Novel cell phenotype screening method

By preparing cells labeled with the first barcode nucleic acid and sorting them using an imaging cell sorter, combined with hybridization of the second barcode nucleic acid, the problems of slow speed and high cost in the existing technology are solved, realizing rapid detection of cell image response and gene expression response, and identifying test targets that cause desired phenotypic changes in cells.

CN114761577BActive Publication Date: 2025-10-24HIKAKE SHO CO LTD +2
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202180006906.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-01-10
Filing Date
2021-01-12
Publication Date
2025-10-24
Estimated Expiration
2041-01-12

AI Technical Summary

Technical Problem

The existing universal large-scale phenotypic screening assay system for wells is slow and costly, making it difficult to quickly conduct multifaceted analyses of gene expression responses and mechanisms of action of individual cells.

Method used

Cells labeled with a first barcode nucleic acid are prepared, and an imaging cell sorter is used to sort the cells based on cell phenotype. The first barcode nucleic acid is used as an indicator to identify the test target, and the second barcode nucleic acid is combined with hybridization with nucleic acids related to the cell genome to perform rapid detection of image reactions and gene expression reactions.

Benefits of technology

It realizes the rapid detection of cell image response and gene expression response, and can associate each input information with image response and gene expression response during high-speed phenotypic screening, and select or find test targets that cause desired phenotypic changes in cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114761577B_ABST
    Figure CN114761577B_ABST
Patent Text Reader

Abstract

The present application provides a method for screening cells, the method comprising: a step of preparing a plurality of cells, the plurality of cells labeled with a first barcode nucleic acid and treated with a test target, the first barcode nucleic acid associated with the test target; a step of selecting the plurality of cells based on a cell phenotype using an imaging cytometer; and, a step of identifying the test target used to treat each cell using the first barcode nucleic acid as an indicator.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This patent application claims priority based on U.S. patent application publication No. 62 / 959,420 filed on January 10, 2020, and the entire disclosure of that prior patent application is incorporated by reference as a part of the disclosure of this specification. Technical Field

[0003] This application relates to novel cell phenotypic screening. Background Art

[0004] Cell phenotype (phenotypic screening) is widely known as a screening method for screening various drugs using cells. Phenotypic screening is a method that uses the phenotype of cells and organs, such as cell proliferation rate, cell death, and cell image information represented by the localization of specific proteins or cell structures, as indicators to find drugs (e.g., low molecular weight compounds, peptides, etc.) that change the phenotype of cells and organs. One of the important goals of cell phenotypic screening is to examine the following information related to the input (test substance, drug stimulation, etc.): (i) what kind of cell phenotypic changes (image response) are exhibited, (ii) the gene expression response exhibited, and (iii) the mechanism of action that underlies them.

[0005] However, in a general-purpose large-scale phenotypic screening assay system utilizing wells in related art, it is necessary to administer each drug to cells cultured in each well, examine the image response, remove subjects in which a response believed to represent the target phenotype is produced, and perform genetic analysis on individual subjects to identify gene expression responses and mechanisms of action (e.g., Non-Patent Document 1). Therefore, in addition to being slow and costly, it is difficult to rapidly perform comprehensive analyses of gene expression responses, mechanisms of action, and the like in individual cells.

[0006] [Citation List]

[0007] [Non-patent literature]

[0008] [Non-Patent Document 1]

[0009] Nature Methods, Vol. 16, pp. 619-626 (2019) Summary of the Invention

[0010] The present application provides a method for rapidly detecting the image response and gene expression response of cells coexisting with a test target (such as a drug).

[0011] According to the embodiment of the present application, there is provided a method for screening a test target, the method including: a step of preparing a plurality of cells labeled with a first barcode nucleic acid associated with the test target and treated with the test target; a step of sorting the plurality of cells based on a cell phenotype using an imaging cell sorter; and a step of identifying the test target used for treating each cell using the first barcode nucleic acid as an index.

[0012] According to the present application, it is possible to quickly detect an image response and a gene expression response of a cell coexisting with a test target. According to the present application, each input information (e.g., a treatment of a cell by a test object) is associated with an image response and a gene expression response in a pooled state, and can be advantageously used when performing high-speed phenotype screening. Advantageously, it is possible to select or search for a test target that causes a desired phenotypic change in a cell using the present application. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 is a schematic diagram of an embodiment of the screening method of the present application.

[0014] Figure 2 is a conceptual diagram showing a step of reading nucleic acid information of each cell in the screening method of the present application. (1) shows hybridization of a second barcode nucleic acid to a first barcode nucleic acid, and (2) shows hybridization of the second barcode nucleic acid to a cell genome or a genome-related nucleic acid corresponding to a derivative thereof.

[0015] Figure 3 is a schematic diagram of an embodiment of the imaging cell sorter in the first embodiment of the present application.

[0016] Figure 4 is a fluorescence micrograph of cells after adding an oligonucleotide conjugated with a red fluorescent dye Cy5 having a sequence corresponding to a partial sequence of the first barcode nucleic acid and incubating for 30 minutes in each solution.

[0017] Figure 5 is a fluorescence micrograph of a cell sample. Cells labeled with an oligonucleotide conjugated with a green fluorescent dye FAM having a sequence corresponding to a partial sequence of the first barcode nucleic acid and cells labeled with an oligonucleotide conjugated with a red fluorescent dye Cy5 having a sequence corresponding to a partial sequence of the first barcode nucleic acid are prepared and mixed with each other. The photograph is taken after incubation for 1 hour.

[0018] Figure 6 is a photograph showing observation of attachment of an oligonucleotide to a cell over time in a cell to which an oligonucleotide conjugated with a red fluorescent dye Cy5 having a sequence corresponding to a partial sequence of the first barcode nucleic acid is attached.

[0019] Figure 7 Photos showing the degree of staining and changes in distribution of the NFkB protein in cells immunostained with primary antibodies against the NFkB protein and secondary antibodies conjugated to a fluorescent dye (Alexa Fluor 488) after fixation with formalin or DTSSP.

[0020] Figure 8 Graphs showing the purity of each cell group measured and quantified by flow cytometry based on the ground truth label signal derived from the Fixable Far Red label, under the condition of fixation with 1 mg or 10 mg of DTSSP. The horizontal axis is the fluorescence intensity derived from immunostaining of the NFkB protein, and the vertical axis is the fluorescence intensity derived from the Fixable Far Red label, which is used to indicate the correct response.

[0021] Figure 9 SVM (Support Vector Machine) scores (histograms) and matrices and tables of results comparing the predicted results of each cell group labeled with the Fixable Far Red label with the true data under the condition of fixation with 1 mg or 10 mg of DTSSP. SVM is a machine learning model. The machine learning is performed by the presence or absence of nuclear localization of the NFkB protein obtained from the image signal data (nuclear localization is positive, and no nuclear localization is negative).

[0022] Figure 10 Schematic diagram of part of the reagents used in the genetic analysis techniques in Examples 5 and 6. In the diagram, Multi-seq barcode, 10x barcode, and UMI correspond to the first barcode sequence, the second universal barcode region, and the second unique barcode region sequence, respectively. The second barcode nucleic acid hybridizes with the first barcode nucleic acid, or the second barcode nucleic acid hybridizes with the cell genome or the genome-related nucleic acid corresponding to the derivative thereof.

[0023] Figure 11 Schematic diagram of the sequence library used after the PCR reaction in Examples 5 and 6.

[0024] Figure 12A Table showing the second universal barcode region sequence of each cell in the mixed sample in which the ratio of cells in which the LPS drug is present to cells in which the drug is not present is 9:1, and the number of reads of each first barcode sequence detected from the unique read having the above sequence (Table 1-1).

[0025] Figure 12BTable 1-2: Another table showing the second universal barcode region sequence for each cell in the mixed sample (in which the ratio of cells in which the LPS drug was present to cells in which the drug was not present was 9: 1), and the number of reads of each first barcode sequence detected from unique reads having the above sequence.

[0026] Figure 13 Table 1-2: Another table showing the second universal barcode region sequence for each cell in the mixed sample (in which the ratio of cells in which the LPS drug was present to cells in which the drug was not present was 9: 1), and the number of reads of each first barcode sequence detected from unique reads having the above sequence.

[0027] Figure 14A Table 2-1: A table showing the second universal barcode region sequence for each negative control cell in which the LPS drug was not present, and the number of reads of each first barcode region sequence detected from unique reads having the above.

[0028] Figure 14B Table 2-2: A table showing the second universal barcode region sequence for each negative control cell in which the LPS drug was not present, and the number of reads of each first barcode region sequence detected from unique reads having the above.

[0029] Figure 15 Table 2-2: A table showing the second universal barcode region sequence for each negative control cell in which the LPS drug was not present, and the number of reads of each first barcode region sequence detected from unique reads having the above.

[0030] Figure 16 Figure 2: A graph showing the distribution of counts of the first barcode nucleic acid sequence (both types) detected from unique reads having the above characteristics (negative control cells in which the drug was not present) (first barcode nucleic acid sequence A: LPS drug not present, first barcode nucleic acid sequence B: LPS drug present) for each second unique barcode region sequence of the first barcode sequence side data matched with the complementary strand DNA side data.

[0031] Figure 17 Figure 2: A graph showing the distribution of counts of the first barcode nucleic acid sequence (both types) detected from unique reads having the above characteristics (negative control cells in which the drug was not present) (first barcode nucleic acid sequence A: LPS drug not present, first barcode nucleic acid sequence B: LPS drug present) for each second unique barcode region sequence of the first barcode sequence side data matched with the complementary strand DNA side data.

[0032] Figure 18A schematic diagram of the cell phenotyping method of Example 8, in which a 96-well microplate format is used to find test targets that cause the desired phenotypic change.

[0033] Figure 19 A table showing the 96 test targets (24 test substances x 4 concentrations) used in Example 8 and the function of the test substances (known mechanism of action).

[0034] Figure 20A A table showing the sequences of the first barcode nucleic acids used in Example 8 (barcode#: Ind_8bp_0015-Ind_8bp_036).

[0035] Figure 20B A table showing the sequences of the first barcode nucleic acids used in Example 8 (barcode#: Ind_8bp_037-Ind_8bp_074).

[0036] Figure 20C A table showing the sequences of the first barcode nucleic acids used in Example 8 (barcode#: Ind_8bp_075-Ind_8bp_262).

[0037] Figure 21 A graph showing the enrichment levels of the first barcode nucleic acid sequences of the cells sorted in Example 8.

[0038] Figure 22 A photograph showing the cells sorted and recovered by the imaging cell sorter in Example 8 to confirm whether the cells actually exhibit the phenotype by taking a photographic image of the cells using an existing image flow cytometer and calculating the nuclear localization score. DETAILED DESCRIPTION

[0039] According to the embodiment of the present application, the method of screening cells includes the steps of preparing a plurality of cells labeled with a first barcode nucleic acid associated with a test target and treated with the test target, sorting the plurality of cells based on a cell phenotype using an imaging cell sorter, and identifying the test target used to treat each cell using the first barcode nucleic acid as an index.

[0040] Definitions

[0041] In the present specification, "genome-related information" means information related to the genome of a cell or a derivative thereof, and refers to information related to changes in nucleic acids and proteins accompanying changes in gene expression. In addition, in the present specification, "genome-related nucleic acid" is a nucleic acid related to genome-related information, and suitable examples thereof are genomic DNA of a cell, RNA (such as mRNA) derived from the genome of a cell, or cDNA thereof. In addition, other examples of "genome-related nucleic acid" include a nucleic acid probe that specifically interacts (e.g., binds) with a molecule such as a protein expressed in a cell. In addition, in the case where the nucleic acid is genomic DNA, the DNA can be a fragment cleaved with a restriction enzyme or the like, or a DNA tag can be introduced into the DNA fragment.

[0042] In the present specification, "barcode region" is a region of a base sequence including T (thymine) or U (uracil), A (adenine), G (guanine), and C (cytosine), and is not limited to the sequence of the universal barcode region or the unique barcode region described below. Furthermore, barcode nucleic acid is a nucleic acid including a barcode region, which is capable of identifying genome-related information of a cell and imaging information derived from a test target or a bead coexisting with the cell.

[0043] The barcode region includes both a universal barcode region and a unique barcode region.

[0044] The length of the barcode region is not limited; however, the sequence is preferably 8 to 40 bases long. For example, in the case where the barcode region is 12 bases long, 4 12 different barcode sequences can be subjected to nucleic acid amplification at one time.

