with two neighboring RCA products;

[0095] (b) Extending the lattice oligonucleotide molecule that hybridizes with two neighboring RCA products to add a complementary sequence from the unique RCA product identifier sequence of the two neighboring RCA products to the lattice oligonucleotide, thereby producing an extended lattice oligonucleotide;

[0096] (c) Sequencing extension grid oligonucleotides; and

[0097] (d) Analyze the sequences to identify which unique RCA product identifier sequences have complementary sequence pairs added to the grid oligonucleotides.

[0098] Implementation Scheme 2. The method of Implementation Scheme 1, which further includes:

[0099] (e) Use the sequence pairs identified in (d) to prepare one or more physical maps of fixed RCA products.

[0100] Implementation Scheme 3. Any method of the prior implementation scheme, wherein the extension includes a gap-filling and / or ligation reaction that adds a complementary sequence from a unique RCA product identifier sequence of two adjacent RCA products to a grid oligonucleotide.

[0101] Implementation Scheme 4. The method of Implementation Scheme 1, wherein in step (a):

[0102] (i) The RCA product group includes: i. a first group of RCA products, each of which contains a repeat sequence containing a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and ii. a second group of RCA products, which contains a repeat sequence containing a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence.

[0103] (ii) Each of the grid oligonucleotide molecules contains a first terminal sequence complementary to the first grid oligonucleotide binding sequence and a second terminal sequence complementary to the second grid oligonucleotide binding sequence; and

[0104] (iii) At least some grid oligonucleotide molecules hybridize with two neighboring RCA products.

[0105] Implementation Scheme 5. As in any of the previous implementation schemes, wherein the RCA product is immobilized in cells via an antibody.

[0106] Implementation Scheme 6. Any method of the previous implementation scheme, wherein the extended grid oligonucleotides are amplified by PCR prior to sequencing.

[0107] Implementation Scheme 7. The method of any prior embodiment, wherein the RCA product is immobilized to one or more cells via one or more binding agents, wherein each binding agent binds to a sequence in the RCA product and a site on one or more cell surfaces.

[0108] Implementation Scheme 8. The method of Implementation Scheme 7, further comprising proximity determination between one or more binders and the RCA products bound thereto.

[0109] Implementation Scheme 9. The method of Implementation Scheme 8, wherein proximity determination produces a determination product comprising a complementary sequence of a binding agent identifier sequence and a complementary sequence of a unique RCA product identifier sequence.

[0110] Implementation Scheme 10. The method of Implementation Scheme 9, wherein the method includes:

[0111] (e) Using the sequence pairs identified in (d), prepare a physical map of the fixed RCA product; and map the binder to the physical map of the fixed RCA product by analyzing and determining which unique RCA product identifier sequences and which binder identifier sequences are present in the product.

[0112] Implementation Scheme 11. The method of Implementation Scheme 10, wherein the complementary sequence of the binding agent identifier sequence and the complementary sequence of the unique RCA product identifier sequence are incorporated into the extended grid oligonucleotide of step (b).

[0113] Implementation Scheme 12. The method of Implementation Scheme 10, wherein the complementary sequence of the binding agent identifier sequence and the complementary sequence of the unique RCA product identifier sequence are incorporated into the assay product separated from the extended grid oligonucleotide of step (b).

[0114] Implementation Scheme 13. A probe system, comprising:

[0115] (a) A group of RCA products, wherein each RCA product in the group has a unique RCA product identifier sequence and a grid oligonucleotide binding sequence; and

[0116] (b) A population of clathrate oligonucleotide molecules, wherein the terminal sequence at one end of the clathrate oligonucleotide molecule is complementary to the clathrate oligonucleotide binding sequence, and the terminal sequence at the other end of the clathrate oligonucleotide molecule is complementary to the clathrate oligonucleotide binding sequence, wherein the hybridization of (a) and (b) produces a complex in which the clathrate oligonucleotide hybridizes with a neighboring RCA product.

[0117] Implementation Scheme 14. The probe system of Implementation Scheme 13, wherein: (a) the RCA product group includes:

[0118] (i) A first group of RCA products, each comprising a repeating sequence including a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and

[0119] (ii) A second set of RCA products comprising a repeating sequence containing a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; and

[0120] (b) The grid oligonucleotide molecule population includes a grid oligonucleotide molecule whose terminal sequence at one end is complementary to a first grid oligonucleotide binding sequence and whose terminal sequence at the other end is complementary to a second grid oligonucleotide binding sequence.

[0121] Implementation Scheme 15. The probe system of Implementation Scheme 14, wherein the first group and the second group of RCA products each include at least 10 members.

[0122] Implementation Scheme 16. The probe system of any one of Implementation Schemes 13 to 15, wherein the grid oligonucleotide binding sequence in the RCA product is adjacent to the unique RCA product identifier sequence in the RCA product, and the end of the grid oligonucleotide molecule hybridizes with the grid oligonucleotide binding sequence but not with the unique RCA product identifier sequence. Example

[0123] The following embodiments are provided to provide additional disclosure and description to those skilled in the art regarding how to prepare and apply the invention, and are not intended to limit the scope of the inventors' claims, nor to represent that the following experiments are all or only the experiments performed.

[0124] Example 1

[0125] The following examples provide a method for analyzing proteins and / or RNA in single cells without compartmentalizing the single cell or microscopy. This method can be used to analyze suspended cells, such as immune cells isolated from body fluids, blood, or tissue, or cells isolated from fixed tissue or tissue sections that have been fixed to a surface (e.g., a glass slide). Such methods traditionally use microscopy to image the cells. Here, instead of microscopy, binding patterns are analyzed via DNA sequencing. In this method, the spatial relationships between RCA products are determined to provide a map (where each RCA product can be considered a “pixel”), and the binding sites of the trapping agent are mapped to the RCA products. This method utilizes RCA products with random barcodes (also known as “unique RCA product identifier sequences” or unique molecular identifiers or “UMIs”), which are naturally compressed into a tight, approximately spherical shape with a diameter of several hundred nanometers. This method does not rely on neighbor diffusion; instead, it relies on a network of oligonucleotides that hybridize with neighboring RCA products.

