regulators of PNPLA3 expression
By interfering with antisense oligonucleotides targeting PNPLA3, the problem of PNPLA3 being difficult to inhibit in existing technologies has been solved, enabling effective treatment and prevention of liver diseases such as NAFLD and NASH.
Patent Information
- Application Number
- CN202080071323.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-10-14
- Filing Date
- 2020-10-12
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2040-10-12
AI Technical Summary
Existing technologies are unable to effectively inhibit the expression and activity of PNPLA3, making it difficult to control the progression of non-alcoholic fatty liver disease (NAFLD) and related liver diseases.
Using compounds that target PNPLA3, particularly antisense oligonucleotides (such as siRNA and ASO), to reduce the levels of PNPLA3 mRNA and protein, thereby reducing liver inflammation and fibrosis, including targeted interference with PNPLA3 with the I148M mutation.
It significantly reduces the level of PNPLA3 protein in the liver, reduces liver inflammation and fibrosis, alleviates the progression of liver diseases such as NAFLD and NASH, improves liver function, and reduces liver damage indicators.
Smart Images

Figure BDA0003589975540000081 
Figure BDA0003589975540000091 
Figure BDA0003589975540000092
Abstract
Description
[0001] sequence list
[0002] This application is submitted together with an electronic sequence listing. The sequence listing is provided as a file created on September 13, 2018, entitled BIOL0317USLSEQ_ST25.txt, and is 480kb in size. Information from the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field
[0003] This invention provides methods, compounds, and compositions that can be used to inhibit the expression of PNPLA3 (potato glycoprotein-like 3 containing a phospholipase domain; putative protein dJ796I17.1; lipotrophic protein; DJ796I17.1), and in some cases reduce the amount of PNPLA3 protein in cells or animals, for the treatment, prevention, or alleviation of diseases associated with PNPLA3. In some embodiments, these methods, compounds, and compositions can be used to treat, prevent, or alleviate diseases associated with PNPLA3 having the I148M mutation. Background Technology
[0004] Nonalcoholic fatty liver disease (NAFLD) encompasses a range of liver diseases, from steatosis to nonalcoholic steatohepatitis (NASH) and cirrhosis. NAFLD is defined as the accumulation of more than 5% fat in the liver, the absence of significant alcohol consumption, lipogenic drug therapy, or a genetic disorder (Kotronen et al., Arterioscler Thromb. Vasc. Biol. [Atherosclerosis, Thrombosis and Vascular Biology] 2008, 28: 27-38).
[0005] Nonalcoholic steatohepatitis (NASH) is an aggressive variant of NAFLD with signs of inflammation and liver damage. Histologically, NASH is defined by macrovesicular steatosis, hepatocellular ballooning degeneration, and lobular inflammatory infiltration (Sanyal, Hepatol. Res. 2011.41:670-4). NASH is estimated to affect 2%–3% of the general population. In the presence of other lesions, such as obesity or diabetes, the estimated prevalence increases to 7% and 62%, respectively (Hashimoto et al., J. Gastroenterol. 2011.46(1):63-69).
[0006] PNPLA3 is a 481-amino acid member of the potato glycoprotein-like family containing a phospholipase domain, expressed in the ER and on lipid droplets. In humans, PNPLA3 is highly expressed in the liver, but its expression is five-fold lower in adipose tissue (Huang et al., Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 2010. 107: 7892-7). Summary of the Invention
[0007] Some embodiments provided herein are compounds and methods for reducing the amount of PNPLA3 mRNA or its activity, and in some embodiments, for reducing the amount of PNPLA3 protein in cells or animals. In some embodiments, the animal has a liver disease. In some embodiments, the disease is NASH. In some embodiments, the disease is NAFLD. In some embodiments, the disease is hepatic steatosis. In some embodiments, the disease is cirrhosis. In some embodiments, the disease is hepatocellular carcinoma. In some embodiments, the disease is alcoholic liver disease. In some embodiments, the disease is alcoholic steatohepatitis (ASH). In some embodiments, the disease is HCV hepatitis. In some embodiments, the disease is chronic hepatitis. In some embodiments, the disease is hereditary hemochromatosis. In some embodiments, the disease is primary sclerosing cholangitis. Some compounds provided herein relate to compounds and compositions that reduce liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic fat accumulation in animals.
[0008] Some of the embodiments provided herein relate to potent and tolerable compounds and compositions for inhibiting PNPLA3 expression, which may be used to treat, prevent, alleviate, or slow the progression of liver disease. Some of the embodiments provided herein relate to compounds and compositions that are more potent or have greater therapeutic value than publicly disclosed compounds.
[0009] In some embodiments, this disclosure provides a method of treating an individual with or at risk of developing liver disease, the method comprising administering to the individual a compound targeting PNPLA3, wherein the individual has an I148M mutation in potato glycoprotein-like protein 3 (PNPLA3) containing a phospholipase domain.
[0010] In some embodiments, this disclosure provides a method for reducing one or more of liver injury, hepatic steatosis, liver inflammation, liver fibrosis, and hepatic steatosis in an individual, the method comprising administering a compound targeting PNPLA3 to the individual, wherein the individual has an I148M mutation in potato glycoprotein-like protein 3 (PNPLA3) containing a phospholipase domain.
[0011] In some embodiments, this disclosure provides a method for reducing the levels of one or more proteins of haptoglobin, MCP1, and TIMP2 in an individual, the method comprising administering a compound targeting PNPLA3 to the individual, wherein the individual has an I148M mutation in potato glycoprotein-like protein 3 (PNPLA3) containing a phospholipase domain.
[0012] In some embodiments, the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), hepatic steatosis, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the liver disease is hepatic steatosis.
[0013] In some embodiments, the method reduces or inhibits liver inflammation or liver fibrosis. In some embodiments, reducing or inhibiting liver inflammation includes lowering the level of liver macrophages. In some embodiments, the level of liver macrophages is reduced by at least 20% relative to individuals who have not been administered the compound targeting PNPLA3, as measured by immunohistochemical staining of liver sections of the individual.
[0014] In some embodiments, the protein level of haptoglobin is reduced by at least 20% relative to individuals who have not been administered the compound targeting PNPLA3, as measured by colorimetric assay of the individual's serum or plasma. In some embodiments, the protein level of MCP1 is reduced by at least 20% relative to individuals who have not been administered the compound targeting PNPLA3, as measured by immunoblotting of the individual's liver sample. In some embodiments, the protein level of TIMP2 is reduced by at least 20% relative to individuals who have not been administered the compound targeting PNPLA3, as measured by immunoblotting of the individual's liver sample.
[0015] In some embodiments, the individual has a homozygous I148M mutation in PNPLA3. In some embodiments, the individual is a human individual.
[0016] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual is an antisense compound targeting PNPLA3. In some embodiments, the antisense compound targeting PNPLA3 is a short interfering RNA (siRNA). In some embodiments, the antisense compound targeting PNPLA3 is an antisense oligonucleotide (ASO).
[0017] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 8 to 80 linked nucleosides and has a nucleotide sequence comprising at least 8, 9, 10, 11, or 12 consecutive nucleosides of any one of the SEQ ID NO: 17-2169. In some embodiments, the compound targeting PNPLA3 comprises a modified oligonucleotide of 8 to 80 nucleosides and has a nucleotide sequence comprising any one of the SEQ ID NO: 17-2169. In some embodiments, the compound targeting PNPLA3 comprises a modified oligonucleotide having a nucleotide sequence consisting of any one of SEQ ID NO: 17-2169.
[0018] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobase portions that are 100% complementary to an equal-length portion of SEQ ID NO: 2, namely 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912, and wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence complementary to SEQ ID NO: 2 in the following sequences: 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912, and wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2.
[0019] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobase portions complementary to the nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of the PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleonucleotide sequence comprising a 16-base moiety complementary to an equal-length portion of nucleosides 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO: 2.
[0020] In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.
[0021] In some embodiments, the modified oligonucleotide has a nucleobase sequence that is complementary to SEQ ID NO: 2 in at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the entire length of the nucleobase sequence.
[0022] In some embodiments, the modified nucleotide comprises at least one modification selected from: at least one modified nucleoside linker, at least one modified sugar, and at least one modified nucleobase. In some embodiments, the modified nucleoside linker is a phosphate thioside linker.
[0023] In some embodiments, the modified sugar is a dicyclic sugar. In some embodiments, the dicyclic sugar is selected from the group consisting of: 4′-(CH2)-O-2′(LNA); 4′-(CH2)2-O-2′(ENA); and 4′-CH(CH3)-O-2′(cEt). In some embodiments, the modified sugar is 2′-O-methoxyethyl. In some embodiments, the modified nucleobase is 5-methylcytosine.
[0024] In some embodiments, the modified oligonucleotide comprises: a nick segment consisting of linked deoxyribonucleotides; a 5' wing segment consisting of linked ribonucleotides; and a 3' wing segment consisting of linked ribonucleotides; wherein the nick segment is positioned adjacent to and between the 5' wing segment and the 3' wing segment, and wherein each ribonucleotide of each wing segment comprises a modified sugar.
[0025] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the target individual is single-stranded. In some embodiments, the compound targeting PNPLA3 is double-stranded. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the target individual comprises a ribonucleotide. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the target individual comprises a deoxyribonucleotide.
[0026] In some embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 15 to 30 linked nucleosides.
[0027] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises: a nick segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides; wherein the nick segment is located between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar.
[0028] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises: a nick segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of three linked nucleosides; wherein the nick segment is located between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment and the 3' wing segment contain cEt sugar; wherein each nucleoside link is a phosphate thioester link; and wherein each cytosine is 5-methylcytosine.
[0029] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a conjugation moiety and a conjugation linker. In some embodiments, the conjugation group comprises a GalNAc cluster containing 1 to 3 GalNAc ligands.
[0030] In some embodiments, the conjugate linker consists of a single bond. In some embodiments, the conjugate linker is cleavable. In some embodiments, the conjugate linker comprises 1 to 3 linker-nucleosides. In some embodiments, the conjugate group is attached to the 5' end of the modified oligonucleotide. In some embodiments, the conjugate group is attached to the 3' end of the modified oligonucleotide.
[0031] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises the following formula or a salt thereof:
[0032]
[0033] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is 16 linked nucleosides and consists of the sequence SEQ ID NO: 1089, wherein the modified oligonucleotide comprises: a nick segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of three linked nucleosides; wherein the nick segment is located between the 5' wing segment and the 3' wing segment; wherein each nucleoside in each wing segment contains a cEt sugar; wherein each nucleoside link is a phosphate thioester link; wherein each cytosine is 5-methylcytosine; and wherein the conjugate group is located at the 5' end of the modified oligonucleotide and is
[0034]
[0035] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual has the following formula or a salt thereof:
[0036]
[0037] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual is a modified oligonucleotide in a pharmaceutically acceptable salt form. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt.
[0038] In some embodiments, the compound targeting PNPLA3 with the I148M mutation is administered to the individual as a composition comprising the compound targeting PNPLA3 and a pharmaceutically acceptable carrier. In some embodiments, the compound targeting PNPLA3 with the I148M mutation is administered parenterally to the individual.
[0039] In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with SEQ ID NO: 115. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with any one of SEQ ID NO: 2170-2172.
[0040] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises the sequence of SEQ ID NO: 115, wherein the modified oligonucleotide comprises: a nick segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of three linked nucleosides; and a 3' wing segment consisting of three linked nucleosides; wherein the nick segment is located between the 5' wing segment and the 3' wing segment; wherein each nucleoside in each wing segment contains a cEt sugar; wherein each nucleoside linkage is a phosphate thioester linkage; and wherein each cytosine is 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual further comprises a conjugation group, wherein the conjugation group is located at the 5' end of the modified oligonucleotide and is
[0041] Attached Figure Description
[0042] Figure 1A-1F relates to Example 11. Figure 1 The results in A-1C involve human HepG2 cells treated with either the control ASO or PNPLA3 ASO as described in the examples herein. Figure 1 A shows the PNPLA3 mRNA level. Figure 1 B shows the area stained with Oil Red O (ORO). Figure 1 C shows an image stained with ORO. Figure 1 The results in D-1F involve human HepG2 cells treated with either the control siRNA or PNPLA3 siRNA described in the examples herein. Figure 1 D shows the PNPLA3 mRNA level. Figure 1 E shows the area stained with Oil Red O (ORO). Figure 1 F shows an image stained with ORO.
[0043] Figure 2 A-2J relates to Example 13. Figure 2 The results in A-2J involve wild-type mice and PNPLA3 I148M mutant knock-in mice that have undergone the control ASO or PNPLA3 ASO treatments described in the examples herein. Figure 2 A shows the weight gain before and after ASO treatment. Figure 2 B shows the calorie intake before and after ASO treatment. Figure 2 C shows the liver Pnpla3 mRNA level measured by qPCR and normalized relative to the ribosomal protein large PO (RplpO). Figure 2 D shows the level of Pnpla3 protein in liver lipid droplets, as measured by Western blotting. Figure 2 E and 2H show representative images of ORO-stained liver sections after 8 weeks of ASO treatment (black scale bar represents 100 μm). Figure 2 F and 2I show the liver lipid levels in PNPLA3 I148M mutant mice and wild-type mice, respectively, as assessed by MRI after 6 weeks of ASO treatment. Figure 2 G and 2J show liver and plasma triglyceride levels in PNPLA3 I148M mutant and wild-type mice, respectively, as measured by biochemical assays.
[0044] Figure 3 A-3F and 4A-4B relate to Example 14. Figure 3 The results in A-3F and 4A-4B involve wild-type mice and PNPLA3 I148M mutant knock-in mice that have undergone the control ASO or PNPLA3 ASO treatments described in the examples herein. Figure 3 A shows the body weight as measured throughout the experiment. Figure 3 B shows the calorie intake measured before and after the ASO treatment. Figure 3 C shows the liver Pnpla3 mRNA level measured by qPCR and normalized relative to the ribosomal protein large PO (RplpO). Figure 3 D shows the level of Pnpla3 protein in liver lipid droplets, as measured by Western blotting. Figure 3 E and 3F show the plasma ALT, AST, and triglyceride levels, as well as the liver triglyceride content, in PNPLA3 I148M mutant mice and wild-type mice, respectively.
[0045] Figure 4 A and 4B show the liver steatosis score, lobular inflammation score, NAFLD activity score (NAS), and fibrosis stage of PNPLA3 I148M mutant mice and wild-type mice, respectively.
[0046] Figure 5 A-5E and Figure 6 Example 15 is relevant. Figure 5 A-3E and Figure 6 The results involved wild-type mice and PNPLA3 I148M mutant knock-in mice that underwent the control ASO or PNPLA3 ASO treatments described in the examples herein. Figure 5 Image A shows a representative image of an oil red O stained liver section (black scale bar represents 100 μm). Figure 5 B and 5C show the liver mRNA expression levels of Accl and Scd1 in PNPLA3I148M mutant mice and wild-type mice, respectively. Figure 5 D and 5E show the fatty acid composition of liver lipid droplets in PNPLA3 I148M mutant mice and wild-type mice, respectively.
[0047] Figure 6 The additional liver lipid droplet fatty acid composition of PNPLA3 I148M mutant mice and wild-type mice is shown, including monounsaturated fatty acids (MUFA), polyunsaturated fatty acids (PUFA) and saturated fatty acids (SFA).
[0048] Figure 7 A-7H, 8A-8E, and 9A-9D relate to Example 16. Figure 7 The results in A-7H, 8A-8E, and 9A-9D involve wild-type mice and PNPLA3 I148M mutant knock-in mice that have undergone the control ASO or PNPLA3 ASO treatments described in the examples herein. Figure 7A and 7B show plasma haptoglobin levels and liver macrophage content (as determined by Mac2 staining) in PNPLA3 I148M mutant and wild-type mice, respectively. Figure 7 C shows a representative image of a Mac2-stained liver section (the black scale bar represents 100 μm). Figure 7 D-7H shows the liver protein Mcp1 in PNPLA3 I148M mutant mice and wild-type mice. Figure 7 D), Il1β Figure 7 E), Il6 ( Figure 7 F), Tnfα( Figure 7 G) and αSma( Figure 7 The level of H).
[0049] Figure 8 A and 8B show the levels of Col1a1 mRNA and protein (immunohistochemical) in the livers of PNPLA3 I148M mutant mice and wild-type mice, respectively. Figure 8 C shows a representative image of collagen immunohistochemistry in a liver section (black scale bar represents 100 μm). Figure 8 D and 8E show the liver hydroxyproline levels in PNPLA3 I148M mutant mice and wild-type mice, respectively.
[0050] Figure 9 A-9D shows liver protein measured by Western blot analysis in PNPLA3 I148M mutant and wild-type mice: Timp2 ( Figure 9 A) Mmp2 Figure 9 B), Timp1 Figure 9 C) and Tgfβr2( Figure 9 D). Detailed Implementation
[0051] It should be understood that both the foregoing overview and the following detailed description are exemplary and illustrative only, and do not limit the embodiments claimed. In this document, the use of the singular includes the plural unless otherwise expressly stated. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting.
[0052] The chapter headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All references, or portions thereof, cited in this application (including but not limited to patents, patent applications, articles, books, papers, and GenBank and NCBI reference sequence records) are specifically linked to the portions of the references discussed herein and in their full text by reference.
[0053] It should be understood that the sequence listed in each SEQ ID NO in the examples included herein is independent of any modification to the sugar moiety, internucleotide linkage, or nucleobase. Therefore, a compound defined by SEQ ID NO may independently contain one or more modifications to the sugar moiety, internucleotide linkage, or nucleobase. Compounds described by ION numbers indicate combinations of nucleobase sequences, chemical modifications, and motifs.
[0054] definition
[0055] Unless otherwise specified, the following terms have the following meanings:
[0056] "2'-Deoxynucleoside" refers to a nucleoside containing a 2'-H(H) furanyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, 2'-deoxynucleoside may contain modified nucleotides or may contain RNA nucleotides (uracil).
[0057] "2'-O-methoxyethyl" (also known as 2'-MOE) refers to the 2'-OH group replacing the ribosyl ring (2'-O(CH2)2-OCH3). Sugars modified with 2'-O-methoxyethyl are modified sugars.
[0058] "2'-MOE nucleoside" (also known as 2'-O-methoxyethyl nucleoside) refers to a nucleoside containing a sugar moiety modified with 2'-MOE.
[0059] "2'-substituted nucleoside" or "2-modified nucleoside" means a nucleoside containing a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2-modified" with respect to the sugar moiety means a sugar moiety containing at least one 2'-substituent group other than H or OH.
[0060] "3' target site" refers to the nucleotide of the target nucleic acid that is complementary to the 3' nucleotide of a specific compound.
[0061] "5' target site" refers to the nucleotide of the target nucleic acid that is complementary to the 5' nucleotide of a specific compound.
[0062] "5-Methylcytosine" refers to cytosine with a methyl group attached to the 5-position.
[0063] "Approximately" means within ±10% of a certain value. For example, if it is stated that "these compounds affect approximately 70% inhibition of PNPLA3", it implies that PNPLA3 levels are inhibited in the range of 60% to 80%.
[0064] "Administration" refers to the means by which a compound or composition provided herein is introduced into an individual to perform its intended function. Examples of possible administration methods include, but are not limited to, parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
[0065] "Simultaneous administration" or "co-administration" means administering two or more compounds in any manner in which the pharmacological effects of the two drugs are manifested in the patient's body. Simultaneous administration does not require administration of a single drug composition, in the same dosage form, via the same route of administration, or simultaneously of two compounds. The effects of the two compounds themselves do not need to be manifested simultaneously. These effects only need to overlap for a period of time and do not need to be concurrent. Simultaneous administration or co-administration encompasses administration in parallel or sequentially.
[0066] "Remission" refers to the improvement or reduction of at least one indicator, sign, or symptom of a related disease, disorder, or condition. In some embodiments, remission includes a delay or reduction in the progression or severity of one or more indicators of the condition or disease. The progression or severity of the indicator can be determined by subjective or objective measures known to those skilled in the art.
[0067] "Animal" refers to human or non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates (including but not limited to monkeys and chimpanzees).
[0068] "Antisense activity" means any detectable and / or measurable activity attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or the target protein encoded by such a target nucleic acid compared to the level of the target nucleic acid or the target protein in the absence of an antisense compound.
[0069] "Antisense compound" refers to a compound that contains an oligonucleotide and optionally one or more additional features (such as conjugation groups or terminal groups). Examples of antisense compounds include single-stranded and double-stranded compounds, such as oligonucleotides, ribonucleotides, siRNA, shRNA, ssRNA, and occupancy-based compounds.
[0070] "Antisense inhibition" refers to the reduction in the level of the target nucleic acid in the presence of the antisense compound compared to the level in the absence of the antisense compound.
[0071] "Antisense mechanisms" are all those mechanisms that involve hybridization of a compound with a target nucleic acid, where the result or effect of hybridization is target degradation or target occupancy, accompanied by the shutdown of cellular machinery involving, for example, transcription or splicing.
[0072] "Antisense oligonucleotide" refers to an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid or a region or segment thereof. In some embodiments, the antisense oligonucleotide may specifically hybridize with the target nucleic acid or a region or segment thereof.
[0073] "Bicyclic nucleoside" or "BNA" refers to a nucleoside containing a dicyclic sugar moiety. "Dicyclic sugar" or "dicyclic sugar moiety" refers to a modified sugar moiety containing two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the dicyclic sugar moiety is a furanyl moiety. In some embodiments, the dicyclic sugar moiety does not contain a furanyl moiety.
[0074] "Branching group" refers to a group of atoms having at least three positions capable of covalently linking with at least three groups. In some embodiments, the branching group provides multiple reactive sites for linking the chain ligand to the oligonucleotide via a conjugate linker and / or a cleavable portion.
[0075] "Targeting cell portion" refers to a portion of a conjugate group or conjugate group that can bind to one or more specific cell types.
[0076] “cEt” or “restricted ethyl” refers to the ribosyl dicyclic sugar moiety, wherein the second ring of the dicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration.
[0077] “cEt nucleoside” refers to a nucleoside containing a cEt-modified sugar moiety.
[0078] The term "chemical modification" in a compound describes the substitution or alteration of any unit in the compound by a chemical reaction relative to the initial state of that unit. "Modified nucleoside" means a nucleoside that independently has a modified sugar moiety and / or a modified nucleobase. "Modified oligonucleotide" means an oligonucleotide containing at least one modified internucleotide linker, a modified sugar, and / or a modified nucleobase.
[0079] "Chemically different regions" refers to regions of a compound that are chemically different from other regions of the same compound in some respects. For example, a region containing a 2'-O-methoxyethyl nucleotide is chemically different from a region containing a nucleotide without the 2'-O-methoxyethyl modification.
[0080] "Chimeric antisense compounds" refers to antisense compounds that have at least two chemically distinct regions, each with multiple subunits.
[0081] "Cleavable bond" means any chemical bond that can be separated. In some embodiments, the cleavable bond is selected from: amides, polyamides, esters, ethers, phosphate diesters, phosphate esters or esters of one or both, carbamates, disulfides or peptides.
[0082] "Cutable portion" refers to a bond or atomic group that can be cut under physiological conditions, such as in a cell, animal, or human.