[0045] The "universal barcode region" is a common barcode region for identifying the same object. In the case where the object to be identified is a test target, examples thereof include a barcode region different for each test object, i.e., a barcode region common for one test target. Labeling with the universal barcode region enables identification of each test target. Furthermore, in the case where the object to be identified is a combination of test targets, such as a combination of test targets included in one compartment, labeling with a barcode nucleic acid having a barcode region different for each combination, i.e., a barcode region common for a specific combination of test targets. Labeling with such a universal barcode region enables identification of the combination of test targets. In the case where the object to be identified is genome-related information of a single cell, examples thereof include a barcode region different for each cell, i.e., a barcode region common for a single cell. Labeling with the universal barcode region enables identification of genome-related information derived from the same cell.

[0046] The "unique barcode region" is a barcode region that individually distinguishes each of the barcode nucleic acids by labeling each of the barcode nucleic acids with a different barcode region. For example, the label in the unique barcode region is able to identify the bead to which each of the barcode nucleic acids is attached, the organism that includes each of the barcode nucleic acids, and the genome-related nucleic acid that hybridizes to each of the barcode nucleic acids.

[0047] In the present specification, "hybridization" means that the hybridization region of the barcode nucleic acid forms a double-stranded complex with the cell genome or its derivative or other barcode nucleic acid. In the present context, examples of exemplary conditions for forming such a double-stranded complex include hybridization at 37°C, 40% to 45% formamide, 1.0 M NaCl, 0.1% SDS and washing in 0.5X-1X SSC at 55°C to 60°C. Examples of other aspects when forming the double-stranded complex described above include performing the formation of the complex under stringent conditions. In the present context, stringent conditions refer to conditions that form a so-called specific complex rather than a non-specific complex, including the above-described exemplary conditions. Such stringent conditions are known to those skilled in the art and can be set with reference to, for example, Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York) and Current Protocols in Molecular Biology (Frederick M. Ausubel et al., Eds., 1987). Examples of sequences having a sequence that hybridizes to the hybridization region of the barcode nucleic acid include a complementary sequence of the hybridization region.

[0048] Accordingly, the "hybridization region" is preferably a region that binds (hybridizes) to a genome-related nucleic acid corresponding to the cell genome or its derivative or another barcode nucleic acid. The hybridization region is preferably present in the barcode nucleic acid together with the barcode region.

[0049] Hereinafter, the present application will be described according to Figure 1 An embodiment of the screening method of the present application will be described.

[0050] In the method of the present application, a cell treated with a test target and labeled with a first barcode nucleic acid is prepared. The preparation step can include, for example, the following steps Figure 1 Steps 1-1 to 1-3 in the above-described embodiment.

[0051] Step 1: A step of preparing a plurality of cells labeled with a first barcode nucleic acid associated with a test target and treated with the test target. Step 1-1: A step of generating sub-compartments (droplets) (a step of forming droplets including a test target and a first barcode nucleic acid corresponding to the test target.

[0052] Figure 1 Step 1-2: A step of generating a compartment by fusing sub-compartments (a step of fusing sub-compartments (droplets) including a test target and a first barcode nucleic acid corresponding to the test target and sub-compartments (droplets) including cells)

[0053] According to the embodiment of the present application, as Step 1-3: A step of destroying the compartmentAs shown in the upper part of Step 1-1, a liquid medium including a test target and a first barcode nucleic acid is mixed with an organic solvent to form a sub-compartment (droplet) including a test target and a first barcode nucleic acid corresponding to the test target. Specifically, for example, a hydrogel bead can be added to a liquid medium including a test target and a first barcode nucleic acid to produce a first sub-compartment including a test target and a first barcode nucleic acid. In a more specific method, by mixing a pre-prepared hydrogel particle with a test target and a first barcode nucleic acid corresponding to the test target, and adding an organic solvent and a surfactant thereto, and vortexing in each container (e.g., each well), a large number of uniform droplets including a test target and a first barcode nucleic acid corresponding to the test target can be produced. In addition, by a similar method, the above-described step can also be performed according to the method described in Anal. Chem., 2018, 90, 16, 9813-9820. For example, beads made of a material such as acrylamide, agarose, collagen, alginate, or polyethylene glycol, etc. can be used as hydrogel particles as a template for this step.

[0054] The test target of the present application is not particularly limited as long as it is a test target of a desired reaction in a cell to be studied, and examples thereof include test substances such as low-molecular-weight organic compounds, peptide compounds, nucleic acid compounds having a nucleic acid or a derivative thereof as a basic framework, polypeptides or proteins (such as enzymes), antibodies and antibody fragments, cells, viruses, and drugs.

[0055] The type of the cell to be studied is not particularly limited as long as it does not hinder the effects of the present application, and the cell can be selected according to the purpose, for example, a human-derived cell such as a cell derived from a patient's blood cell, or a cell differentiated from a stem cell into a target cell such as an iPS cell (induced pluripotent stem cell); and a cell derived from a mammal such as a CHO (Chinese hamster ovary) cell can be used.

[0056] (a step of recovering cells labeled with a first barcode nucleic acid) Figure 1

[0057] Further, according to the embodiment of the present application, as shown in Step 1-2, the step is performed as follows: the droplet including the test target and the first barcode nucleic acid is mixed with the droplet including the cell to associate the test target, the first barcode nucleic acid, and the cell. Specifically, the association of the test target, the first barcode nucleic acid, and the cell can be performed by fusing the first sub-compartment including the test target and the first barcode nucleic acid with the second sub-compartment including the cell and generating a compartment including the test target, the first barcode nucleic acid, and the cell. In a more specific method, in the microfluidic device, by pouring a set of droplets including the test target and the first barcode nucleic acid corresponding to the test target from one channel and a set of droplets including the cell from another channel, and performing continuous droplet-droplet fusion in the microfluidic device, it is possible to generate a large number of droplets including the cell, the test target, and the first barcode nucleic acid corresponding to the test target in the organic solvent phase. At this time, as in the example described below, by forming a droplet including the cell in the microfluidic device, and fusing the droplet with a droplet including the test target and the first barcode nucleic acid corresponding to the test target, it is also possible to generate a droplet including the cell, the test target, and the first barcode nucleic acid corresponding to the test target. In the droplet in the organic solvent phase described above, by attaching the barcode nucleic acid corresponding to the test target to the cell surface while the cell is affected by the test target, it is possible to label the cell with the first barcode nucleic acid. The above step can be performed according to the method described in Anal. Chem. 2018, 90, 2, 1273-1279.

[0058] The compartment or sub-compartment is a compartment unit that enables each combination of components in the compartment or sub-compartment to be distinguished from other compartments.

[0059] The kind and number of test objects included in the compartment of the present application are not particularly limited as long as they do not hinder the effects of the present application, but from the viewpoint of simplifying or clarifying the cell reaction, one type per compartment is preferable. However, for example, in the case where a plurality of test targets are combined to examine the reaction of the cell to the test target, the number of test target types per compartment can be a plurality. In addition, the concentration of the test target can also be set to different concentrations, respectively, so that the cell reaction under different concentrations of the test target can be evaluated. These aspects are also encompassed in the present application.

[0060] The compartment of the present application is not particularly limited as long as it can maintain the compartment distinguishable from other compartments, and examples thereof include an aqueous droplet (e.g., an aqueous droplet in oil) produced by the above-described steps. Further examples thereof include a gel particle of a hydrogel, a water / oil structure (such as an emulsion) having a plurality of overlapping unmixing interfaces, a vesicle (such as a micelle or a liposome) having a single layer or a double layer, and the like. At this time, for the aqueous phase included in the droplet, for example, an aqueous solution such as a cell culture medium, physiological saline, or a buffer can be used. In addition, for the organic solvent phase, for example, an oil such as a droplet generator oil of EvaGreen (manufactured by Bio-Rad Laboratories, Inc.) can be used.

[0061] From the viewpoint of distinguishing from other compartments, the compartment of the present application preferably has a physical barrier function at its periphery. Examples of a suitable method for producing a compartment having such a barrier function include a phase separation method and the like. In the phase separation method, for example, the compartment can be produced by mixing cells and beads with an aqueous medium to obtain an aqueous droplet, and then suspending the aqueous droplet in a hydrophobic solvent. In addition, the compartment can also be produced by mixing droplets together at a branch portion or a merging portion in a microfluidic device.

[0062] In addition, the compartment of the present application can also be formed by housing the compartment in a container such as a microwell, a well, or a tube. In this case, the association (i.e., contact) of the test target and the first barcode corresponding to the test target with the cell occurs by coexistence in the well or the like.

[0063] In addition, according to an embodiment of the present application, the cell can be labeled with the first barcode nucleic acid in the compartment including the test target, the first barcode nucleic acid, and the cell. Desirably, the first barcode nucleic acid has a configuration including an anchor (e.g., a known anchor provided with an oligonucleotide region) capable of attaching the first barcode nucleic acid to the surface of the cell and a lipid region (cholesterol, chitosan-diol-lipid, or the like). Specifically, preferred examples thereof include an anchor DNA and the like, which are used in the examples described below. In addition, the first barcode nucleic acid can also be used in the form of being enclosed in a particle or being bound to a particle, or the like. In this case, the first barcode nucleic acid is designed to be appropriately released from the enclosing particle or the like.

[0064] Hereinafter, the configuration of the first barcode nucleic acid will be described in detail.

[0065] In addition, according to an embodiment of the present application, the cell can be treated with the test target in the compartment.

[0066] According to necessity, incubation can be performed in the compartment while the cell and the test target coexist. Examples of such incubation include: leaving the compartment at a desired incubation temperature for a desired incubation time. While leaving the compartment, the compartment can be moved and left in a reservoir capable of holding a plurality of compartments. The above steps can be performed using known methods. For example, the above steps can be performed according to the methods described in J. J. Agresti et al., Proc Natl Acad Sci U S A., 107(9), 4004-9 (2010), A. Abbaspourrad et al., Sci Rep., 5, 12756 (2015), B. L. Wang et al., Nat Biotechnol. 32(5), 473-8 (2014).

[0067] Here, as the incubation time and the incubation temperature, the incubation time and the incubation temperature can be set to a level at which the reaction of the cell to the test target can be evaluated. Examples of the incubation time include 0 hours or more and 14 days or less, and preferably 2 hours or more and 5 days or less. Examples of the incubation temperature include a temperature of 4°C or more and 40°C or less, and preferably about 37°C.

[0068] In addition to searching for a test target that causes a phenotypic change in a cell as described above, one embodiment of the present application that searches for a test target includes searching for a target site in which a desired phenotypic change occurs in a cell. The search for a target site includes, for example, searching for a target position (target) on a gene in which a desired phenotypic change occurs. By labeling the cell with the first barcode nucleic acid in which the information is determined, in which the information determines the process to be applied to the cell in advance (for example, information that determines the position of gene editing to occur, information on the nucleic acid sequence of the guide RNA, or for gene editing, etc.), it is possible to add information that determines the treatment of the cell to the cell sorted and acquired by the imaging cell sorter, and thus it is possible to efficiently search for the target position (target) on the gene in which the desired phenotypic change occurs using the imaging cell sorter.

[0069] Step 2: Cell sorting

[0070] (image-based cell sorting)

[0071] One embodiment of the present application includes a step of recovering the cell from the compartment described above, as shown in steps 1-3 of Figure 1 As a specific method, it is possible to recover the cell labeled with the first barcode nucleic acid (including the cell affected by the test target and labeled with the first barcode nucleic acid) from the droplet in the organic solvent phase. In the above recovery step, phase separation can be induced by, for example, adding an organic solvent to the organic solvent phase, or by applying an electric field to the organic solvent phase.

[0072] Since the recovered cells are labeled with the first barcode nucleic acid associated with the test target, even if a plurality of cells treated with different test targets are mixed together, information related to the test target can be identified by the step of reading nucleic acid information described below. Therefore, by mixing a plurality of cells labeled with the first barcode nucleic acid recovered by this step, and further separating cells that produce a predetermined phenotype by image-based cell sorting described below, for cells in which a desired change in cell phenotype occurs, it is possible to simultaneously obtain genomic-related information in that specific cell and information of the processed test target.

