Anti-canine Fibroblast Activation Protein monoclonal antibody cross-reactive with mouse and human Fibroblast Activation Protein (FAP)

By designing antibodies and scFv that specifically bind to human, canine, and mouse FAP, the problem of lack of cross-reactive antibodies in the existing technology has been solved, and precise identification and targeting of FAP-expressing cells have been achieved, supporting adoptive cell therapy and cancer treatment.

CN114761036BActive Publication Date: 2025-09-30THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202080079394.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-09-23
Filing Date
2020-09-23
Publication Date
2025-09-30
Estimated Expiration
2040-09-23

AI Technical Summary

Technical Problem

The existing technology lacks antibodies that can cross-react with canine, mouse, and human fibroblast activation protein (FAP), resulting in the inability to effectively identify and target FAP-expressing cells in tumor research and treatment.

Method used

Antibodies, binding peptides and scFv that specifically bind to human, canine and mouse FAP have been developed. High-affinity binding to FAP is achieved by designing specific heavy and light chain variable region amino acid sequences, including precise design of the heavy chain complementarity determining region (HCDR) and light chain complementarity determining region (LCDR).

Benefits of technology

It provides antibodies that can cross-react with canine, mouse, and human FAP for identifying and targeting FAP-expressing cells, supporting adoptive cell therapy and cancer treatment, and enhancing the precision and effectiveness of tumor treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003644887290000171
    Figure BDA0003644887290000171
  • Figure BDA0003644887290000181
    Figure BDA0003644887290000181
  • Figure BDA0003644887290000191
    Figure BDA0003644887290000191
Patent Text Reader

Abstract

The present invention relates to antibodies, binding polypeptides, and scFvs specific for fibroblast activation protein (FAP) that are cross-reactive with canine, mouse, and human FAP.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62 / 904,272, filed on September 23, 2019, which is hereby incorporated by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under Grant No. CA172921 awarded by the National Institutes of Health. The government has certain rights in this invention. Background Art

[0005] Tumor is made up of heterogeneous cell groups, including transformed cells and a large number of untransformed cells. Although the prevalence of different cell types varies due to the different stages of tumor and tumor progression, they include infiltrating inflammatory and immune cells, endothelial cells, smooth muscle cells of mesenchymal origin, pericytes and tumor-associated fibroblasts (TAFs), which are collectively referred to as stromal cells in this article. TAFs are a kind of heterogeneous colony, which can be distinguished from normal fibroblasts in phenotype. Fibroblast activation protein (FAP) has become a marker of reactive fibroblasts in tumor and granulation tissue and fibrotic lesions.

[0006] FAP is a type II transmembrane cell surface protein that belongs to the post-proline dipeptidyl aminopeptidase family and shares the highest similarity with dipeptidyl peptidase IV (DPPIV / CD26). FAP is selectively expressed by TAFs and pericytes in over 90% of human epithelial cancers. It is also expressed during embryonic development, in wound healing tissues, and in chronic inflammatory and fibrotic conditions such as cirrhosis and idiopathic pulmonary fibrosis, as well as on bone and soft tissue sarcomas and certain melanomas. However, FAP expression is undetectable in benign lesions or normal adult tissues, whereas DPPIV is more widely expressed across multiple cell types. In vitro studies have demonstrated that FAP possesses both dipeptidyl peptidase and endopeptidase activities, including collagenolytic activity capable of degrading gelatin and type I collagen, but its in vivo substrate(s) have not been identified.

[0007] There is a need in the art for the development of antibodies that cross-react with canine, mouse, and human fibroblast activation protein. The present invention addresses this need. Summary of the Invention

[0008] As described herein, the present invention relates to antibodies, binding polypeptides, and scFvs specific for Fibroblast Activation Protein (FAP) that are cross-reactive with canine, mouse, and human FAP.

[0009] In one aspect, the invention provides isolated binding polypeptides comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine Fibroblast Activation Protein (FAP).

[0010] In certain embodiments, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0011] In certain embodiments, the binding polypeptide: (a) binds to fibroblast activation protein (FAP); and / or (b) comprises an antibody or antigen-binding fragment thereof; and / or (c) comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identical to the amino acid sequence of the heavy chain variable region shown in SEQ ID NO:7; and / or (d) comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and / or (e) consists of a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:7; and / or (f) comprises a light chain variable region comprising an amino acid sequence that is identical to the amino acid sequence shown in SEQ ID NO: NO:9; and / or (g) comprises a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9; and / or (h) consists of a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0012] In certain embodiments, (a) the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody; and / or (b) the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody, and wherein the antibody is a full-length antibody; and / or (c) the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody, and wherein the antibody or antigen-binding fragment is a humanized antibody or antigen-binding fragment thereof.

[0013] In another aspect, the present invention provides an isolated binding polypeptide comprising: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0014] In another aspect, the present invention provides a single-chain variable fragment (scFv) comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP).

[0015] In certain embodiments, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6), wherein the heavy chain variable region and the light chain variable region are separated by a linker.

[0016] On the other hand, the present invention provides a single-chain variable fragment (scFv), which includes: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9, wherein the heavy chain variable region and the light chain variable region are separated by a linker, and optionally wherein the linker comprises the amino acid sequence shown in SEQ ID NO:15.

[0017] In another aspect, the present invention provides a single-chain variable fragment (scFv) comprising the amino acid sequence shown in SEQ ID NO: 11 or 13; or consisting of the amino acid sequence shown in SEQ ID NO: 11 or 13.

[0018] In another aspect, the invention provides an isolated nucleic acid encoding any of the binding polypeptides or any of the scFvs contemplated herein.

[0019] In another aspect, the invention provides isolated nucleic acids encoding binding polypeptides comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine Fibroblast Activation Protein (FAP).

[0020] In certain embodiments, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0021] In certain embodiments, (a) the binding polypeptide comprises an antibody or an antigen-binding fragment thereof, and optionally wherein the antibody is a full-length antibody; and / or (b) the antigen-binding fragment is selected from a Fab, a single-chain variable fragment (scFv), or a single domain antibody; and / or (c) the antibody or antigen-binding fragment is a humanized antibody or fragment thereof.

[0022] In certain embodiments, (a) the heavy chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identical to SEQ ID NO: 8; and / or (b) the heavy chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO: 8; and / or (c) the heavy chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence shown in SEQ ID NO: 8; and / or (d) the light chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identical to the amino acid sequence of the light chain variable region shown in SEQ ID NO: 10; and / or (e) the light chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO: 10; and / or (f) the light chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence shown in SEQ ID NO: The polynucleotide sequence is shown in NO:10.

[0023] In another aspect, the present invention provides an isolated nucleic acid encoding a binding polypeptide comprising a heavy chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:8; and a light chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:10.

[0024] In another aspect, the present invention provides an isolated nucleic acid that (a) encodes a single-chain variable fragment (scFv) comprising: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6); or (b) encodes a single-chain variable fragment (scFv) comprising: a heavy chain variable region comprising the amino acid sequence SEQ ID NO: 7; NO:8; and a light chain variable region comprising the nucleotide sequence shown in SEQ ID NO:10, wherein the heavy chain variable region and the light chain variable region are separated by a linker, and optionally wherein the linker comprises the amino acid sequence shown in SEQ ID NO:15; and / or (c) encodes a single-chain variable fragment (scFv) comprising the polynucleotide sequence shown in SEQ ID NO:12 or 14; and / or (d) encodes a single-chain variable fragment (scFv) consisting of the polynucleotide sequence shown in SEQ ID NO:12 or 14.

[0025] In another aspect, the invention provides a vector comprising any of the isolated nucleic acids contemplated herein.

[0026] In certain embodiments, the vector is an expression vector; and / or the vector is selected from a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.

[0027] In another aspect, the invention provides a host cell: (a) which comprises any of the vectors contemplated herein; and / or (b) wherein the host cell is of eukaryotic or prokaryotic origin; and / or (c) wherein the host cell is of mammalian origin; and / or (d) wherein the host cell is of bacterial origin.

[0028] In another aspect, the present invention provides a method for producing a binding polypeptide or scFv that binds to FAP. The method comprises culturing any of the host cells contemplated herein.

[0029] In another aspect, the invention provides pharmaceutical compositions comprising any binding polypeptide or any scFv contemplated herein.

[0030] In another aspect, the present invention provides a method for identifying a subject suitable for adoptive cell therapy targeting fibroblast activation protein (FAP). The method comprises: (a) isolating diseased tissue from a subject; (b) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP; and (c) detecting cells expressing FAP in the isolated tissue, thereby identifying a suitable subject for adoptive cell therapy.

[0031] In certain embodiments, the binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 1) (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0032] In certain embodiments, (a) the binding polypeptide comprises an antibody or an antigen-binding fragment thereof; and / or (b) the antigen-binding fragment is selected from a Fab, a single-chain variable fragment (scFv), or a single domain antibody, and optionally wherein the antibody is a full-length antibody; and / or (c) the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof; and / or (d) the binding polypeptide is conjugated to a therapeutic molecule or a diagnostic molecule; and / or (e) the binding polypeptide is conjugated to a diagnostic molecule, wherein the diagnostic molecule comprises a detectable label; and / or (f) the binding polypeptide is conjugated to a diagnostic molecule, wherein the diagnostic molecule comprises a detectable label, and further wherein the detectable label is a radiolabel, a fluorophore, an enzyme, a hapten, biotin, or a chromophore.

[0033] In certain embodiments, adoptive cell therapy is administered to a subject after the subject has been identified as a suitable subject.

[0034] In certain embodiments, (a) the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR); and / or (b) the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR) and wherein the immune cell is a T lymphocyte; and / or (c) the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR) and wherein the immune cell is a NK cell; and / or (d) the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR), wherein the CAR specifically binds to FAP.

[0035] In certain embodiments, the binding polypeptide: (a) comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identical to the amino acid sequence of the heavy chain variable region shown in SEQ ID NO:7; and / or (b) comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and / or (c) consists of a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:7; and / or (d) comprises a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to the amino acid sequence shown in SEQ ID NO:9; and / or (e) comprises a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:10. NO:9; and / or (f) consists of a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0036] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an isolated binding polypeptide comprising: a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7; and a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9.

[0037] In certain embodiments, (a) the cancer is associated with cells that express fibroblast activation protein (FAP); and / or (b) the FAP-expressing cells are cancer-associated cells; and / or (c) the FAP-expressing cells are cancer-associated cells, wherein the cancer-associated cells are cancer-associated fibroblasts (CAFs); and / or (d) the FAP-expressing cells are cancer-associated cells, wherein the FAP-expressing cancer-associated cells are FAP-expressing adipocytes; and / or (e) the FAP-expressing cells are cancer-associated cells, wherein the FAP-expressing cancer-associated cells are tumor-associated macrophages (TAMs); and / or (f) the FAP-expressing cells are cancer-associated cells, wherein the FAP-expressing cancer-associated cells are tumor-associated neutrophils (TANs); and / or (g) the FAP-expressing cells are cancer-associated cells, wherein the FAP-expressing cancer-associated cells are myeloid-derived suppressor cells (MDSCs); and / or (h) the FAP-expressing cells are cancer-associated cells, wherein the FAP-expressing cancer-associated cells are cancer-initiating cells.

[0038] In certain embodiments, (a) the binding polypeptide specifically binds to fibroblast activation protein (FAP); and / or (b) the binding polypeptide comprises an antibody or an antigen-binding fragment thereof; and / or (c) the antigen-binding fragment is selected from a Fab, a single-chain variable fragment (scFv), or a single domain antibody, and optionally wherein the antibody is a full-length antibody; and / or (d) the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0039] In another aspect, the present invention provides a method for treating cancer in a subject in need thereof, comprising: (a) identifying the subject as a suitable subject, wherein the identification comprises: (i) isolating diseased tissue from the subject; (ii) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP; and (iii) detecting cells expressing FAP in the isolated tissue; and (b) administering to the suitable subject adoptive cell therapy comprising modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to fibroblast activation protein (FAP). BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The following detailed description of the preferred embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, there are shown in the accompanying drawings presently preferred embodiments. However, it should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0041] Figure 1 is a sequence alignment of the canine FAP gene sequence listed in the NCBI database (XM_005640252.2) and the product of PCR amplification of the canine FAP gene using two primers generated using the NCBI sequence. At the nucleotide level, the product has two conservative base pair substitutions at T127 and A603 (boxed residues, left; inset sequence, right).

[0042] Figure 2A-2C The vector map and diagram exemplify the generation of cells expressing recombinant canine FAP. The canine FAP PCR product was cloned into a eukaryotic expression plasmid (pcDNA3.1) ( Figure 2A ), and then subcloned into a lentiviral plasmid (pLenti6 / v5-D-TOPO) ( Figure 2B The lentiviral plasmid was transfected into HEK293 cells using the packaging plasmid to generate a virus-containing supernatant. The resulting supernatant containing viral particles was used to transduce BALB / c 3T3 cells. The expression of recombinant canine FAP was confirmed by flow cytometry using a sheep anti-human FAP antibody ( Figure 2C ).

[0043] Figure 3 This is a flow cytometric image demonstrating the generation of hybridoma cells producing anti-FAP antibodies. BALB / c 3T3 cells transduced with canine FAP were used to immunize 14-week-old BALB / c mice. Splenocytes were fused with sp2 / 0 cells, and the resulting hybridomas were screened against PKH-labeled MC KOSA parental (FAP-null) cells and MC KOSA.K9FAP cells expressing the canine FAP transgene. Primary staining was provided by the antibody produced by the hybridoma. Secondary staining was performed using a goat anti-mouse IgG secondary antibody, followed by flow cytometry readout.

[0044] Figures 4A-4C Illustrated isotype characterization of the newly generated 4G5 anti-canine FAP antibody. A commercial ELISA-based typing kit was used in these studies. Figure 4A Colorimetric data from ELISA are shown. Columns represent replicate wells for each row. Positive reactions were observed in rows A and G. Figure 4B is an image of an ELISA plate showing prominent positive signals in rows A and G. Figure 4C is a plate map of a study showing that the 4G5 antibody tested positive for IgG1 and kappa isotype immunoglobulins.

[0045] Figure 5 Depicted is a protein gel demonstrating that the 4G5 antibody and a mouse IgG1 isotype control antibody generate similar banding patterns. DETAILED DESCRIPTION

[0046] A. Definition

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in testing the practice of the present invention, preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.

[0048] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0049] The articles "a" and "an" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0050] As used herein, "about" when referring to a measurable value such as an amount, duration, etc., is meant to include variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% of the specified value, as such variations are suitable for practicing the methods of the present disclosure.

[0051] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. Antibodies can be intact immunoglobulins derived from natural or recombinant sources, and can be immunoreactive portions of intact immunoglobulins. Antibodies are generally tetramers of immunoglobulin molecules. Tetramers can be naturally occurring or reconstructed from single-chain antibodies or antibody fragments. Antibodies also include dimers that can occur naturally or be constructed from single-chain antibodies or antibody fragments. The antibodies of the present invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab')2, as well as single-chain antibodies (scFv), humanized antibodies, and human antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0052] The term "antibody fragment" refers to a portion of a complete antibody and refers to the antigen-determining variable region of a complete antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments, linear antibodies, scFv antibodies, single domain antibodies, such as camel (camelid) antibodies (Riechmann, 1999, Journal of Immunological Methods 231: 25-38), consisting of VL or VH domains that exhibit sufficient affinity for the target, and multispecific antibodies formed by antibody fragments. Antibody fragments also include parts of human antibodies or humanized antibodies or human antibodies or humanized antibodies.