[0083] The term "complementary" in oligonucleotides refers to the situation where, when two nucleobase sequences are aligned in opposite directions, the nucleobase sequence of such an oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. As described herein, nucleobase matching or complementary nucleobases are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (G). m C) and guanine (G), unless otherwise stated. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at every nucleoside and may include one or more nucleobase mismatches. In contrast, “perfectly complementary” or “100% complementary” regarding oligonucleotides means that such oligonucleotides have nucleobase matches at every nucleoside without any nucleobase mismatches.
[0084] A "conjugation group" refers to a set of atoms attached to an oligonucleotide. A conjugation group includes the conjugation moiety and the conjugation linker that attaches the conjugation moiety to the oligonucleotide.
[0085] "Conjugate linker" refers to a group of atoms that contains at least one bond that links the conjugate portion to an oligonucleotide.
[0086] "Conjugate portion" refers to a group of atoms attached to an oligonucleotide via a conjugate linker.
[0087] In the context of oligonucleotides, "continuous" refers to nucleosides, nucleobases, sugar moieties, or links between nucleosides that are adjacent to each other. For example, "continuous nucleobases" means nucleobases that are adjacent to each other in the sequence.
[0088] "Design" or "designed to" refers to the process of designing compounds that specifically hybridize with selected nucleic acid molecules.
[0089] "Diluent" refers to a component in a composition that lacks pharmacological activity but is pharmaceutically necessary or desired. For example, a diluent in an injectable composition can be a liquid, such as a saline solution.
[0090] "Different modifications" means chemical modifications or substituents that are different from each other, including the absence of modification. Therefore, for example, MOE nucleotides and unmodified DNA nucleotides are "different modifications," even though the DNA nucleotide is unmodified. Similarly, DNA and RNA are "different modifications," even if both are naturally occurring unmodified nucleotides. Nucleosides that are identical except for containing different nucleobases are not different modifications. For example, a nucleotide containing a 2'-OMe modified sugar and an unmodified adenine nucleobase is not different from a nucleotide containing a 2'-OMe modified sugar and an unmodified thymine nucleobase.
[0091] "Dosage" means the specified amount of a compound or agent delivered in a single administration or over a specified period of time. In some embodiments, the dosage may be administered in the form of two or more pills, tablets, or injections. For example, in some embodiments, where subcutaneous administration is desired, the desired dosage may require a volume that is not easily provided by a single injection. In such embodiments, two or more injections may be used to achieve the desired dosage. In some embodiments, the dosage may be administered in two or more injections to minimize injection site reactions in the individual. In other embodiments, the compound or agent is administered by infusion over an extended period of time or continuously. Dosage may be specified as the amount of agent per hour, day, week, or month.
[0092] A "dosing regimen" is a combination of doses designed to achieve one or more desired effects.
[0093] "Double-stranded antisense compound" means an antisense compound comprising two oligomers that are complementary to each other and form a double strand, wherein one of the two oligomers comprises an oligonucleotide.
[0094] "Effective dose" refers to the amount of compound sufficient to achieve the desired physiological outcome in an individual who requires the compound. Effective doses can vary between individuals depending on the health and physical condition of the individual to be treated, the individual's taxonomy, the formulation of the composition, the assessment of the individual's medical symptoms, and other relevant factors.
[0095] "Efficacy" refers to the ability to produce the desired effect.
[0096] "Expression" encompasses all functions that translate the coding information of genes into structures that exist and function within the cell. Such structures include, but are not limited to, the products of transcription and translation.
[0097] A "gapmer" refers to an oligonucleotide containing an internal region of multiple nucleotides that supports RNase H cleavage between an external region containing one or more nucleotides. These nucleotides containing the internal regions are chemically distinct from the one or more nucleotides containing the external regions. The internal regions can be called "gap" and the external regions can be called "wings".
[0098] "Hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to specific mechanisms, the most common hybridization mechanisms involve hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding. In some embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets.
[0099] "Closely adjacent" means that there are no intervening elements between adjacent elements of the same kind (e.g., there are no intervening nuclei between adjacent nuclei).
[0100] "Individual" refers to a person or non-human animal that chooses to use for treatment or therapy.
[0101] "Inhibition of expression or activity" refers to a reduction or blockage of expression or activity relative to the expression or activity in untreated or control samples, and does not necessarily indicate complete elimination of expression or activity.
[0102] "Nucleoside linkage" refers to a group or bond that forms a covalent link between adjacent nucleosides in an oligonucleotide. "Modified nucleoside linkage" refers to any nucleoside linkage other than naturally occurring phosphate-based nucleoside linkages. Non-phosphate linkages here refer to modified nucleoside linkages.
[0103] "Elongated oligonucleotides" are those that have one or more additional nucleosides relative to the oligonucleotides disclosed herein (e.g., the parent oligonucleotide).
[0104] "Connected nucleosides" refers to adjacent nucleosides that are linked together through inter-nucleosides.
[0105] "Linker-nucleoside" refers to the nucleoside that links an oligonucleotide to the conjugate moiety. The linker-nucleoside is located within the conjugate linker of the compound. Linker-nucleosides are not considered part of the oligonucleotide moiety of the compound (even if they are adjacent to the oligonucleotide).
[0106] "Mismatch" or "non-complementary" means that when the first and second oligonucleotides are aligned, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid. For example, a nucleobase (including but not limited to universal nucleobases, inosine, and hypoxanthine) can hybridize with at least one nucleobase, but is still mismatched or non-complementary relative to the nucleobase it hybridizes with. As another example, when the first and second oligonucleotides are aligned, the nucleobases of the first oligonucleotide that cannot hybridize with the corresponding nucleobases of the second oligonucleotide or the target nucleic acid are mismatched or non-complementary nucleobases.
[0107] "Regulation" refers to altering or adjusting characteristics in cells, tissues, organs, or organisms. For example, regulating PNPLA3 RNA can mean increasing or decreasing the levels of PNPLA3 RNA and / or PNPLA3 protein in cells, tissues, organs, or organisms. A "regulator" achieves this change in the cell, tissue, organ, or organism. For example, a PNPLA3 compound can be a regulator that decreases the amount of PNPLA3 RNA and / or PNPLA3 protein in cells, tissues, organs, or organisms.
[0108] “MOE” means oxyethyl.
[0109] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.
[0110] "Motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or nucleosides linked together in an oligonucleotide.
[0111] "Natural" or "naturally occurring" means found in nature.
[0112] "Non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" refers to a modified sugar moiety that contains modifications (such as substitutions) that do not form a bridge between the two atoms of the sugar to form a second ring.
[0113] Nucleic acids are molecules composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
[0114] "Nucleobase" refers to a heterocyclic moiety that can pair with a base of another nucleic acid. As used herein, "naturally occurring nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). "Modified nucleobases" are naturally occurring nucleobases that have been chemically modified. "Universal bases" or "universal nucleobases" are nucleobases other than naturally occurring and modified nucleobases, and can pair with any nucleobase.
[0115] "Nucleobase sequence" refers to the sequence of consecutive nucleobases in a nucleic acid or oligonucleotide that is independent of any sugar or nucleoside linkage.
[0116] "Nucleoside" refers to a compound that contains a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either unmodified or modified independently. "Modified nucleoside" refers to a nucleoside that contains a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abase-free nucleosides lacking a nucleobase.
[0117] "Oligomer" means a compound that contains a single oligonucleotide and optionally one or more other features (such as conjugation groups or terminal groups).
[0118] "Oligonucleotide" refers to a polymer of linked nucleosides, each of which may be independently modified or unmodified. Unless otherwise stated, an oligonucleotide consists of 8-80 linked nucleosides. "Modified oligonucleotide" means an oligonucleotide in which at least one sugar, nucleobase, or inter-nucleoside linkage is modified. "Unmodified oligonucleotide" means an oligonucleotide that does not contain any sugar, nucleobase, or inter-nucleoside modification.
[0119] "Mother oligonucleotide" refers to an oligonucleotide whose sequence is used as the design basis for more oligonucleotides with similar sequences but different lengths, motifs, and / or chemistry. The newly designed oligonucleotides may have the same or overlapping sequences as the parent oligonucleotide.
[0120] "Parenteral administration" means administration by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration (e.g., intrathecal or intraventricular administration).
[0121] "Potatoprotein-like 3 containing a phospholipase domain," abbreviated as PNPLA3, also known as lipotrophic protein (ADPN), acylglycerol O-acyltransferase, calcium-independent phospholipase A2-ε (iPLA2-ε), putative protein dJ796I17.1, or DJ796I17.1, is a 481-amino acid protein encoded by the Pnpla3 gene. PNPLA3 possesses hydrolytic activity against triglycerides and retinyl esters, promoting lipid droplet remodeling in hepatocytes and hepatic stellate cells. As described herein, PNPLA3 is a member of the potato glycoprotein-like family containing a phospholipase domain, expressed in the ER and on lipid droplets. In humans, PNPLA3 is highly expressed in the liver. As used herein, "PNPLA3" can refer to any nucleic acid or protein of PNPLA3. "PNPLA3 nucleic acid" means any nucleic acid encoding PNPLA3. For example, in some embodiments, the PNPLA3 nucleic acid includes a DNA sequence encoding PNPLA3, an RNA sequence transcribed from the DNA encoding PNPLA3 (including genomic DNA containing introns and exons), and an mRNA sequence encoding PNPLA3. "PNPLA3 mRNA" refers to the mRNA encoding the PNPLA3 protein. Targets can be indicated using uppercase or lowercase letters.
[0122] "PNPLA3-specific inhibitors" refer to any reagent that can specifically inhibit the expression or activity of PNPLA3 RNA and / or PNPLA3 protein at the molecular level. For example, PNPLA3-specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, and other reagents that can inhibit the expression of PNPLA3 RNA and / or PNPLA3 protein.
[0123] "Pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to an individual. For example, a pharmaceutically acceptable carrier could be a sterile aqueous solution, such as PBS or water for injection.
[0124] "Pharmaceutical acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound (such as an oligomer or oligonucleotide), that is, a salt that retains the desired biological activity of the parent compound without imparting undesirable toxicological effects to it.
[0125] "Pharmaceutical" means a compound that provides therapeutic benefits when administered to an individual.
[0126] "Pharmaceutical composition" means a mixture of substances suitable for individual administration. For example, a pharmaceutical composition may contain one or more compounds or salts thereof and a sterile aqueous solution.
[0127] "Thiophosphate linkage" refers to a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced by a sulfur atom. Thiophosphate nucleoside linkages are modified nucleoside linkages.
[0128] "Phosphorus moiety" refers to a group of atoms containing phosphorus atoms. In some embodiments, the phosphorus moiety includes mono-, di-, or tri-phosphates, or thiophosphates.
[0129] "Partial" refers to a defined number of consecutive (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a partial is a defined number of consecutive nucleobases of a target nucleic acid. In some embodiments, a partial is a defined number of consecutive nucleobases of an oligomer.
[0130] "Prevention" refers to delaying or preventing the onset, development, or progression of a disease, disorder, or condition, for a period ranging from minutes to indefinite periods.
[0131] "Prodrug" refers to a compound in an in vitro form that, when administered to an individual, is metabolized into another form within the body or cells. In some embodiments, the metabolized form is the active or more active form of the compound (e.g., a drug). Typically, the conversion of prodrugs in the body is facilitated by the action of one or more enzymes (e.g., endogenous or viral enzymes) or one or more chemicals present in cells or tissues, and / or by physiological conditions.
[0132] "Reduction" means to reduce to a smaller extent, scale, quantity, or number.
[0133] "RefSeq No." is a unique combination of letters and numbers assigned to a sequence, indicating that the sequence is for a specific target transcript (e.g., a target gene). This sequence and information about the target gene (collectively referred to as a gene record) can be found in genetic sequence databases. Genetic sequence databases include the NCBI Reference Sequence Database, GenBank, the European Nucleotide Archive, and the Japan DNA Database (the latter three forming the International Nucleotide Sequence Database Consortium or INSDC).
[0134] A “region” is defined as a portion of a target nucleic acid that has at least one identifiable structure, function, or feature.
[0135] "RNAi compounds" refers to antisense compounds that function at least partially through RISC or Ago2 rather than through RNase H to regulate target nucleic acids and / or proteins encoded by the target nucleic acids. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs (including microRNA mimics).
[0136] A “segment” is defined as a smaller region or sub-region within a nucleic acid.
[0137] "Side effects" refers to physiological disorders and / or conditions attributable to the treatment, other than the desired effect. In some embodiments, side effects include injection site reactions, abnormal liver function tests, abnormal kidney function, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, muscle disorders, and discomfort. For example, an increase in serum transaminase levels can indicate hepatotoxicity or abnormal liver function. For example, an increase in bilirubin can indicate hepatotoxicity or abnormal liver function.
[0138] The term "single-chain" in the context of a compound means that the compound contains only one type of oligonucleotide. "Self-complementary" means that the oligonucleotide hybridizes at least partially with itself. A compound consisting of a single oligonucleotide (where the oligonucleotides in the compound are self-complementary) is a single-chain compound. Single-chain compounds can combine with complementary compounds to form double-chain compounds.
[0139] A "site" is defined as a unique nucleobase location within a target nucleic acid.
[0140] "Specific hybridization" refers to an oligonucleotide having sufficient complementarity with the target nucleic acid to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids. In some embodiments, specific hybridization occurs under physiological conditions.
[0141] The term "specific inhibition" of target nucleic acids refers to reducing or blocking the expression of target nucleic acids when they show little, minimal, or no effect on non-target nucleic acids. Reduction does not necessarily indicate complete elimination of target nucleic acid expression.
[0142] "Standard cell assay" means one or more assays and their reasonable variations as described in the examples.
[0143] "Standard in vivo experiment" means one or more procedures and their reasonable variations described in one or more instances.
[0144] In the context of a group of molecules with the same molecular formula, a "stereorandomchiral center" refers to a chiral center with a random stereochemical configuration. For example, in a group of molecules containing a stereorandomchiral center, the number of molecules with the (S) configuration may, but is not necessarily, the same as the number of molecules with the (R) configuration. The stereochemical configuration of the chiral center is considered random when it is the result of a synthetic method not designed to control the stereochemical configuration. In some embodiments, the stereorandomchiral center is a stereorandom linker between phosphate thioester nucleosides.
[0145] "Sugar moiety" means an unmodified or modified sugar moiety. "Unmodified sugar moiety" or "unmodified sugar" means a 2'-OH(H) ribosyl moiety found in RNA ("unmodified RNA sugar moiety") or a 2'-H(H) moiety found in DNA ("unmodified DNA sugar moiety"). "Modified sugar moiety" or "modified sugar" means a modified furanyl sugar moiety or sugar substitute. "Modified furanyl sugar moiety" means a furanyl sugar containing at least one non-hydrogen substituent for a hydrogen or hydroxyl group in place of the unmodified sugar moiety. In some embodiments, the modified furanyl sugar moiety is a 2'-substituted sugar moiety. Such modified furanyl sugar moieties include dicyclic and non-dicyclic sugars.
[0146] "Sugar substitute" refers to a modified sugar moiety that differs from the furanyl group, allowing the nucleobase to be linked to another group (such as an internucleotide linker, conjugation group, or terminal group in oligonucleotides). Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary compounds or nucleic acids.
[0147] "Synergy" or "synergize" refers to the combined effect being greater than the sum of the effects of the individual components at the same dosage.
[0148] "Target gene" refers to the gene that encodes the target.
[0149] "Targeting" refers to the specific hybridization of a compound with a target nucleic acid in order to achieve the desired effect.
[0150] "Target nucleic acid", "target RNA", "target RNA transcript" and "nucleic acid target" all refer to nucleic acids that can be targeted by the compounds described in this article.
[0151] "Target region" refers to the portion of the nucleic acid targeted by one or more compounds.
[0152] "Target region" refers to the nucleotide sequence of the target nucleic acid to which the compound targets. "5' target site" refers to the 5th nucleotide of the target region. "3' target site" refers to the 3rd nucleotide of the target region.
[0153] "Terminal group" refers to a chemical group or set of atoms that is covalently attached to the end of an oligonucleotide.
[0154] "Therapeutic effective amount" refers to the amount of a compound, drug, or composition that provides therapeutic benefit to an individual.
[0155] "Treatment" refers to the administration of a compound or pharmaceutical composition to an animal in order to alter or improve the animal's disease, disorder, or ailment.
[0156] Some embodiments
[0157] Some embodiments provide methods, compounds, and compositions for inhibiting PNPLA3 (PNPLA3) expression.
[0158] Some embodiments provide compounds targeting PNPLA3 nucleic acids. In some embodiments, the PNPLA3 nucleic acid has sequences listed in the following: RefSeq or GENBANK accession number NM_025225.2 (disclosed herein as SEQ ID NO: 1 by reference, incorporated herein by reference); NC_000022.11 truncated from nucleotides 43921001 to 43954500 (disclosed herein as SEQ ID NO: 2 by reference, incorporated herein by reference); AK123806.1 (disclosed herein as SEQ ID NO: 3 by reference, incorporated herein by reference); BQ686328.1 (disclosed herein as SEQ ID NO: 4 by reference, incorporated herein by reference); BF762711.1 (disclosed herein as SEQ ID NO: 5 by reference, incorporated herein by reference); DA290491.1 (disclosed herein as SEQ ID NO: 6 by reference, incorporated herein by reference); and sequences listed as SEQ ID NO: 7, 8, 9, and 10. In some embodiments, the compound is an antisense compound or an oligomer. In some embodiments, the compound is single-chained. In some embodiments, the compound is double-chained.
[0159] In some embodiments, the compound comprises a modified oligonucleotide of 16 linked nucleosides. In some embodiments, the compound is an antisense compound or an oligomer.
[0160] Some embodiments provide compounds comprising modified oligonucleotides, the modified oligonucleotides being 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 17-2169. In some embodiments, the compound is an antisense compound or an oligomeric compound. In some embodiments, the compound is single-stranded. In some embodiments, the compound is double-stranded. In some embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides.
[0161] Some embodiments provide compounds comprising modified oligonucleotides consisting of the nucleobase sequences of any one of SEQ ID NO: 17-2169. In some embodiments, the compound is an antisense compound or an oligomeric compound. In some embodiments, the compound is single-stranded. In some embodiments, the compound is double-stranded.
[0162] Some embodiments provide compounds comprising modified oligonucleotides of 12 to 30 linked nucleotides and complementary to the nucleosides 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, and 25844-25912 of SEQ ID NO: 2, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. In some embodiments, the compound is an antisense compound or an oligomeric compound. In some embodiments, the compound is single-stranded. In some embodiments, the compound is double-stranded. In some embodiments, the modified oligonucleotide is of 16 to 30 linked nucleotides.
[0163] In some embodiments, the compound targets nucleotides 5567-5620 of the PNPLA3 nucleic acid. In some embodiments, the compound targets nucleotides 5567-5642, 5644-5731, 5567-5731, and 5567-5620 of the PNPLA3 nucleic acid having the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the compound has at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleotide moieties that are complementary to an isometric moieties within nucleotides 5567-5642, 5644-5731, 5567-5731, and 5567-5620 of the PNPLA3 nucleic acid having the nucleotide sequence of SEQ ID NO: 2. In some embodiments, these compounds are antisense compounds, oligomers, or oligonucleotides.
[0164] In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides.
[0165] In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the modified oligonucleotide has 16 to 30 linked nucleosides.
[0166] In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.
[0167] In some embodiments, the compounds targeting PNPLA3 are ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. Of the more than 2,384 compounds screened as described in the Examples section below, ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, and 975612 appeared as leading lead compounds.
[0168] In some embodiments, any of the modified oligonucleotides described above comprises at least one modified nucleoside linker, at least one modified sugar, and / or at least one modified nucleobase.
[0169] In some embodiments, any of the modified oligonucleotides described above comprises at least one modified sugar. In some embodiments, the at least one modified sugar comprises a 2'-O-methoxyethyl group. In some embodiments, the at least one modified sugar is a dicyclic sugar, such as a 4'-CH(CH3)-O-2' group, a 4'-CH2-O-2' group, or a 4'-(CH2)2-O-2' group.
[0170] In some embodiments, the modified oligonucleotide contains at least one modified nucleoside linker, such as a phosphate thioside linker.
[0171] In some embodiments, any of the modified oligonucleotides described above contains at least one modified nucleobase, such as 5-methylcytosine.
[0172] In some embodiments, any of the modified oligonucleotides described above comprises:
[0173] A gap segment composed of linked deoxynucleosides;
[0174] The 5' wing segment composed of linked nucleosides; and
[0175] The 3' wing segment composed of linked nucleosides;
[0176] The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside in each wing segment contains a modified sugar. In some embodiments, the modified oligonucleotide is 12 to 30 linked nucleosides and has a nucleobase sequence comprising any one of the sequences listed in SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the modified oligonucleotide is 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of the sequences listed in SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the modified oligonucleotide is 16 linked nucleosides and has a nucleobase sequence consisting of any one of the sequences listed in SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899.
[0177] In some embodiments, the compound comprises or is composed of a modified oligonucleotide, the modified oligonucleotide being 12-30 linked nucleobases long and having a nucleobase sequence comprising the sequence listed in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises
[0178] A gap segment consisting of ten linked deoxynucleotides;
[0179] The 5' wing region consisting of three linked nucleosides; and
[0180] The 3' wing segment consists of three linked nucleosides;
[0181] The notched region is located between the 5' wing and the 3' wing, wherein each nucleoside in each wing contains a cEt sugar; wherein each nucleoside linkage is a phosphate thioester linkage and wherein each cytosine is 5-methylcytosine. In some embodiments, the modified oligonucleotide consists of 16-30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
[0182] In some embodiments, the compound comprises or is composed of a modified oligonucleotide, wherein the modified oligonucleotide is 16 linked nucleosides and consists of the sequence of SEQ ID NO: 1089, wherein the modified oligonucleotide comprises:
[0183] A gap segment consisting of ten linked deoxynucleotides;
[0184] The 5' wing region consisting of three linked nucleosides; and
[0185] The 3' wing segment consists of three linked nucleosides;
[0186] The notched segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside in each wing segment contains a cEt sugar; wherein the linkage between each nucleoside is a thiophosphate linkage; and wherein each cytosine is a 5-methylcytosine.
[0187] In some embodiments, the compound comprises a modified oligonucleotide and a conjugation group, wherein the modified oligonucleotide is 16 linked nucleosides and consists of the sequence of SEQ ID NO: 1089, wherein the modified oligonucleotide comprises:
[0188] A gap segment consisting of ten linked deoxynucleotides;
[0189] The 5' wing region consisting of three linked nucleosides; and
[0190] The 3' wing segment consists of three linked nucleosides;
[0191] The notched region is located between the 5' wing and the 3' wing, wherein each nucleoside in each wing contains a cEt sugar; wherein the linkage between each nucleoside is a phosphate thioester linkage; wherein each cytosine is 5-methylcytosine; and wherein the conjugation group is located at the 5' end of the modified oligonucleotide and is
[0192]
[0193] In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with SEQ ID NO: 115. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with any one of SEQ ID NO: 2170-2172.
