Primer probe combination for rapid detection of five kinds of virulent pathogenic bacteria based on droplet digital PCR and application method thereof
By designing specific primer-probe combinations and optimizing molar ratios, the problem that droplet digital PCR technology cannot simultaneously detect multiple highly pathogenic bacteria has been solved, achieving high sensitivity and high efficiency in multiplex detection, especially rapid detection of Yersinia pestis, anthrax, Brucella, melioidosis, and Tularemia.
Patent Information
- Application Number
- CN202210408797.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-19
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2042-04-19
AI Technical Summary
Existing droplet digital PCR technology has difficulty in simultaneously and rapidly detecting multiple highly pathogenic bacteria, especially plague bacteria, anthrax bacteria, brucellosis bacteria, melioidosis bacteria, and tularemia bacteria, mainly because most instruments have dual fluorescence channels and cannot detect three or more targets at the same time.
A primer-probe combo was designed, comprising five primer pairs and six probes. A combination of dual fluorescently labeled probes and single-color fluorescently labeled probes was used for detection. The Bio-Rad QX200 Droplet Reader digital PCR system was employed to ensure that no cross-reaction occurred between the primer pairs. Multiplex detection was achieved by optimizing the molar ratio and concentration.
It achieves highly sensitive and rapid detection of five highly pathogenic bacteria, reduces sample volume, shortens detection time, improves detection efficiency, and can clearly distinguish each target on a two-dimensional scatter plot, avoiding cross-reaction.
Smart Images

Figure BDA0003603247770000061 
Figure BDA0003603247770000071 
Figure BDA0003603247770000111
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of microorganism detection, and particularly relates to a primer probe combination for rapid detection of five kinds of virulent pathogenic bacteria based on droplet digital PCR and an application method thereof. BACKGROUND
[0002] In recent years, events related to Yersinia pestis (hereinafter referred to as "plague bacteria"), Bacillus anthracis (hereinafter referred to as "anthrax bacteria"), Brucella spp., Burkholderia pseudomallei (hereinafter referred to as "mallein bacteria") and Francisella tularensis (hereinafter referred to as "tularensis") and other highly pathogenic virulent pathogens occur and are reported from time to time, which has caused great threat to public health and social stability. On the other hand, these virulent pathogens are internationally recognized as classic biological warfare agents and biological terror agents, and have the potential threat of causing major biological safety incidents. Rapid and accurate detection of pathogens in samples is an important step in the diagnosis and treatment of infectious diseases and the response to biological safety incidents. At present, the rapid detection method applied to virulent pathogens is mainly fluorescence quantitative PCR based on nucleic acid detection. Although this method can detect pathogens more sensitively and quickly, there are still some deficiencies in multi-target detection, sample tolerance and trace detection. Droplet digital PCR (Droplet digital PCR, ddPCR) is a new generation of nucleic acid detection technology. Compared with traditional fluorescence quantitative PCR, digital PCR shows higher detection sensitivity, better sample tolerance, and can accurately quantify the number of target genes, and has been successfully applied to tumor gene detection and genetic disease diagnosis. However, there is still no ddPCR multi-reagent for rapid detection of pathogenic microorganisms, especially plague bacteria, anthrax bacteria, Brucella, mallein bacteria and tularensis. One of the main reasons is that most of the current ddPCR instruments are double-fluorescence channels, which can only detect two different targets at the same time, and the multi-detection capability is limited when three or more bacterial targets need to be detected.
[0003] Therefore, it is of great significance to provide a primer probe combination for rapid detection of five kinds of virulent pathogenic bacteria, i.e. plague bacteria, anthrax bacteria, Brucella, mallein bacteria and tularensis based on droplet digital PCR and an application method thereof. SUMMARY
[0004] The technical problem solved by the present application is how to simultaneously and rapidly detect five kinds of virulent pathogenic bacteria, i.e., Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia mallei and Francisella tularensis, by using double fluorescence channel digital PCR.
[0005] To solve the above technical problem, the present application first provides a composition for detecting or assisting in detecting pathogenic bacteria based on droplet digital PCR, which can be composed of a multiplex PCR primer pair and a probe composition.
[0006] The multiplex PCR primer pair and the probe composition can be composed of five primer pairs and six probes. The 5' end of the nucleotide sequence of each probe of the six probes is labeled with a fluorescent group, and the 3' end of the probe sequence is labeled with a (fluorescent) quencher group.