[0073] Step 3: Identifying a test target that causes a desired cell change

[0074] (nucleic acid information reading)

[0075] According to the embodiments of the present application, the step of sorting a plurality of cells based on the cell phenotype is performed using an imaging cell sorter, as shown in Step 2 of Figure 1 According to the preferred embodiments of the present application, it is possible to sort cells that have a predetermined response due to the test target based on the cell phenotype. More specific aspects of the imaging cell sorter will be described below, and examples of the imaging cell sorter include the devices described in WO2017 / 073737 and WO2018 / 181458. In the imaging cell sorter described in the above documents, it is possible to quickly and accurately perform sorting by analyzing based on signals (such as light and electromagnetic waves) from cells as observation objects without obtaining photographic images, the light source system or the detection system is optimized by machine learning, and the method of analyzing and classifying observation objects is also optimized by machine learning.

[0076] Figure 2

[0077] Figure 2

[0078] According to the embodiments of the present application, as shown in Step 3 of First barcode nucleic acid The step of identifying the test target used to treat each cell with the first barcode nucleic acid as an index is performed in this step. In this step, it is possible to read the nucleic acid information of the first barcode nucleic acid and associate the change in cell phenotype with the test target, and thus it is possible to identify the test target that causes the desired change in cell phenotype.

[0079] Furthermore, in the present application, preferably, genomic related information of each cell sorted by phenotype using an imaging cell sorter is analyzed. By analyzing the genomic related information of each cell, it is possible to correlate the cell phenotype change, the genomic related information of the cell, and the relationship between the test target. Therefore, it is possible to obtain additional information about the phenomenon occurring in the cell in which the desired phenotype change due to the test target occurs at the genetic level, which means that more detailed information about the phenomenon is made available.

[0080] As an example, the step of analyzing the nucleic acid information of the present application will be described below. Here, the nucleic acid information includes information of the first barcode nucleic acid associated with the test target and nucleic acid information of the genomic related nucleic acid corresponding to the genome derived from the cell or its derivative.

[0081] According to the embodiment of the present application, the above-mentioned step of analyzing the nucleic acid information includes:

[0082] The step of preparing a plurality of compartments including a cell exhibiting a desired phenotype change sorted using an imaging cell sorter, a first barcode nucleic acid, and a second barcode nucleic acid connection bead, wherein the second barcode nucleic acid connection bead includes a plurality of second barcode nucleic acids capable of hybridizing to the genomic related nucleic acid corresponding to the genome of the cell or its derivative or to the first barcode nucleic acid;

[0083] The step of obtaining a hybridized complex by hybridizing each of the genomic related nucleic acid and the first barcode nucleic acid to the second barcode nucleic acid;

[0084] The step of generating an amplification product derived from the above-mentioned hybridized complex; and

[0085] The step of detecting the genomic related information using the expression pattern of the above-mentioned amplification product as an index after the first barcode nucleic acid and the test target coexist with the cell.

[0086] The step of analyzing the nucleic acid information will be described below based on Figure 2 An embodiment of the step of analyzing the nucleic acid information.

[0087] A large number of droplets (compartments) are generated in a microfluidic path, and preferably, they are mixed so that each droplet probabilistically includes a ratio of 1:1 of a second barcode nucleic acid connection bead different for each droplet and a cell exhibiting a desired phenotype change. Then, the cell is lysed in the above-mentioned compartment, and the genomic related nucleic acid corresponding to the genome of the cell or its derivative and the first barcode nucleic acid serving as a marker of the test target are included in the compartment in a state of hybridizing with the second barcode nucleic acid connection bead, as shown in the upper left part. Second barcode nucleic acid-linked bead The upper left part.

[0088] Figure 2

[0089] The first barcode nucleic acid of the present application is not limited as long as it includes a barcode region corresponding to each test target, and for example, the nucleic acid is RNA, DNA, or a combination thereof.

[0090] As shown in (1) of FIG. 1, according to the embodiment of the present application, the first barcode nucleic acid preferably includes a first universal barcode region corresponding to each test target and a first hybridization region capable of hybridizing with the second barcode nucleic acid. For example, the first hybridization region is a sequence formed of polyadenine and the portion is capable of hybridizing with a second hybridization region (for example, a sequence formed of polythiophene) of the second barcode nucleic acid connecting the bead. Here, the sequence information of the first universal barcode region enables one-to-one identification of the same test target. Therefore, the sequence information of the first universal barcode region enables identification of the test target present in the compartment. Second barcode nucleic acid

[0091] For the first barcode nucleic acid, a specific nucleic acid sequence is produced by a solid-phase synthesis method or an enzymatic synthesis method. In the case of the barcode nucleic acid being RNA, after synthesizing a DNA template serving as a complementary strand of the single-stranded barcode nucleic acid, RNA can be synthesized by an RNA polymerase, such as T7, which binds to a promoter sequence on the DNA template and synthesizes RNA including the single-stranded barcode region through a linear amplification reaction. In the case of the barcode nucleic acid being DNA, the barcode nucleic acid is not particularly limited as long as it does not hinder the effects of the present application and can be synthesized and / or designed using known sequences, for example.

[0092] Figure 2

[0093] As shown in (1) and (2) of FIG. 1, the second barcode nucleic acid connecting bead is connected to the second barcode nucleic acid, in which the second barcode nucleic acid includes a sequence capable of hybridizing with a genome-related nucleic acid corresponding to the cell genome or a derivative thereof or with the first barcode nucleic acid. Figure 2 The number of the above-described second barcode nucleic acid connecting bead in each compartment is not particularly limited, but preferably one second barcode nucleic acid connecting bead per compartment.

[0094]

[0095] Figure 2 In addition,

[0096] The lower part of (1) and (2) of FIG. 1 is an enlarged view of the surface of the second barcode nucleic acid connecting bead, and shows an example of the structure of the second barcode nucleic acid connected to the bead. Figure 2

[0097] ​​The second barcode nucleic acid can be directly or indirectly linked to the second bead. According to an embodiment of the present application, the second barcode nucleic acid is RNA, DNA, or a combination thereof.

[0098] According to an embodiment of the present application, as shown in the lower part of (1) and (2) in Figure 2 According to an embodiment of the present application, as shown in the lower part of (1) and (2) in Bead In one example of the lower part of (1) and (2) in

[0099] According to an embodiment of the present application, as shown in the lower part of (1) and (2) in Method of generating second barcode nucleic acid-linked beads According to an embodiment of the present application, as shown in the lower part of (1) and (2) in

[0100] According to an embodiment of the present application, as shown in the lower part of (1) and (2) in

[0101] According to an embodiment of the present application, as shown in the lower part of (1) and (2) in Cells or derivatives thereof According to an embodiment of the present application, as shown in the lower part of (1) and (2) in

[0102] According to an embodiment of the present application, as shown in the lower part of (1) and (2) in

[0103] In the case where the genome-associated nucleic acid is DNA, such as genomic DNA, the second hybridization region in the second barcode nucleic acid preferably includes a sequence complementary to a specific sequence of the DNA or a sequence included in a DNA tag introduced to the DNA.

[0104] As the complete second barcode nucleic acid, each second barcode nucleic acid can have a sequence different from each other. The plurality of second barcode nucleic acids attached to the beads are preferably second barcode nucleic acids of a plurality of types.

[0105] Step of acquiring hybridized complex

[0106] From the viewpoint of being able to hybridize with a large amount of genome-associated nucleic acids, it is preferable that 1000 to 100000 second barcode nucleic acids are attached to the beads.

[0107] In the case where the beads are particles, the material thereof is not particularly limited, and examples thereof include: semiconductors such as quantum dots (semiconductor nanoparticles) composed of a semiconductor material such as cadmium selenide (CdSe), zinc sulfide (ZnS), cadmium sulfide (CdS), zinc selenide (ZnSe), zinc oxide (ZnO), and silicon dioxide (SiO2); inorganic materials such as heavy metals such as gold; hydrogels such as acrylamide, agarose, collagen, alginate, cellulose, chitosan, hyaluronic acid, silicone hydrogel, PEG-based hydrogel, and the like; resins such as polystyrene, polypropylene, hydrophilic vinyl polymers such as Toyopearl HW-65S (Tosoh Corporation), or these hydrogel materials chemically crosslinked, or hydrophilic vinyl polymers combined with PEG or a derivative thereof, and the like; and preferred examples include hydrogels, and more preferred examples include acrylamide and alginate.

[0108] Step of preparing amplification products derived from hybridized complex

[0109] Various types of second barcode nucleic acid-linked beads can be produced by known methods. For example, the second barcode nucleic acid-linked beads can be produced according to the methods described in E.Z. Macosko et al, Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, 1202-1214 (2015), or Gierahn, T.M et al., Seq-Well: A Portable, Low-Cost Platform for High Throughput Single-Cell RNA-Seq of Low-Input Samples; Nat Methods. 14, 395-398 (2017).

[0110] Step of reading nucleic acid information after test target coexistence with cells

[0111] The genome-related nucleic acids corresponding to the cell genome or its derivatives enclosed in the above compartment include nucleic acids obtained from cell breakage debris, cell contents, cell lysates, and the like. The cell derivatives (e.g., cell breakage debris, contents, lysates, etc.) can be obtained using known techniques, such as placing the cell with a cell lysis buffer or the like.

[0112] The step of obtaining the genome-related nucleic acids corresponding to the cell genome or its derivatives can be performed by enclosing the cell labeled with the first barcode nucleic acid with the cell lysis buffer in the compartment when the compartment is produced, or by enclosing the cell lysis buffer with the cell labeled with the first barcode nucleic acid and the second barcode nucleic acid-linked beads in the compartment. At this time, the number of cells enclosed in the compartment is not limited as long as it does not affect the effects of the present application, but from the viewpoint of single cell analysis, one cell per compartment is preferred.

[0113] Imaging cell sorter

[0114] Further, according to the embodiment of the present application, in the above step of analyzing the genome-related information, a step of hybridizing each of the genome-related nucleic acids and the first barcode nucleic acids with the second barcode nucleic acid is performed to obtain a hybridized complex.

[0115] This step can be performed by known methods. For example, this step can be performed according to the methods described in E. Z. Macosko et al, Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, 1202-1214 (2015), or Zheng GX et al., Massively parallel digital transcriptional profiling of single cells. Nat Commun. 6; 8: 14049 (2017). Subsequently, the compartments can be destroyed by known methods.

[0116] Imaging cell sorter of first embodiment

[0117] In addition, according to the embodiments of the present application, in the above step of analyzing the genomic related information, a step of amplifying the complex resulting from the above hybridization is performed, wherein the hybridized complex is obtained in the above step of obtaining the hybridized complex.

[0118] This step can be performed by known methods. For example, this step can be performed according to the methods described in E. Z. Macosko et al, Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, 1202-1214 (2015), or Zheng GX et al., Massively parallel digital transcriptional profiling of single cells. Nat Commun. 6; 8: 14049 (2017).

[0119] According to one specific embodiment, the synthesis of the complementary strand DNA and the reverse transcription reaction are performed with respect to the hybridized complex obtained in the above step of obtaining the hybridized complex. By the synthesis and reverse transcription reaction, cDNA with respect to the mRNA of the cell origin and the complementary strand DNA with respect to the first barcode nucleic acid are synthesized. Subsequently, template switching can be performed.

[0120] Subsequently, a PCR reaction is preferably performed. By this PCR reaction, two types of amplified products can be generated, wherein a first amplified product is derived from a hybridized complex of the first barcode nucleic acid and the second barcode nucleic acid, and a second amplified product is derived from a hybridized complex of the cell-derived mRNA and the second barcode nucleic acid. In the case where the genome-related nucleic acid is DNA, an extension PCR method can be performed as the above-mentioned PCR reaction. Subsequently, based on the obtained amplified products, a library of the amplified products can be generated, wherein the amplified products include the first amplified product and the second amplified product, derived from the processing of the test target.

[0121] Figure 3

[0122] Further, according to the embodiments of the present application, a step of identifying the test target coexisting with the cell and detecting the genome-related information of the cell using the expression pattern of the amplified product obtained in the above-mentioned step of preparing the amplified product derived from the hybridized complex as an index. Examples of the above-mentioned expression pattern of the amplified product include sequence information of the amplified product obtained by sequencing, such as sequence information of the first barcode nucleic acid (e.g., sequence information of the first universal barcode region), sequence information of the second barcode nucleic acid (e.g., sequence information of the second universal barcode region, sequence information of the second unique barcode region), sequence information of the genome-related nucleic acid (mRNA sequence of each cell), and the like.