[0126] Rolling circle replication products (RCPs) can be pre-prepared by circularizing multiple synthetic oligonucleotides carrying DNA sequences as tags. In this method, the RCP pool consists of at least millions of RCA products, each encoding one or more random barcodes that identify each RCA product. A 100-nucleotide DNA loop can be replicated via RCA into approximately 200 copies of a multiplicand within 10 minutes using the phi-29 DNA polymerase (Wu et al., Nature Comm. 2019 10:3854). The resulting RCA products will have a submicron size. If necessary, the RCP pool can be pre-sequencing to determine which UMIs pair into a single molecule when using more than one RCA product. In some cases, this information may be needed in the final deconvolution of data generated during analysis. Depending on the molecular setup, each RCP may also use only one random barcode.

[0127] The target analyte protein and / or RNA are bound to protein-specific antibodies and / or RNA-binding nucleic acid probes linked to a DNA tag. Each analyte-specific probe type carries a unique, fixed, and known (non-random) barcode for target identification. These target-specific probes have an affinity for fixed region 1 in the RCP. The probes typically have a free 3' end, which mediates polymerase extension via hybridization to RCP region 1. This gap-filling extension reaction is followed by a ligation event that merges the UMI-encoded sequence, followed by PCR amplification for high-throughput DNA sequencing.

[0128] All RCA products also contain a fixed region 2, which can hybridize with so-called "grid oligonucleotides". Grid oligonucleotides link two neighboring RCA products via hybridization, thus connecting their random barcodes so that the "pixel" positions are deconvolved relative to each other. This identifies which RCPs are close to each other.

[0129] Example 2

[0130] The following description provides a method for analyzing cell (e.g., lymphocyte) suspensions.

[0131] The average number of lymphocytes is 130 μm 3 Its volume and approximately 124 μm 2 The surface area of ​​the RCP is approximately 200 nm in diameter and 0.12 μm in area. 2 Assuming the cell surface has a monolayer of RCP, this exemplary lymphocyte may have approximately 1000 RCPs covering it.

[0132] V = 4 / 3 pi r^3

[0133] A = pi^1 / 3 x (6V)^2 / 3

[0134] Therefore, it is estimated that a typical cell binds to approximately 1000 RCPs.

[0135] In this embodiment, the suspended cells are also analyzed using spatial resolution of target proteins on the surface of each single cell, potentially providing valuable diagnostic information. This type of information is often referred to as cell polarity and regulates many immune cell functions (Russel et al., Journal of Cell Science 2008 121:131-136 and Oliaro J. et al., PNAS December 5, 2006 103(49):18685-18690). Using currently available methods, cell polarity analysis requires microscopy to analyze immune cells, thus limiting analytical throughput to a few cells and a few targets in only a few samples. This method is able to quantify the abundance and relative location of hundreds to thousands of cell surface markers on millions of immune cells. Cell polarity (i.e., the uneven distribution of cell surface proteins on cells) regulates many important functions, and analyzing a large number of proteins on a large number of cells is very difficult. Polarization not only regulates cell migration but also regulates immune cell activity, such as antigen presentation and effector function.

[0136] Example 3

[0137] Materials and methods

[0138] Generation of neighboring probes. Antibodies (or other protein binders) are linked to specific nucleic acid sequences, generating free 3' ends or free 5' ends, or even both. Covalent linkage of oligonucleotides to antibodies can be accomplished in various ways, such as NHS-ester / maleimide chemistry to random lysine residues in the antibody. Other linkages can also be made via thiols or carbohydrates present on the antibody. Neighboring sequences can be directly linked to the antibody or via hybridization to another oligonucleotide covalently linked to the antibody (Lundberg et al., Nucleic Acids Research 2011 39:e1022011). Homobifunctional (e.g., BS3) or heterobifunctional (NHS-ester / maleimide) probes or click chemistry can also be used (Fredriksson et al., Nature Methods 2007 4:327-329).

[0139] The sequence synthesized for antibody conjugation should include a target protein identification barcode sequence (i.e., an antibody-specific barcode sequence). Some assay designs may also include a grid oligonucleotide sequence in the antibody-conjugated sequence (see [link to assay]). Figure 10 Multiple antibodies specific to a particular target protein will be functionalized with unique sequences. These will then be combined and stored.

[0140] The generation of RCA products. The rolling circle replication products used in this assay are pre-prepared into unique molecules containing random barcodes (Unique Molecular Identifiers, UMIs). These RCA products are prepared by first synthesizing pools of DNA oligonucleotides or sequences cut from an array. These DNA molecules are then circularized by DNA ligase after hybridization with a ligation DNA template (i.e., a "snap" that hybridizes to the ends of the oligonucleotides). The circularized molecule is then replicated via rolling circle replication using DNA polymerase and dNTPs. The polymerase can be phi29 DNA polymerase, but other polymerases may also be used. The polymerization reaction is stopped by, for example, heating to about 60 degrees Celsius, and the pixel-RCP pools are stored as the detection reagent for the assay.

[0141] RCA products contain multiple copies of the complementary sequence of the circularized template. Depending on the design, RCA products may contain not only UMIs but also sequences for hybridization with adjacent probe sequences and grid oligonucleotides (as illustrated in some figures).

[0142] Gap-filling polymerization. During assaying, the UMI sequence is replicated via DNA polymerization to be incorporated into PCR amplicon for subsequent DNA sequencing. Gap-filling polymerization is accomplished by adding dNTPs, DNA polymerase, and DNA ligase to the reaction. T4 DNA polymerase and Klenow fragments are commonly used for this purpose, and T4 DNA ligase is typically used for covalently closing the gap. The DNA polymerase used may or may not have 3' exonuclease activity, but preferably it does not have strand substitution activity, as this would displace the oligonucleotide to be closed. The combination of Phusion DNA polymerase and Ampligase is also commonly used for gap-filling reactions (Niedzicka et al., Scientific Reports 2016 6:24051).