[0194] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises the sequence of SEQ ID NO: 115, wherein the modified oligonucleotide comprises:
[0195] A gap segment consisting of ten linked deoxynucleotides;
[0196] The 5' wing region consisting of three linked nucleosides; and
[0197] The 3' wing segment consists of three linked nucleosides;
[0198] The notched region is located between the 5' wing and the 3' wing, wherein each nucleoside in each wing contains a cEt sugar; wherein each nucleoside link is a phosphate thioester link; and wherein each cytosine is 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual further comprises a conjugation group, wherein the conjugation group is located at the 5' end of the modified oligonucleotide and is
[0199]
[0200] In some embodiments, the compound comprises or consists of ION 916333 or a salt thereof, wherein ION 916333 or a salt thereof has the following chemical structure:
[0201]
[0202] In some embodiments, the compound comprises or consists of ION 975616 or a salt thereof, which has the following chemical structure:
[0203]
[0204] In some embodiments, the compound comprises or is composed of a sodium salt of 975616, the sodium salt of which has the following chemical structure:
[0205]
[0206] In some embodiments, the compound comprises or consists of ION 975613 or a salt thereof, which has the following chemical structure:
[0207]
[0208] In some embodiments, the compound comprises or is composed of a sodium salt of ION 975613, which has the following chemical structure:
[0209]
[0210] In some embodiments, the compound comprises or consists of ION 975612 or a salt thereof, which has the following chemical structure:
[0211]
[0212] In some embodiments, the compound comprises or is composed of a sodium salt of ION 975612, which has the following chemical structure:
[0213]
[0214] In some embodiments, the compound comprises or consists of ION 916789 or a salt thereof, which has the following chemical structure:
[0215]
[0216] In some embodiments, the compound comprises or is composed of a sodium salt of ION 916789, which has the following chemical structure:
[0217]
[0218] In some embodiments, the compound comprises or consists of ION 916602 or a salt thereof, wherein ION 916602 or a salt thereof has the following chemical structure:
[0219]
[0220] In some embodiments, the compound comprises or is composed of a sodium salt of ION 916602, the sodium salt of ION 916602 having the following chemical structure:
[0221]
[0222] In any of the above embodiments, the compound or oligonucleotide may be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the nucleic acid encoding PNPLA3.
[0223] In any of the above embodiments, the compound may be single-stranded. In some embodiments, the compound comprises deoxyribonucleotides. In some embodiments, the compound is double-stranded. In some embodiments, the compound is double-stranded and comprises ribonucleotides. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.
[0224] In any of the above embodiments, the length of the compound may be 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In some embodiments, the compound comprises or is composed of oligonucleotides.
[0225] In some embodiments, the compound comprises the modified oligonucleotide described herein and a conjugation group. In some embodiments, the conjugation group is attached to the 5' end of the modified oligonucleotide. In some embodiments, the conjugation group is attached to the 3' end of the modified oligonucleotide. In some embodiments, the conjugation group comprises at least one N-acetylgalactosamine (GalNAc), at least two N-acetylgalactosamines (GalNAc), or at least three N-acetylgalactosamines (GalNAc).
[0226] In some embodiments, the compounds or compositions provided herein comprise a pharmaceutically acceptable salt of the modified oligonucleotide. In some embodiments, the salt is a sodium salt. In some embodiments, the salt is a potassium salt.
[0227] In some embodiments, compounds or compositions as described herein are preferred due to having an in vitro IC50 concentration of less than 2 μM, less than 1.5 μM, less than 1 μM, less than 0.9 μM, less than 0.8 μM, less than 0.7 μM, less than 0.6 μM, less than 0.5 μM, less than 0.4 μM, less than 0.3 μM, less than 0.2 μM, less than 0.1 μM, less than 0.05 μM, less than 0.04 μM, less than 0.03 μM, less than 0.02 μM, or less than 0.01 μM. 50 At least one of them is active.
[0228] In some embodiments, the compounds or compositions described herein are highly tolerable, as demonstrated by an increase of no more than 4-fold, 3-fold, or 2-fold relative to control animal alanine aminotransferase (ALT) or aspartate aminotransferase (AST) values, or an increase of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2% in liver, spleen, or kidney weight relative to control animals. In some embodiments, the compounds or compositions described herein are highly tolerable, as demonstrated by no increase in ALT or AST relative to control animals. In some embodiments, the compounds or compositions described herein are highly tolerable, as demonstrated by no increase in liver, spleen, or kidney weight relative to control animals.
[0229] Some embodiments provide compositions comprising any one of the compounds mentioned in the foregoing embodiments or any pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable carrier or diluent. In some embodiments, the composition has a viscosity of less than about 40 centipoise (cP), less than about 30 centipoise (cP), less than about 20 centipoise (cP), less than about 15 centipoise (cP), or less than about 10 centipoise (cP). In some embodiments, the composition having any of the aforementioned viscosities comprises a concentration of the compound provided herein of about 100 mg / mL, about 125 mg / mL, about 150 mg / mL, about 175 mg / mL, about 200 mg / mL, about 225 mg / mL, about 250 mg / mL, about 275 mg / mL, or about 300 mg / mL. In some embodiments, the composition having any of the aforementioned viscosities and / or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.
[0230] Certain indications
[0231] Some embodiments provided herein relate to methods for inhibiting PNPLA3 expression, which can be used to treat, prevent, or alleviate PNPLA3-related diseases in an individual by administering a compound that targets PNPLA3. In some embodiments, the compound may be a PNPLA3-specific inhibitor. In some embodiments, the compound may be an antisense compound, oligomeric compound, or oligonucleotide that targets PNPLA3.
[0232] Examples of PNPLA3-associated diseases that can be treated, prevented, and / or alleviated using the methods described herein include liver disease, NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. Certain compounds described herein relate to compounds and compositions that reduce liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic fat accumulation in animals.
[0233] In some embodiments, a method of treating, preventing, or alleviating a PNPLA3-associated disease in an individual includes administering to the individual a compound comprising a PNPLA3-specific inhibitor to treat, prevent, or alleviate the disease. In some embodiments, the individual is identified as having a PNPLA3-associated disease or at risk of developing the disease. In some embodiments, the disease is liver disease. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-chain or double-chain. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In some embodiments, the compound is administered parenterally to an individual. In some embodiments, administration of the compound improves, maintains, or prevents liver injury, steatosis, liver fibrosis, cirrhosis, elevated transaminases, or hepatic steatosis in animals.
[0234] In some embodiments, methods of treating, preventing, or alleviating liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis in animals include administering to an individual a compound comprising a PNPLA3-specific inhibitor to treat, prevent, or alleviate liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In some embodiments, the compound is administered parenterally to an individual. In some embodiments, administration of the compound improves, maintains, or prevents liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis. In some embodiments, the individual is identified as having a disease associated with PNPLA3 or at risk of developing the disease.
[0235] In some embodiments, the method of inhibiting PNPLA3 expression in an individual suffering from or at risk of a PNPLA3-associated disease includes administering a compound comprising a PNPLA3-specific inhibitor to the individual, thereby inhibiting PNPLA3 expression in that individual. In some embodiments, the compound is administered to inhibit PNPLA3 expression in the liver. In some embodiments, the disease is a liver disease. In some embodiments, the individual suffers from or is at risk of suffering from: NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the individual suffers from or is at risk of suffering from: liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides of any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequences of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence comprising any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.In some embodiments, the compound is administered parenterally to an individual. In some embodiments, administration of the compound improves, maintains, or prevents liver damage, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or fatty accumulation in the liver.
[0236] In some embodiments, a method of inhibiting PNPLA3 expression in cells includes contacting the cells with a compound containing a PNPLA3-specific inhibitor, thereby inhibiting PNPLA3 expression in the cells. In some embodiments, the cells are hepatocytes. In some embodiments, the cells are located in the liver. In some embodiments, the cells are located in the liver of an individual who has or is at risk of having liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis. In some embodiments, the compound contains an antisense compound that targets PNPLA3. In some embodiments, the compound contains an oligonucleotide that targets PNPLA3. In some embodiments, the compound contains a modified oligonucleotide of 12 to 30 linked nucleosides and has a nucleobase sequence of at least 8 consecutive nucleosides containing any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.
[0237] In some embodiments, a method of reducing or inhibiting liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis in an individual suffering from or at risk of a PNPLA3-associated disease includes administering to the individual a compound comprising a PNPLA3-specific inhibitor, thereby reducing or inhibiting the individual's liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic steatosis. In some embodiments, the individual suffers from or is at risk of suffering from: NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8 consecutive nucleosides of any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and has a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide of 16 to 30 linked nucleosides and has a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In some embodiments, the compound is administered parenterally to an individual.In some embodiments, the individual is identified as having a disease associated with PNPLA3 or at risk of developing the disease.
[0238] Some embodiments relate to compounds comprising a PNPLA3-specific inhibitor for use in the treatment of diseases associated with PNPLA3. In some embodiments, the disease is NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides of any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound. In some embodiments, the compound is administered parenterally to an individual.
[0239] Some embodiments involve compounds comprising a PNPLA3-specific inhibitor for reducing or inhibiting liver injury, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic fat accumulation in an individual who has or is at risk of having NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides of any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.
[0240] Some embodiments relate to the use of compounds comprising a PNPLA3-specific inhibitor for the manufacture or preparation of a medicament for treating diseases associated with PNPLA3. Some embodiments relate to the use of compounds comprising a PNPLA3-specific inhibitor for the preparation of a medicament for treating diseases associated with PNPLA3. In some embodiments, the disease is a liver disease. In some embodiments, the disease is NAFLD, hepatic steatosis, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleosides of any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-stranded or double-stranded. In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.
[0241] Some embodiments relate to the use of compounds comprising PNPLA3-specific inhibitors in the manufacture or preparation of medicaments for reducing or inhibiting liver damage, steatosis, liver fibrosis, liver inflammation, liver scarring or cirrhosis, liver failure, hepatomegaly, elevated transaminases, or hepatic fat accumulation in individuals suffering from or at risk of developing PNPLA3-related liver disease. In some embodiments, the liver disease is NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. Some embodiments relate to the use of compounds comprising PNPLA3-specific inhibitors in the preparation of medicaments for treating diseases associated with PNPLA3. In some embodiments, the disease is NAFLD, hepatic steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the compound comprises an antisense compound targeting PNPLA3. In some embodiments, the compound comprises an oligonucleotide targeting PNPLA3. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and a nucleobase sequence comprising at least 8 consecutive nucleosides comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and a nucleobase sequence comprising any one of the nucleobase sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide consisting of a nucleobase sequence of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In any of the above embodiments, the compound may be single-chain or double-chain.In any of the above embodiments, the compound may be an antisense compound or an oligomeric compound.
[0242] In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with SEQ ID NO: 115. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with any one of SEQ ID NO: 2170-2172.
[0243] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises the sequence of SEQ ID NO: 115, wherein the modified oligonucleotide comprises:
[0244] A gap segment consisting of ten linked deoxynucleotides;
[0245] The 5' wing region consisting of three linked nucleosides; and
[0246] The 3' wing segment consists of three linked nucleosides;
[0247] The notched region is located between the 5' wing and the 3' wing, wherein each nucleoside in each wing contains a cEt sugar; wherein each nucleoside link is a phosphate thioester link; and wherein each cytosine is 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual further comprises a conjugation group, wherein the conjugation group is located at the 5' end of the modified oligonucleotide and is
[0248]
[0249] Some PNPLA3 variants
[0250] Other embodiments of this disclosure relate to individuals having certain variants of potato glycoprotein-like 3 (PNPLA3) containing a phospholipase domain. A mutation in the isoleucine-to-methionine ratio at position 148 of the PNPLA3 protein (referred herein to as “PNPLA3 I148M”, “I148M”, “148I allele variant”, or “PNPLA3 rs738409 polymorphism”; amino acid residue numbered relative to human PNPLA3) may be an important genetic determinant of nonalcoholic steatohepatitis (NASH). The PNPLA3 I148M mutant protein exhibits reduced enzymatic activity. Certain treatments (such as the compounds described herein) have been found to be surprisingly effective in treating liver disease in individuals (e.g., human patients) with the PNPLA3 I148M mutation. As used in this article, "having" or "with" the I148M mutation in PNPLA3 means that the individual has a mutation in the nucleotide sequence of the gene encoding PNPLA3 that corresponds to the substitution of isoleucine to methionine at position 148 of the PNPLA3 protein.
[0251] In some embodiments, this disclosure provides a method of treating an individual who has liver disease or is at risk of developing liver disease, the method comprising administering a compound targeting PNPLA3 to the individual, wherein the individual has an I148M mutation in PNPLA3.
[0252] In some embodiments, treating an individual with liver disease means slowing or stopping the progression of the disease. In some embodiments, treating an individual with liver disease means that the individual's liver recovers from a diseased state to a normal healthy state, for example, as measured by the amount of liver lipids and / or scar tissue, and / or liver function compared to a healthy individual. In some embodiments, when an individual with a PNPLA3 I148M mutation and liver disease is treated with this method, the individual's liver lipids do not increase significantly. In some embodiments, the method reduces an individual's liver lipids by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%. Methods for determining the amount of liver lipids are known to those skilled in the art and include, for example, Oil Red O staining of liver biopsy, magnetic resonance spectroscopy (MRS), and lipoprotein subfraction determination.
[0253] In some embodiments, when an individual with a PNPLA3 I148M mutation and liver disease is treated with this method, the individual's liver scar tissue does not increase significantly. Methods for determining the amount of liver scar tissue are known to those skilled in the art. In some embodiments, the method reduces an individual's liver scar tissue by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100%. Methods for determining the amount of scar tissue are known to those skilled in the art and include, for example, imaging tests such as ultrasound, computed tomography (CT), magnetic resonance imaging (MRI), ultrasound elastography, magnetic resonance elastography, and / or acoustic radiation force pulse imaging; blood tests; and liver biopsy.
[0254] In some embodiments, when an individual with a PNPLA3 I148M mutation and liver disease is treated with this method, the individual's liver function does not decrease significantly. In some embodiments, the individual's liver function increases after treatment with this method. In some embodiments, the individual's liver function increases by about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% after treatment with this method. In some embodiments, the individual's liver function is about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or greater than 99% of the liver function of a healthy individual after treatment with this method. Methods for measuring liver function are known to those skilled in the art and include, for example, measuring the levels of one or more of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), albumin, and bilirubin.
[0255] In some embodiments, treating an individual at risk of developing liver disease means preventing or reducing the individual’s likelihood of developing the disease, for example, by reducing liver lipids and / or scar tissue, or any other compound (e.g., protein, polynucleotide) that may cause or exacerbate the development of liver disease.
[0256] This article describes examples of liver diseases, including, for example, those associated with PNPLA3. In some embodiments, the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), hepatic steatosis, non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. In some embodiments, the liver disease is hepatic steatosis. In some embodiments, when administered to an individual with the I148M mutation in PNPLA3, the method provides a highly effective treatment for liver diseases such as hepatic steatosis.
[0257] In some embodiments, this disclosure provides a method for reducing one or more of liver injury, hepatic steatosis, liver inflammation, liver fibrosis, and hepatic steatosis in an individual, the method comprising administering a compound targeting PNPLA3 to the individual, wherein the individual has an I148M mutation in PNPLA3. In some embodiments, the method reduces or inhibits liver inflammation. In some embodiments, the method reduces or inhibits liver fibrosis.
[0258] In some embodiments, treating an individual's liver disease includes reducing one or more of liver damage, hepatic steatosis, liver inflammation, liver fibrosis, and hepatic steatosis. Examples of liver diseases are described herein. In some embodiments, the method is highly effective in reducing one or more of liver damage, hepatic steatosis, liver inflammation, liver fibrosis, and hepatic steatosis in individuals with the I148M mutation in PNPLA3. In some embodiments, the method is highly effective in reducing hepatic steatosis, liver inflammation, and liver fibrosis in individuals with the I148M mutation in PNPLA3.
[0259] In some embodiments, reducing or suppressing liver inflammation includes lowering the level of hepatic macrophages. The level of hepatic macrophages can be quantified, for example, by immunohistochemical staining for macrophage antigen 2 (Mac2, which is expressed on the surface of inflammatory macrophages). In some embodiments, the level of hepatic macrophages is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% relative to individuals who have not been administered the compound targeting PNPLA3, as measured by immunohistochemical staining (e.g., immunohistochemical staining for Mac2) of liver sections from the individual.
[0260] In some embodiments, reducing hepatic macrophage levels includes reducing the amount of monocyte chemokine 1 (MCP1) in the liver (e.g., hepatocytes). MCP1, also known as chemokine (CC motif) ligand 2 (CCL2) and small inducible cytokine A2, has a receptor, CC chemokine receptor 2 (CCR2), which plays a role in recruiting monocytes, dendritic cells, and macrophages to sites of liver inflammation. In some embodiments, reducing MCP1 expression in the liver can reduce hepatic macrophage levels. In some embodiments, reducing MCP1 expression in the liver can reduce liver inflammation. In some embodiments, reducing hepatic macrophage levels includes reducing the amount of haptoglobin in the liver (e.g., hepatocytes). haptoglobin is an acute-phase protein produced in the liver and adipose tissue that typically responds to inflammation, infection, and / or tissue damage. haptoglobin can attract monocytes and macrophages in part by interacting with CCR2 as described herein. In some embodiments, reducing haptoglobin expression in the liver can reduce liver inflammation.
[0261] In some embodiments, this disclosure provides a method for reducing the levels of one or more proteins of haptoglobin, MCP1, and TIMP2 in an individual, the method comprising administering to the individual a compound that targets PNPLA3, wherein the individual has an I148M mutation in PNPLA3.
[0262] This article describes haptoglobin and its role in liver inflammation. In some embodiments, the method reduces the protein level of haptoglobin in individuals with the I148M mutation in PNPLA3. In some embodiments, the method reduces the expression of haptoglobin in individuals with the I148M mutation in PNPLA3. In some embodiments, the protein level of haptoglobin is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% relative to individuals who have not been administered the compound targeting PNPLA3. Methods for measuring haptoglobin levels in samples are known to those skilled in the art and may include, for example, spectrophotometry, immunoassay, electrophoresis, etc. In some embodiments, the haptoglobin level in samples from individuals (e.g., individuals with the PNPLA3 I148M mutation) is measured by turbidity determination (e.g., using an ABX Pentra instrument). In some embodiments, the haptoglobin levels in samples from individuals (e.g., individuals with PNPLA3 I148M) are determined by colorimetric assay (e.g., PHASE). TM The range of haptoglobin colorimetric assays was used to measure it.
[0263] This article describes MCP1 and its role in liver inflammation. In some embodiments, the method reduces the protein level of MCP1 in individuals with the I148M mutation in PNPLA3. In some embodiments, the method reduces the expression of MCP1 in individuals with the I148M mutation in PNPLA3. In some embodiments, the protein level of MCP1 is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% relative to individuals who have not been administered the compound targeting PNPLA3. Methods for measuring the MCP1 level in a sample are known to those skilled in the art and may include, for example, immunoassays (e.g., ELISA), immunoblotting, electrophoresis, chromatography, etc. In some embodiments, the MCP1 protein level in a sample from an individual (e.g., an individual with the PNPLA I148M mutation) is measured by immunoblotting of a liver sample from the individual.
[0264] In some embodiments, the method reduces the protein level of TIMP2 in individuals with the I148M mutation in PNPLA3. In some embodiments, the method reduces the expression of TIMP2 in individuals with the I148M mutation in PNPLA3. Tissue inhibitor of metalloproteinases 2 (TIMP2) is a member of the TIMP family and is generally a natural inhibitor of matrix metalloproteinase (MMP) hispteptides involved in the degradation of the extracellular matrix. TIMP2 expression has been shown to be elevated in activated human hepatic stellate cells and fibrotic rat livers (see, for example, Xu et al., Gut [Enter] 54(1): 142-151, 2005; and Peng et al., Exp BiolMed [Experimental Biology and Medicine] 238(6): 668-677, 2013). Furthermore, TIMP2 can inhibit the lysosome activity of matrix metalloproteinase 2 (MMP2), which is increased in experimental models of liver fibrosis and in humans with chronic liver disease (see, for example, Lindén et al., Mol Metab [Molecular Metabolism] 22:49-61, 2019). In some embodiments, inhibition of MMP2 by TIMP2 reduces liver fibrosis. In some embodiments, the protein level of TIMP2 is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% relative to individuals who have not been administered the compound targeting PNPLA3. Methods for measuring TIMP2 levels in samples are known to those skilled in the art and may include, for example, immunoassays (e.g., ELISA), immunoblotting, electrophoresis, chromatography, etc. In some embodiments, the TIMP2 protein level in a sample from an individual (e.g., an individual with PNPLA148M) is measured by immunoblotting of a liver sample from the individual.
[0265] In some embodiments, the individual has a heterozygous I148M mutation in PNPLA3. As used herein, a "heterozygous" mutation means a mutation in one allele (the other allele is unmutated, i.e., wild-type). In some embodiments, the individual has a homozygous I148M mutation in PNPLA3. As used herein, a homozygous mutation means the same mutation in both alleles. In some embodiments, the individual has a compound heterozygous mutation at position 148 of PNPLA3. As used herein, a compound heterozygous mutation means a different mutation at each of the two alleles. For example, a compound heterozygous mutation at position 148 of PNPLA3 may comprise an I148M mutation in one allele and a different mutation in the other allele. In some embodiments, a compound heterozygous mutation at position 148 of PNPLA3 (one of the alleles being I148M) has the same phenotype as a homozygous I148M mutation in PNPLA3. In some embodiments, a compound heterozygous mutation at position 148 of PNPLA3 (one of the alleles being I148M) has a different phenotype than a homozygous or heterozygous I148M mutation in PNPLA3. In some embodiments, individuals with a PNPLA3 I148M mutation in at least one allele have an increased risk of liver disease. In some embodiments, individuals with a homozygous PNPLA3 I148M mutation have an increased risk of liver disease. In some embodiments, the methods provided herein unexpectedly provide highly effective treatment for liver disease in individuals with a PNPLA3 I148M mutation in at least one allele. In some embodiments, the methods provided herein unexpectedly provide highly effective treatment for liver disease in individuals with a homozygous PNPLA3 I148M mutation.
[0266] In some embodiments, the individual is a human individual. In some embodiments, the individual is an animal, such as a cow, horse, dog, cat, rat, or mouse. In embodiments where the individual is non-human, those skilled in the art will understand that the number of amino acid residues in PNPLA3 may differ from that in human PNPLA3. Those skilled in the art can use sequence alignment methods known in the art (e.g., BLAST, Clustal, HMMER, etc.) to determine the residue corresponding to residue 148 in human PNPLA3.
[0267] In some embodiments, the methods described herein include administering a compound targeting PNPLA3 to an individual having the I148M mutation in PNPLA3. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual is an antisense compound targeting PNPLA3. Antisense compounds are described herein. In some embodiments, the antisense compound targeting PNPLA3 with the I148M mutation in the individual is a short interfering RNA (siRNA). In some embodiments, the antisense compound targeting PNPLA3 with the I148M mutation in the individual comprises any of the following:
[0268] 5′-GGUCCUCUCAGAUCUUGUGtt-3′ (SEQ ID NO: 2170),
[0269] 5′-GGAGUGAGUGACAACGGUACtt-3′ (SEQ ID NO: 2171), or
[0270] 5'-GGUUCUUGGAAGAGAAGGGtt-3' (SEQ ID NO: 2172).