[0123] Without particular limitation, one aspect of the step of reading the nucleic acid information after the test target coexists with the cell will be described below.

[0124] The sequence of the amplified product (the first amplified product and the second amplified product) obtained in the above-mentioned step of preparing the amplified product derived from the hybridized complex is determined by a sequencer, and the sequence information of the amplified product is analyzed. In the analysis of the second amplified product, using the sequence information of the second universal barcode region as an index, the cell from which each amplified product is derived is assigned. Further, since each mRNA molecule can be individually identified by the sequence information of the second unique barcode region, it becomes possible to obtain information such as mRNA sequence of each cell and its expression amount, and the like using the sequence information as an index. Based on the information obtained by the above-mentioned analysis of the second amplified product, transcriptome information of each cell can be obtained.

[0125] Next, the identification of the test target coexisting with the above-mentioned cell is performed. Here, as described above, the first barcode nucleic acid corresponds to the test target. Therefore, in the above-mentioned identification, based on the sequence information of the first universal barcode region of the first barcode nucleic acid, the test target coexisting with the cell can be assigned to each first amplified product.

[0126] Next, matching of the test target and transcriptome information coexisting with the cells is performed. Thus, the genomic related information of the cells in each compartment can be associated with the test target coexisting therewith on a one-to-one basis.

[0127] Thus, by detecting the genomic related information, such as the transcriptome information, of the cells or their derivatives coexisting with one or more types of test targets, the reaction of the cells can be evaluated with respect to the test targets coexisting therewith.

[0128] The above-described step of reading nucleic acid information can be performed using, for example, Chromium Controller instruments and Single Cell 3' Reagent Kits v3 manufactured by 10x Genomics, wherein the Single Cell 3' Reagent Kits v3 are single-cell analysis techniques using droplet technology.

[0129] Figure 3

[0130] In the present application, as described above, a plurality of cells are sorted based on the cell phenotype of the cells using an imaging cell sorter. In the present application, the use of an imaging cell sorter enables rapid and accurate analysis of changes in the cell phenotype occurring in response to the test target and sorting of cells exhibiting a desired phenotype. The imaging cell sorter is a flow cytometer that rapidly acquires and analyzes morphological information of an observation object such as a cell, and is capable of selectively acquiring a desired observation object based on the analysis result.

[0131] Imaging cell sorter of second embodiment

[0132] According to the embodiment of the present application, the imaging cell sorter is an analysis device provided with an analysis unit. The analysis unit analyzes an observation object based on signals extracted in time series from an electric signal output from a light receiving unit. The light receiving unit receives scattered light, transmitted light, fluorescence, or electromagnetic waves from the observation object present in a light irradiation region irradiated with light from a light source, and converts them into an electric signal. Hereinafter, the imaging cell sorter of the present embodiment is also referred to as "imaging cell sorter in the first embodiment". The imaging cell sorter in the first embodiment uses a Ghost Motion Imaging technique that utilizes the relative motion of an optical structure and an observation object. For example, the imaging cell sorter in the first embodiment can be used for analysis according to the description in WO2017 / 073737.

[0133] According to the imaging cell sorter in the first embodiment of the present application, each key point of a single-cell flow cytometer is entrusted to machine learning, so that cell information can be measured intelligently, and the cell information can be analyzed and classified intelligently, quickly, and accurately. It is possible to realize (1) a cell classification method that is not limited by human knowledge bias, (2) a high-speed imaging / analysis method of cell spatial information without obtaining a “photographic image” of a cell, and (3) an optical capturing method that is automatically optimized according to an object.

[0134] Reference Example 1: Preliminary test of first barcode nucleic acid connection with cells A schematic diagram of an embodiment of the imaging cell sorter in the first embodiment of the present application. As an example, the imaging cell sorter in the first embodiment of the present application has:

[0135] a light source 1;

[0136] a light irradiation region 3 irradiated by light from the light source 1;

[0137] a light receiving unit 7 that receives scattered light (including Raman scattering), transmitted light, fluorescence, or electromagnetic waves from an observation object 5 present in the light irradiation region 3, and converts the light or electromagnetic waves into an electric signal;

[0138] a storage unit 9 that receives the electric signal from the light receiving unit 7 and records the electric signal;

[0139] an analysis unit 11 that analyzes the electric signal related to the scattered light, the transmitted light, the fluorescence, or the electromagnetic waves recorded by the storage unit 9 and records the analysis result; and

[0140] an optical system control unit 13 that optimizes the light source 1 or the light irradiation region 3 based on the analysis result.

[0141] In the imaging cell sorter in the first embodiment of the present application, the light irradiated in the light irradiation region 3 has a structured illumination pattern. As an example, the structured illumination pattern is provided by a light modulation unit including a spatial light modulator, a light filter, or the like, which is arranged in the middle of an optical path from the light source 1 to the light irradiation region 3. Here, the structured illumination is illumination having a plurality of regions with different optical characteristics, and the illumination light irradiating the observation object in the light irradiation region 3 is modulated to be, for example, cingulate light in which a plurality of regions with different optical characteristics from each other are arranged in a grid-like manner and the plurality of regions include at least a region with a first optical characteristic and a region with a second optical characteristic. It is also possible to configure the imaging cell sorter in the first embodiment of the present application to not include the optical system control unit 13 in the configuration described above. Figure 4

[0142] ​Further, as another embodiment of the imaging cell sorter in the first embodiment, it is also possible to have a configuration that structures light from the observation object 5 (scattered light including Raman scattering, transmitted light, fluorescence, or electromagnetic waves) before it is detected by the light-receiving unit 7, without structuring light in the light irradiation region 3. In this configuration, as an example, by arranging a light modulating unit such as a light filter in the middle of the optical path of the light irradiation region 3 to the light-receiving unit 7, it is possible to structure and detect light from the observation object 5 (the above-described scattered light, transmitted light, fluorescence, or electromagnetic waves from the observation object 5). As an example, the light modulating unit used in the structured detection configuration has a plurality of regions arranged in a grid-like manner, and the plurality of regions have a pattern by the arrangement of light-transmitting regions and light-non-transmitting regions. Light from the observation object 5 passes through the above-described light modulating unit. Then, light having a plurality of regions with different optical properties is detected by the light-receiving unit 7.

[0143] The imaging cell sorter in the first embodiment of the present application preferably optimizes the classification algorithm of the analysis unit 11 by machine learning. In the imaging cell sorter in the first embodiment of the present application, it is possible to acquire training data using a training sample including cells exhibiting a desired phenotype, to generate a classification model that classifies cells exhibiting a desired phenotype using the training data, to measure a test sample, and to acquire cells exhibiting a desired phenotype from the test sample based on the model.

[0144] In the imaging cell sorter in the first embodiment of the present application, preferably, the analysis unit 11 analyzes the observation object without reconstructing an image of the observation object from the electrical signals related to scattered light, transmitted light, fluorescence, or electromagnetic waves. That is, the electrical signals related to scattered light, transmitted light, fluorescence, or electromagnetic waves are used as time-series waveform data in the analysis. More preferably, the imaging cell sorter in the first embodiment of the present application acquires waveform data (electrical signals) acquired using a training sample including cells exhibiting a desired phenotype as training data, and generates a classification model for classifying cells exhibiting a desired phenotype using the training data. Then, more preferably, in the imaging cell sorter in the first embodiment of the present application, cells exhibiting a desired phenotype are acquired from a test sample based on waveform data (electrical signals) acquired at the time of the test sample, with reliance on the model.

[0145] In the imaging cell sorter in the first embodiment of the present application, preferably, the optical system control unit 13 optimizes the light source 1 by machine learning.

[0146] In the imaging cell sorter according to the first embodiment of the present application, preferably, the light from the light source 1 has a plurality of optical regions 21, and the optical system control unit 13 controls the optical structure of the plurality of optical regions. Thus, preferably, the imaging cell sorter according to the first embodiment of the present application has a plurality of optical regions, and the optical system control unit controls the optical structure of the optical regions. Further, according to the embodiment, in the imaging cell sorter according to the first embodiment of the present application, a light modulation unit having a plurality of regions with different optical characteristics from each other is provided on the optical path between the light source and the light irradiation region. The light from the light source 1 is structured by the light modulation unit, and the observation object 5 is irradiated with the structured illumination in the light irradiation region 3.

[0147] In the imaging cell sorter according to the first embodiment of the present application, preferably, the optical system control unit 13 analyzes the region where the observation object 3 is present on the basis of the electric signal and controls and restricts the light irradiation region 3.

[0148] In the imaging cell sorter according to the first embodiment of the present application, preferably, the optical system control unit 13 analyzes the roughness of the observation object 5 to obtain roughness information of the observation object on the basis of the electric signal and controls the light source 1 or the light irradiation region 3 on the basis of the roughness information. Thus, according to one embodiment, the analysis unit updates the classification algorithm on the basis of the analysis result. In the imaging cell sorter according to the first embodiment of the present application, preferably, the light and the light irradiation region are controlled on the basis of the result of the analysis by the analysis unit.

[0149] Preferably, the imaging cell sorter according to the first embodiment of the present application further has a light receiving system control unit 27 that receives the electric signal from the light receiving unit 7 and optimizes the light receiving region 25, which is the region where the light receiving unit 7 is irradiated with light. In the imaging cell sorter according to the first embodiment of the present application, preferably, the light receiving system control unit 27 optimizes the light receiving region 25 by machine learning.

[0150] In a preferred use form, the imaging cell sorter according to the first embodiment of the present application has a flow cell including the light irradiation region 3. The observation object 5 moves with a fluid flowing through the flow cell and is irradiated with light from the light source 1 in the light irradiation region 3.

[0151] The imaging cell sorter according to the first embodiment of the present application preferably has a sorting unit that sorts the classified observation object 5 on the basis of the analysis result by the analysis unit 11.

[0152] Reference Example 2: Preliminary test of first barcode nucleic acid connection with cells

[0153] Further, according to the preferred embodiment of the present application, the imaging cell sorter is an analysis device provided with an analysis unit. The analysis unit analyzes an observation object based on signals extracted in time series from an electric signal output from a light receiving unit. The light receiving unit receives scattered light, transmitted light, fluorescence, or electromagnetic waves from the observation object present in a light irradiation region irradiated with light from a light source, and converts them into an electric signal. Hereinafter, the imaging cell sorter of the present embodiment is also referred to as an "imaging cell sorter in the second embodiment". The imaging cell sorter in the second embodiment can be used for analysis according to the description in WO2018 / 199080.

[0154] According to the imaging cell sorter in the second embodiment, it is possible to generate a three-dimensional image of an observation object at high speed, which is advantageous for rapid determination of the phenotype of a cell as an observation object.

[0155] The imaging cell sorter in the second embodiment is preferably an imaging flow cytometer provided with at least one flow path through which an observation object flows, a light source that irradiates the flow path with a band-shaped excitation light, an imaging unit that obtains a photographic image of a certain cross section of the observation object by obtaining fluorescence from the observation object that has passed through the excitation light irradiation position, and a three-dimensional image generation unit that generates a three-dimensional photographic image of the observation object based on a plurality of photographic images of the cross section obtained by the imaging unit.

[0156] Further, in the imaging cell sorter in the second embodiment, preferably, the observation object is sorted based on information represented by the morphology of the observation object shown in the cross-sectional photographic images obtained by the imaging unit.

[0157] Further, in the imaging cell sorter in the second embodiment, preferably, the flow path is a plurality of flow paths arranged in parallel, the plurality of flow paths are irradiated with the excitation light, and the imaging unit obtains a cross-sectional photographic image of the observation object flowing through each of the plurality of flow paths.

[0158] Further, in the imaging cell sorter in the second embodiment, preferably, the optical modulation unit has a plurality of regions having different optical characteristics from each other, is disposed on an optical path between the light source and an image sensor that detects the intensity of fluorescence, and the imaging unit reconstructs an image of the cross section of the observation object into a photographic image taken based on the intensity of fluorescence detected by the image sensor and the optical characteristics of the optical modulation unit.

[0159] According to the present application, it is possible to provide an imaging flow cytometer that generates a three-dimensional image of an observation object at high speed.

[0160] According to an aspect, the method of the present application can be performed after the above preparation step according to the method described in the following examples.

[0161] Further, the contents described in Japanese Patent No. 5441142, Japanese Patent No. 5540359, Japanese Patent No. 6544600, WO2017 / 073737, WO2018 / 181458, WO2018 / 199080, and WO2018 / 203575 are incorporated by reference into the present specification.