[0007] The above pathogenic bacteria can be Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia mallei and Francisella tularensis. The five primer pairs can specifically bind to the genomes of the five pathogenic bacteria, respectively. One of the five primer pairs can specifically bind to the genome of one of the five pathogenic bacteria. Two of the six probes can specifically bind to one of the five pathogenic bacteria. The names of the two probes can be probe A-T1 and probe A-T2. The remaining four of the six probes can specifically bind to the genomes of the remaining four of the five pathogenic bacteria, respectively. One of the remaining four probes can specifically bind to the genome of one of the remaining four pathogenic bacteria. The 5' end of the probe A-T1 and the probe A-T2 is labeled with different fluorescent groups.
[0008] In the above composition, the six probes can all be double-labeled probes: the 5' end of the probe can be labeled with a fluorescent group, which can be FAM, HEX, TET, JOE, CY3 or CY5. The 3' end of the probe can be labeled with a (fluorescent) quencher group, which can be TAMARA, MGB, BHQ-1, BHQ-2 or BHQ-3.
[0009] The probe A-T1 and the probe A-T2 of the six probes can be detection probes for Bacillus anthracis. The remaining four probes can be detection probes for Yersinia pestis, Brucella, Burkholderia mallei and Francisella tularensis, respectively.
[0010] The 5' end of the detection probe of the Yersinia pestis and the detection probe of the Burkholderia pseudomallei can be modified with a fluorescent group FAM group, and the 3' end can be modified with a quenching group BHQ-1. The 5' end of the detection probe of the Brucella and the detection probe of the Francisella tularensis can be modified with a fluorescent group HEX group, and the 3' end can be modified with a quenching group BHQ-1. The 3' end of the probe A-T1 and the probe A-T2 can be modified with a quenching group BHQ-1. One of the detection probes of the probe A-T1 and the probe A-T2 can be modified with a fluorescent group FAM group at the 5' end, and the other detection probe can be modified with a fluorescent group HEX group at the 5' end.
[0011] In the above composition, the molar ratio of the probe A-T1 and the probe A-T2 can be 1-1.5:1.5-1. Specifically, the molar ratio of the probe A-T1 and the probe A-T2 can be 1:1.
[0012] In the above composition, the five pairs of primers can be primer pair A, primer pair B, primer pair C, primer pair D, and primer pair E, respectively. The six probes can be the probe A-T1 and A-T2, the probe B-T, the probe C-T, the probe D-T, and the probe E-T, respectively. The primer pair A and the probe A-T1 and A-T2 can be used to detect Bacillus anthracis; the primer pair B and the probe B-T can be used to detect Burkholderia pseudomallei. The primer pair C and the probe C-T can be used to detect Yersinia pestis. The primer pair D and the probe D-T can be used to detect Brucella. The primer pair E and the probe E-T can be used to detect Francisella tularensis.
[0013] The primer pair A can be a primer pair consisting of a single-stranded DNA represented by sequence 1 and a single-stranded DNA represented by sequence 2 in the sequence listing. The primer pair B can be a primer pair consisting of a single-stranded DNA represented by sequence 3 and a single-stranded DNA represented by sequence 4 in the sequence listing. The primer pair C can be a primer pair consisting of a single-stranded DNA represented by sequence 5 and a single-stranded DNA represented by sequence 6 in the sequence listing. The primer pair D can be a primer pair consisting of a single-stranded DNA represented by sequence 7 and a single-stranded DNA represented by sequence 8 in the sequence listing. The primer pair E can be a primer pair consisting of a single-stranded DNA represented by sequence 9 and a single-stranded DNA represented by sequence 10 in the sequence listing.
[0014] The nucleotide sequence of the probe A-T1 can be sequence 11 in the sequence listing. The nucleotide sequence of the probe A-T2 can be sequence 12 in the sequence listing. The nucleotide sequence of the probe B-T can be sequence 13 in the sequence listing. The nucleotide sequence of the probe C-T can be sequence 14 in the sequence listing. The nucleotide sequence of the probe D-T can be sequence 15 in the sequence listing. The nucleotide sequence of the probe E-T can be sequence 16 in the sequence listing.
[0015] The molar ratio of the primer pair A, the primer pair B, the primer pair C, the primer pair D and the primer pair E in the composition can be 1:1:1:1:1. The molar ratio of the probe A-T1, the probe A-T2, the probe B-T, the probe C-T, the probe D-T and the probe E-T can be 1-1.5:1.5-1:1:2:2:3, and specifically can be 1:1:1:2:2:3.