[0271] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises a modified oligonucleotide having a nucleobase sequence having about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with any one of SEQ ID NO: 2170-2172.
[0272] In some embodiments, the compound targeting PNPLA3 with the I148M mutation is an antisense oligonucleotide (ASO). ASOs are described herein. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide of 8 to 80 linked nucleosides and has a nucleotide sequence having at least 8, 9, 10, 11, or 12 consecutive nucleosides comprising any one of the nucleotide sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide of 12 to 30 linked nucleosides and has a nucleotide sequence having at least 8 consecutive nucleosides comprising any one of the nucleotide sequences of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 12 to 30 linked nucleosides and having a nucleobase sequence comprising any one of the nucleobase sequences in SEQ ID NO: 17-2169. In some embodiments, the compound comprises a modified oligonucleotide having 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899. In some embodiments, the compound is ION 975616, 994284, 975605, 994282, 975613, 975617, 975735, 975736, or 975612. In some embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence having about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with SEQ ID NO: 115.
[0273] In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobase portions that are 100% complementary to an equal-length portion of SEQ ID NO: 2, namely nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912, and wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence complementary to SEQ ID NO: 2 in the following sequences: 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912, and wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2.
[0274] In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobase portions complementary to the nucleobases 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of the PNPLA3 nucleic acid having the nucleobase sequence of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 2. In some embodiments, the compound comprises a modified oligonucleotide of 8 to 80 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising a 16-base portion complementary to an equal-length portion of nucleosides 5567-5642, 5644-5731, 5567-5731, 5567-5620, 13697-13733, 20553-20676, 20664-20824, 20553-20824, or 25844-25912 of SEQ ID NO: 2. In some embodiments, the modified oligonucleotide has a nucleobase sequence that is complementary to at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the entire length of the nucleobase sequence of SEQ ID NO: 2.
[0275] In any of the methods or uses described above, the compound can target PNPLA3. In some embodiments, the compound comprises or is composed of a modified oligonucleotide, for example, a modified oligonucleotide with 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In some embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences listed in SEQ ID NO: 1-10. In some embodiments, the modified oligonucleotide comprises at least one modified inter-nucleoside linker, at least one modified sugar, and / or at least one modified nucleobase. In some embodiments, the modified inter-nucleoside linker is a phosphate thioate nucleoside linker, the modified sugar is a dicyclic sugar or a 2'-O-methoxyethyl modified sugar, and the modified nucleobase is 5-methylcytosine. In some embodiments, the modified oligonucleotide comprises a nick segment consisting of linked deoxyribonucleotides; a 5' wing segment consisting of linked ribonucleotides; and a 3' wing segment consisting of linked ribonucleotides, wherein the nick segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, and wherein each ribonucleotide of each wing segment comprises a modified sugar.
[0276] In any of the above embodiments, the modified oligonucleotide has 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or 16 or 20 linked nucleosides. In some embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleobase sequences listed in SEQ ID NO: 1-10.
[0277] In any of the methods or uses described above, the compound comprises or is composed of a modified oligonucleotide, the modified oligonucleotide being 16 to 30 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 17-2169, wherein the modified oligonucleotide comprises:
[0278] A gap segment composed of linked 2'-deoxynucleotides;
[0279] The 5' wing segment composed of linked nucleosides; and
[0280] The 3' wing segment composed of linked nucleosides;
[0281] The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleotide in each wing segment contains a modified sugar.
[0282] In any of the methods or uses described above, the compound comprises or is composed of a modified oligonucleotide, the modified oligonucleotide having 16 linked nucleosides and having a nucleobase sequence comprising a sequence listed in any one of SEQ ID NOs: 1089, 1757, 141, 1982, 330, 1665, 408, 830, and 899, wherein the modified oligonucleotide comprises
[0283] A gap segment consisting of ten linked deoxynucleotides;
[0284] The 5' wing region consisting of three linked nucleosides; and
[0285] The 3' wing segment consists of three linked nucleosides;
[0286] The notched segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside in each wing segment contains a cEt sugar; wherein each nucleoside linkage is a phosphate thioester linkage and wherein each cytosine is a 5-methylcytosine. In some embodiments, the modified oligonucleotide has 16-30 linked nucleosides.
[0287] In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with SEQ ID NO: 115. In some embodiments, the compound targeting PNPLA3 with the I148M mutation comprises a modified oligonucleotide having a nucleobase sequence having at least 90% identity with any one of SEQ ID NO: 2170-2172.
[0288] In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual comprises the sequence of SEQ ID NO: 115, wherein the modified oligonucleotide comprises:
[0289] A gap segment consisting of ten linked deoxynucleotides;
[0290] The 5' wing region consisting of three linked nucleosides; and
[0291] The 3' wing segment consists of three linked nucleosides;
[0292] The notched region is located between the 5' wing and the 3' wing, wherein each nucleoside in each wing contains a cEt sugar; wherein each nucleoside link is a phosphate thioester link; and wherein each cytosine is 5-methylcytosine. In some embodiments, the compound targeting PNPLA3 with the I148M mutation in the individual further comprises a conjugation group, wherein the conjugation group is located at the 5' end of the modified oligonucleotide and is
[0293]
[0294] In some embodiments, the compound comprises or consists of ION 916333 or a salt thereof, wherein ION 916333 or a salt thereof has the following chemical structure:
[0295]
[0296] In some embodiments, the compound comprises or consists of ION 975616 or a salt thereof, which has the following chemical structure:
[0297]
[0298] In some embodiments, the compound comprises or is composed of a sodium salt of ION 975616, which has the following chemical structure:
[0299]
[0300] In some embodiments, the compound comprises or consists of ION 975613 or a salt thereof, which has the following chemical structure:
[0301]
[0302] In some embodiments, the compound comprises or is composed of a sodium salt of ION 975613, which has the following chemical structure:
[0303]
[0304] In some embodiments, the compound comprises or consists of ION 975612 or a salt thereof, which has the following chemical structure:
[0305]
[0306] In some embodiments, the compound comprises or is composed of a sodium salt of ION 975612, which has the following chemical structure:
[0307]
[0308] In some embodiments, the compound comprises or consists of ION 916789 or a salt thereof, which has the following chemical structure:
[0309]
[0310] In some embodiments, the compound comprises or is composed of a sodium salt of ION 916789, which has the following chemical structure:
[0311]
[0312] In some embodiments, the compound comprises or consists of ION 916602 or a salt thereof, wherein ION 916602 or a salt thereof has the following chemical structure:
[0313]
[0314] In some embodiments, the compound comprises or is composed of a sodium salt of ION 916602, the sodium salt of ION 916602 having the following chemical structure:
[0315]
[0316] In any of the methods or uses described above, the compound may be administered parenterally. For example, in some embodiments, the compound may be administered by injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration (e.g., intrathecal or intraventricular administration).
[0317] Some compounds
[0318] In some embodiments, the compounds described herein may be antisense compounds. In some embodiments, the antisense compound comprises or is composed of an oligomeric compound. In some embodiments, the oligomeric compound comprises a modified oligonucleotide. In some embodiments, the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of the target nucleic acid.
[0319] In some embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In some embodiments, the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of the target nucleic acid.
[0320] In some embodiments, the compound or antisense compound is single-chained. Such single-chain compounds or antisense compounds comprise or consist of oligomeric compounds. In some embodiments, such oligomeric compounds comprise or consist of oligonucleotides and optionally conjugation groups. In some embodiments, the oligonucleotide is an antisense oligonucleotide. In some embodiments, the oligonucleotide is modified. In some embodiments, the oligonucleotide of the single-chain antisense compound or oligomeric compound comprises a self-complementary nucleobase sequence.
[0321] In some embodiments, the compound is double-stranded. Such double-stranded compounds comprise a first modified oligonucleotide having a region complementary to the target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In some embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, thymine nucleobases in the modified oligonucleotide are replaced with uracil nucleobases. In some embodiments, the compound comprises a conjugation group. In some embodiments, one of the modified oligonucleotides is conjugated. In some embodiments, both modified oligonucleotides are conjugated. In some embodiments, the first modified oligonucleotide is conjugated. In some embodiments, the second modified oligonucleotide is conjugated. In some embodiments, the first modified oligonucleotide is 16-30 linked nucleosides long, and the second modified oligonucleotide is 16-30 linked nucleosides long. In some embodiments, one of the modified oligonucleotides has a nucleobase sequence comprising at least 8 consecutive nucleosides comprising any one of SEQ ID NO: 17-2169.
[0322] In some embodiments, the antisense compound is double-stranded. Such double-stranded antisense compounds comprise a first oligomer having a region complementary to the target nucleic acid and a second oligomer having a region complementary to the first oligomer. The first oligomer of such double-stranded antisense compounds typically comprises, or consists of, a modified oligonucleotide and optionally a conjugation group. The oligonucleotide of the second oligomer of such double-stranded antisense compounds may be modified or unmodified. Either or both oligomers of the double-stranded antisense compound may contain a conjugation group. These oligomers of the double-stranded antisense compound may include non-complementary protruding nucleosides.
[0323] Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, siRNAs, microRNAs that target oligonucleotides, and single-stranded RNAi compounds such as hairpin RNA (shRNA), single-stranded siRNA (ssRNA), and microRNA mimics.
[0324] In some embodiments, the compounds described herein have a nucleobase sequence that, when written in the 5' to 3' orientation, contains the reverse complementary sequence of the target segment of the targeted nucleic acid.
[0325] In some embodiments, the compounds described herein comprise oligonucleotides with 12 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 12 to 22 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 14 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 14 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 15 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 15 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 15 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 16 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 16 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 17 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 17 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 18 to 30 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 18 to 20 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 20 to 30 linked subunits. In other words, such oligonucleotides are of 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, or 20 to 30 subunits, respectively. In some embodiments, the compounds described herein comprise oligonucleotides with 14 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 16 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 17 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 18 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 19 linked subunits. In some embodiments, the compounds described herein comprise oligonucleotides with 20 linked subunits. In other embodiments, the compounds described herein comprise oligonucleotides with 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.In some such embodiments, the compounds described herein comprise oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits, or oligonucleotides within the range defined by any two of the above values. In some embodiments, these linked subunits are nucleotides, nucleosides, or nucleobases.
[0326] In some embodiments, the compound may further comprise additional features or elements attached to the oligonucleotide, such as a conjugation group. In some embodiments, such compounds are antisense compounds. In some embodiments, such compounds are oligomeric compounds. In embodiments where the conjugation group comprises a nucleoside (i.e., a nucleoside of the conjugation group linked to the oligonucleotide), the nucleoside of the conjugation group is not counted in the length of the oligonucleotide.
[0327] In some embodiments, the compound may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncated) or alternatively from the 3' end (3' truncated). A shortened or truncated compound targeting PNPLA3 nucleic acid may have two subunits deleted from the 5' end of the compound, or alternatively, may have two subunits deleted from the 3' end of the compound. Alternatively, the deleted nucleoside may be dispersed throughout the compound.
[0328] When a single additional subunit is present in an elongated compound, the additional subunit may be located at the 5' or 3' end of the compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in a compound in which two subunits are added to the 5' end (5' addition) or alternatively to the 3' end (3' addition). Alternatively, the added subunits may be dispersed throughout the compound.
[0329] The length of compounds (such as oligonucleotides) can be increased or decreased, and / or mismatched bases can be introduced without eliminating activity (Woolf et al. Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences] 1992, 89: 7305-7309; Gautschi et al. J. Natl. Cancer Inst. [Journal of the National Cancer Institute] 2001 Mar, 93: 463-471; Maher and Dolnick Nuc. Acid. Res. [Nucleic Acid Research] 1998, 16: 3341-3358). However, seemingly small changes in the oligonucleotide sequence, chemistry, and motif can cause significant differences in one or more of the many properties required for clinical development (Seth et al. J. Med. Chem. [Journal of Medicinal Chemistry] 2009, 52, 10; Egli et al. J. Am. Chem. Soc. [Journal of the American Chemical Society] 2011, 133, 16642).
[0330] In some embodiments, the compounds described herein are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also known as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds function at least in part via a RISC pathway to degrade and / or chelate target nucleic acids (therefore, including microRNA / microRNA mimic compounds). As used herein, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules capable of mediating sequence-specific RNAi, such as short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotides, short interfering nucleic acids, short interfering modified oligonucleotides, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. Additionally, as used herein, the term RNAi is intended to be equivalent to other terms used to describe sequence-specific RNA interference (such as post-transcriptional gene silencing, translational repression, or epigenetics).
[0331] In some embodiments, the compound described herein may comprise any one of the oligonucleotide sequences targeting PNPLA3 described herein. In some embodiments, the compound may be double-stranded. In some embodiments, the compound comprises a first strand and a second strand, the first strand comprising at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleobase portions of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a first strand and a second strand, the first strand comprising the nucleobase sequence of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) in any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises (i) a first strand comprising a nucleobase sequence complementary to a site on PNPLA3 targeted by any one of SEQ ID NO: 17-2169, and (ii) a second strand. In some embodiments, the compound comprises one or more modified nucleotides in which the sugar contains a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe) at the 2' position. In some embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In some embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotide bases along the strand of the dsRNA compound. In some embodiments, the compound comprises one or more linkages between adjacent nucleotides other than naturally occurring phosphodiester linkages. Examples of such linkages include phosphoramide, thiophosphate, and dithiophosphate linkages. These compounds may also be chemically modified nucleic acid molecules, as taught in U.S. Patent No. 6,673,661. In other embodiments, the compound contains one or two capped chains, as disclosed, for example, in WO 00 / 63364 filed April 19, 2000.
[0332] In some embodiments, the first strand of the compound is an siRNA guide strand, and the second strand of the compound is an siRNA passenger strand. In some embodiments, the second strand of the compound is complementary to the first strand. In some embodiments, each strand of the compound has 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In some embodiments, the first or second strand of the compound may contain a conjugation group.
[0333] In some embodiments, the compound described herein may comprise any of the oligonucleotide sequences targeting PNPLA3 described herein. In some embodiments, the compound is single-stranded. In some embodiments, such a compound is a single-stranded RNAi (ssRNAi) compound. In some embodiments, the compound comprises at least 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nucleotide motifs of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises the nucleotide sequence of any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises ribonucleotides in which uracil (U) replaces thymine (T) in any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises a nucleotide sequence complementary to the site on PNPLA3 targeted by any one of SEQ ID NO: 17-2169. In some embodiments, the compound comprises one or more modified nucleotides in which the sugar contains a halogen (such as a fluorine group; 2'-F) or an alkoxy group (such as a methoxy group; 2'-OMe) at the 2' position. In some embodiments, the compound comprises at least one 2'-F sugar modification and at least one 2'-OMe sugar modification. In some embodiments, the at least one 2'-F sugar modification and at least one 2'-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotide bases along the chain of the compound. In some embodiments, the compound comprises one or more linkages between adjacent nucleotides other than naturally occurring phosphodiester linkages. Examples of such linkages include phosphoramide, thiophosphate, and dithiophosphate linkages. These compounds may also be chemically modified nucleic acid molecules, as taught in U.S. Patent No. 6,673,661. In other embodiments, the compound comprises a capped chain, as disclosed, for example, in WO 00 / 63364 filed April 19, 2000. In some embodiments, the compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides. In some embodiments, the compound may contain a conjugation group.
[0334] certain mechanisms
[0335] In some embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In some embodiments, the compounds described herein are antisense compounds. In some embodiments, the compounds comprise oligomeric compounds. In some embodiments, the compounds described herein are capable of hybridizing with target nucleic acids to produce at least one antisense activity. In some embodiments, the compounds described herein selectively affect one or more target nucleic acids. Such compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids or in a manner that produces significantly undesirable antisense activities.
[0336] In certain antisense activities, hybridization of the compounds described herein with the target nucleic acid results in the recruitment of proteins that cleave that target nucleic acid. For example, some compounds described herein lead to RNase H-mediated cleavage of the target nucleic acid. RNase H is an intracellular nuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, the compounds described herein are sufficiently “DNA-like” to induce RNase H activity. Further, in some embodiments, the nicks in the nick body are tolerant to one or more non-DNA-like nucleotides.
[0337] In certain antisense activities, the loading of a compound or a portion thereof described herein into an RNA-induced silencing complex (RISC) ultimately leads to the cleavage of the target nucleic acid. For example, some compounds described herein cause the target nucleic acid to be cleaved by Argonaute. The compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).
[0338] In some embodiments, hybridization of the compound described herein with the target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In some such embodiments, hybridization of the compound with the target nucleic acid results in altered splicing of the target nucleic acid. In some embodiments, hybridization of the compound with the target nucleic acid results in inhibition of binding interactions between the target nucleic acid and a protein or other nucleic acid. In some such embodiments, hybridization of the compound with the target nucleic acid results in altered translation of the target nucleic acid.
[0339] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves observing or detecting changes in the amount of target nucleic acid or protein encoded by such target nucleic acid, changes in the ratio of splice variants of nucleic acid or protein, and / or phenotypic changes in cells or animals.
[0340] Target nucleic acid, target region and nucleotide sequence
[0341] In some embodiments, the compounds described herein comprise or consist of oligonucleotides containing a region complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mRNA and premRNA, including intron regions, exon regions, and untranslated regions. In some embodiments, the target RNA is mRNA. In some embodiments, the target nucleic acid is premRNA. In some such embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron.
[0342] Nucleotide sequences encoding PNPLA3 include, but are not limited to, the following: RefSeq or GENBANK accession number NM_025225.2 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK accession number NC_000022.11 (incorporated by reference, disclosed herein as SEQ ID NO: 2) truncated from nucleotides 43921001 to 43954500; AK123806.1 (incorporated by reference, disclosed herein as SEQ ID NO: 3); BQ686328.1 (incorporated by reference, disclosed herein as SEQ ID NO: 4); BF762711.1 (incorporated by reference, disclosed herein as SEQ ID NO: 5); DA290491.1 (incorporated by reference, disclosed herein as SEQ ID NO: 6); and sequences listed as SEQ ID No. 7, 8, 9, and 10.
[0343] Hybridization
[0344] In some embodiments, hybridization occurs between the compound disclosed herein and the PNPLA3 nucleic acid. The most common hybridization mechanisms involve hydrogen bonding between complementary nucleobases of the nucleic acid molecules (e.g., Watson-Crick, Husstan, or reverse Husstan hydrogen bonding).
[0345] Hybridization can occur under different conditions. Hybridization conditions are sequence-dependent and determined by the properties and composition of the nucleic acid molecules to be hybridized.
[0346] Methods for determining whether a sequence can specifically hybridize with a target nucleic acid are well known in the art. In some embodiments, the compounds provided herein specifically hybridize with PNPLA3 nucleic acid.
[0347] Complementarity
[0348] When two nucleobase sequences are aligned in opposite directions, an oligonucleotide or one or more regions thereof whose nucleobase sequence matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof is said to be complementary to the other nucleic acid. As described herein, nucleobase matching or complementary nucleobases are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G), unless otherwise stated. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at every nucleoside and may include one or more nucleobase mismatches. When such oligonucleotides have nucleobase matching at every nucleoside without any nucleobase mismatches, the oligonucleotide is perfectly complementary or 100% complementary.
[0349] In some embodiments, the compounds described herein comprise or consist of modified oligonucleotides. In some embodiments, the compounds described herein are antisense compounds. In some embodiments, the compounds comprise oligomeric compounds. Non-complementary nucleobases between the compound and the PNPLA3 nucleic acid are acceptable, as long as the compound is still able to specifically hybridize with the target nucleic acid. Furthermore, the compound can hybridize with one or more segments of the PNPLA3 nucleic acid such that intercalated or adjacent segments are not included in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).
[0350] In some embodiments, the compounds provided herein, or designated portions thereof, are at least or at most 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to PNPLA3 nucleic acid, its target region, target segment, or designated portion. In some embodiments, the compounds provided herein, or designated portions thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number between these ranges, complementary to PNPLA3 nucleic acid, its target region, target segment, or designated portion. The percentage complementarity of the compound to the target nucleic acid can be determined using conventional methods.
[0351] For example, a compound with 18 of its 20 nucleosides complementary to the target region and thus specifically hybridizing represents 90% complementarity. In this example, the remaining non-complementary nucleosides can cluster or disperse with complementary nucleosides and do not need to be continuous with each other or with complementary nucleosides. Therefore, a compound of 18 nucleosides with four non-complementary nucleosides flanked by two regions perfectly complementary to the target nucleic acid has 77.8% overall complementarity with the target nucleic acid. The percentage of complementarity of a compound to the target nucleic acid region can be routinely determined using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program (Altschul et al., J. Mol. Biol. [Journal of Molecular Biology], 1990, 215, 403 410; Zhang and Madden, Genome Res. [Genomic Research], 1997, 7, 649 656). Percentage homology, sequence identity, or complementarity can be determined using, for example, the Gap program (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wisconsin) using Smith and Waterman's algorithm (Adv. Appl. Math., 1981, 2, 482 489) with default settings.
[0352] In some embodiments, the compounds described herein, or designated portions thereof, are completely complementary (i.e., 100% complementary) to a target nucleic acid, or a designated portion thereof. For example, a compound may be completely complementary to a PNPLA3 nucleic acid, or a target region, segment, or sequence thereof. As used herein, “completely complementary” means that each nucleobase of the compound is complementary to the corresponding nucleobase of the target nucleic acid. For example, a 20-nucleobase compound may be completely complementary to a 400-nucleobase-long target sequence, provided that a corresponding 20-nucleobase portion of the target nucleic acid is completely complementary to the compound. Complete complementarity may also be used with respect to designated portions of the first and / or second nucleic acids. For example, a 20-nucleobase portion of a 30-nucleobase compound may be “completely complementary” to a 400-nucleobase-long target sequence. A 20-nucleobase portion of a 30-nucleobase compound may be completely complementary to the target sequence if the target sequence has a corresponding 20-nucleobase portion, wherein each nucleobase is complementary to the 20-nucleobase portion of the compound. Meanwhile, the entire 30 nucleobases of the compound may be completely or incompletely complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence.
[0353] In some embodiments, the compounds described herein contain one or more mismatched nucleobases relative to the target nucleic acid. In some such embodiments, antisense activity against the target is reduced by such mismatches, but activity against non-targets is reduced by a greater amount. Thus, in some such embodiments, the selectivity of the compound is improved. In some embodiments, the mismatch is particularly located within an oligonucleotide having a nick motif. In some such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the nick region. In some such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the nick region. In some such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5' end of the wing region. In some such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3' end of the wing region. In some embodiments, the mismatch is particularly located within an oligonucleotide without a nick motif. In some such embodiments, the mismatch occurs at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In some such embodiments, the mismatch occurs at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.
[0354] The non-complementary nucleobase can be located at the 5' or 3' end of the compound. Alternatively, the non-complementary nucleobase or nucleobase can be located in an internal position within the compound. When two or more non-complementary nucleobases are present, they can be continuous (i.e., linked) or discontinuous. In one embodiment, the non-complementary nucleobase is located in the wing segment of the nick-body oligonucleotide.
[0355] In some embodiments, the compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long contain no more than 4, 3, 2, or 1 non-complementary nucleotides relative to the target nucleic acid (such as PNPLA3 nucleic acid) or a designated portion thereof.