[0162] According to the embodiments of the present application, the following is provided.

[0163] [1] A method for screening a test target, the method comprising: a step of preparing a plurality of cells labeled with a first barcode nucleic acid associated with a test target and treated with the test target; a step of sorting the plurality of cells based on a cell phenotype using an imaging cell sorter; and a step of identifying the test target used to treat each cell using the first barcode nucleic acid as an index.

[0164] [2] The method according to [1], wherein the test target used to treat each cell is associated with a phenotype of each cell.

[0165] [3] The method according to [1] or [2], wherein the step of identifying further comprises a step of identifying a target site at which a desired phenotypic change of the cell is produced by the test target.

[0166] [4] The method according to any one of [1] to [3], further comprising: a step of analyzing genome-related information of each cell.

[0167] [5] The method according to any one of [1] to [4], wherein the step of preparing cells comprises: a step of associating the first barcode nucleic acid with cells by mixing a liquid medium including the test target and the first barcode nucleic acid with the cells.

[0168] [6] The method according to any one of [1] to [5], wherein the step of preparing cells comprises: a step of associating the first barcode nucleic acid with the test target by adding a hydrogel bead to a liquid medium including the test target and the first barcode nucleic acid to produce a first sub-compartment including the test target and the first barcode nucleic acid.

[0169] [7] The method according to any one of [1] to [6], wherein the step of preparing cells comprises: fusing a first sub-compartment including the test target and the first barcode nucleic acid with a second sub-compartment including the cells to produce a compartment including the test target, the first barcode nucleic acid, and the cells.

[0170] [8] The method of [7], wherein the step of preparing cells comprises: treating the cells with the test target in the compartment.

[0171] [9] The method of any one of [6] to [8], wherein the compartment and the sub- compartment are droplets.

[0172]

[10] The method of any one of [7] to [9], wherein the step of preparing cells comprises: a step of recovering cells from the compartment.

[0173]

[11] The method of any one of [1] to

[10] , wherein the step of sorting comprises: a step of sorting cells that have a predetermined reaction to the test target based on a cell phenotype.

[0174]

[12] The method of any one of [4] to

[11] , wherein the step of analyzing the genome- related information comprises:

[0175] a step of preparing a plurality of compartments comprising a genome-related nucleic acid corresponding to a cell genome or a derivative thereof, a first barcode nucleic acid, and a second barcode nucleic acid attachment bead, wherein the second barcode nucleic acid attachment bead comprises a plurality of second barcode nucleic acids capable of hybridizing to the genome-related nucleic acid corresponding to the cell genome or a derivative thereof or the first barcode nucleic acid;

[0176] a step of obtaining a hybridized complex by hybridizing each of the genome- related nucleic acid and the first barcode nucleic acid to the second barcode nucleic acid;

[0177] a step of generating amplification products derived from the hybridized complex; and

[0178] a step of detecting genome-related information of the cells using an expression pattern of the amplification products as an indicator after the cells coexist with the test target.

[0179]

[13] The method of

[12] , wherein the genome-related nucleic acid is a cell genomic DNA, or an RNA or a cDNA thereof derived from the cell genome.

[0180]

[14] The method of

[12] or

[13] , wherein each first barcode nucleic acid comprises a first universal barcode region that is common to the same test target and a first hybridization region capable of hybridizing to the second barcode nucleic acid.

[0181]

[15] The method according to any one of

[12] to

[14] , wherein the sequence information of the first universal barcode region is an index for determining the test target.

[0182]

[16] The method according to any one of

[12] to

[15] , wherein each of the plurality of second barcode nucleic acids connected to the bead connected to the second barcode nucleic acid comprises a second universal barcode region common to each other, a second unique barcode region capable of being distinguished from each other, and a second hybridization region capable of hybridizing to the genome-related nucleic acid or the first barcode nucleic acid.

[0183]

[17] The method according to any one of

[12] to

[16] , wherein the sequence information of the second unique barcode region is an index for determining the genome-related nucleic acid.

[0184]

[18] The method according to any one of

[11] to

[16] , wherein the second barcode nucleic acid further comprises a PCR primer region.

[0185]

[19] The method according to any one of

[12] to

[17] , wherein the second hybridization region comprises a nucleic acid complementary to the first hybridization region or the genome-related nucleic acid.

[0186]

[18] The method according to any one of [1] to

[19] , wherein the imaging cell sorter is an analysis device provided with an analysis unit that receives scattered light, transmitted light, fluorescence, or electromagnetic waves from an observation object by a light receiving unit and converts them into an electric signal, and analyzes the observation object based on a signal extracted in time series from the electric signal output from the light receiving unit, wherein the observation object exists in a light irradiation region irradiated with light from a light source.

[0187]

[21] The method according to

[20] , wherein a light modulation unit having a plurality of regions different from each other in optical characteristics is disposed on an optical path between the light source or the light irradiation region.

[0188]

[22] The method according to

[20] or

[21] , further comprising: an optical system control unit that controls the light source based on an analysis result by the analysis unit.

[0189]

[23] The method according to

[22] , wherein light from the light source has a plurality of optical regions, and the optical system control unit controls an optical structure of the optical regions.

[0190]

[24] The method according to any one of

[20] to

[23] , wherein the analysis unit updates a classification algorithm based on the analysis result.

[0191]

[25] The method according to any one of

[20] to

[24] , wherein the light and the light irradiation region are controlled based on a result of the analysis by the analysis unit.

[0192]

[26] The method according to any one of

[20] to

[25] , wherein the imaging cell sorter includes a flow cell including the light irradiation region.

[0193]

[27] The method according to any one of

[20] to

[26] , wherein the imaging cell sorter has a sorting unit that classifies and sorts the observation object based on a result of the analysis by the analysis unit.

[0194]

[28] The method according to any one of

[20] to

[27] , wherein the imaging cell sorter is further provided with: a flow line width control unit by which a flow line width with which the observation object moves in a flow path is variably controlled; and

[0195] a teaching information generation unit that generates teaching information that indicates, by machine learning, a criterion for classifying a state of the observation object, based on a signal extracted in time series and a flow line width at which the signal is acquired;

[0196] the analysis unit estimates a state of the observation object moving on the flow line based on the signal and the teaching information generated by the teaching information generation unit.

[0197]

[29] The method according to

[28] , wherein the flow line width control unit controls the flow line width to a first flow line width that is a width corresponding to a diameter of the observation object;

[0198] the teaching information generation unit generates, as the teaching information, first teaching information based on a first observation result signal detected by the light receiving unit at the first flow line width controlled by the flow line width control unit; and

[0199] the analysis unit estimates a state of the observation object moving on the flow line based on the signal and the first teaching information generated by the teaching information generation unit.

[0200]

[30] The method according to

[28] or

[29] , wherein the flow line width control unit controls the flow line width to a second flow line width, which is a width based on a diameter of the observation object and is wider than the first flow line width.

[0201] The teaching information generation unit further generates second teaching information as the teaching information based on a second observation result signal detected by the light receiving unit under the second flow line width controlled by the flow line width control unit; and

[0202] The analysis unit estimates a state of the observation object moving on the flow line based on the signal, the first teaching information generated by the teaching information generation unit, and the second teaching information generated by the teaching information generation unit.

[0203]

[31] The method according to any one of [1] to

[30] , wherein the imaging cell sorter is provided with:

[0204] at least one flow path through which the observation object flows;

[0205] a light source for irradiating the flow path with a band-shaped excitation light;

[0206] an imaging unit that obtains a photograph image of a certain cross section of the observation object by obtaining fluorescence from the observation object passing through a position irradiated with the excitation light; and

[0207] a three-dimensional image generation unit that generates a three-dimensional photograph image of the observation object based on a plurality of photograph images of the cross section obtained by the imaging unit.

[0208]

[32] The method according to

[31] , wherein the imaging cell sorter sorts the observation object based on information indicating a morphology of the observation object shown in the cross section photograph image obtained by the imaging unit.

[0209]

[33] The method according to

[31] or

[32] , wherein the flow path is a plurality of flow paths arranged in parallel; the plurality of flow paths are irradiated with the excitation light; and the imaging unit obtains a cross section photograph image of the observation object flowing through each of the plurality of flow paths.

[0210]

[34] The method according to any one of [1] to

[33] , wherein a light modulation unit having a plurality of regions with different optical characteristics from each other is disposed on an optical path between the light source and an image sensor that detects intensity of fluorescent light; and the imaging unit reconstructs an image of the cross section of the observation object into a photographed photo image based on intensity of fluorescent light detected by the image sensor and the optical characteristics of the light modulation unit.

[0211]

[35] The method according to any one of [1] to

[34] , wherein the test target includes a test substance.

[0212]

[36] The method according to any one of [1] to

[35] , wherein the test target is a test substance.

[0213]

[37] The method according to any one of [1] to

[36] , wherein the step of analyzing the genome-related information includes:

[0214] a step of preparing a plurality of compartments including cells exhibiting a desired phenotypic change sorted using an imaging cell sorter, first barcode nucleic acids, and second barcode nucleic acid-linked beads, wherein the second barcode nucleic acid-linked beads include a plurality of second barcode nucleic acids capable of hybridizing to a genome-related nucleic acid corresponding to a genome of the cells or a derivative thereof or the first barcode nucleic acids;

[0215] a step of obtaining a hybridized complex by hybridizing each of the genome-related nucleic acids and the first barcode nucleic acids to the second barcode nucleic acids;

[0216] a step of generating amplification products derived from the hybridized complex;

[0217] a step of detecting the genome-related information using an expression pattern of the amplification products as an index after the first barcode nucleic acids and the test target coexist with the cells.

[0218] [Embodiments]

[0219] Hereinafter, the present application will be specifically described based on embodiments, but the present application is not limited to these embodiments. In addition, unless specifically noted, the measurement methods and units of the present application conform to the provisions of Japanese Industrial Standards (JIS).

[0220] Figure 4

[0221] According to the Multi-seq method (described in Nature Methods, Vol. 16, pp. 619-626, (2019)), the following preliminary test was performed using the same cells, anchor CMO, co-anchor CMO, and oligonucleotide as described in Example 1 below. That is, the cells and the anchor CMO were incubated in a phosphate buffered saline (PBS) solution at 4°C for 5 minutes, then the co-anchor CMO was added thereto and further incubated at 4°C for 5 minutes, and finally, a red fluorescent dye (Cy5) conjugated oligonucleotide (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) was mixed therewith and incubated at 4°C for 5 minutes.

[0222] As a result, as shown in A and B of FIG. 10, in the PBS solution, the red fluorescent dye (Cy5) conjugated oligonucleotide (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) remained in the cells after a short incubation (after 30 minutes of incubation). However, it was confirmed that after a longer period of time (incubation for 3 hours or more), a situation where almost all of the cells were dead or the added barcode nucleic acid was detached from the cells occurred (not shown). Reference Example 3: Preliminary test of first barcode nucleic acid association with cells

[0223] Figure 4

[0224] In addition, in addition to the incubation using a cell culture medium containing serum or bovine serum albumin (BSA) as a solvent, the preliminary experiment was performed using the same method as in Reference Example 1. As a result, it was confirmed that the attachment rate of the red fluorescent dye (Cy5) conjugated oligonucleotide (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) to the cells was reduced, as shown in the photographs of C and D of FIG. 11. Example 1: Association of first barcode nucleic acid with cells in a compartment (tube)

[0225] Example 2: Association of test substance, first barcode nucleic acid, and cells in a compartment (tube)

[0226] In addition, in addition to the incubation using a cell culture medium containing serum or bovine serum albumin (BSA) as a solvent, the preliminary experiment was performed using the same method as in Reference Example 1. As a result, it was confirmed that the attachment rate of the red fluorescent dye (Cy5) conjugated oligonucleotide (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) to the cells was reduced, as shown in the photographs of C and D of FIG. 11. Figure 5

[0227] Figure 5

[0228] ​​​In this experiment, first, in tube 1, two types of cholesterol-modified oligonucleotide linkers, namely an anchor CMO (5'-cholesterol-TEG-GTAACGATGGAGCTGTCACTTGGAATTCTCGGGTGCCAAGG-3' (SEQ ID NO: 1)) and a co-anchor CMO (5'-AGTGACAGCTGGATCGTTAC-TEG cholesterol-3' (SEQ ID NO: 2)) were mixed. Here, as "cholesterol-TEG" in the oligonucleotide linker, a commercial product listed in https: / / sg.idtdna.com / site / Catalog / Modifications / Product / 2555 was used. In the above mixing process, serum-free Opti-MEM medium was used as a solvent, and the final concentration of both the anchor CMO and the co-anchor CMO was set to 250 nM. Tube 1 was incubated at room temperature for 5 minutes.