[0053] As used herein, "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformation.

[0054] As used herein, an "antibody light chain" refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations. Kappa and lambda light chains refer to the two major antibody light chain isotypes.

[0055] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, the phage-expressed antibodies described herein. The term should also be interpreted to mean an antibody produced by synthesizing a DNA molecule encoding the antibody (and which expresses the antibody protein) or defining the amino acid sequence of the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology available and known in the art.

[0056] As used herein, the term "antigen" or "Ag" is defined as a molecule that causes an immune response. This immune response may involve antibody production, or the activation of specific immunologically competent cells, or both. Those skilled in the art will appreciate that any macromolecule, including substantially all proteins or peptides, can serve as an antigen. In addition, antigens can be derived from recombinant DNA or genomic DNA. It will be understood by those skilled in the art that any DNA comprising a nucleotide sequence or partial nucleotide sequence encoding a protein that causes an immune response therefore encodes the term "antigen" as used herein. In addition, it will be understood by those skilled in the art that an antigen need not be purely encoded by the full-length nucleotide sequence of a gene. It is apparent that the present invention includes but is not limited to the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in various combinations that cause a desired immune response. Moreover, it will be understood by those skilled in the art that an antigen need not be encoded by a "gene" at all. It is apparent that an antigen can be synthetically generated or can be derived from a biological sample. This biological sample can include but is not limited to a tissue sample, a tumor sample, a cell, or a biological fluid.

[0057] As used herein, the term "anti-tumor effect" refers to a biological effect that can be exhibited by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or a reduction in various physiological symptoms associated with a cancerous condition. An "anti-tumor effect" can also be exhibited by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the initial development of a tumor.

[0058] As used herein, the term "autologous" means any material originating from the same individual that is subsequently reintroduced into that individual.

[0059] "Allogeneic" refers to a transplant that originates from a different animal of the same species.

[0060] "Xenogeneic" refers to a transplant that originates from an animal of a different species.

[0061] As used herein, the term "cancer" is defined as a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream and lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc.

[0062] As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are amino acid substitutions in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR region of an antibody of the present invention can be substituted with other amino acid residues from the same side chain family, and the altered antibody can be tested for its FAP binding ability using the functional assays described herein.

[0063] As used herein, the term "costimulatory ligand" includes molecules on antigen presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing signals that mediate T cell responses, including but not limited to proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, binding of the TCR / CD3 complex to an MHC molecule loaded with a peptide. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors and ligands that specifically bind to B7-H3. Co-stimulatory ligands also include antibodies that specifically bind to co-stimulatory molecules present on T cells, such as but not limited to CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0064] "Costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0065] When used in the context of FAP expression or activity levels, the term "dysregulated" refers to FAP expression or activity levels that are different from the expression level or activity in an otherwise identical healthy animal, organism, tissue, cell, or component thereof. The term "dysregulated" also refers to regulation of FAP expression and activity levels that is altered compared to regulation in an otherwise identical healthy animal, organism, tissue, cell, or component thereof.

[0066] "Encoding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for other polymers and macromolecules having a defined nucleotide (i.e., rRNA, tRNA, and mRNA) sequence or a defined amino acid sequence in a biological process, as well as the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produces the protein in a cell or other biological system. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is typically provided in a sequence listing) and the non-coding strand used as a transcription template for a gene or cDNA may be referred to as encoding a protein or other product of the gene or cDNA.

[0067] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Protein-encoding nucleotide sequences and RNA may include introns.

[0068] "Effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material, or composition as described herein that is effective to achieve a specific biological result. Such results can include, but are not limited to, inhibition of viral infection as determined by any means applicable in the art.

[0069] As used herein, "endogenous" refers to any substance that originates from or is produced within an organism, cell, tissue, or system.

[0070] As used herein, the term "exogenous" refers to any substance that is introduced from outside of an organism, cell, tissue, or system or that is produced outside of an organism, cell, tissue, or system.

[0071] As used herein, the term "expression" is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.

[0072] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) comprising the recombinant polynucleotide.

[0073] As used herein, "homologous" refers to the subunit sequence identity between two polymer molecules, such as between two nucleic acid molecules, such as between two DNA molecules or two RNA molecules, or between two polypeptide molecules. When the subunit positions in the two molecules are occupied by the same monomeric subunit; for example, if one position in each of the two DNA molecules is occupied by adenine, they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half of the positions in the two sequences (e.g., five positions in a multimer of ten subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0074] Non-human (for example, mouse) antibodies of " humanization " and " chimeric " form are chimeric immunoglobulins, immunoglobulin chains or their fragments (such as Fv, Fab, Fab', F(ab')2 or other antigen binding subsequences of antibody) comprising the minimum sequence derived from non-human immunoglobulin. For the most part, humanized antibodies and chimeric antibodies are human immunoglobulins (receptor antibodies), in which the residues from the complementary determining regions (CDR) of the receptor are replaced by residues from the CDRs of non-human species (donor antibodies) such as mice, rats or rabbits with desired specificity, affinity and ability. In some cases, the Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. In addition, humanized antibodies and chimeric antibodies can be included in residues that are not found in the receptor antibody and the CDR or framework sequences imported. These modifications are carried out to further improve and optimize antibody performance. In general, humanized antibodies and chimeric antibodies will comprise substantially all of at least one variable domain, generally two variable domains, wherein all or substantially all of the CDR regions correspond to the CDR regions of a non-human immunoglobulin, and all or substantially all of the FR regions are FR regions of human immunoglobulin sequences. Humanized antibodies and chimeric antibodies will also optimally comprise at least a portion of an immunoglobulin constant region (Fc), generally that of a human immunoglobulin. The World Health Organization (WHO) International Nonproprietary Names (INN) Expert Group defines the requirements for considering non-human derived antibodies as "humanized". According to the guidelines, comparison of candidate antibodies to human sequences should be performed using the International Immunogenetics Information The DomainGapAlign tool (www.imgt.org) is used to query the variable region genes of the antibody germline. The database, in which only the variable region exons of the germline sequence are aligned and scored, thus omitting parts of the CDR3 and J regions from the analysis. For antibodies to be "humanized," in addition to being "closer to human than other species," the top "hit" should be human, and the identity with the human sequence must be at least 85%, otherwise the antibody will be designated as "chimeric." For more details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0075] "Fully human" refers to an immunoglobulin, such as an antibody, wherein the entire molecule is of human origin or is composed of the same amino acid sequence as a human form of an antibody.

[0076] As used herein, "instructional materials" include publications, records, diagrams, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. For example, the instructional materials of the kits of the present invention can be attached to a container containing the nucleic acids, peptides, and / or compositions of the present invention, or shipped together with the container containing the nucleic acids, peptides, and / or compositions. Alternatively, the instructional materials can be shipped separately from the container so that the instructional materials and the compound are used in conjunction with the recipient.

[0077] As used herein, "identity" refers to the subunit sequence identity between two polymer molecules, in particular between two amino acid molecules, such as between two polypeptide molecules. When two amino acid sequences have the same residue at the same position; for example, if one position in each of the two polypeptide molecules is occupied by arginine, then they have identity at that position. Identity, or the degree to which two amino acid sequences have the same residue at the same position in an alignment, is usually expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; for example, if half of the positions in the two sequences are the same (e.g., 5 positions in a polymer of 10 amino acids in length), the two sequences have 50% identity; if 90% of the positions (e.g., 9 out of 10) are matched or identical, the two amino acid sequences have 90% identity.

[0078] "Isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-natural environment, such as, for example, a host cell.

[0079] In the context of the present invention, the following abbreviations are used for commonly occurring nucleic acid bases: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0080] Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" may also include introns, such that a nucleotide sequence encoding the protein may contain intron(s) in some forms.

[0081] As used herein, "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in their ability to infect non-dividing cells; they can transfer large amounts of genetic information into the host cell's DNA, making them one of the most effective methods of gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses provide a means to achieve significant levels of gene transfer in vivo.

[0082] The term "operably linked" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the latter. For example, a first nucleic acid sequence and a second nucleic acid sequence are operably linked when they are placed in a functional relationship. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, when necessary to connect two protein coding regions, are in the same reading frame.

[0083] "Parenteral" administration of the immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection, or infusion techniques.

[0084] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Therefore, nucleic acids and polynucleotides as used herein are interchangeable. It is common knowledge to those skilled in the art that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, those produced by any means available in the art (including, but not limited to, recombinant means, i.e., using conventional cloning techniques and PCR). TM Nucleic acid sequences cloned from recombinant libraries or cell genomes) as well as all nucleic acid sequences obtained by synthetic means.

[0085] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains (which are also commonly referred to as, for example, peptides, oligopeptides and oligomers in the art) and longer chains (which are generally referred to as proteins in the art, of which there are many types). "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins and others. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0086] As used herein, the term "promoter" is defined as a DNA sequence recognized by the synthetic machinery of the cell or introduced synthetic machinery required to initiate specific transcription of a polynucleotide sequence.

[0087] As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence required for expression of a gene product to which the promoter / regulatory sequence is operably linked. In some cases, this sequence may be a core promoter sequence, and in other cases, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0088] A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes a gene product to be produced in a cell under most or all physiological conditions of the cell.

[0089] An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes a gene product to be produced in a cell essentially only when an inducer corresponding to the promoter is present in the cell.

[0090] A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene, causes a gene product to be produced in a cell essentially only if the cell is a cell of the tissue type corresponding to the promoter.

[0091] "Signal transduction pathway" refers to the biochemical relationship between various signal transduction molecules that affect the transmission of signals from one part of a cell to another. The phrase "cell surface receptor" includes molecules and molecular complexes that can receive signals and transmit them across the plasma membrane of a cell.

[0092] "Single-chain antibody" refers to an antibody formed by recombinant DNA technology in which immunoglobulin heavy and light chain fragments are linked to each other using an engineered span of amino acids to recapitulate the Fv region of the antibody into a single polypeptide. Various methods for generating single-chain antibodies are known, including those described in U.S. Patent No. 4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al. (1989) Nature 334:54454; Skerra et al. (1988) Science 242:1038-1041.

[0093] The term "subject" is intended to include living organisms (e.g., mammals) in which an immune response can be elicited. As used herein, a "subject" or "patient" can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as mammals of the ovine, bovine, porcine, canine, feline, and murine families. Preferably, the subject is a human.

[0094] As used herein, "substantially purified" cells are cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types with which they are normally associated in their naturally occurring state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term refers only to cells that have been separated from cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0095] As used herein, the term "therapeutic" means treating and / or preventing. A therapeutic effect is achieved by the inhibition, alleviation or eradication of a disease state.

[0096] As used herein, the term "transfection" or "transformation" or "transduction" refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. Such cells include the primary subject cell and its progeny.

[0097] As used herein, the phrase "under transcriptional control" or "operably linked" means that the promoter is in the correct location and orientation relative to the polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0098] A "vector" is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Various vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmids and non-viral compounds that promote the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc.

[0099] As used herein, the term "specifically binds" refers to an antibody or ligand that recognizes and binds to a cognate binding partner (e.g., a stimulatory and / or co-stimulatory molecule present on T cells) protein present in a sample, but the antibody or ligand does not substantially recognize or bind to other molecules in the sample.

[0100] The term "stimulation" means a primary response caused by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event (such as, but not limited to, signal transduction via the TCR / CD3 complex). Stimulation can mediate changes in the expression of certain molecules, such as downregulation of TGF-β and / or reorganization of cytoskeletal structure and the like.

[0101] As used herein, the term "stimulatory molecule" means a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell and / or on a tumor cell.

[0102] As used herein, "stimulatory ligand" means a ligand that, when present on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) or tumor cells, can specifically bind to a cognate binding partner on a T cell (referred to herein as a "stimulatory molecule"), thereby mediating a primary response of the T cell (including but not limited to activation, initiation of an immune response, proliferation, etc.). Stimulatory ligands are well known in the art and include, among others, peptide-loaded MHC class I molecules, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0103] Range: Throughout this disclosure, various aspects of the invention may be presented in range format. It should be understood that descriptions in range format are merely for convenience and brevity and should not be construed as rigid limitations on the scope of the invention. Thus, descriptions of ranges should be considered to have specifically disclosed all possible subranges within that range, as well as individual values. For example, descriptions of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual values ​​within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the width of the range.

[0104] B. Binding Peptides, Antibodies, and scFv

[0105] The binding polypeptides and antibodies of the present invention are characterized by specific functional characteristics or properties of the antibodies. In such embodiments, the antigen binding domain can be said to have cross-species reactivity. For example, the binding polypeptides and antibodies specifically bind to canine fibroblast activation protein (FAP) and also cross-react with mouse and human FAP. Preferably, the binding polypeptides and antibodies of the present invention bind to canine, mouse, and human FAP with high affinity. Preferably, the binding polypeptides and antibodies of the present invention specifically recognize canine FAP protein naturally expressed on cells without cross-reacting with other surface molecules on the cells.

[0106] In certain aspects, the present invention provides an isolated binding polypeptide comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP). In certain embodiments, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs).

[0107] In certain embodiments, the present invention provides an isolated binding polypeptide comprising a heavy chain variable region comprising three heavy chain complementary determining regions (HCDRs). In certain embodiments, HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3). In certain embodiments, the antigen binding domain comprises a light chain variable region comprising three light chain complementary determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0108] In certain aspects, the present invention provides an isolated binding polypeptide comprising a HCDR1 comprising the amino acid sequence YTITSYSLH (SEQ ID NO: 1). Also provided are isolated binding polypeptides comprising a HCDR1 comprising the amino acid sequence GYTITSYSLH (SEQ ID NO: 17). Also provided are isolated binding polypeptides comprising a HCDR2 comprising the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2). Also provided are isolated binding polypeptides comprising a HCDR3 comprising the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3). Also provided are isolated binding polypeptides comprising a HCDR3 comprising the amino acid sequence TRLDDSRFHWYFDV (SEQ ID NO: 19). Also provided are isolated binding polypeptides comprising a light chain variable region comprising a LCDR1 comprising the amino acid sequence TASSSVSYMY (SEQ ID NO: 4). Also provided are isolated binding polypeptides comprising a LCDR2 comprising the amino acid sequence LTSNLA (SEQ ID NO: 5). Also provided are isolated binding polypeptides comprising a LCDR2 comprising the amino acid sequence LTSNLAS (SEQ ID NO: 20).Also provided are isolated binding polypeptides comprising a LCDR3 comprising the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0109] In certain embodiments, the present invention provides an isolated binding polypeptide comprising a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIKAT (SEQ ID NO: 18), and / or HCDR3 comprises the amino acid sequence TRLDDSRFHWYFDV (SEQ ID NO: 19). In certain embodiments, the isolated binding polypeptide comprises a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0110] In certain aspects, the invention provides an isolated binding polypeptide comprising a HCDR1 comprising the amino acid sequence of GYTITSYSLH (SEQ ID NO: 17), a HCDR2 comprising the amino acid sequence of EINPANGDHNFSEKFEIK (SEQ ID NO: 2), a HCDR3 comprising the amino acid sequence of LDDSRFHWYFDV (SEQ ID NO: 3), a LCDR1 comprising the amino acid sequence of TASSSVSYMY (SEQ ID NO: 4), a LCDR2 comprising the amino acid sequence of LTSNLAS (SEQ ID NO: 20), and a LCDR3 comprising the amino acid sequence of QQWSGYPPIT (SEQ ID NO: 6).