[0356] In some embodiments, compounds described herein that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long contain no more than 6, 5, 4, 3, 2, or 1 non-complementary nucleotides relative to a target nucleic acid (such as PNPLA3 nucleic acid) or a designated portion thereof.
[0357] In some embodiments, the compounds described herein also include those complementary to a portion of the target nucleic acid. As used herein, “portion” refers to a defined number of consecutive (i.e., linked) nucleobases within a region or segment of the target nucleic acid. “Portion” may also refer to a defined number of consecutive nucleobases of the compound. In some embodiments, these compounds are complementary to at least 8 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 9 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 10 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 11 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 12 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 13 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 14 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 15 nucleobase portions of the target segment. In some embodiments, these compounds are complementary to at least 16 nucleobase portions of the target segment. Compounds complementary to at least 9, 10, 17, 18, 19, 20, or more nucleobase moieties of the target region, or ranges defined by any two of these values, were also considered.
[0358] identity
[0359] The compounds described herein may also have a defined percentage identity with a specific nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or a portion thereof. In some embodiments, the compounds described herein are antisense compounds or oligomeric compounds. In some embodiments, the compounds described herein are modified oligonucleotides. As used herein, a compound is considered identical to a disclosed sequence if it has the same nucleobase pairing ability as the disclosed sequence. For example, RNA containing uracil instead of thymine in a disclosed DNA sequence is considered identical to that DNA sequence because both uracil and thymine pair with adenine. Shortened and extended forms of the compounds described herein, as well as compounds having bases that are not identical to those provided herein, are also considered. These bases may be adjacent to each other or scattered throughout the compound. The percentage identity of a compound is calculated based on the number of bases that have the same base pairing with the sequence it is comparing to.
[0360] In some embodiments, the compounds described herein or portions thereof have, or at least have, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with one or more of the compounds disclosed herein or SEQ ID NO, or portions thereof. In some embodiments, the compounds described herein have about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or any percentage between these values, of a specific nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, wherein these compounds comprise oligonucleotides having one or more mismatched nucleobases. In some such embodiments, the mismatch occurs at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5' end of the oligonucleotide. In some such embodiments, the mismatch occurs at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3' end of the oligonucleotide.
[0361] In some embodiments, the compounds described herein comprise or consist of an antisense compound. In some embodiments, a portion of the antisense compound is compared to an equal-length portion of the target nucleic acid. In some embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides is compared to an equal-length portion of the target nucleic acid.
[0362] In some embodiments, the compounds described herein comprise or consist of oligonucleotides. In some embodiments, a portion of the oligonucleotide is compared to an equal-length portion of the target nucleic acid. In some embodiments, a portion of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides is compared to an equal-length portion of the target nucleic acid.
[0363] Some modified compounds
[0364] In some embodiments, the compounds described herein comprise or consist of oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides, relative to unmodified RNA or DNA, comprise at least one modification (i.e., comprising at least one modified nucleoside (comprising a modified sugar moiety and / or modified nucleobases) and / or at least one modified inter-nucleoside linkage).
[0365] Modified nucleosides
[0366] Modified nucleosides contain modified sugar moieties or modified nucleobases, or both modified sugar moieties and modified nucleobases.
[0367] 1. Modified sugar fraction
[0368] In some embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to other types of modified sugar moiety.
[0369] In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety comprising one or more acyclic substituents (including, but not limited to, substituents at the 2', 4', and / or 5' positions). In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. In some embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituent groups for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In some embodiments, the 2'-substituent group is selected from: halogenated, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylenyl-O-alkyl, alkynyl, aryl, aralkyl, O-alkylaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n Independently, it is H, an amino protecting group, or a substituted or unsubstituted C1-C. 10Alkyl groups, and 2'-substituent groups as described in Cook et al., US6,531,584; Cook et al., US5,859,221; and Cook et al., US6,005,087. Certain embodiments of these 2'-substituent groups may be further substituted independently with one or more substituent groups selected from the following: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituent groups for linear non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituent groups for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In some embodiments, the non-bicyclic modified sugar comprises more than one non-bridging sugar substituent, such as a 2′-F-5′-methyl sugar moiety, as well as the modified sugar moiety and modified nucleoside described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0370] In some embodiments, the 2'-substituted nucleoside or the 2'-non-bicyclic modified nucleoside comprises a sugar moiety containing a linear 2'-substituent group selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where each R m and R n Independently, it is H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 alkyl.
[0371] In some embodiments, the 2'-substituted nucleosides or 2'-non-bicyclic modified nucleosides comprise a sugar moiety containing a linear 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).
[0372] In some embodiments, the 2'-substituted nucleoside or the 2'-non-bicyclic modified nucleoside comprises a sugar moiety containing a linear 2'-substituent group selected from the following: F, OCH3, and OCH2CH2OCH3.
[0373] Nucleosides containing a modified sugar moiety (such as a non-bicyclic modified sugar moiety) are referred to by one or more substitution sites on the sugar moiety of the nucleoside. For example, nucleosides containing a 2'-substituted or 2-modified sugar moiety are called 2'-substituted nucleosides or 2-modified nucleosides.
[0374] Certain modified sugar moieties contain bridging sugar substituents that form a second ring, resulting in a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety contains a bridge between the 4' and 2' furanose ring atoms. In some such embodiments, the furanose ring is a ribose ring. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2-O-2′ (“LNA”), 4′-CH2-S-2′, 4′-(CH2)2-O-2′ (“ENA”), 4′-CH(CH3)-O-2′ (when in the S configuration, referred to as “restricted ethyl” or “cEt”). 4′-CH2-O-CH2-2′, 4′-CH2-N(R)-2′, 4′-CH(CH2OCH3)-O-2′ (“constrained MOE” or “cMOE”) and their analogues (see, for example, Seth et al., US7,399,845; Bhat et al., US7,569,686; Swayze et al., US7,741,457, and Swayze et al., US7,741,457). 8,022,193), 4′-C(CH3)(CH3)-O-2′ and its analogues (see, e.g., Seth et al., US8,278,283), 4′-CH2-N(OCH3)-2′ and its analogues (see, e.g., Prakash et al., US8,278,425), 4′-CH2-ON(CH3)-2′ (see, e.g., Allenson et al., US7,696,345 and Allenson et al., US8,124,745), 4′-CH2-C(H)(CH3)-2′ (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH2-C(=CH2)-2′ and its analogues (see, e.g., Seth et al., US8,278,426), 4′-C(R a R b )-N(R)-O-2'、4'-C(R a Rb )-ON(R)-2', 4′-CH2-ON(R)-2′, and 4′-CH2-N(R)-O-2′, wherein each R, R a and R b Independently, it is H, a protecting group, or C1-C. 12 Alkyl (see, for example, Imanishi et al., US7,427,672).
[0375] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups, which are independently selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a ) = N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -、and-N(R) a )-;
[0376] in:
[0377] x is 0, 1, or 2;
[0378] n is 1, 2, 3, or 4;
[0379] Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic, substituted heterocyclic, heteroaryl, substituted heteroaryl, C5-C7 alicyclic, substituted C5-C7 alicyclic, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups, or protecting groups.
[0380] The other dicyclic sugar moiety is known in the art; see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahllestedt et al., Proc. Natl. Acad. Sci. USA. [Proceedings of the National Academy of Sciences], 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett. [Bioorganic Chemistry and Medicinal Chemistry Letters], 1998, 8, 2219-2222; Singh et al., J. Org. Chem. [Journal of Organic Chemistry], 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc. [Journal of the American Chemical Society], 2007, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs [Recent Thoughts on Drug Research], 2001, 2, 558-561; Braasch et al., Chem. Biol. [Chemical Biology], 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther. [Recent Perspectives on Molecular Therapy], 2001, 3, 239-243; Wengel et al., US7,053,207; Imanshi et al., US6,268,490; Imanshi et al., US6,770,748; Imanshi et al., USRE44,779; Wengel et al., US6,794,499; Wengel et al., US6,670,461; Wengel et al., US7,034,133; Wengel et al., US8,080,644; Wengel et al., US8,034,909; Wengel et al., US8,153,365; Wengel et al., US7,572,582; and Ramasamy et al., US6,525,191; Torsten et al., WO 2004 / 106356, Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US 8,088,746; Seth et al., US 7,750,131; Seth et al., US 8,030,467; Seth et al., US 8,268,980; Seth et al., US 8,546,556; Seth et al., US 8,530,640; Migawa et al., US 9,012,421; Seth et al., US 8,501,805; Allenson et al., US 2008 / 0039618; and Migawa et al., US 2015 / 0191727.
[0381] In some embodiments, the dicyclic sugar moiety and the nucleotide incorporated into such a dicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleotides (described herein) can be in the α-L configuration or in the β-D configuration.
[0382]
[0383] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). This overview of bicyclic nucleotides includes two isomeric configurations. When identifying the position of a specific bicyclic nucleotide (e.g., LNA or cEt) in the example examples herein, they are in the β-D configuration unless otherwise stated.
[0384] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted and 4'-2'-bridging sugars).
[0385] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, such modified sugar moiety also contains bridging and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2'-position (see, for example, Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5'-position.
[0386] In some embodiments, the sugar substitute comprises a ring having not five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), atroitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, for example, Leumann, CJ. Bioorg. & Med. Chem. [Bioorganic Chemistry and Medicinal Chemistry] 2002, 10, 841-854), fluoroHNA:
[0387]
[0388] (“F-HNA”, see, for example, Swayze et al., US8,088,904; Swayze et al., US8,440,803; and Swayze et al., US9,005,906. F-HNA may also be referred to as F-THP or 3′-fluorotetrahydropyran), and nucleosides having the following formula that constitute other modified THP compounds:
[0389]
[0390] Independently, for each of the modified THP nucleotides:
[0391] Bx is the nucleobase portion;
[0392] T3 and T4 are each independently an internucleotide linker group that connects the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleotide linker group that connects the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′ terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, a C1-C6 alkyl group, or a substituted C1-C6 alkyl group. Alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.
[0393] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is different from H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H. In some embodiments, R1 is methoxy and R2 is H, and in some embodiments, R1 is methoxyethoxy and R2 is H.
[0394] In some embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising a morpholinyl sugar moiety and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholinyl" means a sugar substitute having the following structure:
[0395]
[0396] In some embodiments, the morpholino group can be modified, for example, by adding or changing different substituent groups from the above-described morpholino group structure. Such sugar substitutes are referred to herein as "modified morpholino groups".
[0397] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides constituting such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids (“PNA”), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US 2013 / 130378.
[0398] Many other bicyclic and tricyclic sugars and sugar substitute ring systems in modified nucleosides are known in the art.
[0399] 2. Modified nucleobases
[0400] Nucleobase (or base) modifications or substitutions are structurally distinguishable from naturally occurring or synthetic unmodified nucleobases, but functionally interchangeable. Both natural and modified nucleobases can participate in hydrogen bonding. Such nucleobase modifications can confer antisense compounds with nuclease stability, binding affinity, or other beneficial biological properties.
[0401] In some embodiments, the compounds described herein comprise modified oligonucleotides. In some embodiments, the modified oligonucleotides comprise one or more nucleosides comprising unmodified nucleobases. In some embodiments, the modified oligonucleotides comprise one or more nucleosides comprising modified nucleobases. In some embodiments, the modified oligonucleotides comprise one or more nucleosides that do not contain nucleobases (referred to as a base-free nucleoside).
[0402] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6 and O-6-substituted purines. In some embodiments, the modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl(C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiolated, 8-thioalkyl, 8-hydroxy, 8-aza, and other 8- -Substituted purines, 5-halogenated (especially 5-bromo), 5-trifluoromethyl, 5-halogenated uracil, and 5-halogenated cytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, enlarged bases, and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine bases are replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in Merigan et al., US3,687,808; those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, edited by Kroschwitz, JI, John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, edited by Crooke, ST and Lebleu, B., CRC Press, 1993, 273-288; and those disclosed in Antisense Drug Technology, Chapters 6 and 15, edited by Crooke ST, CRC Press, 2008, 163-166 and 442-443.
[0403] The disclosures that teach the preparation of certain of the modified nucleobases mentioned above, as well as other modified nucleobases, include, but are not limited to, Manoharan et al., US 2003 / 0158403, and Manoharan et al., US 2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525,711; Haralambidis et al., US5,552,540; Cook et al., US5, 587,469; Froehler et al., US5,594,121; Switcher et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.
[0404] In some embodiments, the compound targeting PNPLA3 nucleic acid comprises one or more modified nucleobases. In some embodiments, the modified nucleobase is 5-methylcytosine. In some embodiments, each cytosine is 5-methylcytosine.
[0405] 3. Modified nucleoside linkages
[0406] Naturally occurring nucleoside linkages in RNA and DNA are 3′ to 5′ phosphodiester linkages. In some embodiments, compounds described herein with one or more modified (i.e., non-naturally occurring) nucleoside linkages are selected as preferred over compounds with naturally occurring nucleoside linkages due to desired properties, such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0407] Representative internucleotide linkages with chiral centers include, but are not limited to, alkylphosphonates and thiophosphates. Modified oligonucleotides containing internucleotide linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleotide linkages, or as a population of modified oligonucleotides containing thiophosphate linkages with specific stereochemical configurations. In some embodiments, the modified oligonucleotide population contains thiophosphate nucleoside linkages, wherein all thiophosphate nucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in the random selection of the stereochemical configuration of each thiophosphate linkage. Nevertheless, as is well known to those skilled in the art, each individual thiophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides containing one or more specific thiophosphate nucleoside linkages with specific, independently selected stereochemical configurations. In some embodiments, the specific configuration of a specific thiophosphate linkage is present in at least 65% of the molecules in the population. In some embodiments, a specific configuration linked to a particular thiophosphate is present in at least 70% of the molecules in the population. In some embodiments, a specific configuration linked to a particular thiophosphate is present in at least 80% of the molecules in the population. In some embodiments, a specific configuration linked to a particular thiophosphate is present in at least 90% of the molecules in the population. In some embodiments, a specific configuration linked to a particular thiophosphate is present in at least 99% of the molecules in the population. Such chiral-enriched modified oligonucleotide populations can be produced using synthetic methods known in the art, for example, those described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. [Nucleic Acid Research] 42, 13456 (2014), and WO 2017 / 015555. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides having at least one thiophosphate indicative of the (Sp) configuration. In some embodiments, the modified oligonucleotide population is enriched with a modified oligonucleotide having at least one phosphate thioester in the (Rp) configuration. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphate thioesters each comprise one or more of the following formulas, wherein "B" indicates a nucleobase:
[0408]
[0409] Unless otherwise stated, the chiral nucleoside linkages of the modified oligonucleotides described herein may be stereo-random or in a specific stereochemical configuration.
[0410] In some embodiments, the compound targeting PNPLA3 nucleic acid comprises one or more modified nucleoside links. In some embodiments, the modified nucleoside link is a phosphate thioester link. In some embodiments, each nucleoside link of the antisense compound is a phosphate thioester nucleoside link.
[0411] In some embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides having modified nucleoside linkages include nucleoside linkages that retain a phosphorus atom and those that do not. Representative phosphorus-containing nucleoside linkages include, but are not limited to, phosphate diesters, phosphate triesters, methylphosphonates, aminophosphates, and thiophosphates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.
[0412] In some embodiments, any nucleoside linker can be used to link the nucleosides of modified oligonucleotides together. Two main classes of nucleoside linker groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleoside linkers include, but are not limited to, phosphate esters (also referred to as unmodified or naturally occurring links) containing a phosphodiester bond (“P=O”), phosphate triesters, methylphosphonates, aminophosphates, and thiophosphates (“P=S”) and dithiophosphates (“HS-P=S”). Representative non-phosphoside linker groups include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2), thiodiester, thioamino esters (-OC(=O)(NH)-S-); siloxanes (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphate ester links, modified nucleoside linkers can be used to alter (typically increase) the nuclease resistance of oligonucleotides. In some embodiments, the chiral nucleoside linkages can be prepared as racemic mixtures or as individual enantiomers. Representative chiral nucleoside linkages include, but are not limited to, alkylphosphonates and thiophosphates. Methods for preparing phosphorus-containing and non-phosphorus-containing nucleoside linkages are well known to those skilled in the art.
[0413] Neutral nucleoside linkages include, but are not limited to, phosphate triesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O-5′), amide-3 (3′-CH2-C(=O)-N(H)-5′), amide-4 (3′-CH2-N(H)-C(=O)-5′), formacetal (3′-O-CH2-O-5′), methoxypropyl, and thioformacetal (3′-S-CH2-O-5′). Other neutral nucleoside linkages include nonionic linkages comprising siloxanes (dialkylsiloxanes), carboxylic esters, carboxamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research; edited by YSSanghvi and PDCook, ACS Symposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside linkages include nonionic linkages that incorporate a mixture of N, O, S, and CH2 components.
[0414] In some embodiments, the oligonucleotide includes modified internucleotide links arranged in a defined pattern or modified internucleotide linking motif along the oligonucleotide or its regions. In some embodiments, the internucleotide links are arranged as notched motifs. In such embodiments, the internucleotide links in each of the two wing regions are different from the internucleotide links in the notched region. In some embodiments, the internucleotide links in the wings are phosphodiesters, and the internucleotide links in the notches are thiophosphates. The nucleoside motifs are chosen independently, so such oligonucleotides having notched internucleotide linking motifs may or may not have notched nucleoside motifs, and if they do have notched nucleoside motifs, the wing and notch lengths may be the same or different.
[0415] In some embodiments, the oligonucleotide includes a region having alternating nucleoside linker motifs. In some embodiments, the oligonucleotide includes a uniformly modified nucleoside linker region. In some such embodiments, the oligonucleotide includes a region uniformly linked by phosphate thioester nucleoside linkers. In some embodiments, the oligonucleotide is uniformly linked by phosphate thioesters. In some embodiments, each nucleoside linker of the oligonucleotide is selected from phosphate diesters and phosphate thioesters. In some embodiments, each nucleoside linker of the oligonucleotide is selected from phosphate diesters and phosphate thioesters, and at least one nucleoside linker is a phosphate thioester.
[0416] In some embodiments, the oligonucleotide comprises at least 6 phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least 8 phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least 10 phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphate-thioester nucleoside linkages. In some embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphate-thioester nucleoside linkages. In some such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In some such embodiments, at least one such block is located within 3 nucleotides at the 3' end of the oligonucleotide.
[0417] In some embodiments, the oligonucleotide comprises one or more methylphosphonate links. In some embodiments, the oligonucleotide with a nick-somatic nucleoside motif comprises a linker motif containing all but one or two methylphosphonate links. In some embodiments, a methylphosphonate linker is located in the central notch of the oligonucleotide with the nick-somatic nucleoside motif.
[0418] In some embodiments, it is desirable to arrange the number of thiophosphate nucleoside links and phosphodiester nucleoside links to maintain nuclease resistance. In some embodiments, it is desirable to arrange the number and position of thiophosphate nucleoside links and phosphodiester nucleoside links to maintain nuclease resistance. In some embodiments, the number of thiophosphate nucleoside links can be reduced, and the number of phosphodiester nucleoside links can be increased. In some embodiments, the number of thiophosphate nucleoside links can be reduced, and the number of phosphodiester nucleoside links can be increased, while still maintaining nuclease resistance. In some embodiments, it is desirable to reduce the number of thiophosphate nucleoside links while retaining nuclease resistance. In some embodiments, it is desirable to increase the number of phosphodiester nucleoside links while retaining nuclease resistance.
[0419] 4. Certain motifs
[0420] In some embodiments, the compounds described herein comprise oligonucleotides. Oligonucleotides may have motifs, such as unmodified and / or modified sugar moieties, nucleotide bases, and / or nucleoside linkage patterns. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides containing modified sugars. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides containing modified nucleotide bases. In some embodiments, modified oligonucleotides comprise one or more modified nucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleotide bases, and / or nucleoside linkages of the modified oligonucleotide define a pattern or motif. In some embodiments, the sugar moieties, nucleotide bases, and nucleoside linkage patterns are each independent of each other. Therefore, modified oligonucleotides can be described by their sugar motifs, nucleotide motifs, and / or nucleoside linkage motifs (as used herein, sequences independent of nucleotides, the nucleotide motif describing modifications to those nucleotides).
[0421] a. Certain glycosylations
[0422] In some embodiments, the compounds described herein comprise oligonucleotides. In some embodiments, the oligonucleotide comprises one or more types of modified and / or unmodified sugar motifs arranged along the oligonucleotide or its regions in a defined pattern or glycomotif. In some cases, such glycomotifs include, but are not limited to, any of the sugar modifications discussed herein.
[0423] In some embodiments, the modified oligonucleotide comprises or is composed of a region having a nick motif, the nick motif comprising two outer regions or "wings" and a central or inner region or "nick". These three regions (5'-wing, nick, and 3'-wing) of the nick motif form a continuous sequence of nucleosides, wherein at least some of the sugar moieties of the nucleosides in each of these wings differ from at least some of the sugar moieties of the nucleosides in the nick. Specifically, the sugar moieties of at least the nucleosides closest to the nick in each wing (the 3'-most nucleosides of the 5'-wing and the 5'-most nucleosides of the 3'-wing) differ from the sugar moieties of the adjacent nick nucleosides, thus defining a boundary (i.e., a wing / nick junction) between the wing and the nick. In some embodiments, the sugar moieties within the nick are identical to each other. In some embodiments, the nick includes one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides in the nick. In some embodiments, the sugar motifs of the two wings are identical to each other (symmetric nick motif). In some embodiments, the 5′-winged glycosylation is different from the 3′-winged glycosylation (asymmetric notch).
[0424] In some embodiments, the wings of the notched body contain 1-5 nucleosides. In some embodiments, the wings of the notched body contain 2-5 nucleosides. In some embodiments, the wings of the notched body contain 3-5 nucleosides. In some embodiments, all nucleosides of the notched body are modified nucleosides.
[0425] In some embodiments, the notch in the notch contains 7-12 nucleosides. In some embodiments, the notch in the notch contains 7-10 nucleosides. In some embodiments, the notch in the notch contains 8-10 nucleosides. In some embodiments, the notch in the notch contains 10 nucleosides. In some embodiments, each nucleoside in the notch of the notch is an unmodified 2'-deoxynucleoside.
[0426] In some embodiments, the notch body is a deoxy notch body. In such embodiments, the nucleoside on the notch side of each wing / notch junction is an unmodified 2'-deoxy nucleoside, and the nucleoside on the wing side of each wing / notch junction is a modified nucleoside. In some such embodiments, each nucleoside of the notch is an unmodified 2'-deoxy nucleoside. In some such embodiments, each nucleoside of each wing is a modified nucleoside.
[0427] In some embodiments, the modified oligonucleotide has a fully modified glycomolecular motif, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar motif. In some embodiments, the modified oligonucleotide comprises, or is composed of, a region having a fully modified glycomolecular motif, wherein each nucleoside within that region comprises a modified sugar motif. In some embodiments, the modified oligonucleotide comprises, or is composed of, a region having a fully modified glycomolecular motif, wherein each nucleoside within that fully modified region comprises the same modified sugar motif, referred herein to as a uniformly modified glycomolecular motif. In some embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In some embodiments, each nucleoside of the uniformly modified oligonucleotide comprises the same 2'-modification.