[0143] Example 4

[0144] The first implementation of this method is as follows Figure 6 As shown. In this embodiment of the method (and possible other embodiments), in order for the clathrate oligonucleotides to bind to two adjacent rolling circle amplification products (represented as RCP-pixels in the figure), rather than binding to the same rolling circle amplification product, the rolling circle amplification product types are made into at least two different types, shown as type 1 and type 2, with different clathrate oligonucleotide binding sequences (GOBS). These sequences are shown as GOBS1 and GOBS2. This design mitigates potential competitive hybridization reactions that would otherwise reduce detection efficiency.

[0145] In this method, all rolling circle amplification products can be sequenced beforehand to determine which UMI pairs are present in each product. In this implementation, UMIs from neighboring rolling circle amplification products are added to oligonucleotides via a nick-filling / ligation reaction to generate extended grid oligonucleotides with forward and reverse PCR primer sites at the ends. Similarly, UMIs adjacent to antibody-conjugated oligonucleotides are added to those oligonucleotides via a nick-filling / ligation reaction to generate extended antibody oligonucleotides also with forward and reverse PCR primer sites at the ends. The extended grid oligonucleotides and antibody oligonucleotides can then be amplified and sequenced.

[0146] Sequencing of grid-PCR molecules identified neighboring RCA products that had hybridized with the same grid oligonucleotide molecule and were subsequently linked by UMI encoded by the same two neighboring RCP-pixels via a gap-filling DNA polymerization event.

[0147] Example 5

[0148] The second implementation of this method is as follows Figure 7 As shown. In this embodiment of the method (and possible other embodiments): 1) target cells are bound by a neighboring probe (an antibody coupled to an oligonucleotide containing a free 3' or free 5' end with a target protein identity barcode) or a nucleic acid probe capable of binding a specific RNA sequence; 2) at least two types of pre-formed RCA products are added to the sample and hybridized to the ends of the neighboring probes via a "neighboring probe binding sequence" (PPBS); 3) a grid oligonucleotide is added to the sample and hybridized to GOBS1 and GOBS2 of either RCA product type. An optional washing step may be performed between steps 1, 2, and 3 to remove unbound reagents. 5) The method may then include allowing DNA polymerase and dNTP extension hybridization to the 3' end and allowing ligase to merge sequences, thereby encoding a PCR amplicon with a UMI from the RCA products to generate a target amplicon that crosses from one neighboring probe to the other via two RCA products, where the UMI provides their relative positions. Because RCA products have multiple copies of the same sequence, many target protein barcodes can be associated with the same UMI to provide the location of multiple proteins in a region covered by the RCA product. Since the product spans at least two RCA products, a neighboring RCP grid can be obtained. 6) Next, the method includes amplifying the merged amplicon with PCR and then sequencing it to decode an image of which proteins are where.

[0149] Similar to Example I, at least two RCP-pixel types with different grid oligonucleotide binding sequences (GOBS1 and GOBS2) were created to enable the grid oligonucleotides to bind to two neighboring RCA products (as well as the same RCA product). The UMI from the RCA product was encoded into the extended grid oligonucleotide.

[0150] Figure 8 The structure of the extended grid oligonucleotide is illustrated in this implementation of the method.

[0151] Example 6

[0152] Figure 9 This illustrates a third implementation of the method. In this implementation: 1) Target cells are bound by a neighboring probe (an antibody coupled to an oligonucleotide containing a free 3' or free 5' end with a target protein identity barcode) or a nucleic acid probe capable of binding a specific RNA sequence. 2) A pre-formed RCA product of a certain type is added to the sample and hybridized to the neighboring probe end via a grid oligonucleotide and a neighboring probe binding sequence (GO&PP BS). Since there is excess GO&PP BS in the multi-pixel-RCP, binding sites are left for the grid oligonucleotide added in the next step; 3) The grid oligonucleotide is added to the sample and hybridized to the GO&PP BS of the RCP-pixel. An optional washing step may be performed between steps 1, 2, and 3 to remove unbound reagents. The next step may include 5) allowing DNA polymerase and dNTP extension hybridization to the 3' end and allowing ligase to merge sequences, thereby encoding a PCR amplicon with a pixel-UMI. This ligation produces a target amplicon that crosses from one neighboring probe to the other via two RCA products, which provides their relative positions. Because RCA products have multiple copies of the same sequence, many target protein barcodes can be associated with the same UMI (from the RCA product), providing the location of multiple proteins within a region covered by that RCA product. Since the product spans at least two RCA products, a grid of neighboring RCA products can be obtained. 6) Next, the method includes amplifying the merged amplicons by PCR and then sequencing them to decode an image of which proteins are where. Similarly, the UMI from the RCA product is encoded into the extended grid of oligonucleotides.

[0153] Example 7

[0154] Figure 10This illustrates a fourth implementation of the method. In this implementation: 1) target cells are bound by a neighboring probe (an antibody coupled to an oligonucleotide containing a free 3' or free 5' end with a target protein identity barcode) or a nucleic acid probe capable of binding a specific RNA sequence; 2) at least two types of pre-formed RCA products are added to the sample and hybridized to the ends of neighboring probes via a "neighboring probe binding sequence" (PPBS); 3) a grid oligonucleotide is added to the sample and hybridized to GOBS1 and GOBS2 of either RCA product type. An optional washing step may be performed between steps 1, 2, and 3 to remove unbound reagents; 5) the method then includes allowing DNA polymerase and dNTPs to extend hybridization to the 3' end and allowing ligase to merge sequences to encode a PCR amplicon with a UMI from the RCA products, thereby forming a target amplicon that crosses from one neighboring probe to the other via two RCA products to provide their relative positions. Because RCPs have multiple copies of the same sequence, many target protein barcodes are associated with the same RCA product UMI, thereby providing the location of multiple proteins in a region covered by the RCA product. Since the product spans at least two pixels—RCPs—a grid of neighboring RCPs is obtained. 6) Next, the method includes amplifying the merged amplicons with PCR and then sequencing them to decode an image of which proteins are where. Similar to the embodiments above, in order for the grid oligonucleotides to bind two neighboring RCA products rather than the same RCA product, these RCA products are fabricated as at least two regions with different sequences. In the illustrated embodiment, their GOBS sequences are different. Similarly, the UMI from the RCA product is encoded into the extended grid oligonucleotide.