[0111] In certain embodiments, the present invention provides an isolated binding polypeptide comprising a heavy chain variable region comprising any one of the three heavy chain complementary determining regions HCDR1, HCDR2, and HCDR3 as described herein. In certain embodiments, the isolated binding polypeptide comprises a light chain variable region comprising any one of the three light chain complementary determining regions LCDR1, LCDR2, and LCDR3 as described herein. In certain embodiments, the isolated binding polypeptide comprises any combination of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 as described herein. Given the heavy and light chain variable region sequences provided herein, a skilled person will be able to readily determine the relevant complementary determining regions based on amino acid numbering.

[0112] Those skilled in the art will know the permissible variations in complementarity determining region (CDR) sequences. For example, in some embodiments, the polypeptide comprises a complementarity determining region (HCDR or LCDR) comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 17, 18, 19, or 20.

[0113] In some embodiments, the binding polypeptide binds to fibroblast activation protein (FAP). In some embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In further embodiments, the antibody is a full-length antibody. In further embodiments, the antibody or antigen-binding fragment is a mouse antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0114] In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide consists of a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 7.

[0115] In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide consists of a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.

[0116] Also provided is an isolated binding polypeptide comprising: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0117] In certain embodiments, the present invention includes antibodies that bind to the same epitope on human, mouse, or canine FAP as an antibody of the present invention (i.e., an antibody that has the ability to cross-compete with any of the antibodies of the present invention for binding to canine FAP). In preferred embodiments, the reference antibody used in cross-competition studies can be one of the antibodies described herein (e.g., 4G5). For example, Biacore analysis, ELISA assays, or flow cytometry can be used to demonstrate cross-competition with an antibody of the present invention. The ability of a test antibody to inhibit, for example, the binding of 4G5 to canine FAP demonstrates that the test antibody can compete with 4G5 for binding to canine, mouse, and human FAP and is therefore considered to bind to the same epitope of FAP as 4G5.

[0118] The antibodies of the present invention can be prepared by engineering modified antibodies using one or more of the VH and / or VL sequences disclosed herein as starting materials, which may have altered properties compared to the starting antibody. Antibodies can be engineered by modifying one or more amino acids within one or both variable regions (i.e., VH and / or VL), such as within one or more CDR regions and / or within one or more framework regions. Additionally or alternatively, antibodies can be engineered by modifying residues within the constant region(s), for example, to alter the effector function(s) of the antibody.

[0119] Also provided are single-chain variable fragments (scFv) comprising an antigen binding domain that specifically binds to an epitope of human and / or canine and / or murine Fibroblast Activation Protein (FAP).

[0120] As used herein, the term "single-chain variable fragment" or "scFv" is a fusion protein of a heavy chain (VH) variable region and a light chain (VL) variable region that are covalently linked to form a VH::VL heterodimer of an immunoglobulin (e.g., mouse or human). The heavy chain (VH) and light chain (VL) are directly connected or connected by a linker encoding a peptide that connects the N-terminus of VH to the C-terminus of VL, or the C-terminus of VH to the N-terminus of VL. In some embodiments, the antigen binding domain (e.g., a FAP binding domain) includes an scFv having a configuration from N-terminus to C-terminus - VH-linker-VL. In some embodiments, the antigen binding domain includes an scFv having a configuration from N-terminus to C-terminus - VL-linker-VH. Those skilled in the art will be able to select an appropriate configuration for use in the present invention.

[0121] Typically, the linker is rich in glycine for flexibility and rich in serine or threonine for solubility. The linker can connect the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80 (6): 1910-1917 (2008) and WO 2014 / 087010, the contents of which are hereby incorporated by reference in their entirety. Various linker sequences are known in the art, including, but not limited to, glycine serine (GS) linkers, such as (GS) n 、(GSGGS) n (SEQ ID NO: 21), (GGGS) n (SEQ ID NO: 22) and (GGGGS) n (SEQ ID NO: 23), wherein n represents an integer of at least 1. Exemplary linker sequences may include amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 24), GGSGG (SEQ ID NO: 25), GSGSG (SEQ ID NO: 26), GSGGG (SEQ ID NO: 27), GGGSG (SEQ ID NO: 28), GSSSG (SEQ ID NO: 29), GGGGS (SEQ ID NO: 30), GGGGSGGGGSGGGGS (SEQ ID NO: 15), etc. Those skilled in the art will be able to select appropriate linker sequences for use in the present invention. In one embodiment, the scFv of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 15), which can be encoded by the nucleic acid sequence GGTGGCGGTGGCTCGGGCGGTGGT GGGTCGGGTGGCGGCGGATCT (SEQ ID NO: 31).

[0122] Despite the removal of the constant region and the introduction of a linker, the ScFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids comprising VH- and VL-coding sequences as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85: 5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife eta., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40). Agonistic scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Biol Chem 200325278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0123] In one aspect, the present invention provides a single-chain variable fragment (scFv) comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP), wherein the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs).

[0124] In certain embodiments of scFv, HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3), and / or LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6). The heavy chain variable region and the light chain variable region are separated by a linker.

[0125] In certain embodiments of scFv, HCDR1 comprises the amino acid sequence GYTITSYSLH (SEQ ID NO: 17), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3), and / or LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLAS (SEQ ID NO: 20), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6). The heavy chain variable region and the light chain variable region are separated by a linker.

[0126] Also provided is a single-chain variable fragment (scFv) comprising: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7; and / or a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 9. The heavy chain variable region and the light chain variable region are separated by a linker.

[0127] In another aspect, a single-chain variable fragment (scFv) comprising the amino acid sequence shown in SEQ ID NO: 11 or 13 is provided. In another aspect, a single-chain variable fragment (scFv) consisting of the amino acid sequence shown in SEQ ID NO: 11 or 13 is provided.

[0128] Those skilled in the art will recognize the permissible variations in scFv sequences. For example, in some embodiments, the scFv comprises an amino acid sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any of the amino acid sequences set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 9, 11, 13, 15, 17, 18, 19, or 20.

[0129] Table 1: Amino acid and nucleotide sequences

[0130]

[0131]

[0132]

[0133] C. Nucleic Acids and Expression Vectors

[0134] The present disclosure provides isolated nucleic acids encoding binding polypeptides (e.g., antibodies or fragments thereof, e.g., scFvs), comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP). The nucleic acids of the present disclosure may comprise a polynucleotide sequence encoding any one of the binding polypeptides, scFvs, or antibodies disclosed herein.

[0135] In certain embodiments, the binding polypeptide comprises an antigen binding domain comprising a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3). In certain embodiments, the antigen binding domain further comprises a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0136] In certain embodiments, the binding polypeptide comprises an antigen binding domain comprising: a heavy chain variable region, wherein HCDR1 comprises the amino acid sequence of GYTITSYSLH (SEQ ID NO: 17), and / or HCDR2 comprises the amino acid sequence of EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence of LDDSRFHWYFDV (SEQ ID NO: 3); and / or a light chain variable region, wherein LCDR1 comprises the amino acid sequence of TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence of LTSNLAS (SEQ ID NO: 20), and / or LCDR3 comprises the amino acid sequence of QQWSGYPPIT (SEQ ID NO: 6).

[0137] In certain embodiments, the binding polypeptide comprises an antigen binding domain comprising: a heavy chain variable region, wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIKAT (SEQ ID NO: 18), and / or HCDR3 comprises the amino acid sequence TRLDDSRFHWYFDV (SEQ ID NO: 19); and / or a light chain variable region, wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0138] In certain embodiments, the nucleic acid encoding the binding polypeptide comprises an antigen binding domain comprising a heavy chain variable region comprising any one of the three heavy chain complementary determining regions HCDR1, HCDR2, and HCDR3 as described herein. In certain embodiments, the antigen binding domain comprises a light chain variable region comprising any one of the three light chain complementary determining regions LCDR1, LCDR2, and LCDR3 as described herein. In certain embodiments, the antigen binding domain comprises any combination of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 as described herein. In view of the heavy and light chain variable region sequences provided herein, a skilled person will be able to readily determine the relevant complementary determining regions based on amino acid numbering.

[0139] In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or a fragment thereof.

[0140] Also provided are nucleic acids encoding binding polypeptides comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP), wherein the heavy chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8. In certain embodiments, the heavy chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO: 8. In certain embodiments, the heavy chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence shown in SEQ ID NO: 8.

[0141] In certain embodiments, the light chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 10. In certain embodiments, the light chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence set forth in SEQ ID NO: 10. In certain embodiments, the light chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence set forth in SEQ ID NO: 10.

[0142] Also provided is an isolated nucleic acid encoding a binding polypeptide comprising: a heavy chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:8; and a light chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:10.

[0143] Also provided are isolated nucleic acids encoding single-chain variable fragments (scFvs) comprising: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs). In certain embodiments, HCDR1 comprises the amino acid sequence GYTITSYSLH (SEQ ID NO: 17), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3), and / or LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLAS (SEQ ID NO: 20), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0144] In certain embodiments, the nucleic acid encodes a single-chain variable fragment comprising a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3). In certain embodiments, the light chain variable region comprises three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0145] In certain embodiments, the nucleic acid comprises a single-chain variable fragment comprising a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence GYTITSYSLH (SEQ ID NO: 17), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3). In certain embodiments, the antigen binding domain comprises a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLAS (SEQ ID NO: 20), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0146] In certain embodiments, the nucleic acid comprises a single-chain variable fragment comprising a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIKAT (SEQ ID NO: 18), and / or HCDR3 comprises the amino acid sequence TRLDDSRFHWYFDV (SEQ ID NO: 19). In certain embodiments, the single-chain variable fragment further comprises a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0147] In certain embodiments, the nucleic acid comprising a single-chain variable fragment comprises a heavy chain variable region comprising any one of the three heavy chain complementary determining regions HCDR1, HCDR2, and HCDR3 as described herein. In certain embodiments, the single-chain variable fragment comprises a light chain variable region comprising any one of the three light chain complementary determining regions LCDR1, LCDR2, and LCDR3 as described herein. In certain embodiments, the single-chain variable fragment comprises any combination of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 as described herein. Given the heavy and light chain variable region sequences provided herein, a skilled person will be able to readily determine the relevant complementary determining regions based on amino acid numbering.

[0148] Also provided are isolated nucleic acids encoding single-chain variable fragments (scFvs) comprising a heavy chain variable region encoded by the polynucleotide sequence shown in SEQ ID NO: 8; and / or a light chain variable region encoded by the polynucleotide sequence shown in SEQ ID NO: 10. The heavy chain variable region and the light chain variable region are separated by a linker. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 15.

[0149] Also provided is an isolated nucleic acid encoding a single-chain variable fragment (scFv), wherein the nucleic acid comprises the polynucleotide sequence shown in SEQ ID NO: 12 or 14. Also provided is an isolated nucleic acid encoding a single-chain variable fragment (scFv), wherein the nucleic acid consists of the polynucleotide sequence shown in SEQ ID NO: 12 or 14.

[0150] Those skilled in the art will recognize the permissible variations in nucleic acid sequences. For example, in some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences shown in SEQ ID NO: 8, 10, 12, or 14.

[0151] In certain embodiments, the nucleic acid of the present disclosure comprises a first polynucleotide sequence and a second polynucleotide sequence. In certain embodiments, the first polynucleotide sequence includes a polynucleotide sequence encoding a FAP-targeting binding polypeptide of the present disclosure. In some embodiments, the FAP-targeting binding polypeptide of the present disclosure can be used in combination with other therapeutic agents, such as but not limited to immunotherapy (such as immuno-oncology antibody therapy and checkpoint blockade), or other CAR-T cell therapies. Therefore, in such an embodiment, the second polynucleotide sequence may include a polynucleotide sequence encoding an anti-cancer antibody, a checkpoint blocking molecule, or a CAR.

[0152] The first and second polynucleotide sequences can be separated by a connector. For example, in some embodiments, the heavy chain variable region and light chain variable region of scFv are separated by a connector. In some embodiments, the connector comprises the amino acid sequence shown in SEQ ID NO:15. Connectors for the present disclosure allow multiple proteins to be encoded by the same nucleic acid sequence (for example, a polycistronic sequence or a bicistronic sequence), which are translated into polyproteins that are dissociated into independent protein components. In some embodiments, nucleic acid comprises the first polynucleotide sequence, a connector, and the second polynucleotide sequence from 5' to 3'. In some embodiments, nucleic acid comprises the second polynucleotide sequence, a connector, and the first polynucleotide sequence from 5' to 3'.

[0153] In some embodiments, the linker comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). As used herein, an "internal ribosome entry site" or "IRES" refers to an element that promotes direct entry of internal ribosomes into the start codon (e.g., ATG) of a protein coding region, thereby causing cap-independent translation of the gene. Various internal ribosome entry sites are known to those skilled in the art, including, but not limited to, IRESs available from viral or cellular mRNA sources, e.g., immunoglobulin heavy chain binding protein (BiP); vascular endothelial growth factor (VEGF); fibroblast growth factor 2; insulin-like growth factor; translation initiation factor eIF4G; yeast transcription factors TFIID and HAP4; and IRESs available from, e.g., cardiovirus, rhinovirus, foot-and-mouth disease virus, HCV, Friend murine leukemia virus (FrMLV), and Moloney murine leukemia virus (MoMLV). Those skilled in the art will be able to select a suitable IRES for use in the present invention.

[0154] In some embodiments, the linker comprises a nucleic acid sequence encoding a self-cleaving peptide. As used herein, "self-cleaving peptide" or "2A peptide" refers to an oligopeptide that allows multiple proteins to be encoded as a polyprotein that dissociates into component proteins after transcription. The use of the term "self-cleavage" is not intended to imply a proteolytic cleavage reaction. Various self-cleaving peptides or 2A peptides are known to those skilled in the art, and non-limiting examples include those found in members of the Picornaviridae family of viruses, for example, foot-and-mouth disease virus (FMDV), equine rhinitis virus (ERAV0, β-tetrasomal trichothivirus (TaV), and porcine teschovirus-1 (PTV-1); and cardioviruses, such as Theilovirus and encephalomyocarditis virus. The 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are referred to herein as "F2A," "E2A," "P2A," and "T2A," respectively. Those skilled in the art will be able to select suitable self-cleaving peptides for use in the present invention.