[0428] b. Certain nucleobase sequences
[0429] In some embodiments, the compounds described herein comprise oligonucleotides. In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or its regions. In some embodiments, each nucleobase is modified. In some embodiments, none of these nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine.
[0430] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.
[0431] In some embodiments, the oligonucleotide with the nick motif comprises a nucleoside containing a modified nucleotide. In some such embodiments, a nucleoside containing a modified nucleotide is located in the central nick of the oligonucleotide with the nick motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl motif. In some embodiments, the modified nucleotide is selected from 2-thiopyrimidine and 5-propynylpyrimidine.
[0432] c. Certain nucleoside linker motifs
[0433] In some embodiments, the compounds described herein comprise oligonucleotides. In some embodiments, the oligonucleotides comprise modified and / or unmodified internucleotide links arranged along the oligonucleotide or its regions in a defined pattern or motif. In some embodiments, substantially each internucleotide linking group is a phosphate internucleotide linker (P=O). In some embodiments, each internucleotide linking group of the modified oligonucleotide is a phosphate thioester (P=S). In some embodiments, each internucleotide linking group of the modified oligonucleotide is independently selected from phosphate thioesters and phosphate internucleotide links. In some embodiments, the glycosylation motif of the modified oligonucleotide is a notch, and all internucleotide links within the notch are modified. In some such embodiments, some or all of the internucleotide links in these wings are unmodified phosphate links. In some embodiments, the terminal internucleotide links are modified. In some embodiments, the modified oligonucleotide's glycosylation is a nick motif, and the internucleotide linker motif contains at least one phosphodiester internucleotide linker in at least one wing, wherein the at least one phosphodiester linker is not a terminal internucleotide linker, and the remaining internucleotide links are phosphate thioester internucleotide links. In some such embodiments, all phosphate thioester links are stereo-random. In some embodiments, all phosphate thioester links in the wings are (Sp) phosphate thioesters, and the nick contains at least one Sp, Sp, Rp motif. In some embodiments, the modified oligonucleotide population is rich in modified oligonucleotides containing such internucleotide linker motifs.
[0434] 5. Certain modified oligonucleotides
[0435] In some embodiments, the compounds described herein comprise modified oligonucleotides. In some embodiments, the modifications described above (sugars, nucleosides, nucleoside linkages) are incorporated into the modified oligonucleotides. In some embodiments, the modified oligonucleotides are characterized by their modifications, motifs, and total length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise specified, each nucleoside linkage of an oligonucleotide with a cleavage sugar motif can be modified or unmodified, and may or may not follow the cleavage modification patterns of these sugar modifications. For example, nucleoside linkages within the wing regions of a sugar cleavage can be the same or different from each other, and can be the same or different from the nucleoside linkages within the cleavage regions of the sugar motif. Similarly, independent of these cleavage patterns, such cleavage oligonucleotides can contain one or more modified nucleosides. Furthermore, in some cases, oligonucleotides are described by total length or range and by the length or length range of two or more regions (e.g., regions with nucleosides of specified sugar modifications). In such cases, values can be selected for each range that result in oligonucleotides with a total length exceeding the specified range. In such cases, both factors must be satisfied. For example, in some embodiments, the modified oligonucleotide consists of 15-20 linked nucleosides and has a glycosyl motif consisting of three regions (A, B, and C), where region A consists of 2-6 linked nucleosides with a specified glycosyl motif, region B consists of 6-10 linked nucleosides with a specified glycosyl motif, and region C consists of 2-6 linked nucleosides with a specified glycosyl motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides, and B consists of 10 linked nucleosides (even if those numbers of nucleosides are within the requirements of A, B, and C), because the total length of such oligonucleotides would be 22, which exceeds the upper limit (20) for the total length of modified oligonucleotides. Here, if the description of the oligonucleotide is not mentioned with respect to one or more parameters, such parameters are not limited. Thus, a modified oligonucleotide described only as having a nick-somatic glycosyl motif without further description can have any length, inter-nucleoside linking motif, and nucleobase motif. Unless otherwise specified, all modifications are independent of the nucleobase sequence.
[0436] Certain conjugated compounds
[0437] In some embodiments, the compounds described herein comprise, or consist of, an oligonucleotide (modified or unmodified) and optionally one or more conjugation groups and / or terminal groups. The conjugation group consists of one or more conjugation moieties and a conjugation linker that links the conjugation moieties to the oligonucleotide. The conjugation group may be attached to either end or both ends of the oligonucleotide and / or attached at any internal location. In some embodiments, the conjugation group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugation group attached to either end or both ends of the oligonucleotide is a terminal group. In some such embodiments, the conjugation group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In some such embodiments, the conjugation group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the conjugation group is attached near the 3' end of the oligonucleotide. In some embodiments, the conjugation group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the conjugation group is attached near the 5' end of the oligonucleotide.
[0438] In some embodiments, the oligonucleotide is modified. In some embodiments, the oligonucleotide of the compound has a nucleobase sequence complementary to the target nucleic acid. In some embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In some embodiments, the oligonucleotide is complementary to pre-mRNA. In some embodiments, the oligonucleotide is complementary to sense transcripts.
[0439] Examples of terminal groups include, but are not limited to, conjugation groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0440] certain conjugate groups
[0441] In some embodiments, the oligonucleotide is covalently attached to one or more conjugation groups. In some embodiments, the conjugation groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugation groups endow the attached oligonucleotide with novel properties, such as enabling the detection of a fluorophore or reporter group of the oligonucleotide.
[0442] Certain conjugating groups and conjugating moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences], 1989, 86, 6553-6556), bile acids (Manoharan et al., Bioorg. Med. Chem. Lett. [Letters of Bioorganic and Medicinal Chemistry], 1994, 4, 1053-1060), thioethers (e.g., hexyl-S-triphenylmethylthiol) (Manoharan et al., Ann. NY Acad. Sci. [Annual Reports of the New York Academy of Sciences], 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett. [Letters of Bioorganic and Medicinal Chemistry], 1993, 3, 2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids). Res. [Nucleic Acid Research], 1992, 20, 533-538), aliphatic chains (e.g., dodecanediol or undecyl residues) (Saison-Behmoaras et al., EMBO J. [Journal of the European Society for Molecular Biology], 1991, 10, 1111-1118; Kabanov et al., FEBS Lett. [Letter from the Federation of European Biochemical Societies], 1990, 259, 327-330; Svinarchuk et al., Biochimie [Biochemistry], 1993, 75, 49-54), phospholipids (e.g., di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-propanetriyl-3-H-phosphate) (Manoharan et al., Tetrahedron Lett. [Tetrahedron Letters], 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res. [Nucleic Acid Research], 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), stearylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi: 10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO 2014 / 179620).
[0443] 1. Conjugate portion
[0444] The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.
[0445] In some embodiments, the conjugate portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, sulprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carboprofen, dansinosteroids, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiazide, chlorothiazide, diazepam, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial drugs, or antibiotics.
[0446] 2. Conjugate joint
[0447] The conjugated moiety is attached to the oligonucleotide via a conjugation linker. In some embodiments, the conjugated group is a single chemical bond (i.e., the conjugated moiety is attached to the oligonucleotide via the conjugation linker via a single bond). In some embodiments, the conjugation linker comprises an oligomer of a chain structure (such as a hydrocarbon chain) or a repeating unit (such as an ethylene glycol, nucleoside, or amino acid unit).
[0448] In some embodiments, the conjugate connector comprises one or more groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some such embodiments, the conjugate connector comprises groups selected from the group consisting of alkyl, amino, oxo, amide, and ether. In some embodiments, the conjugate connector comprises groups selected from alkyl and amide groups. In some embodiments, the conjugate connector comprises groups selected from alkyl and ether groups. In some embodiments, the conjugate connector comprises at least one phosphorus moiety. In some embodiments, the conjugate connector comprises at least one phosphate ester group. In some embodiments, the conjugate connector includes at least one neutral linker group.
[0449] In some embodiments, the conjugate linker (including the conjugate linker described above) is a bifunctional linker, such as those known in the art for attaching a conjugate group to a parent compound (such as the oligonucleotides provided herein). Typically, the bifunctional linker comprises at least two functional groups. One functional group is selected to bind to a specific site on the compound, and the other functional group is selected to bind to the conjugate group. Examples of functional groups used in the bifunctional linker include, but are not limited to, electrophilic reagents for reacting with nucleophilic groups and nucleophilic reagents for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from the group consisting of amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0450] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), succinimide-4-(N-maleimide-methyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C... 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 The alkynyl group, wherein a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0451] In some embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise optionally protected heterocyclic bases selected from: purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable portion is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Ideally, the linker-nucleosides are cleaved from the compound upon reaching the target tissue. Therefore, linker-nucleosides are typically linked to each other by cleavable bonds and to the remainder of the compound. In some embodiments, such cleavable bonds are phosphodiester bonds.
[0452] In this document, the linker-nucleoside is not considered part of the oligonucleotide. Therefore, in the following examples, the compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage complementarity to a reference nucleic acid, and the compound further comprises a conjugate group containing a linker-nucleoside that is not included in the length of the oligonucleotide and is not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, the compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group containing 1-10 linker-nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of consecutively linked nucleosides in such a compound exceeds 30. Alternatively, the compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. The total number of consecutively linked nucleosides in such a compound does not exceed 30. Unless otherwise stated, the conjugate linker comprises no more than 10 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 5 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 3 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 2 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 1 linker-nucleoside.
[0453] In some embodiments, it is desirable that the conjugated group is cleaved from the oligonucleotide. For example, in some cases, compounds containing a particular conjugated moiety are better absorbed by a particular cell type, but once the compound is absorbed, it is desirable that the conjugated group be cleaved to release the unconjugated or parent oligonucleotide. Therefore, some conjugates may contain one or more cleavable moieties, typically within the conjugation linker. In some embodiments, the cleavable moieties are cleavable bonds. In some embodiments, the cleavable moieties are a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moieties contain a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moieties are selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moieties are selectively cleaved by endogenous enzymes (such as nucleases).
[0454] In some embodiments, the cleavable bond is selected from one or both of the following: amides, esters, ether diesters, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or both esters of a phosphate diester. In some embodiments, the cleavable portion comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable portion is a phosphate ester link between an oligonucleotide and a conjugate moiety or conjugate group.
[0455] In some embodiments, the cleavable portion comprises or consists of one or more linker-nucleosides. In some such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the compound via cleavable bonds. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2′-deoxynucleoside attached to the 3′ or 5′-terminal nucleoside of the oligonucleotide via phosphate ester nucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate group via phosphate ester or thiophosphate linkage. In some such embodiments, the cleavable portion is 2′-deoxyadenosine.
[0456] 3. Conjugate components targeting certain cells
[0457] In some embodiments, the conjugation group comprises a conjugation moiety targeting cells. In some embodiments, the conjugation group has the following general formula:
[0458]
[0459] Where n ranges from 1 to approximately 3 (m is 0 when n is 1; m is 1 when n is 2 or greater), j is 1 or 0, and k is 1 or 0.
[0460] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.
[0461] In some embodiments, the conjugation group comprises a portion of the target cell having at least one chain ligand. In some embodiments, the portion of the target cell comprises two chain ligands covalently attached to the branching group. In some embodiments, the portion of the target cell comprises three chain ligands covalently attached to the branching group.
[0462] In some embodiments, the portion of the target cell comprises a branched group containing one or more groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some embodiments, the branched group comprises a branched aliphatic group containing groups selected from the group consisting of alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the branched aliphatic group comprises groups selected from the group consisting of alkyl, amino, oxo, amide, and ether groups. In some such embodiments, the branched aliphatic group comprises groups selected from the group consisting of alkyl, amino, and ether groups. In some such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In some embodiments, the branched group comprises a monocyclic or polycyclic ring system.
[0463] In some embodiments, each chain of the cell-targeting portion comprises one or more groups selected from any combination of: alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphate diester, and polyethylene glycol. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from: alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from: alkyl, phosphate diester, ether, amino, oxo, and amide. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from: alkyl, ether, amino, oxo, and amide. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from: alkyl, amino, and oxo. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from alkyl and oxo. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from alkyl and phosphate diesters in any combination. In some embodiments, each chain comprises at least one phosphorus-linking group or a neutral linking group. In some embodiments, each chain comprises a chain of about 6 to about 20 atoms in length. In some embodiments, each chain comprises a chain of about 10 to about 18 atoms in length. In some embodiments, each chain comprises a chain of about 10 atoms in length.
[0464] In some embodiments, each ligand in the cell-targeting portion has affinity for at least one type of receptor on the target cell. In some embodiments, each ligand has affinity for at least one type of receptor on the surface of mammalian hepatocytes. In some embodiments, each ligand has affinity for the hepatic desialylate glycoprotein receptor (ASGP-R). In some embodiments, each ligand is a carbohydrate. In some embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and trehalose. In some embodiments, each ligand is N-acetylgalactosamine (GalNAc). In some embodiments, the cell-targeting portion contains three GalNAc ligands. In some embodiments, the cell-targeting portion contains two GalNAc ligands. In some embodiments, the cell-targeting portion contains one GalNAc ligand.
[0465] In some embodiments, each ligand of the cell-targeting portion is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In some such embodiments, the conjugation group comprises a carbohydrate cluster (see, for example, Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem., 2004, 47, 5798-5808, which are incorporated herein by reference in their entirety). In some such embodiments, each ligand is an amino sugar or a sulphose. For example, amino sugars can be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucanopyranose, 4,6-dideoxy-4-carbamoyl-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucanopyranose and N-sulfo-D-glucosamine, and N-ethanolyl-α-neuraminic acid. Sulfoses, for example, can be selected from 5-thio-β-D-glucanopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucanopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucanopyranoside.
[0466] In some embodiments, the conjugation group comprises a portion of the target cell having the following formula:
[0467]
[0468] In some embodiments, the conjugation group comprises a portion of the target cell having the following formula:
[0469]
[0470] In some embodiments, the conjugation group comprises a portion of the target cell having the following formula:
[0471]
[0472] In some embodiments, the compounds described herein contain a conjugation group described herein as "LICA-1". The following shows that LICA-1 has no optional cleavable portion at the end of the conjugation linker:
[0473]
[0474] In some embodiments, the compound described herein comprises LICA-1 and a cleavable portion within the conjugate connector, the compound having the following formula:
[0475]
[0476] 'oligo' is an oligonucleotide.
[0477] Representative disclosures that teach the preparation of certain of the conjugation groups mentioned above, as well as compounds containing conjugation groups, chains, conjugation linkers, branching groups, ligands, cleavable moieties, and other modifications, include, but are not limited to, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 9,127,276, US 2006 / 0148740, US 2011 / 0123520, WO2013 / 033230, and WO 2012 / 037254, Biessen et al., J. Med. Chem. [Journal of Medicinal Chemistry] 1995, 38, 1846-1852, Lee et al., Bioorganic & Medicinal Chemistry, 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem., 2001, 276, 37577-37584; Rensen et al., J. Med. Chem., 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem., 1999, 42, 609-618; and Valentijn et al., Tetrahedron, 1997, 53, 759-770. Each of these references is incorporated herein by reference in its entirety.
[0478] In some embodiments, the compounds described herein comprise modified oligonucleotides containing a notched or fully modified motif and conjugate groups comprising at least one, two, or three GalNAc ligands. In some embodiments, the compounds described herein contain conjugation groups found in any of the following references: Lee, Carbohydr Res [Carbohydrate Research], 1978, 67, 509-514; Connolly et al., J Biol Chem [Journal of Biochemistry], 1982, 257, 939-945; Pavia et al., Iht J Pep Protein Res [International Journal of Peptide and Protein Research], 1983, 22, 539-548; Lee et al., Biochem [Biochemistry], 1984, 23, 4255-4261; Lee et al., Glycoconjugate J [Journal of Glycoconjugates], 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett [Tetrahedron Letters], 1990, 31, 2673-2676; Biessen et al., J Med Chem [Journal of Medicinal Chemistry], 1995, 38, 1538-1546; Valentijn et al., Tetrahedron [Tetrahedron], 1997, 53, 759-770; Kim et al., Tetrahedron Lett [Tetrahedron Letters], 1997, 38, 3487-3490; Lee et al., Bioconjug Chem [Chemistry of Bioconjugations], 1997, 8, 762-765; Kato et al., Glycobiol [Glycobiology], 2001, 11, 821-829; Rensen et al., J Biol Chem [Journal of Biochemistry], 2001, 276, 37577-37584; Lee et al., Methods Enzymol [Enzymological Methods], 2003, 362, 38-43; Westerlind et al., Glycoconjug J [Journal of Glycoconjugates], 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500;Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., AngewChemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther [Gene Therapy], 2004, 11, 457-464; Sato et al., J Am Chem Soc [Journal of the American Chemical Society], 2004, 126, 14013-14022; Lee et al., J Org Chem [Journal of Organic Chemistry], 2012, 77, 7564-7571; Biessen et al., FASEB J [Journal of the Federation of American Societies of Laboratory Biology], 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem [Chemistry of Bioconjugations], 1997, 8, 935-940; Duff et al., Methods Enzymol [Enzymatic Methods], 2000, 313, 297-321; Maier et al., Bioconjug Chem [Chemistry of Bioconjugations], 2003, 14, 18-29; Jayaprakash et al., Org Lett, Organic Letters, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Development, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International Applications: WO 1998 / 013381; WO 2011 / 038356; WO 1997 / 046098; WO 2008 / 098788; WO 2004 / 101619; WO 2012 / 037254; WO 2011 / 120053;WO2011 / 100131;WO 2011 / 163121; WO 2012 / 177947; WO 2013 / 033230; WO 2013 / 075035; WO2012 / 083185; WO 2012 / 083046; WO 2009 / 082607; WO 2009 / 134487; WO 2010 / 144740; WO2010 / 148013; WO 1997 / 020563; WO 2010 / 088537; WO 2002 / 043771; WO 2010 / 129709; WO2012 / 068187; WO 2009 / 126933; WO 2004 / 024757;WO 2010 / 054406; WO 2012 / 089352; WO2012 / 089602; WO 2013 / 166121; WO 2013 / 165816; US Patents 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,72 0; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publication US 2011 / 0097264; US 2011 / 0097265; US 2013 / 0004427; US 2005 / 0164235; US 2006 / 0148740; US 2008 / 0281044; US2010 / 0240730; US 2003 / 0119724; US 2006 / 0183886; US 2008 / 0206869; US 201I / 0269814; US 2009 / 0286973; US 2011 / 0207799; US 2012 / 0136042; US 2012 / 0165393;US 2008 / 0281041;US 2009 / 0203135; US 2012 / 0035115; US 2012 / 0095075; US 2012 / 0101148; US2012 / 0128760; US 2012 / 0157509; US 2012 / 0230938;US 2013 / 0109817; US 2013 / 0121954; US 2013 / 0178512; US 2013 / 0236968; US 2011 / 0123520; US 2003 / 0077829; US 2008 / 0108801; and US 2009 / 0203132; each of these references is incorporated herein by reference in its entirety.
[0479] Composition and method for preparing pharmaceutical composition
[0480] The compounds described herein may be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The composition and the method used to formulate the pharmaceutical composition depend on several criteria, including but not limited to the route of administration, disease severity, or dose to be administered.
[0481] Some embodiments provide pharmaceutical compositions comprising one or more compounds or salts thereof. In some embodiments, these compounds are antisense compounds or oligomeric compounds. In some embodiments, these compounds comprise or consist of modified oligonucleotides. In some such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more compounds. In some embodiments, such a pharmaceutical composition consists of a sterile saline solution and one or more compounds. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more compounds and sterile water. In some embodiments, the pharmaceutical composition consists of a compound and sterile water. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In some embodiments, the pharmaceutical composition consists of one or more compounds and sterile PBS. In some embodiments, the sterile PBS is pharmaceutical grade PBS. The composition and the method of formulating the pharmaceutical composition depend on several criteria, including but not limited to the route of administration, disease severity, or dose to be administered.
[0482] Compounds described herein that target the PNPLA3 nucleic acid can be utilized in pharmaceutical compositions obtained by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Thus, in one embodiment, the method described herein employs a pharmaceutical composition comprising a compound targeting the PNPLA3 nucleic acid and a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent is water. In some embodiments, the compound comprises or is composed of the modified oligonucleotides provided herein.
[0483] Pharmaceutical compositions comprising the compounds provided herein encompass any pharmaceutically acceptable salt, ester, or salt of such esters, or any other oligonucleotide that, upon administration to animals (including humans), provides (directly or indirectly) a biologically active metabolite or its residue. In some embodiments, these compounds are antisense compounds or oligomeric compounds. In some embodiments, the compound comprises or is composed of modified oligonucleotides. Thus, for example, this disclosure also relates to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0484] Prodrugs may include additional nucleosides incorporated into one or both ends of a compound, which are cleaved in vivo by endogenous nucleases to form the active compound.
[0485] In some embodiments, these compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
[0486] Certain selected compounds
[0487] The effects of approximately 2,384 newly designed compounds of varying lengths, chemical compositions, and motifs on human PNPLA3 mRNA were tested in vitro across several cell types (Example 1). Of the 2,384 compounds tested in vitro for single-dose potency, over 400 selected compounds were tested for dose-dependent inhibition in A431 cells (Example 2). Of the over 400 compounds tested by dose-response assays, compounds were further screened for high-dose tolerance in a BALB / c mouse model, and 87 oligonucleotides were selected for in vivo efficacy in a PNPLA3 transgenic mouse model.
[0488] Of the 87 oligonucleotides tested in transgenic mouse models, 23 were selected for further testing in preclinical rodel models for tolerability. Body weight and organ weight, liver function markers (such as alanine aminotransferase, aspartate aminotransferase, and bilirubin), and kidney function markers (such as BUN and creatinine) were measured in in vivo rodent tolerance models. In CD1 mouse models and Sprague-Dawley rat models, ION 975591, 975605, 975612, 975613, 975616, 975617, 975735, 975736, 994282, and 994284 were found to be tolerable (Examples 5 and 6).
[0489] The efficacy of these compounds was further tested in multiple-dose assays in PNPLA3 transgenic mice (Example 7).
[0490] The tolerability of ION 994284, 97605, 975616, 994282, 975613, 975617, 975735, 975736, and 975612 in cynomolgus monkeys was tested (Example 8). Treatment with the compounds was well tolerated in the monkeys.
[0491] Therefore, this document provides compounds having any one or more improved properties. In some embodiments, the compounds described herein are potent and tolerable.
[0492] Example
[0493] The following examples illustrate the screening process for identifying lead compounds targeting PNPLA3. ION 994284, 97605, 975616, 994282, 975613, 975617, 975735, 975736, and 975612 lead to high potency and tolerability.
[0494] Non-restrictive disclosures and content incorporated through reference
[0495] Although the sequence listing attached to this document identifies each sequence as “RNA” or “DNA” as needed, those sequences can actually be modified with any combination of chemical modifications. Those skilled in the art will readily recognize that names such as “RNA” or “DNA” to describe modified oligonucleotides are arbitrary in certain circumstances. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar (2'-OH for DNA) or RNA with a modified base (thymine (methylated uracil) for RNA).