[0155] Example 8

[0156] The following examples describe Figure 10 The design shown (“Design 4”) and the implementation of Embodiment 7 described above.

[0157] Antibody binding sequence

[0158] The target-specific probe or antibody will be ligated to the following sequence (via its free 3' end): 3'AAAAA-ATCCGCAGCTACGGCTAGGGCT 5' (SEQ ID NO:1). Chemical conjugation with the antibody can be achieved using 3'-amine modification of an oligonucleotide, but several other chemical reactions can also be used. The A-stretch is a flexible, single-link header region, while the remainder of the sequence hybridizes with the target barcode.

[0159] Claspoxylnucleotides

[0160] The clathroid oligonucleotide (or “bridge” oligonucleotide) contains a barcode (i.e., “TP-BC”) identifying the target to which the bridge clathroid oligonucleotide binds and first and second terminal sequences (“PPBS1” and “PPBS2”), which are complementary to the corresponding first and second clathroid oligonucleotide binding sequences in the RCA product. The oligonucleotide hybridizes to the antibody-conjugated sequence in a 1:1 ratio. The 6xA region is a flexible single-link header. The middle region TP-BC is complementary to the oligonucleotide linked to the antibody, thereby allowing the clathroid oligonucleotide to hybridize with the oligonucleotide linked to the antibody. The following sequence is an example of a clathroid oligonucleotide: 5'(PPBS1)P-TGAAGGTAGACGGAGGATTTAT-AAAAAAA-TAGGCGTCGATGCCGATCCCGA(TP-BC)-AAAAAAA-CAACATCAGTATTCCCAGGCTA(PPBS2)-3'(SEQ ID NO:2).

[0161] RCA Product Manufacturing and Application

[0162] In this embodiment, the method uses two types of RCA products (which may be referred to as "Type 1" and "Type 2" RCA products). For example... Figure 10 As shown, these products have a first grid oligonucleotide binding sequence (PPBS1) and an amplification primer binding site (F-PCR) or a second grid oligonucleotide binding sequence (PPBS2). These RCA products also have a unique RCA product identifier sequence Nx22.

[0163] Type 1 RCA products

[0164] The following oligonucleotide was cyclized: 5′P-TGGTTCGCAGGATGAG-GCCGGGAGTCTAACTCAAATAC-NNNNNNNNNNNNNNNNNNNNNN-TGAAGGTAGACGGAGGATTTAT-CGCTTCGGTGAGATAG-3′ (SEQ ID NO:3), which hybridized with a linker template oligonucleotide, CTCATCCTGCGAACCA-CTATCTCACCGAAGCG-3′ (SEQ ID NO:4), used as a cyclization clamp. The cyclized oligonucleotide also contained a randomly generated UMI barcode “Nx22” and PPBS1 and a forward PCR primer site (F-PCR”). The linker template oligonucleotide of the type 1 RCA product could also be used to initiate an RCA reaction.

[0165] After amplification, the type 1 RCA product is a polymer of the following sequence: 5'CTATCTCACCGAAGCGATAAATCCTCCGTCTACCTTCA NNNNNNNNNNNNNNNNNNNNNNNN GTATTTGAGTTAGACTCCCGGCCTCATCCTGCGAACCA-3' (SEQ ID NO:5).

[0166] In this embodiment, primers that bind to the F-PCR (sequence GCGGGAGTCTAACTCAAATAC; SEQ ID NO: 6) in the type 1 RCA product are extended to replicate the UMI in a gap-filling polymerization / ligation reaction. This reaction adds the complementary sequence of the UMI in the first RCA product to the 5' end of the grid oligonucleotide.

[0167] Type 2 RCA products

[0168] The following oligonucleotide is cyclized: 5'-P-TAGTGAGTGTACGGAC CAACATCAGTATTCCCAGGCTANNNNNNNNNNNNNNNNNNNNNN GTGCTGACCAATCGACCAAGAT CGCCTAGTCTCTACTA-3' (SEQ ID NO:7), which hybridizes with the linker template oligonucleotide 5-GTCCGTACACTCACTATAGTAGAGACTAGGCG-3 (SEQ ID NO:8), which serves as a cyclization clamp. The cyclized oligonucleotide also contains a randomly generated UMI barcode "Nx22" and PPBS2 and reverse PCR primer sites ("R-PCR"). The linker template oligonucleotide of the type 2 RCA product can also be used to initiate the RCA reaction.

[0169] After amplification, the type 2 RCA product is a multiply of the following sequence: 5'-TAGTAGAGACTAGGCG-ATCTTGGTCGATTGGTCAGCAC-NNNNNNNNNNNNNNNNNNNNNNNN-TAGCCTGGGAATACTGATGTTG-GTCCGTACACTCACTA-3' (SEQ ID NO: 9).

[0170] In this embodiment, the 3' end of the clathrate oligonucleotide hybridizes to its binding site (PPBS2) in the type 2 product and is extended, thereby replicating the UMI in the gap-filling polymerization / ligation reaction. The 3' end of the clathrate oligonucleotide is extended until it encounters the 5' end of the oligonucleotide of the sequence 5'-P-GTGCTGACCAATCGACCAAGAT (SEQ ID NO: 10). The 3' end of this extended product is then ligated to the 5'-P end of the oligonucleotide.

[0171] PCR amplification

[0172] The gap-filling polymerization / ligation reaction merges the grid oligonucleotide (and thus the TP-BC sequence) with complementary sequences from two UMIs (one from the type 1 RCA product and the other from the type 1 RCA product). The product is then amplified by PCR using the following primers: F-PCR primer 5'GTATTTGAGTTAGACTCCCGGC-3' (SEQ ID NO:11) and R-PCR primer 5'ATCTTGGTCGATTGGTCAGCAC-3' (SEQ ID NO:12).