[0229] Next, the first barcode nucleic acid A was added to tube 1, mixed, and incubated. The oligonucleotide including the first barcode nucleic acid A sequence (8 bases) was 5'-CCTTGGCACCCGAGAATTCCACCACAATGA30-3' (SEQ ID NO: 3). Here, A30 added to the end of the first barcode nucleic acid A is a polyadenine (poly(A 30 )) formed of 30 residues. The final concentration of the first barcode nucleic acid A was set to 250 nM, and the incubation was performed at room temperature for 5 minutes.

[0230] Next, the cells collected in advance by centrifugation were added to tube 1 and incubated. The cells used at this time were THP1 cells, and the cell concentration was set to 1 x 10 7 cells / mL. The incubation was performed at room temperature for 5 minutes.

[0231] On the other hand, in tube 2, the cells were labeled with the first barcode nucleic acid B according to the same method and conditions as when tube 1 was described, except that an oligonucleotide including the first barcode nucleic acid B (8 bases) was used instead of the oligonucleotide including the first barcode nucleic acid A (8 bases). The oligonucleotide including the first barcode nucleic acid B (8 bases) was 5'-CCTTGGCACCCGAGAATTCCATGAGACCTA30-3' (SEQ ID NO: 4).

[0232] Figure 5

[0233] In the tube 1 and the tube 2, the cells are respectively resuspended in RPMI-1640 medium with 10% FBS and 50 mM 2-mercaptoethanol. Next, as a drug, lipopolysaccharide (LPS) suspended in dimethyl sulfoxide (DMSO) is added to the tube 1 at a final concentration of 2 pg / mL. In the tube 2, only the solvent DMSO for the drug is added. Next, the tube 1 and the tube 2 are respectively incubated at 37°C, CO2 for 2 hours. Through the experiment so far, whether the drug LPS is present is associated with each cell by corresponding each cell to the first barcode nucleic acid type A or the first barcode nucleic acid type B, respectively.

[0234] In the method of Example 2, it is also confirmed that by resuspending and culturing the cells in RPMI-1640 medium with 10% FBS and 50 mM 2-mercaptoethanol, the problem of the barcode nucleic acid attached to the cells falling off from the cells during a long incubation process can be avoided.

[0235] Specifically, cells labeled with an oligonucleotide conjugated with a green fluorescent dye FAM (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) and cells labeled with an oligonucleotide conjugated with a red fluorescent dye (Cy5) (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) are respectively prepared and mixed in a PBS solution, and incubated for 1 hour. When this mixed cell sample after incubation is observed using a fluorescence microscope through the respective channels of green fluorescence (A) and red fluorescence (B) in FIG. 1, Figure 5 Figure 6 Many cells emit green and red light at the same time. That is, when the cells are cultured for a long time in a PBS solution (which is the previous method), the barcode nucleic acids fall off from the cells, and the two types of barcode nucleic acids are mixed together.

[0236] Next, in the same manner, cells labeled with an oligonucleotide conjugated with a green fluorescent dye FAM (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) and cells labeled with an oligonucleotide conjugated with a red fluorescent dye (Cy5) (having a sequence corresponding to a partial sequence of the first barcode nucleic acid) are respectively prepared and mixed in RPMI-1640 medium with 10% FBS and 50 mM 2-mercaptoethanol, and incubated for 1 hour. When this mixed cell sample after incubation is observed using a fluorescence microscope through the respective channels of green fluorescence (C) and red fluorescence (D) in FIG. 2, Example 3: Fixation, protein-tagging, and staining experiment of cells in response to test substance Figure 7 It is confirmed that the barcodes do not fall off from the cells, and the problem of the two barcode nucleic acids being mixed together is solved.

[0237] ​​Furthermore, the barcode nucleic acid added to the cells was still attached to the surface of the cell membrane about 1 hour after addition, and then the changes in the cells to which the barcode nucleic acid was added were observed over time (1 hour, 2 hours, 3 hours, and 6 hours later). Example 4: Experiment of sorting cells in response to test substance based on cell image phenotypes by imaging cell sorter As shown, a portion of the barcode nucleic acid was taken up into the cells, and the cells retained the barcode nucleic acid intact. In addition, it was confirmed that culturing cells in RPMI-1640 medium containing 10% FBS and 50 μM 2-mercaptoethanol could prevent the death of cells to which the barcode nucleic acid was added.

[0238] Figure 8

[0239] Next, some cells were collected from tubes 1 and 2, respectively. The obtained cells were fixed by incubating in a 4% formalin solution suspended in PBS for 15 minutes at room temperature, or incubating in a 1 mg / mL DTSSP solution (disodium dithiobissulfosuccinimidyl propionate (DTSSP) (manufactured by DOJINDO) at room temperature for 30 minutes, and then treated with ice-cold methanol for 5 minutes. The fixed cells were replaced with a PBS solution. Immunostaining was then performed using a primary antibody against NFκB protein (NFκB p65 (D14E12), manufactured by CST). The primary antibody was used after 100-fold dilution, and the reaction solution was treated with PBS containing 1% BSA at 4°C for 16 to 20 hours. Next, reaction was performed with a secondary antibody conjugated to a fluorescent dye (Alexa Fluor 488). The secondary antibody was used after 200-fold dilution, and the reaction solution was treated with PBS containing 1% BSA at room temperature for 1 hour.

[0240] like Figure 9 As shown, when confirmed using a fluorescence microscope, in the cells in tube 2 to which only the drug solvent DMSO was added, almost all of the NFκB protein was localized in the cytoplasm, while in the cells in tube 1 to which the LPS drug was added, almost all of the NFκB protein was localized in the nucleus.

[0241] Next, some of the cells collected in tube 1 were stained with Fixable Far Red. These stained cells were then mixed with some of the cells collected in tube 2 that were not stained with Fixable Far Red to obtain a mixed cell solution A, in which both types of cells were included in the mixed cell solution at a 1:1 concentration.

[0242] In addition, a portion of cells was collected from tube 2 to which only DMSO (a solvent for the drug) was added to obtain cell solution B, which served as a negative control.

[0243] In addition, a portion of mixed cell solution A is prepared to obtain training data for the imaging cell sorter.

[0244] Example 5: Experiment of confirming information connectivity between test substance and cell phenotype of cells sorted and recovered by imaging cell sorter Figure 10

[0245] Cells were sorted and recovered from a mixed cell solution based on the nuclear localization of the NFKB protein using an imaging cell sorter, where the nuclear localization of the NFKB protein is a cell image phenotype observed in response to the addition of the LPS drug. The imaging cell sorter used in this experiment is the sorter described in Science, 15 Jun 2018: Vol. 360, Issue 6394, pp. 1246-1251.

[0246] First, a machine learning model was developed to classify cells in which the nuclear localization of the NFKB protein occurred, where the nuclear localization of the NFKB protein is a cell image phenotype to be classified and recovered. Specifically, a supervised machine learning model (SVM: Support Vector Machine) was generated using a portion of mixed cell solution A in which cells from tube 1 and cells from tube 2 (only cells from tube 1 were stained with a fixable infrared dye) were mixed at a known ratio for training. A portion of the mixed cell solution A was introduced to the imaging cell sorter to obtain an image signal derived from the Alexa Fluor 488 used to label the NFKB protein. Using the image signal and the correct answer data based on the fixable infrared label as training data, a classification model that predicts the nuclear localization of the NFKB protein was generated.

[0247] Next, using the imaging cell sorter, cells of cell solution A were sorted based on the nuclear localization of the NFKB protein and cells in which the nuclear localization of the NFKB protein occurred were recovered, where in the cell solution A, cells to which the LPS drug was added and cells to which no drug was added were mixed at a cell concentration of 1:1, where the nuclear localization of the NFKB protein is a cell image phenotype of cells to which the LPS drug was added. The recovery rate was 90% or more of the total cells.

[0248] For samples in which protein labeling was performed after 4% formalin fixation, the nuclear localization of the NFKB protein was predicted from the image signal data and the prediction was associated with the correct answer based on the label signal derived from the fixable infrared. As a result, for acc (accuracy), a classification accuracy of 0.95 was obtained, and for roc-auc (area under the receiver operating characteristic curve), 0.997 was obtained. In addition, after sorting based on the image signal data, the purity of the recovered sample after sorting was measured and quantified by flow cytometry based on the label signal derived from the fixable infrared. The results are shown in Figure 11

[0249] ​For samples in which protein tagging was performed after DTSSP fixation, the nuclear localization of the NFkB protein was predicted from the image signal data, and the prediction was associated with the correct answer based on the tag signal derived from the fixable infrared. The results are shown in Table 1. Example 6: Experiment of confirming association of test substance and cell phenotype information with gene expression information in mixed cells Under the fixation conditions of 1 mg of DTSSP, a classification accuracy of 0.87 was obtained for acc (accuracy), and 0.91 was obtained for roc-auc. Under the fixation conditions of 10 mg of DTSSP, a classification accuracy of 0.90 was obtained for acc (accuracy), and 0.96 was obtained for roc-auc.

[0250] As can be seen from the above results, the present method can quickly sort cells based on image phenotypes using an imaging cell sorter, whereas the cell sorting based on image phenotypes in the prior art method is time-consuming and costly.

[0251] Figure 12A Figure 12A

[0252] A solution including about 4800 cells was provided by mixing cells recovered by sorting through the imaging cell sorter (positive purity: 0.995) and control mixed cells (the ratio of the presence of LPS drug to the absence of drug was 1:1), and single cell analysis was performed for each cell. In order to read the DNA barcode modified for each cell, a single cell analysis technique using a droplet technique, and particularly a Chromium Controller instrument manufactured by 10x Genomics and a Single Cell 3' Reagent Kit v3 were used.

[0253] Figure 13 A schematic diagram of the reagents included in the kit is shown. In this technology, a large number of droplets are generated in a microfluidic channel, and in each droplet, a second barcode nucleic acid binding bead and one cell are included in each droplet at a ratio of 1:1, and the second barcode nucleic acid binding bead is different for each droplet. A plurality of second barcode nucleic acids are connected to the second bead through a linker. In addition, each of the plurality of second barcode nucleic acids connected to the second bead includes a second universal barcode region (16 bases) that is common to each other as long as the cell included in the droplet is the same, a second unique barcode region (12 bases) that can be distinguished from each other for each independent droplet, and a second hybridization region that can be hybridized with a nucleic acid derived from the genome of the cell or a first barcode nucleic acid.

[0254] Specifically, first, in each droplet, a second hybridizing poly(dT) sequence added to the end of the second unique barcode region binds to the poly(A) end of the first barcode nucleic acid attached to the cell surface. Furthermore, a reverse transcription reaction is performed using a reverse transcriptase or the like, and a complementary DNA strand of the first barcode nucleic acid bound to the second barcode nucleic acid sequence is generated using the first barcode primer 5'-CTTGGCACCCGAGAATTCC-3' (SEQ ID NO: 5) and a complementary DNA strand primer included in the Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics.

[0255] Each resulting droplet was then disrupted in a mixed state, and a complementary DNA strand to the second unique barcode extracted from each droplet was amplified by PCR. The DNA concentration was measured using an Invitrogen Qubit Fluorometer. The result was 23.4 ng / μl for the image-sorted and recovered cell solution, and 30.4 ng / μl for the control cell solution.

[0256] Next, if Figure 14A As shown in , a next generation sequence library of a first barcode nucleic acid is generated by PCR reaction, wherein the first barcode nucleic acid is combined with a second barcode nucleic acid sequence that is different for each cell. The primers used are as follows:

[0257] Read length 1 side (universal I5 primer)

[0258] 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA TCT-3' (serial number 6),

[0259] Read length 2 side (TruSeq RPI primer)

[0260] In the cell solution for image classification and recovery,

[0261] 5'-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCG AGAATTCCA-3' (SEQ ID NO: 7), and

[0262] In the control cell solution,

[0263] 5'-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCC GAGAATTCCA-3' (SEQ ID NO: 8).