[0496] Therefore, the nucleic acid sequences provided herein (including, but not limited to, those listed in the sequence listing) are intended to cover nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleotides. As another example, and not a limitation, oligonucleotides having the nucleotide sequence “ATCGATCG” cover any oligonucleotide having such a nucleotide sequence, whether modified or unmodified, including, but not limited to, such compounds containing RNA bases, such as those having the sequence “AUCGAUCG”, and those having some DNA bases and some RNA bases such as “AUCGATCG”, and those having other modified nucleotides such as “AT”. m The compound of "CGAUCG" (in which m C represents a cytosine base containing a methyl group at the 5-position.
[0497] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomers, which, in absolute stereochemistry, can be defined as (R) or (S), or as α or β (e.g., for glycoanomers), or as (D) or (L) (e.g., for amino acids), etc. The compounds provided herein that are written or described as having certain stereoisomers include only those shown. The compounds provided herein that are written or described in undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, all tautomeric forms of the compounds provided herein are included unless otherwise stated. Unless otherwise stated, the oligomeric compounds and modified oligonucleotides described herein are intended to include the corresponding salt forms.
[0498] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes indicating the element. For example, the compounds contained in this article cover those containing hydrogen atoms for each 1 All possible deuterium substitutions of the hydrogen atom. Isotopic substitutions covered by the compounds in this article include, but are not limited to: 2 H or 3 H replaces 1 H, 13 C or 14 C replaces 12 C 15 N replaces 14 N、 17 O or 18 O replaces 16 O, and 33 S, 34 S, 35 S or 36 S replaces 32 S.
[0499] While some of the compounds, compositions, and methods described herein have been specifically described with reference to certain embodiments, the following examples are illustrative only and are not intended to limit the scope of the compounds described herein. All references cited in this application are incorporated herein by reference in their entirety.
[0500] Example 1: Antisense inhibition of human PNPLA3 in A431 cells
[0501] Antisense oligonucleotides targeting PNPLA3 nucleic acid were designed, and their effects on PNPLA3 mRNA in vitro were tested. These antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are presented in separate tables below.
[0502] The newly designed chimeric antisense oligonucleotides in the table below are designed as 3-10-3cEt nick structures. These nick structures are 16 nucleotides long, with a central nick segment consisting of ten 2'-deoxy nucleotides and flanking segments in the 5' and 3' directions, each flanking segment containing three nucleotides. Each nucleotide in the 5' flanking segment and each nucleotide in the 3' flanking segment is modified with a cEt sugar. The internucleotide linkages throughout each nick structure are phosphate thioester (P=S) linkages. All cytosine residues throughout each nick structure are 5-methylcytosine.
[0503] “Start site” indicates the most 5' nucleotide in the human gene sequence targeted by the cleavage. “Termination site” indicates the most 3' nucleotide in the human gene sequence targeted by the cleavage. Each cleavage listed in the table below targets human PNPLA3 mRNA (designated herein as SEQ ID NO: 1 (GENBANK accession number NM_025225.2)) or the human PNPLA3 genome sequence (designated herein as SEQ ID NO: 2 (GENBANK accession number NC_000022.11 truncated from nucleotides 43921001 to 43954500)). 'n / a' indicates that the antisense oligonucleotide does not target this specific gene sequence with 100% complementarity.
[0504] Study 1
[0505] A431 cells cultured at a density of 20,000 cells / well were transfected with 4,000 nM antisense oligonucleotides via free uptake. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. The human primer-probe set RTS36070 (forward sequence CCTTGGTATGTTCCTGCTTCA, referred to herein as SEQ ID NO: 11; reverse sequence GTTGTCACTCACTCCTCCATC, referred to herein as SEQ ID NO: 12; probe sequence TGGCCTTATCCCTCCTTCCTTCAGA, referred to herein as SEQ ID NO: 13) was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to total RNA content, as indicated by... The measured values are presented as the percentage of PNPLA3 inhibition relative to untreated control cells.
[0506] Table 1
[0507] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0508]
[0509]
[0510] Table 2
[0511] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0512]
[0513]
[0514] Table 3
[0515] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0516]
[0517]
[0518]
[0519] Table 4
[0520] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0521]
[0522]
[0523] Table 5
[0524] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0525]
[0526]
[0527]
[0528] Table 6
[0529] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0530]
[0531]
[0532] Table 7
[0533] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0534]
[0535]
[0536]
[0537] Table 8
[0538] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0539]
[0540]
[0541] Table 9
[0542] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0543]
[0544]
[0545] Table 10
[0546] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0547]
[0548]
[0549]
[0550] Table 11
[0551] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0552]
[0553]
[0554] Table 12
[0555] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0556]
[0557]
[0558]
[0559] Table 13
[0560] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0561]
[0562]
[0563]
[0564] Table 14
[0565] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0566]
[0567]
[0568] Table 15
[0569] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0570]
[0571]
[0572] Table 16
[0573] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0574]
[0575]
[0576]
[0577] Table 17
[0578] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0579]
[0580]
[0581] Table 18
[0582] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0583]
[0584]
[0585] Table 19
[0586] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0587]
[0588]
[0589]
[0590] Table 20
[0591] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0592]
[0593]
[0594] Table 21
[0595] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0596]
[0597]
[0598] Table 22
[0599] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0600]
[0601]
[0602]
[0603] Table 23
[0604] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0605]
[0606]
[0607] Table 24
[0608] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0609]
[0610]
[0611] The human primer-probe set RTS36075 (forward sequence TGAGGCTGGAGGGAGATG, referred to as SEQ ID NO: 14 in this paper; reverse sequence GCTCATGTATCCACCTTTGTCT, referred to as SEQ ID NO: 15 in this paper; probe sequence CTAGACCACCTGCGTCTCAGCATC, referred to as SEQ ID NO: 16 in this paper) was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted based on total RNA content, and these levels were then measured using... The measured values are presented as the percentage of PNPLA3 inhibition relative to untreated control cells.
[0612] Table 25
[0613] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0614]
[0615]
[0616]
[0617] Table 26
[0618] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0619]
[0620]
[0621] Study 2
[0622] A431 cells cultured at a density of 5,000 cells / well were transfected with 1,000 nM antisense oligonucleotides via free uptake. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. The human primer-probe set RTS36070 was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to total RNA content, as indicated by... The measured values are presented as the percentage of PNPLA3 inhibition relative to untreated control cells.
[0623] Table 27
[0624] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0625]
[0626]
[0627] Table 28
[0628] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0629]
[0630]
[0631]
[0632] Table 29
[0633] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0634]
[0635]
[0636] Table 30
[0637] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0638]
[0639]
[0640] Table 31
[0641] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0642]
[0643]
[0644] Table 32
[0645] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0646]
[0647]
[0648] Table 33
[0649] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0650]
[0651]
[0652] Table 34
[0653] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0654]
[0655]
[0656]
[0657] Table 35
[0658] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0659]
[0660]
[0661] Table 36
[0662] Inhibition of PNPLA3 mRNA by 3-10-3cEt nick bodies targeting SEQ ID NO: 1 and 2
[0663]
[0664]
[0665] Example 2: Dose-dependent antisense inhibition of human PNPLA3 in A431 cells
[0666] The nick bodies from Example 1, exhibiting significant in vitro inhibition of PNPLA3 mRNA, were selected and tested in A431 cells at different doses. These antisense oligonucleotides were tested in a series of experiments with similar culture conditions. The results of each experiment are presented in a separate table below. Cells were plated at a density of 10,000 cells / well and transfected with different concentrations of antisense oligonucleotides for free uptake as specified in the table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and PNPLA3 mRNA levels were measured by quantitative real-time PCR. The human primer and probe set RTS36070 was used to measure mRNA levels. PNPLA3 mRNA levels were adjusted according to total RNA content, as indicated by... The measured values are presented as the percentage of PNPLA3 inhibition relative to untreated control cells.
[0667] The half-maximal inhibitory concentration (IC50) for each oligonucleotide was also presented. PNPLA3 mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0668] Table 37
[0669] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0670]
[0671] Table 38
[0672] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0673]
[0674] Table 39
[0675] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0676]
[0677]
[0678] Table 40
[0679] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0680]
[0681] Table 41
[0682] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0683]
[0684]
[0685] Table 42
[0686] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0687]
[0688] Table 43
[0689] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0690]
[0691]
[0692] Table 44
[0693] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0694]
[0695] Table 45
[0696] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0697]
[0698]
[0699] Table 46
[0700] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0701]
[0702] Table 47
[0703] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0704]
[0705] Table 48
[0706] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0707]
[0708] Table 49
[0709] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0710]
[0711] Table 50
[0712] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0713]
[0714]
[0715] Table 51
[0716] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0717]
[0718] Table 52
[0719] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0720]
[0721]
[0722] Table 53
[0723] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0724]
[0725] Table 54
[0726] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0727]
[0728]
[0729] Table 55
[0730] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0731]
[0732] Table 56
[0733] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0734]
[0735]
[0736] Table 57
[0737] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0738]
[0739] Table 58
[0740] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0741]
[0742]
[0743] Table 59
[0744] Multiple dose assay of 3-10-3cEt nick body in A431 cells
[0745]
[0746] Example 3: Tolerance of modified oligonucleotides targeting human PNPLA3 in BALB / c mice
[0747] BALB / c mice are a multipurpose mouse model frequently used for safety and efficacy testing. Mice were treated with antisense oligonucleotides selected from the studies described above, and changes in the levels of different plasma chemomarkers were assessed.
[0748] The Ionis oligonucleotides selected from the above studies will be conjugated with a 3'-THA-C6-GalNAc3-(3R,5S)-5-(hydroxymethyl)pyrrolidine-3-ol phosphate end cap (hereinafter referred to as 3'-THA).
[0749] treat
[0750] Six- to seven-week-old male mice were administered a single subcutaneous injection of 200 mg / kg of the modified oligonucleotide. A group of male BALB / c mice were injected with PBS. Mice were euthanized 72–96 hours after the single dose, and plasma was harvested for further analysis.
[0751] To assess the effects of modified oligonucleotides on liver function, plasma transaminase levels were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). Modified oligonucleotides that caused transaminase level changes beyond the expected range of antisense oligonucleotides were excluded from further studies. Oligonucleotides deemed tolerable in this study and selected for further evaluation are listed in the table below. 'Mother oligonucleotide' indicates an Ionis oligonucleotide already described in the above studies, conjugated to 3'-THA, and tested in this study.
[0752] Table 60
[0753] Antisense oligonucleotides in BALB / c mouse studies
[0754]
[0755]
[0756]
[0757] Example 4: The antisense inhibitory effect of PNPLA3 in a transgenic mouse model
[0758] A wild-type C57BL / 6 PNPLA3 transgenic mouse model was used, derived from the University of California, Irvine. This mouse model contained a genome construct with the entire PNPLA3 gene Foss plasmid, generously provided by the University of Washington. The efficacy of Ionis oligonucleotides was evaluated in this model.
[0759] treat
[0760] Transgenic mice were kept in a 12-hour light-dark cycle and fed an arbitrary amount of normal Purina mouse food. Animals were acclimatized to the research equipment for at least 7 days before starting the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtration through a 0.2-micron filter. The oligonucleotides were dissolved in 0.9% PBS for injection.
[0761] hPNPLA3 Tg mice were randomly divided into groups of two. On days 1 and 8, each group received a subcutaneous injection of Ionis oligonucleotide at a dose of 2.5 mg / kg. On days 1 and 8, one group of four mice received a subcutaneous injection of PBS. The saline-treated group served as the control group, and the oligonucleotide-treated group was compared with this control group.
[0762] RNA analysis
[0763] On day 10, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. Primer and probe sets RTS36070 and RTS36075 were used to measure PNPLA3 mRNA levels. Results are presented relative to a PBS control. Percentage of normalized mRNA change. As presented in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant reduction in PNPLA3 mRNA compared to the PBS control. '0' indicates that these oligonucleotides do not inhibit mRNA expression.
[0764] Table 61
[0765] The percentage of PNPLA3 mRNA inhibition in the liver of transgenic mice compared to the PBS control.
[0766]
[0767]
[0768]
[0769] Example S: Tolerance of modified oligonucleotides targeting human PNPLA3 in CD1 mice
[0770] Mice (Charles River, Massachusetts) are multipurpose mouse models frequently used for safety and efficacy testing. Mice were treated with Ionis antisense oligonucleotides selected from the studies described above, and changes in the levels of different plasma chemomarkers were assessed.
[0771] The Ionis oligonucleotides selected from the above studies were conjugated with a 5'-trihexylamino-(THA)-C6GalNAC3 cap (hereinafter referred to as 5'-THA). The Ionis oligonucleotides tested are presented in the table below. 'Unconjugated parent ION number' refers to the Ionis oligonucleotide with the same sequence described in the above in vitro studies. '3'-THA counterpart ION number' refers to the 3'-THA conjugated oligonucleotide with the same sequence that was evaluated in the above mouse studies.
[0772] Table 62
[0773] 5'-THA oligonucleotides tested in CD1 mouse tolerance studies
[0774]
[0775]
[0776] treat
[0777] Each group of four CD1 mice was subcutaneously injected with 15 mg / kg of Ionis oligonucleotide weekly for 6 weeks, with a loading dose administered on day 4 (a total of 8 doses). A group of male CD1 mice was subcutaneously injected with PBS for 6 weeks. Forty-eight hours after the last administration, the mice were euthanized, and organs and plasma were harvested for further analysis.
[0778] plasma chemical markers
[0779] To assess the effects of Ionis oligonucleotides on liver and kidney function, plasma levels of transaminases (ALT and AST), albumin, total bilirubin, and creatinine were measured at week 3 using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). Results are presented in the table below. Ionis oligonucleotides that caused changes in the levels of any liver or kidney function markers outside the expected range were excluded in further studies.
[0780] Table 63
[0781] Plasma chemical marker levels in CD1 mice at week 3
[0782]
[0783]
[0784] Hematological tests
[0785] Blood samples obtained from the selected mouse groups were sent to IDEXX BioResearch at week 6 for platelet count measurements. The results are presented in the table below. Ionis oligonucleotides that caused platelet count changes outside the expected range of the antisense oligonucleotide were excluded in further studies.
[0786] Table 64
[0787] Platelet count in CD1 mice
[0788]
[0789] Example 6: Tolerance to modified oligonucleotides targeting human PNPLA3 in Spratly-Dowley rats
[0790] The Sprat-Dowley rat is a multi-purpose model used for safety and efficacy evaluation. Rats were treated with Ionis antisense oligonucleotides from the studies described in the examples above, and changes in the levels of different plasma chemomarkers were assessed.
[0791] treat
[0792] Male Spratländer rats were kept in a 12-hour light-dark cycle and fed an arbitrary amount of normal Purina rat food (diet 500g). Four Spratländer rats per group were subcutaneously injected weekly with 15 mg / kg of Ionis oligonucleotides for 6 weeks, including a loading dose on day 4 (a total of 8 doses). Forty-eight hours after the last administration, the rats were euthanized, and organs and plasma were harvested for further analysis.
[0793] plasma chemical markers
[0794] To assess the effects of Ionis oligonucleotides on liver function, plasma transaminase levels were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). Plasma levels of ALT (alanine aminotransferase) and AST (aspartate aminotransferase) were measured, and these results are presented in the table below, in IU / L. Plasma levels of bilirubin, creatinine, albumin, and BUN were also measured using the same clinical chemistry analyzer, and these results are also presented in the table below, in mg / dL. Ionis oligonucleotides that would cause changes in the levels of any liver function markers outside the expected range of antisense oligonucleotides were excluded from further studies.
[0795] Table 65
[0796] Plasma chemical markers in Spra-Dowley rats
[0797]
[0798] Kidney function
[0799] To assess the effects of Ionis oligonucleotides on renal function, urinary protein and creatinine levels were measured using an automated clinical chemistry analyzer (Beckman Coulter AU480, Brea, CA). The total protein to creatinine ratio is presented in the table below. Ionis oligonucleotides that resulted in ratio changes outside the expected range for antisense oligonucleotides were excluded from further studies.
[0800] Table 66
[0801] The ratio of total protein to creatinine in Spratly-Dowley rats
[0802] PBS 1.5 975591 2.0 975605 1.6 975612 1.9 975613 2.3 975616 2.0 975617 1.4 975735 2.2 975736 1.1 994282 2.1 994284 2.1
[0803] organ weight
[0804] At the end of the study, the weights of the liver, heart, spleen, and kidneys were measured and are presented in the table below. Ionis oligonucleotides that would cause any changes in organ weight beyond the expected range of antisense oligonucleotides were excluded from further studies.
[0805] Table 67
[0806] Organ weight (g)
[0807] liver kidney spleen brine 16 3 l 975591 16 4 1 975605 21 3 1 975612 12 3 l 975613 16 3 1 975616 15 3 1 975617 19 4 2 975735 14 4 l 975736 15 3 1 994282 14 3 l 994284 15 3 1
[0808] Example 7: The antisense inhibitory effect of PNPLA3 in a transgenic mouse model
[0809] Ionis oligonucleotides were tested in a multi-dose assay in the hPNPLA3 Tg model.
[0810] treat
[0811] Transgenic mice were kept in a 12-hour light-dark cycle and fed an arbitrary amount of normal Purina mouse food. Animals were acclimatized to the research equipment for at least 7 days before starting the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtration through a 0.2-micron filter. The oligonucleotides were dissolved in 0.9% PBS for injection.
[0812] Study 1
[0813] hPNPLA3 Tg mice were randomly divided into groups of four. On days 1, 5, 8, 15, and 23, each group received a weekly subcutaneous injection of Ionis oligonucleotides at doses of 5 mg / kg, 1 mg / kg, or 0.25 mg / kg. On days 1, 5, 8, 15, and 23, one group of four mice received a subcutaneous injection of PBS. The saline-treated group served as the control group, and the oligonucleotide-treated group was compared to this control group.
[0814] RNA analysis
[0815] On day 26, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. Primer and probe sets RTS36070 and RTS36075 were used to measure PNPLA3 mRNA levels. Results are presented relative to a PBS control. Percentage of normalized mRNA change. As presented in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant dose-dependent reduction in PNPLA3 mRNA compared to the PBS control.
[0816] Table 68
[0817] The percentage of PNPLA3 mRNA inhibition in the liver of transgenic mice compared to the PBS control.
[0818]
[0819]
[0820] Study 2
[0821] hPNPLA3 Tg mice were randomly divided into groups of four. On days 1, 5, 8, 15, and 23, each group received weekly subcutaneous injections of Ionis oligonucleotides at doses of 5 mg / kg, 2.5 mg / kg, 1 mg / kg, 0.5 mg / kg, or 0.25 mg / kg. On days 1, 5, 8, 15, and 23, one group of four mice received subcutaneous injections of PBS. The saline-treated group served as the control group, and the oligonucleotide-treated group was compared to this control group.
[0822] RNA analysis
[0823] On day 26, RNA was extracted from the liver for real-time PCR analysis to measure PNPLA3 mRNA expression. Primer and probe sets RTS36070 and RTS36075 were used to measure PNPLA3 mRNA levels. Results are presented relative to a PBS control. Percentage of normalized mRNA change. As presented in the table below, treatment with Ionis antisense oligonucleotides resulted in a significant dose-dependent reduction in PNPLA3 mRNA compared to the PBS control.
[0824] Table 69
[0825] The percentage of PNPLA3 mRNA inhibition in the liver of transgenic mice compared to the PBS control.
[0826]
[0827] Example 8: The role of modified oligonucleotides targeting human PNPLA3 in cynomolgus monkeys
[0828] Treat cynomolgus monkeys with Ionis antisense oligonucleotides selected from the studies described in the examples above. Assess the tolerability of the antisense oligonucleotides.
[0829] treat
[0830] Prior to the study, the monkeys were kept isolated, and their general health was monitored daily. The monkeys were 2–4 years old and weighed 2–4 kg. Nine groups of five male cynomolgus monkeys were randomly assigned to receive subcutaneous injections of Ionis oligonucleotides or PBS at four different sites on their backs in a clockwise rotation. For the first two weeks, the monkeys received 10 mg / kg of Ionis oligonucleotides twice weekly (days 1, 5, 9, and 14), and then once weekly for 10 weeks (days 21, 28, 35, 42, 49, 56, 63, 70, 77, and 84). A control group of five cynomolgus monkeys was injected with PBS in a similar manner.
[0831] During the study, the monkeys were observed twice daily for signs of illness or pain. Any animal experiencing brief or mild pain or suffering due to treatment, injury, or illness was relieved of pain by veterinary staff using approved analgesics or agents, in consultation with the study director. Any animal in poor health or in a potentially terminal condition was identified for further monitoring and possible euthanasia. The planned euthanasia was performed by exsanguination approximately 48 hours after the last administration of medication on day 86, under deep anesthesia. The protocol described in this example was approved by the Institutional Animal Care and Use Committee (IACUC).
[0832] Body weight and organ weight measurements
[0833] To assess the effects of Ionis oligonucleotides on the overall health of these animals, body weight and organ weight were measured. Body weight and organ weight were measured on day 86, and the data are presented in the table below. These results indicate that the effects of antisense oligonucleotide treatment on body weight and organ weight are within the expected range for antisense oligonucleotides. Specifically, treatment with ION 945616 was well tolerated in terms of body weight and organ weight in the monkeys.
[0834] Table 70
[0835] Final body weight and organ weight of cynomolgus monkeys
[0836] Weight(kg) Spleen (g) Kidney (g) Liver and gallbladder (g) PBS control 2797 2.6 13.1 53 994284 2789 3.3 14.7 69 975605 2685 4.1 12.2 58 975616 2868 3.1 12.9 63 994282 2782 4.4 12.1 62 975613 2704 3.0 13.5 60 975617 2761 3.8 14.1 61 975735 2765 4.1 15.5 67 975736 2844 3.0 14.1 66 975612 2711 2.8 13.2 60
[0837] Liver function
[0838] To assess the effects of Ionis oligonucleotides on liver function, blood samples were collected from all study groups on day 86. Monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without the need for anticoagulants used for serum separation. These tubes were kept at room temperature for at least 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. The levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of ALT and AST were measured, and these results are presented in the table below, expressed as IU / L. Similarly, bilirubin (a liver function marker) was measured and presented in the table below, expressed as mg / dL. These results indicate that the antisense oligonucleotides did not have an effect on liver function exceeding the expected range.
[0839] Table 71
[0840] liver function markers in cynomolgus monkey plasma
[0841]
[0842] Kidney function
[0843] To assess the effects of Ionis oligonucleotides on renal function, blood samples were collected from all study groups on day 86. Monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without the need for anticoagulants used for serum separation. These tubes were kept at room temperature for at least 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. BUN and creatinine levels were measured using a Toshiba 200FR NEO chemical analyzer (Toshiba Co., Japan). Results are presented in the table below, expressed in mg / dL.
[0844] Plasma chemistry data indicate that most Ionis oligonucleotides do not have any effect on renal function beyond the expected range for antisense oligonucleotides.