[0016] The 1st nucleotide of the sequence 11 can modify a FAM fluorescent group, and the 28th nucleotide can modify a BHQ-1 quenching group. The 1st nucleotide of the sequence 12 modifies a HEX fluorescent group, and the 28th nucleotide modifies a BHQ-1 quenching group. The 1st nucleotide of the sequence 13 can modify a FAM fluorescent group, and the 21st nucleotide modifies a BHQ-1 quenching group. The 1st nucleotide of the sequence 14 can modify a FAM fluorescent group, and the 22nd nucleotide can modify a BHQ-1 quenching group. The 1st nucleotide of the sequence 15 modifies a HEX fluorescent group, and the 24th nucleotide can modify a BHQ-1 quenching group. The 1st nucleotide of the sequence 16 can modify a HEX fluorescent group, and the 24th nucleotide can modify a BHQ-1 quenching group.
[0017] To solve the above technical problems, the present application further provides a reagent and / or a kit for identifying or assisting in identifying pathogenic bacteria. The reagent and / or the kit can contain the composition described above.
[0018] The pathogenic bacteria can be Bacillus anthracis, Burkholderia pseudomallei, Yersinia pestis, Brucella and / or Francisella tularensis.
[0019] In the reagent and / or the kit, the working concentration of the primer pair can be 700-1100 nM. Specifically, the working concentration of the primer pair can be 900 nM.
[0020] In the reagent and / or the kit, the working concentration of the probe can be as follows: the working concentration of the probe for detecting the anthrax bacteria can be 400-900 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the melioidosis bacteria can be 200-300 nM, and specifically can be 250 nM. The working concentration of the probe for detecting the plague bacteria can be 400-600 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the Brucella bacteria can be 400-600 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the tularensis bacteria can be 600-900 nM, and specifically can be 750 nM.
[0021] To solve the above technical problems, the present application further provides a system for identifying or assisting in identifying pathogenic bacteria. The system can contain the reagent and / or the kit described above.
[0022] The system can also comprise a digital PCR system. The digital PCR system can be a digital PCR system with a number of fluorescence channels equal to or greater than 2. The digital PCR system can be a Bio-Rad QX200 Droplet Reader digital PCR system.
[0023] To solve the above technical problems, the present application also provides a method for detecting or assisting in detecting pathogenic bacteria. The method can comprise performing droplet digital PCR on a sample to be tested using the composition described above, or the reagent or kit described above, or the system described above, and determining or assisting in determining whether the sample to be tested is the pathogenic bacteria, or contains the pathogenic bacteria, or is infected with the pathogenic bacteria, which can be Bacillus anthracis, Burkholderia pseudomallei, Yersinia pestis, Brucella and / or Francisella tularensis.
[0024] In the above method, the molar ratio of the primer pair A, the primer pair B, the primer pair C, the primer pair D and the primer pair E in the PCR system used in the droplet digital PCR can be 1:1:1:1:1. The molar ratio of the probe A-T1, the probe A-T2, the probe B-T, the probe C-T, the probe D-T and the probe E-T can be 1-1.5:1.5-1:1:2:2:3, and specifically can be 1:1:1:2:2:3.
[0025] In the above method, the working concentration of the primer pair can be 700-1100 nM. The working concentration of the primer pair can be specifically 900 nM. The working concentration of the probe can be as follows: the working concentration of the probe for detecting the anthrax bacteria can be 400-900 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the melioidosis bacteria can be 200-300 nM, and specifically can be 250 nM. The working concentration of the probe for detecting the plague bacteria can be 400-600 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the Brucella bacteria can be 400-600 nM, and specifically can be 500 nM. The working concentration of the probe for detecting the tularensis bacteria can be 600-900 nM, and specifically can be 750 nM.
[0026] The use of the composition described above in the preparation of a product for detecting or assisting in detecting Bacillus anthracis, Burkholderia pseudomallei, Yersinia pestis, Brucella and / or Francisella tularensis also falls within the scope of the present application.
[0027] The application or method is a non-disease diagnosis application or method. The application or method is not directly aimed at obtaining a disease diagnosis result or health condition of a living human or animal body. The sample to be detected can be a sample from a non-living human or animal body, such as an environmental sample (such as soil), food (such as frozen food or fresh food).
[0028] The annealing temperature in the droplet digital PCR amplification described above can be 55-63℃, such as 60℃.
[0029] The amplification reaction condition adopted by the droplet digital PCR can be: 94-98℃ pre-denaturation for 8-12min, 94-95℃ denaturation for 30-40s, and 55-63℃ for 60-90s for 35-40 cycles.