[0264] For the obtained next-generation sequence library, DNA size and concentration were measured using D5000 screen tape manufactured by Agilent to confirm the quality of the library.

[0265] P5 and P7 sequence libraries were generated using MiSeq Reagent Kit v3 manufactured by Illumina, and next-generation sequencing was performed using a MiSeq next-generation sequencer manufactured by Illumina. The obtained sequence data was read as a text-based FASTQ file on the Read1 side and the Read2 side, and analyzed using Python3, DropseqTools, and UMITools.

[0266] As a result, the total number of reads of the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) for the image-sorted and recovered cells was 19912682. In addition, the number of first barcode nucleic acid sequences that can be associated with the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) was 16354670. Among them, the number of reads of the first barcode nucleic acid A associated with the presence of the drug LPS was 85.1% of the total number of first barcode nucleic acid reads, and the number of reads of the first barcode nucleic acid B associated with the absence of the drug was 0.8% of the total number of first barcode nucleic acid reads.

[0267] For the control mixed cells (the ratio of cells in the presence of the LPS drug to cells in the absence of the drug was 1:1), the total number of reads of the second universal barcode region (16 bases) and the second unique barcode region (12 bases) was 10795154, and the number of first barcode nucleic acid sequences that can be associated with the second universal barcode region (16 bases) and the second unique barcode (12 bases) was 7587061. Among them, the number of reads of the first barcode nucleic acid A associated with the presence of the drug LPS was 51.3% of the total number of first barcode nucleic acid reads, and the number of reads of the first barcode nucleic acid B associated with the absence of the drug was 35.6% of the total number of first barcode nucleic acid reads.

[0268] Through this series of experiments, it was confirmed that using an imaging cell sorter, it is possible to perform a cell phenotype screening of a test substance by sorting cells on which nucleic acid barcodes associated with the test substance are attached based on the observed cell image phenotype in response to the test substance and reading the nucleic acid barcode sequence attached to the sorted cells.

[0269] Figure 14B Figure 15

[0270] A sample simulating a sample of a cell mixture sorted and recovered through an imaging cell sorter (a ratio of cells in which an LPS drug was present to cells in which no drug was present was 9: 1) (positive purity: 0.9) was prepared through the above-described immobilization, labeling, and staining immobilization conditions. A solution including approximately 4800 cells was provided from the sample, and single cell analysis was performed thereon. In order to read out the DNA barcode modified for each cell and the genetic information derived from the cell, a single cell analysis technique using a droplet technique, particularly, a Chromium Controller instrument and a Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics, was used as described in Example 5.

[0271] First, in each droplet, the second hybridization region of the poly(dT) sequence added to the end of the second unique barcode region is bound to the poly(A) end of the first barcode nucleic acid attached to the surface of the cell. In addition, a reverse transcription reaction is performed using a reverse transcriptase or the like, and a complementary strand DNA for the first barcode nucleic acid is generated using a primer 5'CTTGGCACCCGAGAATTCC-3' (SEQ ID NO: 5) for the first barcode nucleic acid and a complementary strand DNA primer included in the Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics, which is bound to the second barcode nucleic acid sequence.

[0272] In addition, at the same time as the generation of the complementary strand DNA of the second unique barcode, the second hybridization poly(dT) sequence added to the end of the second unique barcode region is bound to the poly(A) end of the mRNA derived from the cell for the endogenous cDNA of each cell. In addition, a reverse transcription reaction is performed using a reverse transcriptase or the like, and a complementary strand DNA derived from the cell is generated using a complementary strand DNA primer included in the Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics.

[0273] Then, each of the generated droplets was disrupted in a mixed state, and a set of the complementary strand DNA of the first barcode nucleic acid of the second unique barcode and the complementary strand DNA derived from the cell was extracted from each droplet. Thereafter, each of the complementary strand DNAs was amplified through a PCR reaction, and their DNA concentrations were measured with a Qubit Fluorometer manufactured by Invitrogen. For the results of the measurement, the barcode complementary strand DNA concentration of the cells recovered after image sorting was 57.8 ng / μl, and the complementary strand DNA concentration derived from the cell was 0.676 ng / μl.

[0274] Using the same method, the barcode complementary strand DNA and the cell-derived complementary strand DNA were also recovered from the negative control cells to which no LPS drug stimulation was given, respectively, and the DNA concentration was similarly measured using the Qubit Fluorometer manufactured by Invitrogen. According to the measured results, the concentration of the barcode complementary strand DNA was 45.6 ng / μl, and the concentration of the cell-derived complementary strand DNA was 0.658 ng / μl.

[0275] Next, a next-generation sequence library of the first barcode nucleic acid and the cell-derived complementary strand DNA, to which the second barcode nucleic acid sequence different for each cell was bound, was generated by a PCR reaction:

[0276] Read 1 side (universal I5 primer)

[0277] 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 6); and

[0278] Read 2 side for negative control cells (TruSeq RPI primer)

[0279] 5'-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3' (SEQ ID NO: 7) and

[0280] Read 2 side for image-sorted and recovered cells

[0281] 5'-CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3' (SEQ ID NO: 8).

[0282] For the obtained next-generation sequence library, the DNA size and the DNA concentration were measured using the D5000 screen tape manufactured by Agilent and the qPCR reaction, and the quality of the library was confirmed.

[0283] The P5 and P7 sequence library was generated using the MiSeq Reagent Kit v3 manufactured by Illumina, and next-generation sequencing was performed using the MiSeq next-generation sequencer manufactured by Illumina. The obtained sequence data was read as a text-based FASTQ file on the Read 1 side and the Read 2 side, and was analyzed using Python 3, DropseqTools, and UMITools.

[0284] As a result, the total number of read lengths of the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) from the mixed sample cells (the ratio of cells in which the LPS drug was present to cells in which the drug was not present was 9:1) was 251,958. In addition, the number of first barcode nucleic acid sequences associated with the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) was simultaneously read was 249,793. Among them, the number of read lengths of the first barcode nucleic acid A corresponding to the presence of the drug LPS was 86.8% of the total number of first barcode nucleic acid read lengths. The number of read lengths of the first barcode nucleic acid B corresponding to the absence of the drug was 3.1% of the total number of first barcode nucleic acid read lengths. Further, after performing read length error correction, among the number of read lengths of the second universal barcode region sequence read corresponding to the first barcode nucleic acid sequence A or the first barcode nucleic acid sequence B, in which the upper table in which the second universal barcode region sequence having a large number of read lengths was sequentially arranged was shown together with the number of read lengths of the first barcode nucleic acid sequence A or the first barcode nucleic acid sequence B simultaneously read (Table 1-1 in Example 7: Cell phenotype screening method in a compartment (droplet) and Table 1-2 in Figure 16 ). In addition, among the 594 second unique barcode region sequences of the complementary strand DNA, 550 sequences identical to the second unique barcode region sequence were found in the first barcode sequence library, and almost all (92.6%) of the library in which the first nucleic acid barcode sequence in which the second unique barcode region sequence was found belonged to the first barcode nucleic acid A (Table 1-1 in Figure 17 , Chart 1).

[0285] The total number of read lengths of the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) of the negative control cells not containing the LPS drug was 185,858. In addition, the number of first barcode nucleic acid sequences that can be associated with the second universal barcode region sequence (16 bases) and the second unique barcode region (12 bases) was 184,181. Among them, the number of read lengths of the first barcode nucleic acid A corresponding to the presence of the drug LPS was 0% of the total number of first barcode nucleic acid read lengths, and the first barcode nucleic acid B corresponding to the absence of the drug was 83.3% of the total number of first barcode nucleic acid read lengths. In addition, after performing read error correction, in the upper table shown in which the second unique barcode region sequence having a large number of read lengths was sequentially arranged, the total number of read lengths of the second universal barcode region sequence corresponding to the first barcode nucleic acid sequence A and the first barcode nucleic acid sequence B, respectively, was shown (Table 2-1 in Example 8: Cell phenotype screening method using 96-well microplate and Table 2-2 in Figure 18In addition, among the 197 second unique barcode region sequences of the complementary strand DNA, 172 sequences identical to the second unique barcode region sequences were found in the first barcode sequence library, and almost all (>99%) of the first barcode nucleic acid sequences belonged to the first barcode nucleic acid B ( Figure 18 , Figure 2).

[0286] Figure 19

[0287] For cell phenotype screening of the test substance in which cells, a test substance, and a first barcode nucleic acid corresponding to the test substance are enclosed in a compartment (droplet) and contacted in the compartment (droplet), the following method, for example, can be used.

[0288] 7-1

[0289] The first subcompartment of the enclosed test substance and the first barcode nucleic acid corresponding to the test substance can be generated according to the following method described in Anal.Chem.2018,90,16,9813-9820. Specifically, Opti-MEM medium without FBS is used, and the test substance is dissolved in an aqueous phase. Next, in a well or tube, the aqueous phase, hydrogel particles pre-produced using a microfluidic device or the like (e.g., gel beads with a concentration of 1.1 wt% agarose, with a diameter of about 70 μm), the first barcode nucleic acid corresponding to the test substance, the anchor CMO, and the co-anchor CMO are mixed. Next, droplets (as the first subcompartment) including the test substance and the first barcode nucleic acid corresponding to the test substance are obtained by adding an organic solvent and a surfactant (e.g., Triton-100) to the well and stirring and oscillating with a vortex mixer. Figure 20A to Figure 20C The micrograph in Figure 2 is a micrograph of the first subcompartment produced without the addition of a test substance and the first barcode nucleic acid. However, droplets with a diameter of approximately 70 μm can be similarly produced by including a test substance and the first barcode nucleic acid corresponding to the test substance in the droplets. This treatment associates the test substance with the first barcode nucleic acid in the first subcompartment.

[0290] For example, as the organic solvent here, EvaGreen droplet generator oil (manufactured by BioRad Laboratories, Inc.) can be used. The droplet generator oil used for EvaGreen has oxygen permeability and is suitable for culturing cells in droplets. In fact, as a result, when cells were cultured in droplets generated from this organic solvent and FBS-free Opti-MEM medium for 24 hours, the survival rate of cells (THP1 cells) was 88%.

[0291] 7-2

[0292] Next, cells (THP1 cells) are prepared to be suspended in Opti-MEM medium without FBS. The cell suspension is poured into the microfluidic device together with the organic solvent, and a second sub-compartment including cells is generated during passage through the microfluidic device. The flow rates of the cell suspension and the organic solvent are controlled, and the size of the second sub-compartment including cells is adjusted to about 100 pm. In addition, the first sub-compartment and the second sub-compartment are merged in the microfluidic device to generate a droplet (compartment) including the test substance, the cells, and the first barcode nucleic acid at the same time by applying a voltage of 350 V to 500 V. That is, in the microfluidic device, a set of droplets including the test substance and the first barcode nucleic acid corresponding to the test substance (first sub-compartment) is injected from one channel, and the cell suspension is injected from another channel, each together with the organic solvent, so that a droplet (compartment) enclosing the test substance, the cells, and the first barcode nucleic acid at the same time is finally generated. For example, for the generation of droplets, a flow focusing device described in E.Z. Macosko et al., Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets, Cell. 161, 1202-1214 (2015) can be used.

[0293] On the other hand, instead of using a vortex mixer with gel beads for stirring and shaking treatment, the droplet (compartment) can also be generated by pre-generating the first sub-compartment using a microfluidic device, and then merging the first sub-compartment with the second sub-compartment including cells. More specifically, according to the method described in Anal. Chem. 2018, 90, 2, 1273-1279, in the microfluidic device, a set of droplets including the test substance and the first barcode nucleic acid corresponding to the test substance (first sub-compartment) is poured from one channel, and the cell suspension together with the organic solvent is poured from another channel, so that a droplet (compartment) including the test substance, the cells, and the first barcode nucleic acid at the same time can be generated. For example, as a result of sequentially performing one-to-one droplet fusion between a set of droplets including the first barcode nucleic acid (first sub-compartment, size of about 70 pm in diameter) and the second sub-compartment including cells (size of about 100 pm in diameter) in the microfluidic device, as shown in the micrograph in FIG. 11, it is confirmed that uniform droplets (compartments) (about 110 pm in diameter) are stably generated. Figure 21

[0294] 7-3

[0295] ​In the droplet (compartment) of the above-mentioned organic solvent phase, the cells are affected by the test substance, so that the first barcode nucleic acid corresponding to the test substance is attached to the cell surface and at the same time the cell is labeled with the first barcode nucleic acid becomes possible.