[0845] Table 72
[0846] Plasma BUN and creatinine levels (mg / dL) in cynomolgus monkeys
[0847] BUN Creatinine PBS control 23 0.8 994284 24 0.8 975605 27 0.7 975616 21 0.8 994282 24 0.8 975613 23 0.9 975617 21 0.7 975735 20 0.8 975736 23 0.8 975612 20 0.8
[0848] hematology
[0849] To assess any effects of Ionis oligonucleotides on hematological parameters in cynomolgus monkeys, blood samples of approximately 0.5 mL were collected from each of the available study animals on day 86. Samples were collected in tubes containing K2-EDTA. Samples were analyzed using an ADVIA 2120i hematology analyzer (Siemens, USA) for red blood cell (RBC) count, white blood cell (WBC) count, various white blood cell counts (e.g., monocytes, neutrophils, lymphocytes), and for platelet count, hemoglobin content, and hematocrit.
[0850] The data indicate that these oligonucleotides did not cause any changes in hematological parameters beyond the expected range for antisense oligonucleotides at this dose.
[0851] Table 73
[0852] Blood cell count in cynomolgus monkeys
[0853]
[0854] Table 74
[0855] Hematological parameters in cynomolgus monkeys
[0856]
[0857]
[0858] Pro-inflammatory protein analysis
[0859] To assess any inflammatory effects of Ionis oligonucleotides in cynomolgus monkeys, blood samples were collected for analysis. Monkeys were fasted overnight prior to blood collection. Approximately 1.5 mL of blood was collected from each animal and placed into tubes without anticoagulants for serum separation. These tubes were kept at room temperature for at least 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. C-reactive protein (CRP) and complement C3, synthesized in the liver and serving as inflammatory markers, were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan).
[0860] Example 9: Measurement of viscosity of antisense oligonucleotides targeting human PNPLA3
[0861] The viscosity of the antisense oligonucleotides selected from the studies described above was measured in order to screen for antisense oligonucleotides with a viscosity higher than 40 centipoise (cP). Oligonucleotides with a viscosity higher than 40 cP will have a viscosity lower than the optimal viscosity.
[0862] Oligonucleotides (32-35 mg) were weighed into glass vials, 120 μL of water was added, and the antisense oligonucleotides were dissolved in the solution by heating the vial at 50 °C. A portion (75 μL) of the preheated sample was pipetted into a microviscometer (Cambridge). The microviscometer was set to 25 °C, and the viscosity of the sample was measured. Another portion (20 μL) of the preheated sample was pipetted into 10 mL of water for UV reading at 260 nM at 85 °C (Cary UV instrument). These results are presented in the table below, where the concentration of each antisense oligonucleotide is 200 mg / mL, and it is shown that most antisense oligonucleotide solutions are at their optimal viscosity under the above standards.
[0863] Table 75
[0864] Viscosity of 200 mg / mL antisense oligonucleotide
[0865]
[0866]
[0867] Example 10: Designing oligonucleotides at the ION 975616 site
[0868] Design additional antisense oligonucleotides targeting PNPLA3 nucleic acids that overlap with the target site of ION 916333, which is the unconjugated form of ION 975616 and has different chemical modifications and motifs.
[0869] The newly designed chimeric antisense oligonucleotides in the table below are designed as 3-10-3cEt nick bodies or deoxy oligonucleotides, MOE oligonucleotides, and cEt oligonucleotides. These 3-10-3cEt nick bodies are 16 nucleotides long, with a central nick consisting of ten 2'-deoxy nucleotides and flanking segments in the 5' and 3' directions, each flanking segment containing three nucleotides. Each nucleotide in the 5' flanking segment and each nucleotide in the 3' flanking segment is cEt sugar modified. Nucleoside linkages throughout each nick body are phosphate thioester (P=S) linkages. All cytosine residues throughout each nick body are 5-methylcytosine. These deoxy oligonucleotides, MOE oligonucleotides, and (S)-cEt oligonucleotides are 16 nucleotides long, with these nucleotides having MOE sugar modification, (S)-cEt sugar modification, or deoxy modification. The 'Chemistry' column describes the sugar modification of each oligonucleotide. 'k' indicates (S)-cEt sugar modification; 'd' indicates deoxyribose; the number after 'd' indicates the number of deoxyriboses; and 'e' indicates MOE modification. Nucleoside linkages throughout each nick are phosphate thioester (P=S) linkages. All cytosine residues throughout each nick are 5-methylcytosine. The "start site" indicates the most 5' nucleotide in the human gene sequence (SEQ ID NO: 2) targeted by the nick.
[0870] Table 76
[0871] Modified oligonucleotides targeting human PNPLA3
[0872]
[0873]
[0874] Oligonucleotides were tested in a series of experiments. A-431 cells cultured at a density of 10,000 cells / well were treated with modified oligonucleotides diluted to different concentrations using free uptake. After approximately 48 hours of treatment, PNPLA3 mRNA levels were measured using the human PNPLA3 primer and probe set RTS36070 as previously described. PNPLA3 mRNA levels were adjusted according to total RNA content, as indicated by… The measured IC. 50 The ratios are presented in the table below, which is the IC50 ratio of the baseline oligonucleotide. 50 IC with this oligonucleotide 50 The ratio. Therefore, a larger value of this ratio indicates that the oligonucleotide is more active than the benchmark.
[0875] Table 77
[0876] The efficacy of modified oligonucleotides targeting human PNPLA3
[0877]
[0878] Example 11: Screening and selection of antisense oligonucleotides targeting human PNPLA3
[0879] S-restricted ethyl (cEt) modified 16-mer antisense oligonucleotides (ASOs) targeting the human PNPLA3 gene were screened and their potency in human HepG2 cells (delivered via electroporation) was tested. Human cEt ASO (5′-GAGTTAAGTGCTGGAC-3′; SEQ ID NO: 115) was selected for all subsequent pharmacological studies. The specificity of the target knockdown was demonstrated using a chemically matched scrambled control ASO (5′-GGCCAATACGCCGTCA-3′; SEQ ID NO: 2173).
[0880] HepG2 cells were purchased from [source missing]. (Manassas, Virginia). After thawing, the cells were plated in T-75 flasks and grown in minimum essential medium (MEM) containing 10% fetal bovine serum (FBS) (HyClone Laboratories, Logan, Utah).
[0881] Cells were seeded in 6-well or 24-well plates with coverslips for Oil Red O (ORO) staining. Cells were then incubated with MEM (2% FBS) and transfected for 24 h with either control or PNPLA3 ASO (1 μM) or control siRNA or PNPLA3 siRNA (10 nM) using lipofectamine 3000 (Thermo Scientific, Waltham, MA) according to the manufacturer's instructions. Cells were then incubated with MEM (FBS-free) for 24 h for further transfection. The control siRNA was a mixture of two negative control siRNA molecules (Ambion, Thermo Scientific, Waltham, MA). PNPLA3 siRNA is a mixture of three siRNA molecules (5′-GGUCCUCUCAGAUCUUGUGtt-3′ (SEQ ID NO: 2170); 5′-GGAGUGAGUGACAACGUACtt-3′ (SEQ ID NO: 2171); 5′-GGUUCUUGGAAGAGAAGGGtt-3′ (SEQ ID NO: 2172)) (Ambion, Thermo Technologies, Waltham, Massachusetts).
[0882] For Oil Red O (ORO) staining, images were acquired at 100x magnification using an Axio KS 400 imaging system and Axio version 4.8 software (Zeiss, Oberkochen, Germany). The ORO-stained areas were quantified using BioPix iQ 2.1.4 software (BioPix AB, Gothenburg, Sweden).
[0883] Total RNA was isolated from cells using the RNeasy mini kit (Qiagen, Valencia, CA). First-strand complementary DNA was synthesized from RNA using a reverse transcription kit (Applied Biosystems, Foster City, CA). PNPLA3 and β-ACTIN mRNA expression was assessed in HepG2 cells transfected with control ASO, PNPLA3 ASO, control siRNA, or PNPLA3 siRNA by real-time quantitative polymerase chain reaction (PCR). TaqMan probes (PNPLA3 probe: Hs00228747_ml; β-actin probe: Hs01060665_gl) and premixes (Life Technologies, Carlsbad, CA) were used according to the manufacturer's protocols. Real-time quantitative PCR assays were performed on a CFX real-time PCR detection system (Bio-Rad, Hercules, CA).
[0884] To test whether knockdown of the PNPLA3 148M mutant protein affects intracellular neutral lipid content, PNPLA3 was inhibited in HepG2 cells (homozygous for the PNPLA3 148M / M mutation) using ASO and siRNA as described in this paper. PNPLA3 ASO ( Figure 1 A) Approximately 70% reduction in endogenous PNPLA3 mRNA expression was observed. When intracellular neutral lipids were examined by ORO staining, a 40% reduction in intracellular lipid content was observed (PNPLA3 ASO). Figure 1 B, 1C). To confirm these data using independent methods, consistent results were observed by inhibiting PNPLA3 in these cells using siRNA (B, 1C). Figure 1 D-1F).
[0885] Example 12: Antisense oligonucleotide therapy in wild-type mice and PNPLA3 I148M knock-in mice
[0886] The materials and methods used in the examples in this paper are further described in Lindén et al., Molecular Metabolism 22:49-61, 2019, which is incorporated herein by reference in its entirety.
[0887] S-restricted ethyl (cEt) modified 16-mer ASOs targeting the mouse Pnpla3 gene were screened, and their potency in primary mouse embryonic cortical neurons was tested via free uptake. A potent mouse cEt ASO (5′-TATTTTTGGTGTATCC-3′; SEQ ID NO: 2174) was selected as a lead for all subsequent pharmacological studies. This mouse Pnpla3 ASO was modified by 5′-conjugation to triantennary-type N-acetylgalactosamine (GalNAc3) to further enhance in vivo hepatocyte targeting after subcutaneous administration. The specificity of the target knockdown was demonstrated using a chemically matched scrambling control, the GalNAc3-conjugated ASO (5′-GGCCAATACGCCGTCA-3′; SEQ ID NO: 2175). When administered at 10 mg / kg / week for six weeks to mice fed a NASH-induced diet (D09100301, Research Diets, New Brunswick, New Jersey (NJ)), the control, namely GalNAc3-conjugated ASO, did not affect body weight gain, liver weight, plasma alanine aminotransferase (ALT) or liver triglyceride levels compared to the saline-mediated control.
[0888] All animal experiments are conducted with humane care and have been approved by the Gothenburg Ethics Committee for Experimental Animals in Sweden. The facility is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC).
[0889] The human PNPLA3 I148M mutation was introduced into the mouse Pnpla3 gene by replacing the isoleucine codon with a methionine codon at amino acid position 148 and using homologous recombination. Initial mice were backcrossed with C57BL / 6N females to produce heterozygous Pnpla3 148I / M mice. Sequence-validated heterozygous Pnpla3 148I / M mice were crossed to produce experimental homozygous Pnpla3 148M / M and wild-type littermates (Pnpla3 148I / I), the latter serving as control mice for dietary challenge and ASO pharmacology studies. All experimental animals were validated for correct genotype using PCR before the start of the study and again using PCR after termination of pregnancy. Some experimental animals were also validated by cDNA sequencing. All animals were housed in transparent Makrolon cages with aspen wood bedding and nesting material, and the temperature (21±1℃) and humidity (50±10%) of the containment facility were controlled. Mice had free access to tap water and food and were kept in a 12-hour diurnal cycle.
[0890] Female Pnpla3 148M / M mice (n=21) and wild-type littermates (n=19) (6-8 weeks old) were fed a high-sucrose diet (70% sucrose; TD98090, Envigo, Huntingdon, UK) for 15 weeks. This experiment used female mice to replicate the model established by Smagris et al. (Hepatology 61(1): 108-118, 2015), who used female animals in their high-sucrose diet experiments. Furthermore, in pilot-scale experiments, female mice accumulated more triglycerides in the liver compared to male mice fed this diet. Furthermore, female mice fed a high-sucrose diet accumulated more hepatic triglycerides compared to those fed a standard diet containing 12% fat, 62% carbohydrates, and 26% protein (total energy content 3 kcal / g) (R3; Lactamin, Kimstad, Sweden). Hepatic lipid levels were assessed using a magnetic resonance imaging (MRI)-derived marker, proton density fat fraction (PDFF), after 5 weeks of high-sucrose feeding. Mice were then randomly assigned to GalNAc3-conjugated ASO study groups (n = 9–12 animals / group) based on pre-treatment body weight and hepatic lipid content. During the final 8 weeks of the study, mice in each group were administered either control ASO or Pnpla3 ASO (5 mg / kg / week, administered subcutaneously twice weekly via saline). Hepatic lipid levels were again assessed using MRI after 6 weeks of ASO administration. Before euthanizing unfasted mice between 8:00 AM and 10:00 AM, their metabolism was synchronized for 24 hours by withholding food from 8:00 AM to 8:00 PM, followed by free access to food again from 8:00 PM to 8:00 AM. Mice were euthanized with isoflurane (Forene, Abbot Scandinavia AB, Sweden), blood was collected and plasma separated, livers were collected, and fragments (from the same location in the left lateral lobe of all mice) were fixed in 4% formaldehyde in PBS for histology or flash-frozen in liquid N2 and stored at -80°C.
[0891] Male Pnpla3148 M / M mice (n=17) and wild-type littermates (n=17) (6–8 weeks old) were fed a high-fat (40%, containing 18% trans fat), carbohydrate (40%, containing 20% fructose), and cholesterol (2%) diet (NASH diet; D09100301, Research Diet, New Brunswick, NJ) for 26 weeks. In a separate study, wild-type male mice fed a NASH-induced diet were found to have elevated liver Pnpla3 mRNA, triglyceride levels, and plasma ALT levels compared to mice fed a conventional diet. Mice were assigned to GalNAc3-conjugated ASO groups (n=8–9 mice / group) based on body weight, and for the last 14 weeks, mice were given either control ASO or Pnpla3 ASO (5 mg / kg / week, administered subcutaneously twice weekly via saline). Before euthanizing unfasted mice between 8:00 and 10:00 AM, their metabolism was synchronized for 24 hours as described above. Mice were euthanized with isoflurane (Forene, Abbott Scandinavia, Sweden), blood was collected and plasma was separated, livers were collected, and fragments (from the same location in the left lateral lobe of all mice) were fixed in 4% formaldehyde in PBS for histology or flash-frozen in liquid N2 and stored at -80°C.
[0892] Example 13: Effects of Pnpla3 ASO on hepatic steatosis in wild-type and I148M mice fed a high-sucrose diet
[0893] To drive hepatic steatosis and assess the effect of Pnpla3 silencing on hepatic steatosis, homozygous Pnpla3148M / M (mutant) knock-in female mice and wild-type littermates were fed a high-sucrose diet (70%) for 15 weeks, as described in Example 11. During the last 8 weeks of the experiment, mice of both genotypes were treated with either GalNAc3-conjugated Pnpla3 or GalNAc3-conjugated control ASO. No increase in body weight or food intake was observed between the two groups. Figure 2 Differences in the weight of ovarian white adipose tissue (A and 2B). Furthermore, Pnpla3 ASO treatment did not affect blood glucose or insulin levels. Compared to control ASO, Pnpla3 ASO treatment significantly reduced liver expression of Pnpla3 mRNA (98% reduction, p < 0.0001) and the level of PNPLA3 protein on lipid droplets in both Pnpla3 mutant knock-in mice and wild-type mice (p < 0.0001). Figure 2 (C and 2D). Pnpla3 ASO treatment did not affect the expression of Pnpla3 mRNA in white adipose tissue.
[0894] Treatment with Pnpla3 ASO for six weeks reduced liver lipid levels in Pnpla3 mutant knock-in mice by 20%, as measured by MRI. Figure 2 F, p = 0.025). After 8 weeks of treatment, Pnpla3 mutant knock-in mice treated with Pnpla3 ASO showed reduced liver weight and decreased Oil Red O staining of neutral lipids in the liver (F, p = 0.025). Figure 2 E) Liver triglyceride levels decreased by 20% (p = 0.038) (as measured by biochemical analysis) Figure 2 F), but no change in circulating plasma triglyceride levels was observed ( Figure 2 G). Interestingly, Pnpla3 ASO treatment did not affect liver weight, lipid levels, or liver triglyceride content in wild-type mice. Figure 2 H-2J). The liver triglyceride content of Pnpla3 mutant knock-in mice treated with control ASO was 30% higher than that of wild-type mice treated with control ASO (Pnpla3 mutant knock-in mice = 5.7 ± 0.4 g / 100 g liver, wild-type mice = 4.4 ± 0.5 g / 100 g liver, p = 0.046).
[0895] Example 14: Effects of Pnpla3 ASO on liver inflammation and fibrosis in wild-type and I148M mice fed a NASH-induced diet
[0896] Male Pnpla3 mutant knock-in mice (n=17) and wild-type littermates (n=17) were fed a NASH-induced diet for 26 weeks, as described in Example 11. During the last 14 weeks of the experiment, mice of both genotypes were treated with either GalNAc3-conjugated Pnpla3 or GalNAc3-conjugated control ASO. No increase in body weight or food intake was observed between the two groups. Figure 3 Differences in the weight of epididymal white adipose tissue (A and 3B) or ASO. Furthermore, Pnpla3 ASO treatment did not affect blood glucose or insulin levels. Compared to control ASO, Pnpla3 ASO treatment significantly reduced (97%, p < 0.0001) liver expression of Pnpla3 mRNA in Pnpla3 mutant knock-in mice and wild-type mice, and persistently reduced the level of Pnpla3 protein on lipid droplets. Figure 3 (C and 3D). Using the NASH diet, which has a longer treatment period than the sucrose diet study (14 weeks and 8 weeks, respectively), Pnpla3 ASO treatment also reduced the expression of Pnpla3 mRNA in white adipose tissue.
[0897] Pnpla3 ASO treatment reduced plasma ALT levels in both genotype mice (Pnpla3 mutant knock-in mice p = 0.0006, wild-type mice p = 0.018), while plasma AST remained unchanged. Figure 3 E and 3F). Pnpla3 ASO treatment reduced liver weight only in Pnpla3 mutant knock-in mice and decreased triglyceride content in both Pnpla3 mutant knock-in mice (p = 0.002) and wild-type mice (p = 0.004), without observing changes in circulating plasma triglyceride levels. Figure 3 E and 3F).
[0898] Pnpla3 ASO treatment improved hepatic steatosis score (p = 0.007), lobular inflammation score (p = 0.018), NAFLD activity score (NAS) (p = 0.0003), and fibrosis stage (p = 0.031) in Pnpla3 mutant knock-in mice. Figure 4 A), while in wild-type mice only the hepatic steatosis score (p = 0.003) and NAS (p = 0.036) were improved (A). Figure 4 B). No ballooning degeneration of hepatocytes was found in any liver.
[0899] Example 15: Effects of Pnpla3 ASO on de novo lipogenesis and palmitoleic acid in wild-type and I148M mice fed a NASH-induced diet
[0900] Pnpla3 ASO treatment reduced the amount of neutral lipids in liver Oil Red O staining in both Pnpla3 mutant knock-in mice and wild-type mice. Figure 5 A). Pnpla3 ASO reduces the mRNA expression of lipogenesis genes (such as acetyl-CoA carboxylase 1 (Acc1) and stearoyl-CoA desaturase 1 (Scd1)) in both genotypes. Figure 5 B and 5C), indicating reduced hepatic lipogenesis. Pnpla3 ASO treatment reduced monounsaturated fatty acids (MUFAs), with p = 6.1 × 10⁻⁶ in both mutant and wild types. -5 and 7.6×10 -6 The relative amount of ) was increased, and the amount of polyunsaturated fatty acids (PUFAs) was increased, with p = 1.2 × 10 in the mutant and wild types, respectively. -4 and 1.3×10 -5 Regardless of genotype ( Figure 5 D-5E and Figure 6Specifically, compared to oleic acid, the MUFA reduction was only 2% (p = 0.034) and 5% (p = 0.001) in the mutant and wild types, respectively. The reduction in MUFA was even stronger in palmitoleic acid (16:1), with a reduction of 36% (p = 2.4 × 10⁻⁶) in both the mutant and wild types. -4 ) and 30% (1.0×10 -9 ).
[0901] Example 16: Effects of Pnpla3 ASO on haptoglobin, Mcp1, and Timp2 protein levels in wild-type and I148M mice fed a NASH-induced diet
[0902] Pnpla3 ASO treatment reduced plasma haptoglobin levels (p = 0.0005) and liver macrophage content (p = 0.047) in Pnpla3 mutant knock-in mice, but not in wild-type littermates. Figure 7 A-7C), indicating that Pnpla3 inhibition specifically reduced liver inflammation in mutant mice. Pnpla3 ASO treatment reduced hepatic Mcp1 (A-7C) levels in Pnpla3 mutant knock-in mice. Figure 7 D) Protein levels. Pnpla3 ASO treatment did not alter liver protein I11β in either genotype. Figure 7 E), I16 Figure 7 F), Tnfα( Figure 7 G) or αSma( Figure 7 The expression level of H). Pnpla3 ASO treatment reduced the liver expression of type I collagen α1 (Col1a1) mRNA in Pnpla3 mutant knock-in mice and wild-type mice. Figure 8 A and 8B). Pnpla3 ASO treatment reduced liver collagen in Pnpla3 mutant knock-in mice, as measured by immunohistochemistry (p = 0.04). Figure 8 A-8C). Although ASO treatment tends to reduce hepatic hydroxyproline levels, no significant difference was observed. Figure 8 D and 8E). Pnpla3 ASO treatment reduced the level of Timp2 protein in the liver of Pnpla3 mutant knock-in mice (p = 0.007). Figure 9 A). Pnpla3 ASO treatment did not alter the liver protein Mmp2 in either genotype. Figure 9 B), Timp1 Figure 9 C) or Tgfβr2 ( Figure 9 The level of expression of D).
Claims
1. Use in the preparation of a medicament for treating an individual with liver disease at risk of developing liver disease, wherein the liver disease is selected from non-alcoholic fatty liver disease (NAFLD), hepatic steatosis, cirrhosis, hepatocellular carcinoma, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, or primary sclerosing cholangitis. The individual in question is human and possesses the I148M mutation in PNPLA3; and The compound targeting PNPLA3 contains the following formula or a salt thereof:
2. The use as described in claim 1, wherein the liver disease is selected from non-alcoholic steatohepatitis (NASH) and alcoholic steatohepatitis (ASH).
3. Use of a compound targeting PNPLA3 in the preparation of a medicament for reducing one or more of hepatic steatosis, liver inflammation, liver fibrosis, and hepatic steatosis in an individual, wherein the individual is human and has the I148M mutation in PNPLA3; and The compound targeting PNPLA3 contains the following formula or a salt thereof:
4. The use as described in claim 1, wherein the liver disease is hepatic steatosis.
5. The use as described in any of the preceding claims, wherein the compound targeting PNPLA3 is in a pharmaceutically acceptable salt form.
6. The use as described in claim 5, wherein the pharmaceutically acceptable salt is a sodium salt.
7. The use as described in claim 5, wherein the pharmaceutically acceptable salt is a potassium salt.
Citation Information
Patent Citations
Lipid-based formulations
US20030077829A1
Ligands to enhance cellular uptake of biomolecules
US20030119724A1
Nuclease resistant chimeric oligonucleotides
US20030158403A1
Nuclease resistant chimeric oligonucleotides
US20030175906A1
Modified iRNA agents
US20050164235A1