[0155] In some embodiments, the connector further comprises a nucleic acid sequence encoding a furin cleavage site. Furin is a ubiquitously expressed protease that is located in the trans-Golgi apparatus and is processed before protein precursor secretion. Furin cuts at the COOH-terminal end of its consensus recognition sequence. Various furin consensus recognition sequences (or " furin cleavage sites ") are well known to those skilled in the art, and they include, without limitation, Arg-X1-Lys-Arg (SEQ ID NO:32) or Arg-X1-Arg-Arg (SEQ ID NO:33), X2-Arg-X1-X3-Arg (SEQ ID NO:34) and Arg-X1-X1-Arg (SEQ ID NO:35), such as Arg-Gln-Lys-Arg (SEQ ID NO:36), wherein X1 is any naturally occurring amino acid, X2 is Lys or Arg, and X3 is Lys or Arg. Those skilled in the art will be able to select a suitable furin cleavage site for the present invention.

[0156] In some embodiments, the linker comprises a nucleic acid sequence encoding a combination of a furin cleavage site and a 2A peptide. Examples include, but are not limited to, a linker comprising a nucleic acid sequence encoding a furin cleavage site and F2A, a linker comprising a nucleic acid sequence encoding a furin cleavage site and E2A, a linker comprising a nucleic acid sequence encoding a furin cleavage site and P2A, and a linker comprising a nucleic acid sequence encoding a furin cleavage site and T2A. One skilled in the art will be able to select suitable combinations for use in the present invention. In such embodiments, the linker may further comprise a spacer sequence between the furin cleavage site and the 2A peptide. In some embodiments, the linker comprises the furin cleavage site 5' to the 2A peptide. In some embodiments, the linker comprises the 2A peptide 5' to the furin cleavage site. Various spacer sequences are known in the art, including, but not limited to, glycine-serine (GS) spacers, such as (GS)n, (GSGGS)n (SEQ ID NO: 21), and (GGGS)n (SEQ ID NO: 22), where n represents an integer of at least 1. Exemplary spacer sequences may comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 24), GGSGG (SEQ ID NO: 25), GSGSG (SEQ ID NO: 26), GSGGG (SEQ ID NO: 27), GGGSG (SEQ ID NO: 28), GSSSG (SEQ ID NO: 29), etc. One skilled in the art will be able to select suitable spacer sequences for use in the present invention.

[0157] Another aspect of the present invention provides a vector comprising any of the isolated nucleic acids disclosed herein. In certain embodiments, the vector is selected from a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector. In certain embodiments, the vector is an expression vector.

[0158] Also provided are host cells comprising any of the vectors or nucleic acids disclosed herein. The host cells can be of eukaryotic, prokaryotic, mammalian, or bacterial origin. Also provided herein are methods for producing a binding polypeptide or scFv that binds to FAP, wherein the method comprises culturing the host cells.

[0159] In some embodiments, the nucleic acids of the present disclosure can be operably linked to transcriptional control elements, such as promoters and enhancers, etc. Suitable promoter and enhancer elements are known to those skilled in the art.

[0160] In certain embodiments, the nucleic acid is operably linked to a promoter. In certain embodiments, the promoter is a phosphoglycerate kinase-1 (PGK) promoter.

[0161] For expression in bacterial cells, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, λP, and trc. For expression in eukaryotic cells, suitable promoters include, but are not limited to, light chain and / or heavy chain immunoglobulin gene promoter elements and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoters present in long terminal repeats from retroviruses; mouse metallothionein-I promoter; and various tissue-specific promoters known in the art. Suitable reversible promoters (including reversible inducible promoters) are known in the art. Such reversible promoters can be isolated and derived from a variety of organisms, for example, eukaryotes and prokaryotes. Modification of a reversible promoter derived from a first organism for use in a second organism (e.g., a first prokaryote and a second eukaryote, a first eukaryote and a second prokaryote, etc.) is well known in the art. Such reversible promoters and systems based on such reversible promoters also include other control proteins, including but not limited to alcohol-regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator protein (A1cR), etc.), tetracycline-regulated promoters (e.g., promoter systems including Tet activators, TetON, TetOFF, etc.), steroid-regulated promoters (e.g., rat glucocorticoid receptor promoter system, human estrogen receptor promoter system, retinoid promoter system, thyroid promoter system, ecdysone promoter system, mifepristone promoter system, etc.), metal-regulated promoters (e.g., metallothionein promoter system, etc.), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoter, ethylene regulated promoter, benzothiadiazole regulated promoter, etc.), temperature-regulated promoters (e.g., heat shock-inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, etc.), light-regulated promoters, synthetic inducible promoters, etc.

[0162] In some embodiments, the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or a NK-specific promoter. For example, the CD4 gene promoter can be used; see, for example, Salmon et al. Proc. Natl. Acad. Sci. USA (1993) 90: 7739; and Marodon et al. (2003) Blood 101: 3416. As another example, the CD8 gene promoter can be used. NK cell-specific expression can be achieved by using the NcrI (p46) promoter; see, for example, Eckelhart et al. Blood (2011) 117: 1565.

[0163] For expression in yeast cells, suitable promoters are constitutive promoters, such as ADH1 promoter, PGK1 promoter, ENO promoter, PYK1 promoter, etc.; or regulatable promoters, such as GAL1 promoter, GAL10 promoter, ADH2 promoter, PHOS promoter, CUP1 promoter, GALT promoter, MET25 promoter, MET3 promoter, CYC1 promoter, HIS3 promoter, ADH1 promoter, PGK promoter, GAPDH promoter, ADC1 promoter, TRP1 promoter, URA3 promoter, LEU2 promoter, ENO promoter, TP1 promoter, and AOX1 (e.g., for Pichia). The selection of suitable vectors and promoters is well within the level of one of ordinary skill in the art.Suitable promoters for prokaryotic host cells include, but are not limited to, the bacteriophage T7 RNA polymerase promoter; the trp promoter; the lac operator promoter; hybrid promoters, for example, the lac / tac hybrid promoter, the tac / trc hybrid promoter, the trp / lac promoter, the T7 / lac promoter; the trc promoter; the tac promoter, etc.; the araBAD promoter; in vivo regulated promoters, such as the ssaG promoter or related promoters (see, for example, U.S. Patent Publication No. 20040131637), the pagC promoter (Pulkkinen and Miller, J. Bacteriol. (1991) 173(1):86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21):10079-83), the nirB promoter promoter (Harborne et al. Mol. Micro. (1992) 6:2805-2813) and the like (see, e.g., Dunstan et al., Infect. Immun. (1999) 67:5133-5141; McKelvie et al., Vaccine (2004) 22:3243-3255; and Chatfield et al., Biotechnol. (1992) 10:888-892); σ70 promoter, e.g., consensus σ70 promoter (see, e.g., GenBank accession numbers AX798980, AX798961, and AX798183); stationary phase promoters, e.g., dps promoter, spv promoter, and the like; promoters derived from pathogenicity island SPI-2 (pathogenicity island SPI-2) promoter (see, e.g., WO96 / 17951); actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70: 1087-1096); rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22: 367); tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, Protein--Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); SP6 promoter (see, e.g., Melton et al., Nucl. Acids Res.(1984)12:7035); etc.Suitable strong promoters for use in prokaryotes such as E. coli include, but are not limited to, Trc, Tac, T5, T7, and PL. Non-limiting examples of operons for use in bacterial host cells include the lactose promoter operator (when exposed to lactose, the LacI repressor protein changes conformation, thereby preventing the Lad repressor protein from binding to the operator), the tryptophan promoter operator (when complexed with tryptophan, the TrpR repressor protein adopts a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein adopts a conformation that does not bind to the operator), and the tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80: 21-25).

[0164] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive high-level expression of any polynucleotide sequence operably linked thereto. Other constitutive promoter sequences can also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, EF-1α promoter, and human gene promoters, such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Further, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on expression of a polynucleotide sequence to which the inducible promoter is operably linked (when such expression is desired) or turn off such expression (when such expression is not desired). Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0165] In some embodiments, a locus or construct or transgenic containing a suitable promoter is irreversibly switched by induction of an induction system. Suitable systems for inducing irreversible switches are well known in the art, for example, induction of irreversible switches can utilize Cre-lox-mediated recombination (see, for example, Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28: e99, the disclosure of which is incorporated herein by reference). Any suitable recombination of recombinases, endonucleases, ligases, recombination sites, etc. known in the art can be used to generate promoters that are irreversibly switched. The methods, mechanisms, and requirements for performing site-specific recombination described elsewhere herein can be used to generate irreversibly switched promoters and are well known in the art, see, for example, Grindley et al. Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, Mass.) (the disclosures of which are incorporated herein by reference).

[0166] The nucleic acids disclosed herein may be present in expression vectors and / or cloning vectors. The expression vectors may include selectable markers, origins of replication, and other features that provide for replication and / or maintenance of the vector. Suitable expression vectors include, for example, plasmids, viral vectors, and the like. A variety of suitable vectors and promoters are known to those skilled in the art; many are commercially available for use in generating the subject recombinant constructs. The following vectors are provided by way of example and should not be construed as limiting in any way: Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). For eukaryotes: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0167] Expression vectors usually have convenient restriction sites near the promoter sequence to provide for insertion of the nucleic acid sequence encoding the heterologous protein. A selectable marker operative in the expression host may be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g., those based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35:2543-2549; Borras et al., Gene Ther. (1999) 6:515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92:7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5:1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (see, e.g., Ali et al., Hum. Gene Ther. (1998) 9:81-86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94:6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38:2857-2863; Jomary et al., Gene Ther. (1997) 4:683-690, Rolling et al., Hum. Gene Ther. (1999) 10:641-648; Ali et al., Hum. Mol. Genet. (1996) 5:591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166:154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., , Proc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al., J. Virol. (1999) 73: 7812-7816); retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from the following retroviruses: such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); etc.

[0168] Other expression vectors suitable for use are, for example, but not limited to, lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus vectors, adenoviral vectors, poxvirus vectors, herpesvirus vectors, engineered hybrid virus vectors, transposon-mediated vectors, etc. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, Vol. 1-4, Cold Spring Harbor Press, NY) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

[0169] Generally, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (eg, WO 01 / 96584; WO 01 / 29058; and US Pat. No. 6,326,193).

[0170] In some embodiments, an expression vector (e.g., a lentiviral vector) can be used to introduce a nucleic acid into a host cell. Therefore, the expression vector (e.g., a lentiviral vector) of the present invention may comprise a nucleic acid encoding a polypeptide. In some embodiments, the expression vector (e.g., a lentiviral vector) will comprise other elements that will assist in the functional expression of the polypeptide encoded therein. In some embodiments, the expression vector comprising the nucleic acid encoding the polypeptide further comprises a mammalian promoter. In one embodiment, the vector further comprises an elongation factor-1-α promoter (EF-1α promoter). The use of the EF-1α promoter can improve the efficiency of downstream transgenic expression. Physiological promoters (e.g., EF-1α promoter) are less likely to induce integration-mediated genotoxicity and may abolish the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for vectors (e.g., lentiviral vectors) are known to those skilled in the art and can be incorporated into the vectors of the present invention. In some embodiments, the vector (e.g., lentiviral vector) further comprises a non-essential cis-acting sequence that can provide increased titer and gene expression. A non-limiting example of a non-essential cis-acting sequence is a central polypurine tract and a central termination sequence (cPPT / CTS), which are important for efficient reverse transcription and nuclear import. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). In some embodiments, the vector further comprises a post-transcriptional regulatory element. The post-transcriptional regulatory element can increase RNA transcription, increase transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Therefore, in some embodiments, the vector of the present invention further comprises a WPRE sequence. Various post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into the vectors of the present invention (e.g., lentiviral vectors). The vector of the present invention may further comprise other elements, such as rev response elements (RREs) for RNA transport and packaging sequences, and 5' and 3' long terminal repeats (LTRs). The term "long terminal repeat sequence" or "LTR" refers to a base pair located at the end of the retroviral DNA comprising the domain of U3, R and U5 regions. LTR generally provides the functions required for retroviral gene expression (e.g., polyadenylation of initiation, initiation and gene transcripts) and viral replication. In one embodiment, the vector of the present invention (e.g., a lentiviral vector) includes the LTR of 3'U3 deletions. Therefore, the vector of the present invention (e.g., a lentiviral vector) may include any combination of elements described herein to enhance the efficiency of functional expression of transgenics. For example, the vector of the present invention (e.g., a lentiviral vector) may include a WPRE sequence, a cPPT sequence, an RRE sequence, a 5'LTR, a 3'U3 deletion LTR' in addition to the nucleic acid encoding CAR.

[0171] The vectors of the present invention can be self-inactivating vectors. As used herein, the term "self-inactivating vector" refers to a vector in which the 3'LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). Self-inactivating vectors prevent viral transcription beyond the first round of viral replication. Thus, self-inactivating vectors are capable of infection and then integrate into the host genome (e.g., a mammalian genome) only once and cannot be further removed (passed). Therefore, self-inactivating vectors can greatly reduce the risk of generating replication-competent viruses.

[0172] In some embodiments, the nucleic acid of the present invention can be RNA, for example, RNA synthesized in vitro. Methods for synthesizing RNA in vitro are known to those skilled in the art; RNA comprising a sequence encoding a polypeptide of the present invention can be synthesized using any known method. Methods for introducing RNA into host cells are known in the art. See, for example, Zhao et al. Cancer Res. (2010) 15: 9053. Introduction of RNA comprising a nucleotide sequence encoding a polypeptide of the present invention into host cells can be implemented in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) can be electroporated in vitro or ex vivo with RNA comprising a nucleotide sequence encoding a polypeptide of the present invention.

[0173] In order to evaluate the expression of the polypeptide or its portion, the expression vector to be introduced into the cell may also contain a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a cell population sought to be transfected or infected by a viral vector. In some embodiments, the selectable marker can be carried on a separate DNA fragment and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, but are not limited to, antibiotic resistance genes.

[0174] Reporter gene is used to identify the cell of potential transfection and for evaluating the functionality of regulatory sequence.In general, reporter gene is not present in recipient organism or tissue or by the gene of the coded polypeptide expressed therein, and the expression of this polypeptide is performed by some characteristics (for example, enzymatic activity) that are easy to detect.The expression of reporter gene is assessed at the appropriate time after DNA is imported into recipient cell.Suitable reporter gene can include the gene of coding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase, or green fluorescent protein gene (for example, Ui-Tei et al., 2000FEBSLetters 479:79-82) without limitation.

[0175] In some embodiments, the nucleic acids of the present disclosure are provided for use in producing a polypeptide as described herein, for example, in a host cell. In some embodiments, the nucleic acids of the present disclosure provide for amplification of a nucleic acid encoding a polypeptide.

[0176] D. How to use

[0177] The anti-FAP antibodies, binding polypeptides, and scFvs disclosed herein can also be used in diagnostic and imaging applications.

[0178] For example, the anti-FAP antibodies described herein can be used to determine the level of FAP protein in a biological sample using classical immunohistological methods known to those skilled in the art, including immunoassays such as enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, Western blotting, or immunohistochemistry. Suitable antibody assay labels are known in the art and include, but are not limited to, enzyme labels such as glucose oxidase, alkaline phosphatase, and horseradish peroxidase; radioactive isotopes such as iodine ( 125 I, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( 121 In) and technetium ( 99 mTc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin. Such labels can be used to label the binding polypeptides, antibodies, or antigen-binding fragments thereof (e.g., scFv) described herein.