[0296] 7-4

[0297] Next, the cells can be recovered from the compartment (droplet) by the following procedure. Using a microchip or the like, 100 pL of the droplet (comprising the compartment of the cells affected by the test substance and labeled with the first barcode nucleic acid) is collected and transferred to a microtube containing 500 pL of a fluorinated solvent (e.g., hydrofluoroether (HFE), Novec (trademark) 7200 High Performance Liquid (manufactured by 3M Japan)) in the lower layer. To break the droplet, 300 pL of another organic solvent (e.g., perfluoro-n-octanol) is added to the mixture, and the microtube is shaken vigorously for 10 seconds, and then left to stand. Thus, the mixture is divided into two layers of an aqueous phase comprising the cells labeled with the first barcode nucleic acid and an organic solvent phase, and the cells labeled with the first barcode nucleic acid can be recovered from the aqueous phase and prepared into a cell mixture.

[0298] When recovering the cells from the compartment (droplet), in addition to the method using the organic solvent, it is also possible to use an anti-static gun (e.g., Zerostat 3) to break the droplet. Using a microchip or the like, 100 pL of the droplet (comprising the compartment of the cells affected by the test substance and labeled with the first barcode nucleic acid A) is collected and transferred to a microtube containing 100 pL of a fluorinated solvent (e.g., hydrofluoroether (HFE), Novec (trademark) 7200 High Performance Liquid (manufactured by 3M Japan)) in the lower layer. The droplet can be broken by pulling the trigger of the anti-static gun back to the microtube about 10 times. The cells labeled with the first barcode nucleic acid A are recovered from the aqueous phase to prepare a cell mixture. For example, the method of breaking the droplet using an anti-static gun can be performed according to the method described in, for example, Biomicrofluidics. 22(4): 044107, 2017.

[0299] 7-5

[0300] Next, using an imaging cell sorter, the cells are sorted and recovered from the cell mixture based on the observed cell image phenotype in response to the addition of the test substance (e.g., nuclear localization of proteins in response to stimulation or drug treatment). Specifically, the method of sorting the cells in which the cell image phenotype has changed using an imaging cell sorter can be performed by, for example, the same method as in Example 4.

[0301] 7-6

[0302] Next, the same as in Example 6, single cell analysis was performed on the cell mixture sorted and recovered by the imaging cell sorter, and information of the test substance was associated with the cell phenotype information of the cells sorted and recovered by the imaging cell sorter. When reading the DNA barcode modifying each cell and the genetic information derived from the cell, Chromium Controller instrument and Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics, which is a single cell analysis technology using a droplet technique, can be used as described in Example 5. In addition, the same kit can also be used to read the gene expression information of the recovered cells.

[0303] Figure 22

[0304] According to ​ the schematic diagram shown in FIG. 1, the test target that causes the desired phenotype change was searched for (in the example of FIG. 1, the test substance inhibits the nuclear localization of NF-κB induced by LPS). ​

[0305] Specifically, in each well of a 96-well microplate, the first barcode nucleic acid was attached to the cells (THP1 cells) in the method described in Reference Example 1, and then brought into contact with the test substance. At this time, in each well, different types and concentrations of test substances and different types of first barcode nucleic acids were used. Thus, 96 test targets (24 test substances x 4 concentrations) were associated with 96 first barcode nucleic acids attached to the cells (THP1 cells).

[0306] The 96 test targets (24 test substances x 4 concentrations) used in this experiment and the functions (known mechanisms of action) of the test substances are shown in Table 1. ​ In addition, ​ The sequence of the first barcode nucleic acid (barcode #) used in this experiment is shown in Table 2. The sequence of each first barcode nucleic acid used is independently different for each test target, and the first barcode nucleic acid is associated with the test target.

[0307] In this test, the test was performed by bringing each test substance, the first barcode nucleic acid corresponding to the test substance, and the cells into contact in each well of a 96-well microplate.

[0308] Next, using the imaging cell sorter, cells were sorted and recovered from the cell mixture based on the cell image phenotype observed in response to the addition of the test substance (nuclear localization of NF-κB protein in the presence or absence in response to LPS stimulation).

[0309] ​Next, the cell mixture sorted and recovered by the imaging cell sorter was subjected to single cell analysis in the same manner as in the above-described examples. Specifically, when reading the DNA barcode modified for each cell and the genetic information derived from the cell, the Chromium Controller instrument and Single Cell 3' Reagent Kit v3 manufactured by 10x Genomics, which is a single cell analysis technology using a droplet technique, were used, as described in Example 5 and Example 6.

[0310] ​ The enrichment level of the first barcode nucleic acid sequence of the sorted cells is shown in the middle. Here, a value of the vertical axis exceeding 1 means that the sample is more concentrated than the sample before sorting.

[0311] The positive control (LPS(-): no nuclear localization of NF-κB) was enriched by about 20 times by image sorting.

[0312] The cell group using a known NF-κB nuclear localization inhibitor (TAK242: 30 μM) as a test substance was enriched by about 1.5 times by image sorting.

[0313] Furthermore, among the randomly added test substances, the cell group using Costunolide as a test substance was significantly enriched (Costunolide: anti-inflammatory activity).

[0314] Furthermore, the negative control (LPS(+): nuclear localization of NF-κB) was hardly enriched in the sorted sample.

[0315] ​is a photograph in which it is confirmed whether or not the cells sorted and recovered by the imaging cell sorter actually exhibit the phenotype. The photographic image of the cells is captured by the imaging flow cytometry, and the nuclear localization score is also calculated by the imaging flow cytometry. Regarding the nuclear localization score, the higher the value, the higher the degree of nuclear localization. A is the cells corresponding to the positive control (LPS(-): no nuclear localization of NF-κB), B is the cells treated with LPS and a known NF-κB nuclear localization inhibitor (TAK242: 30 μM) as the test substance, C is the cells treated with LPS and costunolide, which is a test substance selected as a candidate by the cell phenotype screening, and D is the cells corresponding to the negative control (LPS(+): nuclear localization of NF-κB). The nuclear localization scores of the cells corresponding to the positive control (LPS(-): no nuclear localization of NF-κB), the cells treated with LPS and a known NF-κB nuclear localization inhibitor (TAK242: 30 μM) as the test substance, the cells treated with LPS and costunolide, which is a test substance selected as a candidate by the cell phenotype screening, and the cells corresponding to the negative control D (LPS(+): nuclear localization of NF-κB) are 1.58, 0.92, 0.23, and 0.30, respectively.

[0316] As described above, according to the present disclosure, using the imaging cell sorter, it is possible to perform the cell phenotype screening of the test target by sorting the cells to which the nucleic acid barcodes corresponding to each test substance are attached based on the cell image phenotype observed according to the test target; reading the attached barcode nucleic acid sequences; and further reading the genes of each cell.

[0317] [LIST OF REFERENCE NUMERALS]

[0318] 1: light source

[0319] 3: light irradiation region

[0320] 5: observation object

[0321] 7: light receiving unit

[0322] 9: storage unit

[0323] 11: analysis unit

[0324] 13: optical system control unit

[0325] 25: light receiving region

[0326] 27: light receiving system control unit SEQUENCE LIST <110> National University Corporation University of Tokyo Shin Nippon Rika Co., Ltd. National Institute for Research and Development of RIKEN <120> Novel cell phenotyping screening method <130> 235447PX <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid in linker <400> 1 gtaacgatgg agctgtcact tggaattctc gggtgccaag g 41 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid in linker <400> 2 agtgacagct ggatcgttac 20 <210> 3 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> First barcode nucleic acid A <400> 3 ccttggcacc cgagaattcc accacaatga aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 59 <210> 4 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> First barcode nucleic acid B <400> 4 ccttggcacc cgagaattcc atgagaccta aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 59 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 5 cttggcaccc gagaattcc 19 <210> 6 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 6 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <210> 7 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 7 caagcagaag acggcatacg agatattggc gtgactggag ttccttggca cccgagaatt 60 cca 63 <210> 8 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 8 caagcagaag acggcatacg agattacaag gtgactggag ttccttggca cccgagaatt 60 cca 63

Claims

1. A method for screening a test target, the method comprising: a step of preparing a plurality of cells labeled with a first barcode nucleic acid corresponding to a test target and treated with the test target; a step of sorting the plurality of cells based on a cell phenotype using an imaging cytometer; and a step of identifying the test target used to treat each cell using the first barcode nucleic acid as an indicator, wherein the first barcode nucleic acid comprises an anchor capable of attaching the first barcode nucleic acid to a cell surface.

2. The method according to claim 1, wherein the test target used to treat each cell causes a change in phenotype of each cell.

3. The method according to claim 1 or 2, further comprising: a step of analyzing a genome-related nucleic acid of each cell, wherein the genome-related nucleic acid is a cell genomic DNA or an RNA or a cDNA thereof derived from the cell genome.

4. The method according to claim 1 or 2, wherein the step of preparing a cell comprises a step of attaching the first barcode nucleic acid to the cell by mixing a liquid medium comprising the test target and the first barcode nucleic acid with the cell.

5. The method according to claim 1 or 2, wherein the step of preparing a cell comprises a step of corresponding the first barcode nucleic acid to the test target by adding a hydrogel bead to a liquid medium comprising the test target and the first barcode nucleic acid to generate a first sub-compartment comprising the test target and the first barcode nucleic acid.

6. The method according to claim 1 or 2, wherein the step of sorting comprises a step of sorting a cell that has a predetermined response to the test target based on a cell phenotype.

7. The method according to claim 3, wherein the step of analyzing the genome-related nucleic acid comprises: a step of preparing a plurality of compartments comprising a genome-related nucleic acid corresponding to a cell genome of the each cell, the first barcode nucleic acid, and a second barcode nucleic acid attachment bead, wherein the second barcode nucleic acid attachment bead comprises a plurality of second barcode nucleic acids capable of hybridizing to the genome-related nucleic acid corresponding to the cell genome or the first barcode nucleic acid; a step of obtaining a hybridized complex by hybridizing each of the genome-related nucleic acid and the first barcode nucleic acid to the second barcode nucleic acid; a step of generating an amplification product derived from the hybridized complex; and a step of detecting the genome-related nucleic acid of the cell using an expression pattern of the amplification product as an indicator after the cell coexists with the test target.

8. The method according to claim 7, wherein, each first barcode nucleic acid comprises a first universal barcode region common to the same test target and a first hybridization region capable of hybridizing to the second barcode nucleic acid.

9. The method according to claim 8, wherein, sequence information of the first universal barcode region is an indicator for determining the test target.

10. The method according to claim 8, wherein Each of the plurality of second barcode nucleic acids attached to the bead attached to the second barcode nucleic acid comprises: a second universal barcode region common to each other, a second unique barcode region capable of being distinguished from each other, and a second hybridization region capable of hybridizing with the genome-related nucleic acid or the first barcode nucleic acid.

11. The method according to claim 10, wherein, The sequence information of the second unique barcode region is an index for determining the genome-related nucleic acid.

12. The method according to claim 10, wherein The second hybridization region comprises a nucleic acid complementary to the first hybridization region or the genome-related nucleic acid.

13. The method according to claim 1 or 2, wherein The imaging cell sorter is an analysis device provided with A light modulation unit having a plurality of regions with different optical characteristics from each other is arranged on an optical path between a light source and a light irradiation region irradiated with light from the light source, An analysis unit in which scattered light, transmitted light, fluorescent light, or electromagnetic waves from an observation object present in the light irradiation region are received by a light receiving unit and converted into an electric signal, and the observation object is analyzed based on a signal extracted in time series from the electric signal output from the light receiving unit, and A sorting unit that classifies and sorts the observation object based on the analysis result of the analysis unit.

14. The method according to claim 1 or 2, wherein The test target is at least one test substance selected from the group consisting of a peptide compound, a nucleic acid compound having a nucleic acid as a basic framework, a cell, and a virus.

15. The method according to claim 1 or 2, wherein The test target is at least one test substance selected from a polypeptide.

Citation Information

Patent Citations

  • Heating safety device of contact heating type roller fixing device

    JP1979041142A

  • Remote controlled universal head

    JP1980040359A

  • Analysis device

    WO2017073737A1

  • Learning result output apparatus and learning result output program

    WO2018181458A1

  • Imaging flow cytometer

    WO2018199080A1