[0173] The PCR product generated in this reaction will have the following sequence containing these elements: F-primer, pixel-1 UMI, PPBS1, pA-adaptor, TP-BC, pA-adaptor, PPBS2, pixel-2 UMI, and R-primer. In this embodiment, the product will have the sequence GCCGGGAGTCTAACTCAAATAC-Nx22-TGAAGGTAGACGGAGGATTTAT-AAAAAAA-TAGGCGTCGATGCCGATCCCGA-AAAAAAA-CAACATCAGTATTCCCAGGCTA-Nx22-GTGCTGACCAATCGACCAAGAT (SEQ ID NO:13). PCR amplification may include additional primer sequences that can be used to uniquely label individual samples to enable downstream merging of multiple samples before sequencing, a process known as sample barcoding.

[0174] Data Analysis

[0175] Once the obtained PCR products are cloned and sequenced, the combination of UMIs (with their complementary sequences linked to grid oligonucleotides) from the type 1 RCA products and pixel RCA products provides the relative positions of the individual RCA products and can be used to generate maps of the surface regions. The combination of UMIs and target barcodes (TP-BC) provides information on which target proteins (or mRNAs) are present in the very neighboring region (approximately 100 nm) of a given pixel.

[0176] Measurement Procedure

[0177] Cells on a slide or in solution can be immobilized or unimmobilized before binding to probes (mRNA-binding probes and / or antibodies linked to nucleic acids). Cells can then be blocked by adding large amounts of nonspecific antibodies and DNA (e.g., salmon sperm DNA) to reduce nonspecific binding. The probe is then typically added to the sample and incubated overnight at low temperature, followed by washing the cells to remove unbound probes. RCP products are then added, which hybridize to their respective binding sites in the probe sequence. Enzymes (ligases and polymerases) and dNTPs, ATP, and NAD, along with appropriate buffering conditions and temperatures, are designed according to the sequence to allow for the co-occurrence of UMIs in pixels including target protein barcodes. The sample can then be washed to remove enzymes and cofactors, as well as buffers, thus making room for PCR amplification components (e.g., thermostable DNA polymerases and dNTPs and primers). As described above, after standard amplification, the PCR products are processed to enable high-throughput clonal amplicon sequencing.

[0178] Example 9

[0179] The fifth implementation of this method is as follows: Figure 11 As shown. In this embodiment of the method, RNA is detected. As shown, lattice oligonucleotides are designed to bind to sites in a probe that hybridizes with cellular RNA. In this embodiment, sequencing results should show mRNA 1 adjacent to mRNA 2 in the cell, because the lattice oligonucleotides that bind to those mRNAs (indirectly via the probe) add UMI to the left-hand RCA product during the gap-filling / ligation reaction.

[0180] Example 10

[0181] The sixth implementation of this method is as follows: Figure 12 As shown. In this implementation of the method, the lattice oligonucleotides are broken into two parts, which only bind together when they are adjacent to each other in the presence of a splint. Figure 12 The implementation shown is the same as the implementation described in Example 7 above (and Figure 10 Similar to (as shown), the difference lies in the clamp-mediated proximity assay (PLA) step, which ensures that if two binding events occur for the same target molecule, the clathrate oligonucleotide will be a single molecule. This increases the specificity of the assay. In this embodiment, the clathrate oligonucleotide is broken into two parts and clamped together by a PLA clamp. The PLA clamp can be designed to act only as a clamp for neighboring probe pairs targeting the same protein, which further improves specificity and multiplexability.

[0182] Example 11

[0183] The seventh implementation of this method is as follows: Figure 13 and Figure 14 As shown. In this implementation of the method, Figure 13 This demonstrates how to prepare the RCA product. In this embodiment, each of the two types of RCA products is pre-hybridized with two oligonucleotides, one upstream and one downstream of the UMI. After nick filling / ligation assay, the RCA product has multiple free 3' and / or 5' ends, which can be added to the sample and allow interaction with the target-binding probe. Figure 14 As shown, these RCA products (with free 3' and / or 5' ends capable of ligation) are hybridized with a sample that has been pre-hybridized with a target-specific probe. In this embodiment, the ligation reaction connects the notch-filled / ligated product of one RCA product to the notch-filled / ligated product of another RCA product via the target-specific probe. The resulting product contains a two-pixel-derived UMI and a barcode indicating a specific target. One advantage of Example 11 is that only the enzymatic ligation reaction is performed during sample analysis, thus simplifying the reaction, but the pre-preparation of RCA products in batches makes it slightly more complex.

[0184] Example 12

[0185] The following section describes the situation from Example 11 described above. Figure 13 and Figure 14 The implementation of the overall design shown.

[0186] Antibody binding sequence

[0187] The target-specific probe or antibody is ligated to the following sequence (via its free 3' end): 3'AAAAA-ACCGTGGCCTGGCAGACTTTAC 5' (SEQ ID NO:14). Chemical conjugation with the antibody can be achieved using 3'-amine modification of an oligonucleotide, but several other chemical reactions can be used. The A-stretch is a flexible single-link header region, while the rest of the sequence hybridizes with the target-barcode.

[0188] Claspoxylnucleotides

[0189] The clathrate oligonucleotide is constructed from three parts combined via a ligation reaction during the assay step. The first part of the clathrate oligonucleotide, 5'P-ACATAGGAGACAATTGAATAGC-AAAAAAA-TGGCACCGGACCGTCTGAAATG-AAAAAAA-ATGAATTACGCGCGCTCAGACA-3' (SEQ ID NO:15), is hybridized to an oligonucleotide covalently linked to an antibody and contains a barcode (i.e., "TP-BC") identifying the target of antibody binding. This probe, constructed via hybridization, is pre-prepared in mass production.

[0190] RCA Product Manufacturing and Application

[0191] In this embodiment, the method uses two types of RCA products (which may be referred to as "Type 1" and "Type 2" RCA products). For example... Figure 13 As shown, these products have a first grid oligonucleotide binding sequence (PPBS1) and an amplification primer binding site (F-PCR) or a second grid oligonucleotide binding sequence (PPBS2). These RCA products also have a unique RCA product identifier sequence Nx22.