[0179] Alternatively, a second antibody that recognizes an anti-FAP antibody or antigen-binding fragment thereof described herein can be labeled and used in combination with an anti-FAP antibody or antigen-binding fragment thereof to detect FAP protein levels. In one embodiment, the present invention relates to the use of an anti-FAP antibody of the present invention for determining and / or detecting FAP protein levels in a biological sample in vitro or in vivo.

[0180] Determination of the level of FAP protein expression is intended to include qualitative or quantitative measurement or estimation of the level of FAP protein in a first biological sample, either directly (e.g., by measuring or estimating absolute protein levels) or relatively (e.g., by comparing to the level of a disease-associated protein in a second biological sample). The level of FAP polypeptide expression in a first biological sample can be measured or estimated and compared to a standard FAP protein level. The standard can be taken from a second biological sample obtained from an individual who does not have the disorder, or can be determined by averaging the levels of a population of individuals who do not have the disorder. As will be understood in the art, once the "standard" FAP polypeptide level is known, it can be repeatedly used as a comparison standard.

[0181] The anti-FAP antibodies or antigen-binding fragments thereof described herein can be used in prognostic, diagnostic, monitoring, or screening applications, including in vitro and in vivo applications that are well known and standard to the skilled artisan and based on the present description.

[0182] Prognosis, diagnosis, monitoring and screening assays and kits for in vitro assessment and evaluation of immune system status and / or immune response can be used for prediction, diagnosis and monitoring or evaluation of patient samples, including those patient samples known or suspected to have immune system dysfunction or disease or condition, or about the expected or desired immune system response, antigen response or vaccine response relevant to the treatment of disease or condition. The assessment and evaluation of immune system status and / or immune response are also used to determine the suitability of patients for clinical trials of drugs or for administering specific chemotherapeutics or antibodies or their antigen-binding fragments (including combinations thereof) relative to different reagents or antibodies or their antigen-binding fragments. This type of prognosis and diagnostic monitoring and evaluation has been used in practice with antibodies against HER2 proteins in breast cancer (HercepTest TM , Dako), wherein the assay is also used to evaluate patient use In vivo applications include targeted cell therapy and immune system modulation as well as radiological imaging of immune responses.

[0183] In one aspect, the present invention relates to an anti-FAP antibody and / or pharmaceutical composition of the invention for use as a diagnostic.

[0184] In one aspect, the present invention relates to an anti-FAP antibody and / or pharmaceutical composition of the present invention for use in a method for prognosing, diagnosing and / or monitoring immune system dysfunction and / or cancer.

[0185] In one embodiment, the present invention relates to the use of the anti-FAP antibodies of the present invention for predicting, diagnosing and / or monitoring immune system dysfunction and / or cancer in a subject by determining and / or detecting the level of FAP protein in a biological sample of the subject in vitro.

[0186] In one embodiment, the anti-FAP antibodies or antigen-binding fragments thereof can be used for immunohistochemistry of biopsy samples. In another embodiment, the anti-FAP antibodies or antigen-binding fragments thereof can be used to detect the level of FAP, or the level of cells containing FAP on their membrane surface, which can then be correlated with certain disease symptoms. The anti-FAP antibodies or antigen-binding fragments thereof described herein can carry a detectable or functional marker. When a fluorescent marker is used, currently available microscopy and fluorescence activated cell sorter analysis (FACS) or a combination of both methods and procedures known in the art can be used to identify and quantify specific binding members.

[0187] The anti-FAP antibodies or antigen-binding fragments thereof described herein may carry a fluorescent label. Exemplary fluorescent labels include, for example, reactive and conjugated probes such as aminocoumarins, fluorescein and Texas Red, Alexa Fluor dyes, Cy dyes, and DyLight dyes. The anti-FAP antibodies or antigen-binding fragments thereof may carry a radioactive label, such as an isotope 3 H. 14 C. 32 P. 35 S. 36 C1, 51 Cr, 52 Co、 57 Co、 59 Fe, 67 Cu, 90 Y. 99M Tc, 111 In, 117 Lu, 121 I. 124 I. 125 I. 131 I. 198 Au, 211 At 213 Bi, 225 Ac and 186 When a radioactive label is used, currently available counting procedures known in the art can be used to identify and quantify the specific binding of the anti-FAP antibody or antigen-binding fragment thereof to FAP. When the label is an enzyme, detection can be accomplished by any currently available colorimetric, spectrophotometric, fluorescence spectrophotometric, amperometric, or gasometric technique known in the art. This can be achieved by contacting a sample or control sample with an anti-FAP antibody or antigen-binding fragment thereof under conditions that allow formation of a complex between the antibody or antigen-binding fragment thereof and FAP. Any complex formed between the antibody or antigen-binding fragment thereof and FAP is detected and compared in the sample and control. Given the specific binding of the antibodies described herein to FAP, the antibodies or antigen-binding fragments thereof can be used to specifically detect FAP expression on the surface of cells. The antibodies or antigen-binding fragments thereof described herein can also be used to purify FAP by immunoaffinity purification. Also included herein are assay systems that can be prepared in the form of test kits for quantitative analysis of, for example, the presence of FAP or a CTLA-4 / FAP ligand complex. The system or test kit can include a labeled component, such as a labeled antibody, and one or more additional immunochemical reagents.

[0188] In one embodiment, the present invention relates to an in vitro method for determining and / or detecting the level of FAP protein in a biological sample, comprising (1) contacting the sample and, optionally, a control sample, with an anti-FAP antibody of the present invention, or an antigen-binding fragment thereof, under conditions that allow formation of a complex between the antibody or antigen-binding fragment thereof and FAP, and (2) detecting and comparing the complex formed in the sample and, optionally, the control.

[0189] In certain embodiments, the level and / or distribution of FAP is determined in vivo (e.g., non-invasively) by detecting a detectably labeled antibody disclosed herein using a suitable imaging technique, such as positron emission tomography (PET). For example, target antibody-PET or immuno-PET (e.g., anti-FAP PET) can be used to detect the level and / or distribution (e.g., tumor localization) of cells expressing the target FAP in vivo. Techniques for antibody imaging (e.g., antibody-PET imaging) are known in the art, for example, as described in Lamberts, LE et al. (2015) J. Clin. Oncol. 33 (DOI: 10.1200 / JCO.2014.57.8278); Tavare, R. et al. (2014) PNAS 111(3): 1108-1113; Pampaloni et al., J Clin Oncol 32:5s, 2014 (suppl; abstr 3084); and Boerman and Oyen (2011) The Journal of Nuclear Medicine 52(8): 1171-72; U.S. Pat. No. 5,192,525, U.S. Pat. No. 5,219,548, U.S. Pat. No. 5,399,338; all of which are incorporated herein by reference.

[0190] In one embodiment, an anti-FAP antibody detectably labeled with a PET agent, such as 5-2-(4-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid, is detected, for example, by detection. 64Cu radiolabeled, the level and / or distribution of FAP is measured in vivo, for example, as described in Tavare, R. et al. (2014) PNAS 111(3):1108-1113. In another embodiment, the level and / or distribution of FAP is measured in vivo, for example, by detecting an anti-FAP antibody detectably labeled with a PET agent, for example, by fluorine-18 labeling of an antibody, antibody fragment, or polypeptide targeting FAP. In yet another embodiment, the level and / or distribution of FAP is measured in vivo, for example, by detecting an anti-FAP antibody detectably labeled with a PET agent, for example, as described in U.S. Patent No. 9,988,452. In yet another embodiment, the polypeptide targeting FAP is covalently linked to a chelating agent desferoxamine to an appropriate radioisotope.

[0191] In other embodiments, the level of FAP is determined (eg, using immunohistochemistry) in a sample obtained from a subject (eg, a tumor biopsy).

[0192] Detection reagents are also within the scope of the present invention. For example, immunoPET reagents comprising anti-FAP antibody molecules as described herein are provided. Exemplary labeling reagents include, but are not limited to, astatine 211 (211At), bromine 76 ( 76 Br), calcium 47( 47 Ca), carbon 11 ( 11 C), carbon 14 ( 14 C), chromium 51 ( 51 Cr), cobalt-57( 57 Co), cobalt-58 ( 58 Co), copper-64( 64 Cu), Er-169( 169 Er), fluorine-18 ( 18 F), fluorodeoxyglucose ( 18 F-FDG), Gallium-67 ( 67 Ga), gallium-68( 68 Ga), hydrogen-3( 3 H), indium-111 ( 111 In), iodine-123 ( 123 I), iodine-124( 124 I), iodine-125( 125 I), iodine-131( 131 I), iron-59( 59 Fe), krypton-81m ( 81m Kr), Lutetium-177 ( 177 Lu), nitrogen-13 ( 13 N), oxygen-15 ( 150 ), phosphorus-32( 32P), Samarium-153 ( 153 Sm), selenium 75 ( 75 Se), strontium 89 (89Sr), thallium 201 ( 201 T1), sodium 22( 22 Na), sodium 24( 24 Na), Technetium 99m( 99m Tc), xenon 133 ( 133 Xe), yttrium-86 ( 86 Y), Yttrium 88 ( 88 Y), Yttrium 90 ( 90 Y), and zirconium 89 ( 89 Zr). Other exemplary labeling agents and their use in immunoPET are described, for example, in Lamberts, LE et al. (2015) J. Clin. Oncol. 33 (DOI: 10.1200 / JCO.2014.57.8278) and Boerman and Oyen (2011) The Journal of Nuclear Medicine 52(8): 1171-72.

[0193] In one aspect, the present invention provides a method for identifying a subject suitable for adoptive cell therapy targeting fibroblast activation protein (FAP). The method comprises (a) isolating diseased tissue from a subject, (b) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP, and (c) detecting cells expressing FAP in the isolated tissue, thereby identifying a suitable subject for adoptive cell therapy.

[0194] In certain embodiments, the binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence GYTITSYSLH (SEQ ID NO: 17), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLAS (SEQ ID NO: 20), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0195] In certain embodiments, the isolated binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0196] In certain embodiments, the isolated binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence of GYTITSYSLH (SEQ ID NO: 17), and / or HCDR2 comprises the amino acid sequence of EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and / or HCDR3 comprises the amino acid sequence of LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence of TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence of LTSNLAS (SEQ ID NO: 20), and / or LCDR3 comprises the amino acid sequence of QQWSGYPPIT (SEQ ID NO: 6).

[0197] In certain embodiments, the isolated binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), and / or HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIKAT (SEQ ID NO: 18), and / or HCDR3 comprises the amino acid sequence TRLDDSRFHWYFDV (SEQ ID NO: 19); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), and / or LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and / or LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0198] In certain embodiments, the isolated binding polypeptide comprises a heavy chain variable region comprising any one of the three heavy chain complementary determining regions HCDR1, HCDR2, and HCDR3 as described herein. In certain embodiments, the antigen binding domain comprises a light chain variable region comprising any one of the three light chain complementary determining regions LCDR1, LCDR2, and LCDR3 as described herein. In certain embodiments, the antigen binding domain comprises any combination of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 as described herein. Given the heavy and light chain variable region sequences provided herein, a skilled person will be able to readily determine the relevant complementary determining regions based on amino acid numbering.

[0199] In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof. In certain embodiments, the binding polypeptide is conjugated to a therapeutic molecule or a diagnostic molecule. In certain embodiments, the diagnostic molecule comprises a detectable label. In certain embodiments, the detectable label is a radiolabel, a fluorophore, an enzyme, a hapten, biotin, or a chromophore.

[0200] In certain embodiments, after the subject is identified as a suitable subject, adoptive cell therapy is administered to the subject. In certain embodiments, adoptive cell therapy includes modified immune cells comprising chimeric antigen receptors (CARs). In certain embodiments, the immune cells are T lymphocytes. In certain embodiments, the immune cells are NK cells. In certain embodiments, CARs specifically bind to FAP.

[0201] In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide consists of a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide is composed of a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0202] E. Treatment methods

[0203] The antibodies, binding polypeptides, and scFv described herein can be included in a composition for treating a disease or condition in a subject in need thereof. The composition can include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition can be administered to a subject.

[0204] In one aspect, the present invention provides a method for treating cancer in a subject in need thereof. The method comprises administering to the subject an isolated binding polypeptide comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or mouse fibroblast activation protein (FAP). In certain embodiments, the binding polypeptide comprises any HCDR or LCDR contemplated herein. In certain embodiments, the binding polypeptide comprises: a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7; and / or a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9.

[0205] In certain embodiments, the cancer is associated with cells expressing fibroblast activation protein (FAP). In certain embodiments, the cells expressing FAP are cancer-associated cells. In certain embodiments, the cancer-associated cells are cancer-associated fibroblasts (CAFs). In certain embodiments, the cancer-associated cells expressing FAP are fat cells expressing FAP. In certain embodiments, the cancer-associated cells expressing FAP are tumor-associated macrophages (TAMs). In certain embodiments, the cancer-associated cells expressing FAP are tumor-associated neutrophils (TANs). In certain embodiments, the cancer-associated cells expressing FAP are myeloid-derived suppressor cells (MDSCs). In certain embodiments, the cancer-associated cells expressing FAP are cancer-initiating cells.

[0206] In certain embodiments, the binding polypeptide specifically binds to fibroblast activation protein (FAP). In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0207] In some embodiments, the FAP-targeting binding polypeptides disclosed herein can be used in combination with other therapeutic agents, such as, but not limited to, immunotherapy (such as immuno-oncology antibody therapy and checkpoint blockade), or CAR-T therapy. Therefore, in such embodiments, the second polynucleotide sequence may comprise a polynucleotide sequence encoding an anti-cancer antibody, a checkpoint blockade molecule, or a CAR.

[0208] Another aspect of the invention includes a method for treating cancer in a subject in need thereof, the method comprising: (a) identifying the subject as a suitable subject, wherein the identification comprises (i) isolating diseased tissue from the subject; (ii) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP; (iii) detecting cells expressing FAP in the isolated tissue; (b) administering to the suitable subject adoptive cell therapy comprising modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to fibroblast activation protein (FAP).

[0209] In another aspect of the present invention, provided herein are methods for treating fibrosis. Fibrosis is the formation of excess fibrous connective tissue in an organ or tissue during a repair or reaction process. This connective tissue, deposited by stimulated fibroblasts, interferes with or completely inhibits the normal structure and function of the underlying organ or tissue. In certain embodiments, the fibrosis that can be treated includes, but is not limited to, pulmonary fibrosis, cardiac fibrosis, liver fibrosis, skin fibrosis (including keloids and scleroderma), intestinal fibrosis, and renal fibrosis. In certain embodiments, the fibrosis is cardiac fibrosis.

[0210] The compositions of the present invention may be administered at dosages and routes, and sometimes as determined in appropriate preclinical and clinical trials and experiments. The compositions may be administered multiple times at dosages within these ranges. Administration of the compositions may be combined with other methods useful for treating the desired disease or condition as determined by those skilled in the art.