[0030] Compared with the prior art, the present application has at least the following beneficial effects:
[0031] (1) The present application provides a primer probe combination capable of rapidly detecting five virulent pathogenic bacteria, i.e., Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia pseudomallei and Francisella tularensis, based on droplet digital PCR. The primer probe combination includes five pairs of primers and six corresponding probes; one target is detected using two different fluorescently labeled probes, and the other four targets are each detected using a single-color fluorescently labeled probe; the primer probe combination uses only two fluorescent labels (such as FAM and HEX) to analyze the amplification of the genes of the five different target virulent bacteria on a digital PCR two-dimensional scatter plot.
[0032] (2) The method for detecting the above five virulent pathogenic bacteria using the primer probe combination provided in the present application does not have cross-reactions between the primer pairs.
[0033] Experiments in the embodiments of the present application have shown that when the molar ratio of the primer pairs is 1:1:1:1:1 and the molar ratio of the probes is 1:1:1:2:2:3, the primer probe combination can specifically amplify and detect the five virulent pathogens, i.e., Bacillus anthracis, Burkholderia pseudomallei, Yersinia pestis, Brucella and / or Francisella tularensis, realize five-target joint detection, and does not have cross-reactions between the primer pairs, and has high detection sensitivity for each target. At the same time, five-target joint detection can effectively reduce the sample amount and shorten the detection time, thereby effectively improving the detection efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1Figure 6 is a droplet distribution chart of the five-fold ddPCR detection. (A) is a droplet distribution chart of the five-fold ddPCR detection under the optimal working concentration of the probe; (B) is a droplet distribution chart of the detection after adjusting the final concentration of the Yersinia pestis and the detection probe of the T. pallidum in the ddPCR reaction system; (C) is a droplet distribution chart of the detection after adjusting the concentration ratio of the two detection probes of the B. anthracis in the ddPCR reaction system.
[0035] Figure 2 Figure 7 is the sensitivity of the multi-fold ddPCR detection. (A) represents the ddPCR detection results of different concentrations of Yersinia pestis; (B) represents the ddPCR detection results of different concentrations of B. pseudomallei; (C) represents the ddPCR detection results of different concentrations of Brucella; (D) represents the ddPCR detection results of different concentrations of T. pallidum; (E) represents the ddPCR detection results of different concentrations of B. anthracis. The abscissa is the logarithmic value Log (CFU / mL) of the bacterial concentration, and the ordinate is the logarithmic value Log (copies / reaction) of the copy number per reaction, and LOB is the negative control (blank detection limit).
[0036] Figure 3 Figure 8 is the sensitivity of the single real-time fluorescent PCR detection. (A) represents the amplification curves of different concentrations of Yersinia pestis, (B) represents the amplification curves of different concentrations of B. pseudomallei, (C) represents the amplification curves of different concentrations of B. anthracis, (D) represents the amplification curves of different concentrations of Brucella, (E) represents the amplification curves of different concentrations of T. pallidum, and NTC represents the negative control. The abscissa is the cycle value Cycles of the fluorescent PCR, and the ordinate is the relative fluorescence intensity RFU.
[0037] Figure 4 Figure 9 is a droplet distribution chart of the specificity results of the multi-fold ddPCR detection. DETAILED DESCRIPTION
[0038] The present application will be further described in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.
[0039] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0040] Yersinia pestis and Bacillus anthracis in the embodiments of the present application are preserved in the laboratory, and the related literature is: Hua F, Zhang P, Zhang F, et. al. Development and evaluation of an up-converting phosphor technology-based lateral flow assay for rapid detection of Francisella tularensis. Sci Rep. 2015 Nov 26; 5: 17178.
[0041] Brucella spp., Burkholderia pseudomallei and Francisella tularensis are preserved in the laboratory, and the related literature is: Zhang P, Liu X, Wang C, et. al. Evaluation of up-converting phosphor technology-based lateral flow strips for rapid detection of Bacillus anthracis Spore, Brucella spp., and Yersinia pestis. PLoS One. 2014 Aug 21; 9(8): e105305. doi: 10.1371 / journal.pone.0105305.