[0192] Type 1 RCA products

[0193] The following oligonucleotide is cyclized: 5′P-TGGTTCGCAGGATGAG-GCCGGGAGTCTAACTCAAATAC-NNNNNNNNNNNNNNNNNNNNNN-TGAAGGTAGACGGAGGATTTAT-CGCTTCGGTGAGATAG-3′ (SEQ ID NO:3), which hybridizes with a linker template oligonucleotide, 5′-CTCATCCTGCGAACCA-CTATCTCACCGAAGCG-3′ (SEQ ID NO:4), used as a cyclization clamp. The cyclized oligonucleotide also contains a randomly generated UMI barcode “Nx22” and PPBS1 and a forward PCR primer site (F-PCR”). The linker template oligonucleotide of the type 1 RCA product can also be used to initiate the RCA reaction.

[0194] After amplification, the type 1 RCA product is a polymer of the following sequence: 5'CTATCTCACCGAAGCGATAAATCCTCCGTCTACCTTCA NNNNNNNNNNNNNNNNNNNNNNNN GTATTTGAGTTAGACTCCCGGCCTCATCCTGCGAACCA-3' (SEQ ID NO:5).

[0195] In this embodiment, the primers that bind to the F-PCR (sequence GCCGGGAGTCTAACTCAAATAC; SEQ ID NO: 6) in the type 1 RCA product are extended during the batch manufacturing step, thereby replicating the UMI to the 5' end of the PPBS 1-oligonucleotide (5'P-TGAAGGTAGACGGAGGATTTAT-AAAAAAA-GATCATGCAACGTATTGAAACG (SEQ ID NO: 20) in the nick-filling polymerization / ligation reaction.

[0196] Type 2 RCA products

[0197] The following oligonucleotide is cyclized: 5'-P-TAGTGAGTGTACGGAC CAACATCAGTATTCCCAGGCTANNNNNNNNNNNNNNNNNNNNNN GTGCTGACCAATCGACCAAGAT CGCCTAGTCTCTACTA-3' (SEQ ID NO:7), which hybridizes with the linker template oligonucleotide 5-GTCCGTACACTCACTATAGTAGAGACTAGGCG-3 (SEQ ID NO:8), which serves as a cyclization clamp. The cyclized oligonucleotide also contains a randomly generated UMI barcode "Nx22" and PPBS2 and reverse PCR primer sites ("R-PCR"). The linker template oligonucleotide of the type 2 RCA product can also be used to initiate the RCA reaction.

[0198] After amplification, the type 2 RCA product is a multiply of the following sequence: 5'-TAGTAGAGACTAGGCG-ATCTTGGTCGATTGGTCAGCAC-NNNNNNNNNNNNNNNNNNNNNNNN-TAGCCTGGGAATACTGATGTTG-GTCCGTACACTCACTA-3' (SEQ ID NO: 9).

[0199] In this embodiment, during the mass production of the RCA product, the 3' end of the PPBS2-oligonucleotide (P-CTAGACGCTGTAGTTCTGTAGC-AAAAAAA-CAACATCAGTATTCCCAGGCTA-3' (SEQ ID NO: 16) hybridizes with its binding site in the type 2 RCA product and is extended to replicate the UMI in the gap-filling polymerization / ligation reaction. The 3' end of the PPBS2-oligonucleotide is extended until it encounters the 5' end of the oligonucleotide of sequence 5'-P-GTGCTGACCAATCGACCAAGAT (SEQ ID NO: 10). The 3' end of this extended product is then ligated to the 5'-P end of the oligonucleotide.

[0200] These steps result in the batch production of two types of RCA products, both containing multiple 3'-free or 5'-free oligonucleotides capable of reacting and ready for sample assays, such as Figure 13 As shown.

[0201] Linkage reaction on samples forming complete grid oligonucleotides

[0202] like Figure 14As shown, the grid oligonucleotide is formed by combining three oligonucleotides via a splice ligation reaction. This allows the target-binding probe to bind to the sample. Ligation splice oligonucleotides (PPBS1+ probe splice 5'GCTATTCAATTGTCTCCTATGT-CGTTTCAATACGTTGCATGATC (SEQ ID NO:17) and PPBS2+ probe splice GCTACAGAACTACAGCGTCTAG-TGTCTGAGCGCGCGTAATTCAT (SEQ ID NO:18)) were added to the target-binding probe to enable it to ligate to PPBS1 and PPBS2 oligonucleotides. These splices preferably contain uracil-substituted thymidine to facilitate enzymatic degradation by uracil-N-glycosylation enzymes after ligation, thereby reducing the possibility of erroneous PCR skipping.

[0203] After the target probe containing the splice binds to the sample, type 1 and type 2 RCA products are added and functionalized as described above. The free ends of PPBS1 and PPBS2 are respectively bound to each end of the middle portion (part 1) of the lattice oligonucleotide via the splice. DNA ligase is added to covalently fuse the p-UMI from the type 1 RCA product with TP-BC and the p-UMI from the type 2 RCA product.

[0204] PCR amplification

[0205] The ligation reaction merges the lattice oligonucleotide component (and thus the TP-BC sequence) with complementary sequences from two UMIs (one from the type 1 RCA product and the other from the type 1 RCA product). The product is amplified by PCR using the following primers: F-PCR primer 5'GTATTTGAGTTAGACTCCCGGC-3' (SEQ ID NO:11) and R-PCR primer 5'ATCTTGGTCGATTGGTCAGCAC-3' (SEQ ID NO:12).

[0206] The PCR product generated in this reaction will have the following sequence containing these elements: F-primer, pixel-1 UMI, PPBS1, pA-adaptor, ligation sequence, pA-adaptor, TP-BC, pA-adaptor, ligation sequence, pA-adaptor, PPBS2, pixel-2 UMI, and R-primer. In this embodiment, the product will have the sequence GCCGGGAGTCTAACTCAAATAC-Nx22-TGAAGGTAGACGGAGGATTTAT-AAAAAAA-GATCATGCAACGTATTGAAACG-ACATAGGAGACAATTGAATAGC-AAAAAAA-TGGCACCGGACCGTCTGAAATG-AAAAAAA-ATGAATTACGCGCGCTCAGACA-CTAGACGCTGTAGTTCTGTAGC-AAAAAAA-CAACATCAGTATTCCCAGGCTA-Nx22-GTGCTGACCAATCGACCAAGAT (SEQ ID NO:19). PCR amplification can include additional primer sequences that can be used to uniquely label individual samples so that multiple samples can be merged downstream before sequencing, a process known as sample barcoding.