[0211] F. Pharmaceutical Compositions and Formulations

[0212] Also provided are pharmaceutical compositions comprising the binding polypeptides, scFvs, antibodies, or antigen-binding fragments disclosed herein. Among the compositions are pharmaceutical compositions and formulations for administration, such as for treating a disease or disorder. Also provided are therapeutic methods for administering the pharmaceutical compositions to a subject (e.g., a patient).

[0213] Pharmaceutical compositions and formulations typically include one or more optional pharmaceutically acceptable carriers or excipients.In some embodiments, the composition includes at least one additional therapeutic agent.

[0214] The term "pharmaceutical formulation" refers to a formulation that is in a form that allows the biological activity of the active ingredient contained therein to be effective and does not contain other ingredients that are unacceptably toxic to the subject to which the formulation is administered. A "pharmaceutically acceptable carrier" refers to a component of a pharmaceutical formulation, other than the active ingredient, that is non-toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives. In some aspects, the choice of carrier is determined in part by the specific composition and / or method of administration. Thus, a variety of suitable formulations exist. For example, a pharmaceutical composition may contain a preservative. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservative or mixture thereof is typically present in an amount of about 0.0001% to about 2% by weight of the total composition. For example, Remington's Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1980) describes carriers. Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to, buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl alcohol, or benzyl alcohol; alkyl parabens such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants such as polyethylene glycol (PEG).

[0215] In some aspects, a buffer is included in the composition. Suitable buffers include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffers is used. The buffer or mixture thereof is typically present in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administerable pharmaceutical compositions are known. Exemplary methods are described in more detail, for example, in Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).

[0216] The preparation may include an aqueous solution. The preparation or composition may also include more than one active ingredient, and the active ingredient can be used for a specific indication, disease or condition treated with the composition, preferably an active ingredient whose activity is complementary to the composition, wherein the respective activities do not adversely affect each other. Such active ingredients are appropriately present in an amount combination effective for the intended purpose. Therefore, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, such as asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine (gemcitabine), hydroxyurea, methotrexate, paclitaxel, rituximab (rituximab), vinblastine, and / or vincristine. In some embodiments, the pharmaceutical composition contains a composition of an amount (such as a therapeutically effective or prophylactically effective amount) that is effective for treating or preventing a disease or condition. In some embodiments, the therapeutic or preventive efficacy is monitored by periodic assessment of the treated subject. The desired dose can be delivered by a single bolus administration of the composition, multiple bolus administration of the composition, or by continuous infusion administration of the composition.

[0217] Preparations include oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, oral, sublingual or suppository preparations. In some embodiments, parenteral administration compositions. As used herein, the term "parenteral" includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, peripheral systemic delivery is utilized, and the composition is administered to the subject by intravenous injection, intraperitoneal injection, or subcutaneous injection. In some embodiments, the composition is provided as a sterile liquid preparation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which can be buffered to a selected pH value in some aspects. Liquid preparations are generally easier to prepare than gels, other viscous compositions, and solid compositions. In addition, liquid compositions are more convenient to administer, especially by injection. On the other hand, viscous compositions can be formulated within an appropriate viscosity range to provide a longer contact time with a specific tissue. Liquid or viscous compositions may comprise a carrier, which may be a solvent or dispersion medium containing, for example, water, saline, phosphate-buffered saline, a polyol (eg, glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof.

[0218] Sterile injectable solutions can be prepared by incorporating the composition into a solvent, such as mixing with a suitable carrier, diluent or excipient (e.g., sterile water, normal saline, glucose, dextrose, etc.). The composition can include auxiliary substances, such as wetting agents, dispersants or emulsifiers (e.g., methylcellulose), pH buffers, gels or viscosity enhancing additives, preservatives, flavorings, and / or pigments, depending on route of administration and desired formulation. Suitable formulations can be prepared with reference to standard texts in some respects.

[0219] Various additives that enhance the stability and sterility of the composition may be added, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, and sorbic acid, can ensure protection against the action of microorganisms. Absorption of injectable pharmaceutical forms can be prolonged by using agents that delay absorption (e.g., aluminum monostearate and gelatin).

[0220] Formulations to be used for in vivo administration are generally sterile. Sterility can be readily accomplished, for example, by filtration through sterile filtration membranes.

[0221] The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic files.

[0222] G. Implementation of the Present Disclosure

[0223] In one aspect, the invention provides isolated binding polypeptides comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine Fibroblast Activation Protein (FAP).

[0224] In certain embodiments, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0225] In certain embodiments, the binding polypeptide binds to fibroblast activation protein (FAP). In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0226] In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide consists of a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 7.

[0227] In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide consists of a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.

[0228] In another aspect, the present invention provides an isolated binding polypeptide comprising: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9.

[0229] In another aspect, the present invention provides single-chain variable fragments (scFv) comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine fibroblast activation protein (FAP).

[0230] In certain embodiments of scFv, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6), wherein the heavy chain variable region and the light chain variable region are separated by a linker.

[0231] On the other hand, the present invention provides a single-chain variable fragment (scFv), which includes: a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:7; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:9, wherein the heavy chain variable region and the light chain variable region are separated by a linker.

[0232] In certain embodiments of the scFv, the linker comprises the amino acid sequence set forth in SEQ ID NO:15.

[0233] In another aspect, the present invention provides a single-chain variable fragment (scFv) comprising the amino acid sequence shown in SEQ ID NO: 11 or 13. In another aspect, the present invention provides a single-chain variable fragment (scFv) consisting of the amino acid sequence shown in SEQ ID NO: 11 or 13.

[0234] In another aspect, the invention provides an isolated nucleic acid encoding any of the binding polypeptides or any of the scFvs contemplated herein.

[0235] In another aspect, the invention provides isolated nucleic acids encoding binding polypeptides comprising an antigen binding domain that specifically binds to an epitope of human and canine, and / or murine Fibroblast Activation Protein (FAP).

[0236] In certain embodiments of the nucleic acid, the antigen binding domain comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0237] In certain embodiments of the nucleic acid, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments of the nucleic acid, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single domain antibody. In certain embodiments of the nucleic acid, the antibody is a full-length antibody. In certain embodiments of the nucleic acid, the antibody or antigen-binding fragment is a humanized antibody or a fragment thereof.

[0238] In certain embodiments of the nucleic acid, the heavy chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 8. In certain embodiments of the nucleic acid, the heavy chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO: 8. In certain embodiments of the nucleic acid, wherein the heavy chain variable region is encoded by a nucleic acid, the nucleic acid consists of the polynucleotide sequence shown in SEQ ID NO: 8.

[0239] In certain embodiments of the nucleic acid, the light chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of the light chain variable region set forth in SEQ ID NO: 10. In certain embodiments of the nucleic acid, the light chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence set forth in SEQ ID NO: 10. In certain embodiments of the nucleic acid, the light chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence set forth in SEQ ID NO: 10.

[0240] In another aspect, the present invention provides an isolated nucleic acid encoding a binding polypeptide comprising a heavy chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:8; and a light chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:10.

[0241] In another aspect, the present invention provides an isolated nucleic acid encoding a single-chain variable fragment (scFv), comprising: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO: 4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO: 5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO: 6).

[0242] In another aspect, the present invention provides an isolated nucleic acid encoding a single-chain variable fragment (scFv), comprising: a heavy chain variable region comprising the nucleotide sequence set forth in SEQ ID NO: 8; and a light chain variable region comprising the nucleotide sequence set forth in SEQ ID NO: 10, wherein the heavy chain variable region and the light chain variable region are separated by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 15.

[0243] In another aspect, the present invention provides an isolated nucleic acid encoding a single-chain variable fragment (scFv) comprising the polynucleotide sequence shown in SEQ ID NO: 12 or 14. In another aspect, the present invention provides an isolated nucleic acid encoding a single-chain variable fragment (scFv) consisting of the polynucleotide sequence shown in SEQ ID NO: 12 or 14.

[0244] On the other hand, the present invention provides a vector comprising any isolated nucleic acid contemplated herein. In certain embodiments, the vector is an expression vector. In certain embodiments, the vector is selected from a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.

[0245] On the other hand, the present invention provides host cells comprising any vector contemplated herein. In certain embodiments, the host cell is eukaryotic or prokaryotic in origin. In certain embodiments, the host cell is mammalian in origin. In certain embodiments, the host cell is bacterial in origin.

[0246] In another aspect, the invention provides a method of producing a binding polypeptide or scFv that binds FAP, the method comprising culturing any of the host cells contemplated herein.

[0247] In another aspect, the invention provides pharmaceutical compositions comprising any binding polypeptide or any scFv contemplated herein.

[0248] In another aspect, the present invention provides a pharmaceutical composition comprising any of the antibodies or any antigen-binding fragments contemplated herein.

[0249] In another aspect, the present invention provides a method for identifying a subject suitable for adoptive cell therapy directed against fibroblast activation protein (FAP), wherein the method comprises: (a) isolating diseased tissue from a subject; (b) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP; and (c) detecting cells expressing FAP in the isolated tissue, thereby identifying a suitable subject for adoptive cell therapy.

[0250] In certain embodiments of the method, the binding polypeptide comprises: a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises the amino acid sequence YTITSYSLH (SEQ ID NO:1), HCDR2 comprises the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO:1) (SEQ ID NO:2), and HCDR3 comprises the amino acid sequence LDDSRFHWYFDV (SEQ ID NO:3); and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 comprises the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 comprises the amino acid sequence QQWSGYPPIT (SEQ ID NO:6).

[0251] In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0252] In certain embodiments, the binding polypeptide is conjugated to a therapeutic molecule or a diagnostic molecule. In certain embodiments, the diagnostic molecule comprises a detectable label. In certain embodiments, the detectable label is a radiolabel, a fluorophore, an enzyme, a hapten, biotin, or a chromophore.

[0253] In certain embodiments, after the subject is identified as a suitable subject, adoptive cell therapy is administered to the subject.In certain embodiments, adoptive cell therapy comprises modified immune cells comprising a chimeric antigen receptor (CAR).

[0254] In certain embodiments, the immune cell is a T lymphocyte. In certain embodiments, the immune cell is a NK cell.

[0255] In certain embodiments, the CAR specifically binds to FAP.

[0256] In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identical to the amino acid sequence of the heavy chain variable region set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7. In certain embodiments, the binding polypeptide consists of a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NO: 7.

[0257] In certain embodiments, the binding polypeptide comprises a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9. In certain embodiments, the binding polypeptide consists of a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9.

[0258] In another aspect, the present invention provides a method for treating cancer in a subject in need thereof. The method comprises administering to the subject an isolated binding polypeptide comprising: a heavy chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7; and a light chain variable region comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9.

[0259] In certain embodiments, the cancer is associated with cells expressing fibroblast activation protein (FAP). In certain embodiments, the cells expressing FAP are cancer-associated cells. In certain embodiments, the cancer-associated cells are cancer-associated fibroblasts (CAFs). In certain embodiments, the cancer-associated cells expressing FAP are fat cells expressing FAP. In certain embodiments, the cancer-associated cells expressing FAP are tumor-associated macrophages (TAMs). In certain embodiments, the cancer-associated cells expressing FAP are tumor-associated neutrophils (TANs). In certain embodiments, the cancer-associated cells expressing FAP are myeloid-derived suppressor cells (MDSCs). In certain embodiments, the cancer-associated cells expressing FAP are cancer-initiating cells.

[0260] In certain embodiments, the binding polypeptide specifically binds to fibroblast activation protein (FAP). In certain embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment is selected from Fab, a single-chain variable fragment (scFv), or a single-domain antibody. In certain embodiments, the antibody is a full-length antibody. In certain embodiments, the antibody or antigen-binding fragment is a humanized antibody or an antigen-binding fragment thereof.

[0261] In another aspect, the present invention provides a method for treating cancer in a subject in need thereof, comprising: (a) identifying the subject as a suitable subject, wherein the identification comprises (i) isolating diseased tissue from the subject; (ii) contacting the isolated tissue with a binding polypeptide that specifically binds to FAP; and (iii) detecting cells expressing FAP in the isolated tissue; and (b) administering to the suitable subject adoptive cell therapy comprising modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to fibroblast activation protein (FAP).

[0262] Although the present invention has been described with reference to its specific embodiments, it will be understood by those skilled in the art that various changes and equivalent substitutions may be made without departing from the true spirit and scope of the present invention. It will be apparent to those skilled in the art that suitable equivalents may be used to make other suitable modifications and adaptations to the methods described herein without departing from the scope of the embodiments disclosed herein. In addition, many modifications may be made to adapt specific circumstances, materials, compositions of matter, processes, or one or more process steps to the purpose, spirit, and scope of the present invention. All of these modifications are intended to fall within the scope of the appended claims. Having now described certain embodiments in detail, they will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting.

[0263] Experimental Examples

[0264] The present invention is further described in detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise stated. Therefore, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all modifications that become apparent as a result of the teachings provided herein.

[0265] Without further description, it is believed that those skilled in the art can utilize the foregoing description and the following exemplary embodiments to prepare and apply the compounds of the present invention and to practice the claimed methods. Therefore, the following working examples specifically point out preferred embodiments of the present invention and are not to be construed as limiting the remainder of the disclosure in any way.

[0266] The materials and methods used in performing the experiments disclosed herein are now described.

[0267] Bioinformatics inference of the canine FAP gene sequence: PCR primers were designed using the NCBI predicted sequence of canine FAP (XM_005640252.2). The resulting PCR product matched the predicted sequence 100% at the protein level. At the nucleotide level, there were two conserved base pair substitutions at T127 and A603.

[0268] Canine FAP cDNA PCR, Subcloning, and Expression: A confluent 10 cm dish of canine SK osteosarcoma cells expressing endogenous FAP was treated with 1 ml of TRIzol (Life Technologies, #15596-026), and total RNA was extracted according to the manufacturer's protocol. cDNA was reverse transcribed from 5 μg of total RNA using the SuperScript First Strand Synthesis Kit (Life Technologies, #11904-018). This cDNA served as a template for touchdown PCR using the following primers: forward 5' ATGTAGACGTGGTTAAAAATTG (SEQ ID NO: 37); reverse 5' CGTCATCTTCAGTCGGACAA (SEQ ID NO: 38). A 2291 bp amplicon was detected on a 1% agarose gel.

[0269] The resulting PCR product was purified and cloned into pGEM-T Easy (Promega) and sequenced. This shuttle vector is linearized and contains a single "T" overhang. This allows the PCR product to be simply non-directionally cloned using the 3' "A" overhang added to the PCR product by Taq polymerase. On this basis, the cDNA was non-directionally cloned into the plasmid pcDNA3.1 using the EcoRI cloning site.

[0270] Canine FAP cDNA was subcloned from pcDNA3.1 into a lentiviral plasmid (pLenti6 / v5-D-TOPO) by excising the cDNA with SpeI and opening pLenti6 / v5-D-TOPO with XbaI. These restriction sites have compatible ends. This generated canine FAP.pLenti6 / v5-D-TOPO.

[0271] Canine FAP.pLenti / v5-D-TOPO was co-transfected with packaging plasmids (pMD2.G, pCMVΔR8.2) into HEK 293 cells. Virus-containing supernatant was harvested 48 hours later. Viral titers were determined by p24 ELISA, and Balb / C 3T3 fibroblasts were transduced at varying MOIs ranging from 0.5:1 to 10:1.