[0042] The sources of the seven pathogenic bacteria of Yersinia pseudotuberculosis, Yersinia enterocolitica, Bacillus cereus, Staphylococcus aureus, Salmonella enteritidis, Shigella dysenteriae and Escherichia coli in the embodiments of the present application are as follows:
[0043] Yersinia pseudotuberculosis, Yersinia enterocolitica, Bacillus cereus, Salmonella enteritidis and Escherichia coli O157:H7 were preserved in our laboratory, related literature: Zhang P, Liu X, Wang C, et. al. Evaluation of up-converting phosphor technology-based lateral flow strips for rapid detection of Bacillus anthracis Spore, Brucella spp., and Yersinia pestis. PLoS One. 2014 Aug 21;9(8):e105305. doi: 10.1371 / journal.pone.0105305.
[0044] Shigella dysenteriae was preserved in our laboratory, related literature: Hua F, Zhang P, Zhang F, et. al. Development and evaluation of an up-converting phosphor technology-based lateral flow assay for rapid detection of Francisella tularensis. Sci Rep. 2015 Nov 26;5: 17178.
[0045] Staphylococcus aureus was preserved in the laboratory. Related literature: Zhao Y, Li Y, Zhang P, et.al. Cell-based fluorescent microsphere incorporated with carbon dots as a sensitive immunosensor for the rapid detection of Escherichia coli O157 in milk. Biosens Bioelectron. 2021 May 1; 179: 113057. doi: 10.1016 / j.bios.2021.113057. Epub 2021 Feb 2.
[0046] Example 1, Establishment of a method for rapid detection of five virulent pathogens based on droplet digital PCR
[0047] 1.1 Primer design and probe synthesis
[0048] According to literature retrieval, the amplification primer pairs and detection probes of the chromosomal specific genes of the three pathogens Yersinia pestis, Bacillus anthracis and Burkholderia mallei were obtained; for Brucella and B. pseudomallei, the corresponding amplification primer pairs and detection probes were designed according to their chromosomal specific genes by PrimerExpress 3.0 software, as shown in Table 1.
[0049] Table 1. Primer and probe sequences for detecting five virulent pathogens
[0050]
[0051]
[0052] The primers and probes used were synthesized by Shanghai Shengong Biotechnology Co., Ltd., in which the primers were PAGE purified and the probes were HPLC purified. The fluorescent probes used were double-labeled probes: 5' end labeled with a fluorescent group; 3' end labeled with a quencher group.
[0053] One of the five pathogens was detected by two different fluorescently labeled probes, and the other four pathogens were detected by one single-color fluorescently labeled probe. Among them, the anthrax bacteria were detected by two fluorescent probes, one of which was modified with a FAM fluorescent group at the 5' end, and the other was modified with a HEX fluorescent group at the 5' end, and the 3' end was modified with a BHQ-1 quencher (i.e. sequence 11 in the sequence table is modified with a FAM fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 28th nucleotide, and sequence 12 is modified with a HEX fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 28th nucleotide); The detection probes for glanders and plague bacteria were modified with a FAM fluorescent group at the 5' end, and a BHQ-1 quencher at the 3' end (i.e. sequence 13 is modified with a FAM fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 21st nucleotide, and sequence 14 in the sequence table is modified with a FAM fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 22nd nucleotide); The detection probes for Brucella and Clostridium tetani were modified with a HEX fluorescent group at the 5' end, and a BHQ-1 quencher at the 3' end (i.e. sequence 15 in the sequence table is modified with a HEX fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 24th nucleotide, and sequence 16 is modified with a HEX fluorescent group at the 1st nucleotide, and a BHQ-1 quencher at the 24th nucleotide).
[0054] 1.2 Preparation of bacterial genome template
[0055] After inactivating the bacterial cultures of the overnight cultures of the five strains of plague bacteria, anthrax bacteria, Brucella bacteria, glanders bacteria and Clostridium tetani bacteria, DNA was extracted using QIAamp DNA Mini Kit (Qiagen 51304), and finally 100 μL TE buffer was used for elution to obtain the DNA of the five bacteria.