[0207] Example 13

[0208] The eighth implementation of the method is shown in Figure 15 and Figure 16 . Figure 15 This demonstrates how to design RCA products, which are similar to Figure 10 The method is illustrated. This version utilizes two types of pre-preparation steps for RCP-pixels to achieve DNA-linked sample sensing. The pixels are first partially formed into double strands through gap-filling polymerization across the UMI. Figure 16 In the assay steps shown, two types of pixels are prepared having GOBS-1 or GOBS-2 sites capable of hybridizing with grid oligonucleotides. Figure 16 The sample was shown to be bound to the target analyte sensing probe, which carried a grid oligonucleotide. The RCA product was then added to the sample, causing GOBS1 and GOBS2 to hybridize to the ends of the grid oligonucleotide, forming a nick that could be closed by a DNA ligation reaction that forms PCR amplicon. The product could then be sequenced to determine the UMI of the RCA product. sequence list <110> Pixelgen Technologies AB Fredriksson, Simon <120> Methods for plotting rolling circle amplification products <130> PIXL-001WO <150> US 62 / 926,907 <151> 2019-10-28 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 1 tcggggatcgg catcgacgcc taaaaaa 27 <210> 2 <211> 80 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (51)..(52) <223> There is a TP-BC between nucleotides. <400> 2 tgaaggtaga cggaggattt ataaaaaaat aggcgtcgat gccgatcccg aaaaaaaaca 60 acatcagtat tcccaggcta 80 <210> 3 <211> 98 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (39) (60) <223> n is a, c, g, or t <400> 3 tggttcgcag gatgaggccg ggagtctaac tcaaatacnn nnnnnnnnnn nnnnnnnnnn 60 tgaaggtaga cggaggattt atcgcttcgg tgagatag 98 <210> 4 <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 4 ctcatcctgc gaaccactat ctcaccgaag cg 32 <210> 5 <211> 98 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (39) (60) <223> n is a, c, g, or t <400> 5 ctatctcacc gaagcgataa atcctccgtc taccttcann nnnnnnnnnn nnnnnnnnnn 60 gtatttgagt tagactcccg gcctcatcct gcgaacca 98 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 6 gccgggagtc taactcaaat ac 22 <210> 7 <211> 98 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (39) (60) <223> n is a, c, g, or t <400> 7 tagtgagtgt acggaccaac atcagtattc ccaggctann nnnnnnnnnn nnnnnnnnnn 60 gtgctgacca atcgaccaag atcgcctagtctctacta 98 <210> 8 <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 8 gtccgtacac tcactatagt agagactagg cg 32 <210> 9 <211> 98 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (39) (60) <223> n is a, c, g, or t <400> 9 tagtagagac taggcgatct tggtcgattg gtcagcacnn nnnnnnnnnn nnnnnnnnnn 60 tagcctggga atactgatgt tggtccgtac actcacta 98 <210> 10 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 10 gtgctgacca atcgaccaag at 22 <210> 11 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 11 gtatttgagt tagactcccg gc 22 <210> 12 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 12 atcttggtcg attggtcagc ac 22 <210> 13 <211> 124 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (22)..(22) <223> The nucleotides contain a randomly generated UMI barcode "Nx22". <220> <221> misc_feature <222> (102) (103) <223> The nucleotides contain a randomly generated UMI barcode "Nx22". <400> 13 gccggggagtc taactcaaat actgaaggta gacggaggat ttataaaaaa ataggcgtcg 60 atgccgatcc cgaaaaaaaa caacatcagt attcccaggc tagtgctgac caatcgacca 120 agat 124 <210> 14 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 14 catttcagac ggtccggtgc caaaaaa 27 <210> 15 <211> 80 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 15 acataggaga caattgaata gcaaaaaaat ggcaccggac cgtctgaaat gaaaaaaaat 60 gaattacgcg cgctcagaca 80 <210> 16 <211> 51 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 16 ctagacgctg tagttctgta gcaaaaaaac aacatcagta ttcccaggct a 51 <210> 17 <211> 44 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 17 gctattcaat tgtctcctat gtcgtttcaa tacgttgcat gatc 44 <210> 18 <211> 44 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 18 gctacagaac tacagcgtct agtgtctgag cgcgcgtaat tcat 44 <210> 19 <211> 228 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_feature <222> (22)..(23) <223> The nucleotides contain a randomly generated UMI barcode "Nx22". <220> <221> misc_feature <222> (205)..(206) <223> The nucleotides contain a randomly generated UMI barcode "Nx22". <400> 19 gccggggagtc taactcaaat acntgaaggt agacggagga tttataaaaa aagatcatgc 60 aacgtattga aacgacatag gagacaattg aatagcaaaa aaatggcacc ggaccgtctg 120 aaatgaaaaa aaatgaatta cgcgcgctca gacactagac gctgtagttc tgtagcaaaa 180 aaacaacatc agtattccca ggctangtgc tgaccaatcg accaagat 228 <210> 20 <211> 51 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 20 tgaaggtaga cggaggattt ataaaaaaag atcatgcaac gtattgaaac g 51

Claims

1. A method for making a physical map of rolling circle amplification (RCA) products, comprising: (a) generating a complex of a population of grid oligonucleotide molecules and a population of RCA products each having a unique RCA product identifier sequence, wherein the grid oligonucleotide hybridizes directly or indirectly via a splint to a complementary site in the RCA product; (b) extending a grid oligonucleotide molecule that hybridizes to two RCA products to add the complement of unique RCA product identifier sequences from the two RCA products to the grid oligonucleotide molecule; (c) sequencing the extended grid oligonucleotide; and (d) analyzing the sequence to identify which pairs of unique RCA product identifier sequence complements have been added to the grid oligonucleotide; and (e) using the sequence pairs identified in (d) to make one or more physical maps of immobilized RCA products.