[0272] Transgene expression in Balb / C 3T3 canine FAP was confirmed by flow cytometry. The primary antibody used was a biotinylated sheep anti-huFAP polyclonal antibody from R&D systems (5 μg / ml). The secondary antibody was APC-streptavidin from Biolegend (1 μg / ml).

[0273] Immunization and hybridoma generation: 14-week-old Balb / C 3T3 cells expressing full-length canine FAP were used to immunize 14-week-old Balb / C.FAP -\- All injections were given intraperitoneally and consisted of 1 x 10 7 The cells were composed of 10 cells. After the initial immunization, boosts were given on days 14 and 28; the animals were then bled on day 42, followed by a boost on day 56, a bleed on day 63, and three more boosts on days 70, 217, and 238. Spleens were harvested on day 241 in 2017, single-cell suspensions were prepared, and splenocytes were fused with sp2 / 0 cells by the UPENN Hybridoma Core Facility. Hybridoma supernatants were initially screened by FACS on MC KOSA parental (FAP null) vs. MC KOSA.K9FAP expressing the canine FAP transgene, using hybridoma supernatants as primary antibodies and AF488 goat anti-mouse IgG as secondary antibodies. Clone 4G5 was identified as reactive to transduced cells but not parental cells and screened on additional cells to confirm reactivity with FAP-expressing cells but not FAP-negative cells: human primary fibroblasts, BALB / c 3T3 expressing mouse or human FAP transgenes, canine primary fibroblasts, SK KOSA (expressing FAP), and BALB / c 3T3 (FAP-negative) cells. 4G5 was then confirmed to be an IgG1k isotype antibody using the Thermo Fisher Rapid ELISA Mouse mAb Identification Kit #37503.

[0274] Example 1: Bioinformatics inference of canine FAP gene sequence for designing PCR primers

[0275] As a first step, the sequence of the canine FAP gene was amplified by PCR. Canine FAP-specific PCR primers were designed using the NCBI predicted sequence of canine FAP (XM_005640252.2). The resulting PCR product matched the canine FAP sequence 100% at the protein level ( Figure 1 Subsequent sequencing revealed that canine FAP has two conserved base pair substitutions at T127 and A603 at the nucleotide level.

[0276] Example 2: Canine FAP cDNA PCR, subcloning, sequencing and expression

[0277] As a first step in generating anti-canine FAP antibodies, a construct capable of producing recombinant canine FAP protein was created. To provide canine FAP cDNA, TRIzoL-based RNA extraction was performed on canine SK osteosarcoma cells expressing endogenous FAP, and the isolated RNA was then reverse transcribed into cDNA. This cDNA was used as a template for touchdown PCR, which generated a 2291 bp amplicon. The amplified PCR product was purified and cloned into a shuttle vector, which allows for simple non-directional cloning of the PCR product. On this basis, the cDNA was cloned into a eukaryotic expression plasmid ( Figure 2A The canine FAP cDNA was then subcloned into a lentiviral plasmid to allow transduction into mammalian cell lines ( Figure 2B The resulting canine FAP-lentiviral construct was then co-transfected with the packaging plasmid into HEK293 cells. The virus-containing supernatant was harvested 48 hours later. Viral titers were determined by p24 ELISA, and BALB / c-derived 3T3 fibroblasts were transduced at varying MOIs ranging from 0.5:1 to 10:1. Flow cytometry was used to confirm transgene expression in 3T3-canine FAP cells. Figure 2C ).

[0278] Example 3: Immunization, fusion and screening

[0279] 14-week-old BALB / c FAP mice were then immunized with BALB / c 3T3 fibroblasts transduced to express full-length canine FAP. -\- All injections were given intraperitoneally and consisted of 1 x 10 7The initial immunization was followed by six booster immunizations at regular intervals over the next eight months. At the end of the study, the spleens were harvested and the resulting single-cell suspensions were used to generate hybridomas by fusion with sp2 / 0 cells. The resulting hybridomas were then screened for those producing anti-canine FAP antibodies. As an initial screen, immunoglobulin-producing cells that were able to stain MC KOSA cells expressing the canine FAP transgene but not the FAP-null MC KOSA parental cells were identified by flow cytometry. Figure 3 ). As a result, the 4G5 clone was identified as a potential candidate. Subsequent studies further showed that the immunoglobulin produced by this clone was able to stain human primary fibroblasts expressing FAP, BALB / c 3T3 cells expressing mouse or human FAP transgenes, canine primary fibroblasts, and SK KOSA cells expressing FAP. Similarly, the 4G5 immunoglobulin was unable to stain FAP-negative parental BALB / c 3T3 cells, further demonstrating its specificity. Finally, a commercial ELISA-based antibody typing kit was used to further characterize the immunoglobulin produced by 4G5. These results demonstrated that 4G5 is a mouse-IgG1-κ isotype antibody ( Figures 4A-4C Subsequent protein gels comparing 4G5 to a mouse IgG1 isotype control yielded similar heavy and light chain banding patterns, further demonstrating the isotype identity of 4G5 ( Figure 5 ).

[0280] Other Implementations

[0281] The enumeration of elements in any definition of a variable herein includes that variable being defined as any single element or combination (or subcombination) of the listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiment or part thereof.

[0282] The disclosures of each patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety. Although the present invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the present invention may be devised by those skilled in the art without departing from the true spirit and scope of the invention. It is intended that the appended claims be interpreted as including all such embodiments and equivalent variations. Sequence Listing <110> Board of Trustees of the University of Pennsylvania E. Poole L. Todd <120> Anti-canine Fibroblast Activation Protein monoclonal antibody cross-reactive with mouse and human Fibroblast Activation Protein (FAP) <130> 046483-7274WO1(02348) <150> 62 / 904,272 <151> 2019-09-23 <160> 38 <170> PatentIn version 3.5 <210> 1 <211> 9 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR1 <400> 1 Tyr Thr Ile Thr Ser Tyr Ser Leu His 1 5 <210> 2 <211> 18 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR2 <400> 2 Glu Ile Asn Pro Ala Asn Gly Asp His Asn Phe Ser Glu Lys Phe Glu 1 5 10 15 Ile Lys <210> 3 <211> 12 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR3 <400> 3 Leu Asp Asp Ser Arg Phe His Trp Tyr Phe Asp Val 1 5 10 <210> 4 <211> 10 <212> PRT <213> Artificial sequence <220> <223> 4G5 LCDR1 <400> 4 Thr Ala Ser Ser Ser Val Ser Tyr Met Tyr 1 5 10 <210> 5 <211> 6 <212> PRT <213> artificial sequence <220> <223> 4G5 LCDR2 <400> 5 Leu Thr Ser Asn Leu Ala 1 5 <210> 6 <211> 10 <212> PRT <213> artificial sequence <220> <223> 4G5 LCDR3 <400> 6 Gln Gln Trp Ser Gly Tyr Pro Pro Ile Thr 1 5 10 <210> 7 <211> 121 <212> PRT <213> artificial sequence <220> <223> 4G5 VH <400> 7 Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Ile Thr Ser Tyr 20 25 30 Ser Leu His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Ala Asn Gly Asp His Asn Phe Ser Glu Lys Phe 50 55 60 Glu Ile Lys Ala Thr Leu Thr Val Asp Ser Ser Ser Asn Thr Ala Phe 65 70 75 80 Met Gln Leu Ser Arg Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Leu Asp Asp Ser Arg Phe His Trp Tyr Phe Asp Val Trp Gly 100 105 110 Ala Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 8 <211> 363 <212> DNA <213> Artificial Sequence <220> <223> 4G5 VH <400> 8 caggtccaac tgcagcagcc tggggctgaa ctggtaaagc ctggggcttc agtgaagttg 60 tcctgcaagg cgtctggcta caccatcacc agctactctc tgcactgggt gaagcagagg 120 cctggacaag gccttgagtg gattggagag attaatcctg ccaatggtga tcataacttc 180 agtgagaagt tcgagatcaa ggccacactg actgtagaca gctcctccaa cacagcattc 240 atgcaactca gcaggctgac atctgaggac tctgcggtct attactgtac aagattggac 300 gatagtaggt tccactggta cttcgatgtc tggggcgcag ggaccacggt caccgtctcc 360 tca 363 <210> 9 <211> 107 <212> PRT <213> Synthetic Sequence <220> <223> 4G5 VL <400> 9 Gln Ile Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Thr Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 Tyr Trp Tyr Gln Gln Lys Pro Arg Ser Ser Pro Lys Pro Trp Ile Phe 35 40 45 Leu Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg 50 55 60 Gly Ser Gly Thr Ser Phe Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Gly Tyr Pro Pro Ile 85 90 95 Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 10 <211> 321 <212> DNA <213> Artificial sequence <220> <223> 4G5 VL <400> 10 caaattgttc tcacccagtc tccagcgctc atgtctgctt ctccagggga gaaggtcacc 60 atgacctgca ctgccagctc aagtgttagt tacatgtact ggtaccagca gaagccacga 120 tcctccccca aaccctggat ttttctcacc tccaacctgg cttctggagt ccctgctcgc 180 ttcagtggcc gtgggtctgg gacctctttc tctctcacaa tcagcagcat ggaggctgaa 240 gatgctgcca cttattactg ccagcagtgg agtggttacc cacccatcac attcggctcg 300 gggacaaagt tggaaataaa a 321 <210> 11 <211> 243 <212> PRT <213> Artificial sequence <220> <223> 4G5 scFv VLVH <400> 11 Gln Ile Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Thr Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 Tyr Trp Tyr Gln Gln Lys Pro Arg Ser Ser Pro Lys Pro Trp Ile Phe 35 40 45 Leu Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Arg 50 55 60 Gly Ser Gly Thr Ser Phe Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Gly Tyr Pro Pro Ile 85 90 95 Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln 115 120 125 Pro Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Val Lys Leu Ser Cys 130 135 140 Lys Ala Ser Gly Tyr Thr Ile Thr Ser Tyr Ser Leu His Trp Val Lys 145 150 155 160 Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Glu Ile Asn Pro Ala 165 170 175 Asn Gly Asp His Asn Phe Ser Glu Lys Phe Glu Ile Lys Ala Thr Leu 180 185 190 Thr Val Asp Ser Ser Ser Asn Thr Ala Phe Met Gln Leu Ser Arg Leu 195 200 205 Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Thr Arg Leu Asp Asp Ser 210 215 220 Arg Phe His Trp Tyr Phe Asp Val Trp Gly Ala Gly Thr Thr Val Thr 225 230 235 240 Val Ser Ser <210> 12 <211> 729 <212> DNA <213> Artificial sequence <220> <223> 4G5 scFv VLVH <400> 12 caaattgttc tcacccagtc tccagcgctc atgtctgctt ctccagggga gaaggtcacc 60 atgacctgca ctgccagctc aagtgttagt tacatgtact ggtaccagca gaagccacga 120[[ID=q1]] tcctccccca aaccctggat ttttctcacc tccaacctgg cttctggagt ccctgctcgc 180 ttcagtggcc gtgggtctgg gacctctttc tctctcacaa tcagcagcat ggaggctgaa 240 gatgctgcca cttattactg ccagcagtgg agtggttacc cacccatcac attcggctcg 300 gggacaaagt tggaaataaa aggtggaggt ggcagcggag gaggtgggtc cggcggtgga 360 ggaagccagg tccaactgca gcagcctggg gctgaactgg taaagcctgg ggcttcagtg 420 aagttgtcct gcaaggcgtc tggctacacc atcaccagct actctctgca ctgggtgaag 480 cagaggcctg gacaaggcct tgagtggatt ggagagatta atcctgccaa tggtgatcat 540 aacttcagtg agaagttcga gatcaaggcc acactgactg tagacagctc ctccaacaca 600 gcattcatgc aactcagcag gctgacatct gaggactctg cggtctatta ctgtacaaga 660 ttggacgata gtaggttcca ctggtacttc gatgtctggg gcgcagggac cacggtcacc 720 gtctcctca 729 <210> 13 <211> 243 <212> PRT <213> Artificial Sequence <220> <223> 4G5 scFv VHVL <400> 13 Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Ile Thr Ser Tyr 20 25 30 Ser Leu His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Ala Asn Gly Asp His Asn Phe Ser Glu Lys Phe 50 55 60 Glu Ile Lys Ala Thr Leu Thr Val Asp Ser Ser Ser Asn Thr Ala Phe 65 70 75 80 Met Gln Leu Ser Arg Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Leu Asp Asp Ser Arg Phe His Trp Tyr Phe Asp Val Trp Gly 100 105 110 Ala Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Gln Ile Val Leu Thr Gln Ser Pro 130 135 140 Ala Leu Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Thr 145 150 155 160 Ala Ser Ser Ser Val Ser Tyr Met Tyr Trp Tyr Gln Gln Lys Pro Arg 165 170 175 Ser Ser Pro Lys Pro Trp Ile Phe Leu Thr Ser Asn Leu Ala Ser Gly 180 185 190 Val Pro Ala Arg Phe Ser Gly Arg Gly Ser Gly Thr Ser Phe Ser Leu 195 200 205 Thr Ile Ser Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln 210 215 220 Gln Trp Ser Gly Tyr Pro Pro Ile Thr Phe Gly Ser Gly Thr Lys Leu 225 230 235 240 Glu Ile Lys <210> 14<---- <211> 729 <212> DNA <213> Artificial sequence <220> <223> 4G5 scFv VHVL <400> 14 caggtccaac tgcagcagcc tggggctgaa ctggtaaagc ctggggcttc agtgaagttg 60 tcctgcaagg cgtctggcta caccatcacc agctactctc tgcactgggt gaagcagagg 120 cctggacaag gccttgagtg gattggagag attaatcctg ccaatggtga tcataacttc 180 agtgagaagt tcgagatcaa ggccacactg actgtagaca gctcctccaa cacagcattc 240 atgcaactca gcaggctgac atctgaggac tctgcggtct attactgtac aagattggac 300 gatagtaggt tccactggta cttcgatgtc tggggcgcag ggaccacggt caccgtctcc 360 tcaggtggag gtggcagcgg aggaggtggg tccggcggtg gaggaagcca aattgttctc 420 acccagtctc cagcgctcat gtctgcttct ccaggggaga aggtcaccat gacctgcact 480 gccagctcaa gtgttagtta catgtactgg taccagcaga agccacgatc ctcccccaaa 540 ccctggattt ttctcacctc caacctggct tctggagtcc ctgctcgctt cagtggccgt 600 gggtctggga cctctttctc tctcacaatc agcagcatgg aggctgaaga tgctgccact 660 tattactgcc agcagtggag tggttaccca cccatcacat tcggctcggg gacaaagttg 720 gaaataaaa 729 <210> 15 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Linker <400> 15 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 16 <211> 2283 <212> DNA <213> Artificial sequence <220> <223> Full-length canine FAP <400> 16 atgaagacgt ggttaaaaat tgtatttgga gttgccacct ctgctgtgct tgctttattg 60 gtgatgtgca ttgtcttacg tccttcaaga gttcatgact ccgaaggagg tacaacaaga 120 gcactcacac tggaggatat tttaaatggg acatttacct ataaaacatt ttttccaaac 180 tggatttcag gaagaata tcttcatcag tctacagata atgatatagt atattacaat 240 attgaaacag gagaatcata taccattttg agtaatgcca ccatgaaaag tgtgaatgct 300 tcaaattatg gcttatcacc tgatcgtcaa tttgcatatc tagaaagtga ttattcaaag 360 ctttggagat actcttacac tgcaacatat cacatctata acctcaataa tggagagttt 420 atgagcttcc tcgtccaatt foottttat gctggtcgcc tgttgggagt 480 aaattagcat atgtctatca aaacaatatc tatttgaaac aaagaccaga agacccacct 540 tttcaataa catataatgg aagaaaat aaaatattca atggaatccc agactgggta 600 tatgaagagg aaatgcttgc tacaaaacat gctctctggt ggtctcctaa tggaaattt 660 ttggcatatg cagaatttaa tgatacagag atacagtta ttgcctattc ctattatggt 720 gatgaacaat atcctagaac aataatatt ccatacccaa aggctggagc taagaaccct 780 gttgttcgga tctttattat cgataccact tatcctcagc agacaggtcc cagagaagtg 840 ccagttccag caatgatagc atcaagtgat tattattca gttggctcac atgggttact 900 gatgaacgag tatgtttgca gtggctaaaa agaatccaga acgtttcagt tctgtccata 960 tgtgatttca gggaaggctg gcagacatgg gattgtccaa aggcccagga acatatagaa 1020 gaaagcagaa ctggatgggc tggtggattc tttgtttcaa caccagtttt cagctatgat 1080 gccatttcat actacaaaat atttagcgac aaggatggct acaaacatat tcactatatc 1140 aaagacactg tggaaaatgc tattcaaatt acaagtggca agtgggaggc cataaatata 1200 ttcagagtaa cacaggattc actgttttat tctagcaatg aatttgaaga ctacccagga 1260 agaagaaata tctatagaat tagcattgga agctctcctc caagcaaaaa gtgcattact 1320 tgccatctaa ggaaagaaag gtgccaatat tacacagcaa gtttcagtga ctacgccaag 1380 tactatgcac ttatctgcta tggcccaggc ctccccattt ccacccttca tgacggccac 1440 actgatcaag aaattaaaat cctggaagaa aacaaagaat tggaaaatgc tttgaaaaat 1500 atccagctgc ctaaagagga aattaagaaa cttgaagtgg atgatattac tttatggtac 1560 aagatgatgc ttcctccccg gtttgacaga tcaaagaagt atcccttgct aattcaagtg 1620. tatggtggtc cctgcagtca gagcgtaag tctgtattca gtattaattg gatttcttat cttgcaagta aggaaggat agtcattgcc ttggtggatg gccgaggaac agcttaccaa ggtgacaaac tcctgtatgc agtatatcga aagctgggtg tttatgaagt tgaggaccag atcacagccg tcagaaaatt catagaaatg ggtttcattg atgaaaaag aatagccata tggggctggt cctatggagg ctatgtttca tcactggccc ttgcttcagg aactggtctt ttcaaatgtg ggatagcagt ggctcctgtc tccagctggg aatattacgc atctatctac acagaacgat tcatgggcct cccaacaaag aacgataatc tcgagcacta caaaaattca actgtgatgg caagagcaga atatttcaga aatgtagact atcttctcat ccacggaaca gcagatgata atgtgcactt tcaaaactca gcacagattg ctaaagctct ggttaatgca caagtggatt tccaggcaat gtggtactct gaccagaacc atggcatacc cggcctgtcc tcgaagcact fathercccg catgacccac ttcctaaagc agtgtttttc tttgtccgac tga 2283 <210> 17 <211> 10 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR1 <400> 17 Gly Tyr Thr Ile Thr Ser Tyr Ser Leu His 1 5 10 <210> 18 <211> 20 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR2 <400> 18 Glu Ile Asn Pro Ala Asn Gly Asp His Asn Phe Ser Glu Lys Phe Glu 1 5 10 15 Ile Lys Ala Thr 20 <210> 19 <211> 14 <212> PRT <213> Artificial sequence <220> <223> 4G5 HCDR3 <400> 19 Thr Arg Leu Asp Asp Ser Arg Phe His Trp Tyr Phe Asp Val 1 5 10 <210> 20 <211> 7 <212> PRT <213> Artificial sequence <220> <223> 4G5 LCDR2 <400> 20 Leu Thr Ser Asn Leu Ala Ser 1 5 <210> twenty one <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <220> <221> repeat <222> (1)..(5) <223> Repeat n times, where n is an integer at least 1 <400> twenty one Gly Ser Gly Gly Ser 1 5 <210> twenty two <211> 4 <212> PRT <213> Artificial sequence <220> <223> Connector <220> <221> repeat <222> (1)..(4) <223> Repeat n times, where n is an integer at least 1 <400> twenty two Gly Gly Gly Ser 1 <210> twenty three <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <220> <221> repeat <222> (1)..(5) <223> Repeat n times, where n is an integer at least 1 <400> twenty three Gly Gly Gly Gly Ser 1 5 <210> twenty four <211> 4 <212> PRT <213> Artificial sequence <220> <223> Connector <400> twenty four Gly Gly Ser Gly 1 <210> 25 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 25 Gly Gly Ser Gly Gly 1 5 <210> 26 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 26 Gly Ser Gly Ser Gly 1 5 <210> 27 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 27 Gly Ser Gly Gly Gly 1 5 <210> 28 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 28 Gly Gly Gly Ser Gly 1 5 <210> 29 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 29 Gly Ser Ser Ser Gly 1 5 <210> 30 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 30 Gly Gly Gly Gly Ser 1 5 <210> 31 <211> 45 <212> PRT <213> Artificial sequence <220> <223> Connector <400> 31 Gly Gly Thr Gly Gly Cys Gly Gly Thr Gly Gly Cys Thr Cys Gly Gly 1 5 10 15 Gly Cys Gly Gly Thr Gly Gly Thr Gly Gly Gly Thr Cys Gly Gly Gly 20 25 30 Thr Gly Gly Cys Gly Gly Cys Gly Gly Ala Thr Cys Thr 35 40 45 <210> 32 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Furin cleavage site <220> <221> misc_feature <222> (2)..(2) <223> Xaa can be any naturally occurring amino acid <400> 32 Arg Xaa Lys Arg 1 <210> 33 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Furin cleavage site <220> <221> misc_feature <222> (2)..(2) <223> Xaa can be any naturally occurring amino acid <400> 33 Arg Xaa Arg Arg 1 <210> 34 <211> 5 <212> PRT <213> Artificial sequence <220> <223> Furin cleavage site <220> <221> misc_feature <222> (1)..(1) <223> Xaa can be any naturally occurring amino acid <220> <221> misc_feature <222> (3)..(4) <223> Xaa can be any naturally occurring amino acid <400> 34 Xaa Arg Xaa Xaa Arg 1 5 <210> 35 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Furin cleavage site <220> <221> misc_feature <222> (2)..(3) <223> Xaa can be any naturally occurring amino acid <400> 35 Arg Xaa Xaa Arg 1 <210> 36 <211> 4 <212> PRT <213> Artificial sequence <220> <223> Furin cleavage site <400> 36 Arg Gln Lys Arg 1 <210> 37 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 37 atgtagacgt ggttaaaaat tg 22 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 38 cgtcatcttc agtcggacaa 20