2. The method of claim 1, wherein in step (a) at least some of the unique RCA product identifier sequences in the RCA products are double stranded, and wherein step (b) comprises ligating a grid oligonucleotide molecule to the end of a strand of a double stranded region of an RCA product, thereby adding the complement of unique RCA product identifier sequences from two RCA products to the grid oligonucleotide.

3. The method of claim 1, wherein step (a) comprises: (a) hybridizing a population of grid oligonucleotide molecules to a population of RCA products, wherein the grid oligonucleotide molecules or the RCA products are immobilized, wherein: (i) the RCA products of the population of RCA products each have a unique RCA product identifier sequence and a grid oligonucleotide binding sequence, and (ii) the grid oligonucleotide molecules each comprise a first end sequence that is complementary to a grid oligonucleotide binding sequence and a second end sequence that is complementary to a grid oligonucleotide binding sequence; and (iii) at least some of the grid oligonucleotide molecules hybridize to two adjacent RCA products.

4. The method of any of the preceding claims, wherein the extending comprises a gap fill and / or ligation reaction that adds the complement of unique RCA product identifier sequences from two adjacent RCA products to the grid oligonucleotide.

5. The method of claim 4, wherein in step (a): (i) the population of RCA products comprises: i. a first set of RCA products each comprising a repeat sequence comprising a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence, and ii. a second set of RCA products comprising a repeat sequence comprising a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; (ii) the grid oligonucleotide molecules each comprise a first end sequence that is complementary to a first grid oligonucleotide binding sequence and a second end sequence that is complementary to a second grid oligonucleotide binding sequence; and (iii) at least some of the grid oligonucleotide molecules hybridize to two adjacent RCA products.

6. The method of any one of the preceding claims, wherein the extended grid oligonucleotides are amplified by PCR prior to sequencing.

7. The method of any one of the preceding claims, wherein the grid oligonucleotide molecules are immobilized and the RCA products hybridize to the immobilized grid oligonucleotide molecules.

8. The method of claim 7, wherein the grid oligonucleotides hybridize to sequences within or on a cell prior to hybridization to the RCA products.

9. The method of claim 7, wherein the grid oligonucleotide molecules are generated in situ within or on a cell prior to hybridization to the RCA products.

10. The method of claim 7, wherein the RCA products are immobilized and the grid oligonucleotide molecules hybridize to the immobilized RCA products.

11. The method of claim 10, wherein the RCA products hybridize to sequences within or on a cell prior to hybridization to the grid oligonucleotide molecules.

12. The method of claim 10, wherein the RCA products are generated in situ within or on a cell prior to hybridization to the grid oligonucleotide molecules.

13. The method of any one of the preceding claims, wherein the grid oligonucleotide molecules or the RCA products are immobilized via an antibody.

14. The method of any one of the preceding claims, wherein the grid oligonucleotide molecules or the RCA products are immobilized via a nucleic acid probe.

15. The method of any one of the preceding claims, wherein the grid oligonucleotide molecules or RCA products are immobilized on one or more surfaces.

16. The method of any one of the preceding claims, wherein the grid oligonucleotide molecules or RCA products are immobilized at one or more sites within or on a cell, wherein the cell is in suspension or attached to a support.

17. The method of claim 16, wherein the grid oligonucleotide molecules or RCA products are immobilized at one or more sites within or on a cell via one or more binding agents, wherein each of the binding agents binds to a sequence in the grid oligonucleotide molecule or RCA product and to the one or more sites within or on a cell.

18. The method of claim 17, further comprising performing a proximity assay between the one or more binding agents and the RCA products to which they bind.

19. The method of claim 18, wherein the proximity assay generates assay products comprising a complement of a binding agent identifier sequence and a complement of a unique RCA product identifier sequence.

20. The method of claim 19, wherein the method comprises: mapping the binding agents into a physical map of the immobilized RCA products by analyzing which unique RCA product identifier sequences and which binding agent identifier sequences are in the assay products.

21. The method of claim 20, wherein the complement of the binding agent identifier sequence and the complement of the unique RCA product identifier sequence are incorporated into the extended grid oligonucleotides of step (b).

22. The method of any of the preceding claims, wherein the grid oligonucleotide molecules uniquely hybridize to a binder identifier sequence.

23. A probe system comprising: (a) a population of RCA products, wherein the RCA products of the population of RCA products each have a unique RCA product identifier sequence and a grid oligonucleotide binding sequence; and (b) a population of grid oligonucleotide molecules, wherein the terminal sequence at one end of the grid oligonucleotide molecules is complementary to a grid oligonucleotide binding sequence and the terminal sequence at the other end of the grid oligonucleotide molecules is complementary to a grid oligonucleotide binding sequence, wherein the grid oligonucleotide molecules are either single molecules or fragmented, and if the grid oligonucleotide molecules are fragmented into one or more sequences, the system further comprises one or more splint oligonucleotides that hold the sequences together; wherein hybridization of (a) and (b) produces a complex in which the grid oligonucleotide is hybridized to an adjacent RCA product.

24. The probe system of claim 23, wherein: the population of RCA products of (a) comprises: (i) a first set of RCA products each comprising a repeat sequence comprising a unique RCA product identifier sequence and a first grid oligonucleotide binding sequence; and (ii) a second set of RCA products comprising a repeat sequence comprising a unique RCA product identifier sequence and a second grid oligonucleotide binding sequence; and the population of grid oligonucleotide molecules of (b) comprises, the terminal sequence at one end of the grid oligonucleotide molecules is complementary to the first grid oligonucleotide binding sequence and the terminal sequence at the other end of the grid oligonucleotide molecules is complementary to the second grid oligonucleotide binding sequence, wherein the grid oligonucleotide molecules are either single molecules or fragmented, and if the grid oligonucleotide molecules are fragmented into one or more sequences, the system further comprises one or more splint oligonucleotides that hold the sequences together.

25. The probe system of claim 24, wherein the first and second sets of RCA products each comprise at least 10 members.

26. The probe system of any of claims 23-25, wherein the grid oligonucleotide binding sequence in the RCA product is adjacent to the unique RCA product identifier sequence in the RCA product, and the terminal of the grid oligonucleotide molecule hybridizes to the grid oligonucleotide binding sequence but not to the unique RCA product identifier sequence.

Images