Claims

1. An antibody or antigen-binding fragment thereof comprising an antigen-binding domain that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), wherein the antigen-binding domain comprises: (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 consists of the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 consists of the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 consists of the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 consists of the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 consists of the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 consists of the amino acid sequence QQWSGYPPIT (SEQ ID NO:6).

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof: (a) comprises a heavy chain variable region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 7; or (b) comprises a light chain variable region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence shown in SEQ ID NO:

9.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein: (a) the antibody or antigen-binding fragment thereof is a Fab or a single-chain variable fragment (scFv); or (b) The antibody or antigen-binding fragment thereof is a full-length antibody.

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof is a Fab, a single-chain variable fragment (scFv), or a full-length antibody, and wherein the antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof.

5. An antibody or antigen-binding fragment thereof that specifically binds to an epitope of human and canine fibroblast activation protein (FAP) and comprises: (a) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7; and (b) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:

9.

6. A single-chain variable fragment (scFv) comprising an antigen binding domain that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), wherein the antigen binding domain comprises: (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 consists of the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 consists of the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 consists of the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 consists of the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 consists of the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 consists of the amino acid sequence QQWSGYPPIT (SEQ ID NO:6), wherein the heavy chain variable region and the light chain variable region are separated by a linker.

7. A single-chain variable fragment (scFv) that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), comprising: (a) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7; and (b) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 9, wherein the heavy chain variable region and the light chain variable region are separated by a linker, wherein the linker comprises the amino acid sequence shown in SEQ ID NO:

15.

8. Single-chain variable fragment (scFv) that specifically binds to epitopes of human and canine fibroblast activation protein (FAP): (a) comprising the amino acid sequence shown in SEQ ID NO: 11 or 13; or (b) consisting of the amino acid sequence shown in SEQ ID NO: 11 or 13.

9. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5 or the scFv according to any one of claims 6 to 8.

10. An isolated nucleic acid encoding an antibody or antigen-binding fragment thereof comprising an antigen-binding domain that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), wherein the antigen-binding domain comprises: (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 consists of the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 consists of the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 consists of the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 consists of the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 consists of the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 consists of the amino acid sequence QQWSGYPPIT (SEQ ID NO:6).

11. The nucleic acid according to claim 10, wherein The antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof.

12. The nucleic acid of claim 10, wherein the antibody is a full-length antibody.

13. The nucleic acid of claim 10, wherein the antibody or antigen-binding fragment thereof is a Fab or a single-chain variable fragment (scFv).

14. The nucleic acid according to claim 10, wherein: (a) the heavy chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 8; or (b) the light chain variable region is encoded by a nucleic acid comprising a polynucleotide sequence that is at least 95% identical to the amino acid sequence of the light chain variable region shown in SEQ ID NO:

10.

15. An isolated nucleic acid encoding an antibody or antigen-binding fragment thereof that specifically binds to an epitope of human and canine fibroblast activation protein (FAP) and comprising: (a) a heavy chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO: 8; and (b) a light chain variable region encoded by a nucleic acid sequence comprising the polynucleotide sequence shown in SEQ ID NO:

10.

16. Isolated nucleic acids: (a) encoding a single-chain variable fragment (scFv) that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), comprising: (i) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 consists of the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 consists of the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 consists of the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and (ii) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 consists of the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 consists of the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 consists of the amino acid sequence QQWSGYPPIT (SEQ ID NO:6); (b) encoding a single-chain variable fragment (scFv) that specifically binds to an epitope of human and canine fibroblast activation protein (FAP), comprising: (i) a heavy chain variable region comprising the nucleotide sequence shown in SEQ ID NO: 8; and (ii) a light chain variable region comprising the nucleotide sequence shown in SEQ ID NO: 10, wherein the heavy chain variable region and the light chain variable region are separated by a linker, wherein the linker comprises the amino acid sequence shown in SEQ ID NO: 15; (c) encoding a single-chain variable fragment (scFv) comprising the polynucleotide sequence shown in SEQ ID NO: 12 or 14, wherein the scFv specifically binds to an epitope of human and canine fibroblast activation protein (FAP); or (d) encodes a single-chain variable fragment (scFv) consisting of the polynucleotide sequence shown in SEQ ID NO: 12 or 14, wherein the scFv specifically binds to an epitope of human and canine fibroblast activation protein (FAP).

17. A vector comprising the isolated nucleic acid of any one of claims 10-16. The vector according to claim 17 , wherein the vector is an expression vector. The vector according to claim 17 , wherein the vector is a DNA vector or an RNA vector.

20. The vector according to claim 17, wherein the vector is a plasmid.

21. The vector of claim 17, wherein the vector is a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector.

22. The vector of claim 17, wherein the vector is a retroviral vector. 23.Host cells: (a) comprising the vector of claim 17; and (b) wherein the host cell is of eukaryotic or prokaryotic origin; (c) wherein the host cell is of mammalian origin; or (d) wherein the host cell is of bacterial origin.

24. A method of producing an antibody or antigen-binding fragment thereof or scFv that binds to FAP, the method comprising culturing the host cell of claim 23.

25. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5 or the scFv according to any one of claims 6 to 8.

26. Use of an antibody or antigen-binding fragment thereof that specifically binds to an epitope of human and canine fibroblast activation protein (FAP) in the manufacture of a kit or reagent for identifying subjects suitable for adoptive cell therapy for FAP, wherein the identification comprises: (a) isolating diseased tissue from the subject; (b) contacting the isolated tissue with the antibody or antigen-binding fragment thereof; and (c) detecting cells expressing FAP in the isolated tissue, thereby identifying suitable subjects for the adoptive cell therapy, and wherein the antibody or antigen-binding fragment thereof comprises: (i) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 consists of the amino acid sequence YTITSYSLH (SEQ ID NO: 1), HCDR2 consists of the amino acid sequence EINPANGDHNFSEKFEIK (SEQ ID NO: 2), and HCDR3 consists of the amino acid sequence LDDSRFHWYFDV (SEQ ID NO: 3); and (ii) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 consists of the amino acid sequence TASSSVSYMY (SEQ ID NO:4), LCDR2 consists of the amino acid sequence LTSNLA (SEQ ID NO:5), and LCDR3 consists of the amino acid sequence QQWSGYPPIT (SEQ ID NO:6).

27. The use according to claim 26, wherein: The antibody or antigen-binding fragment thereof is selected from the group consisting of Fab, single-chain variable fragment (scFv) and full-length antibody.

28. The use according to claim 26, wherein the adoptive cell therapy is administered to the subject after the subject is identified as a suitable subject.

29. The use according to claim 28, wherein: The adoptive cell therapy comprises modified immune cells comprising a chimeric antigen receptor (CAR).

30. The use according to any one of claims 26 to 29, wherein the antibody or antigen-binding fragment thereof: (a) comprises a heavy chain variable region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 7; or (b) comprises a light chain variable region comprising an amino acid sequence that is at least 95% identical to the amino acid sequence shown in SEQ ID NO:

9.

31. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:

7.

32. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO:

7.

33. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:

9.

34. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO:

9.

35. The nucleic acid of claim 10, wherein the heavy chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO:

8.

36. The nucleic acid of claim 10, wherein the heavy chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence shown in SEQ ID NO:

8.

37. The nucleic acid of claim 10, wherein the light chain variable region is encoded by a nucleic acid comprising the polynucleotide sequence shown in SEQ ID NO:

10.

38. The nucleic acid of claim 10, wherein the light chain variable region is encoded by a nucleic acid consisting of the polynucleotide sequence shown in SEQ ID NO:

10.

39. The use of claim 28, wherein the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR) and wherein the immune cell is a T lymphocyte.

40. The use of claim 28, wherein the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR) and wherein the immune cell is a NK cell.

41. The use of claim 28, wherein the adoptive cell therapy comprises a modified immune cell comprising a chimeric antigen receptor (CAR), wherein the CAR specifically binds to FAP.