[0056] 1.3 Preparation of ddPCR reaction system
[0057] The total volume of the ddPCR reaction system is 20 μL, of which 2 μL is the DNA of the sample to be detected, and the insufficient volume is supplemented with ultrapure water. The specific reaction system and component concentration are shown in Table 2:
[0058] Table 2. Main components of ddPCR reaction system
[0059] ddPCR components Final concentration (20 μL) ddPCR Supermix for Probes (No dUTP) (Bio-Rad) 2× Five pairs of target amplification primers 900 nM (each primer) Y. pestis probe (5' FAM, 3' BHQ-1) 500 nM B. pseudomallei probe (5' FAM, 3' BHQ-1) 250 nM C. anthracis probe-1 (5' FAM, 3' BHQ-1) 250 nM C. anthracis probe-2 (5' HEX, 3' BHQ-1) 250 nM B. abortus probe (5' HEX, 3' BHQ-1) 500 nM F. tularensis probe (5' HEX, 3' BHQ-1) 750 nM
[0060] 1.4 Droplet generation
[0061] Mix well the prepared ddPCR reaction system of step 1.3, then add it into the sample well of droplet generator (Bio-Rad QX200 Droplet), and add 70 μL droplet generation oil into the oil well, cover the gasket, and put it into the droplet generator to prepare the droplet;
[0062] 1.5 PCR amplification
[0063] Transfer 40 μL droplet into a 96-well PCR plate, and after sealing the film, perform multiple ddPCR amplification in Bio-Rad T100 PCR instrument, and the PCR reaction conditions are as follows: 95℃ pre-denaturation for 10 min, 95℃ for 30 sec, 60℃ for 1 min, 40 cycles;
[0064] 1.6 Result interpretation
[0065] After amplification, transfer the PCR reaction plate to Bio-Rad QX200 Droplet Reader, and perform droplet counting and fluorescence signal detection according to the instrument and software operation instructions; at the same time, use QuantaSoft Analysis Pro version 1.0.596 software to classify and count the droplets; finally, use the two-dimensional scatter plot to locate and divide the droplet clusters generated by the detection of the five target bacteria, as shown in Figure 1 (A), the detection results of the five target bacteria can be well distinguished and will not affect each other.
[0066] Example 2, adjustment of detection probe final concentration of Yersinia pestis and Francisella tularensis in ddPCR reaction system
[0067] Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia mallei and Francisella tularensis were detected by the rapid detection method based on droplet digital PCR established in Example 1, wherein the difference from Example 1 is that in this example, the detection probe final concentration of Yersinia pestis in the ddPCR reaction system is adjusted from 500 nM to 350 nM, and the detection probe final concentration of Francisella tularensis is adjusted from 750 nM to 600 nM, and the remaining steps are consistent with Example 1.
[0068] The obtained two-dimensional scatter plot results are shown in Figure 1 (B), the droplet clusters of Burkholderia mallei and Yersinia pestis are difficult to distinguish, and the droplet clusters of Francisella tularensis and Brucella are also difficult to distinguish.
[0069] Therefore, after adjusting the detection probe final concentration of Yersinia pestis and Francisella tularensis in the ddPCR reaction system, the rapid detection method based on droplet digital PCR established in Example 1 will not be able to clearly identify Yersinia pestis, Brucella, Burkholderia mallei and Francisella tularensis.
[0070] Example 3: Adjustment and detection of the final concentration of anthrax detection probe in ddPCR reaction system
[0071] The rapid detection method based on droplet digital PCR established in Example 1 was used to detect five highly pathogenic bacteria: Yersinia pestis, anthrax, Brucella, melioidosis, and Tularemia. The difference from Example 1 is that the concentrations of the two detection probes for anthrax were adjusted as follows: Anthrax probe-1 (5'FAM, 3'BHQ-1) was adjusted from 250 nM to 150 nM, and anthrax probe-2 (5'HEX, 3'BHQ-1) was adjusted from 250 nM to 350 nM. That is, the concentration ratio of the two probes in the ddPCR reaction system was adjusted from 1:1 to 3:7, but the total concentration of the two probes (500 nM) remained unchanged; the remaining steps were the same as in Example 1.
[0072] The resulting two-dimensional scatter plot is as follows Figure 1 As shown in (C), after changing the working concentration ratio of the two detection probes for anthrax in the ddPCR reaction system, the anthrax and Brucella bacteria... Figure 1 The droplet clusters of Brucella in (C) could not be clearly distinguished, and the detection results could not clearly identify the two bacteria.
[0073] Example 4, Sensitivity Test
[0074] Bacterial cultures of five bacterial strains—plague, anthrax, brucellosis, melioidosis, and tularemia—that had been cultured overnight were inactivated and then serially diluted 10-fold with physiological saline to obtain 10... 1 ~10 8 Different concentrations of bacterial suspensions (CFU / mL) were prepared. 1 mL of each of the five bacterial suspensions was added to 0.25 g of soil and left at room temperature for 12 h to obtain a total of 40 simulated soil samples of the five bacteria (8 samples of each target bacterium). 1 mL of physiological saline was mixed with 0.25 g of soil and left at room temperature for 12 h as a negative control sample.
[0075] Five types of bacteria were used in simulated soil samples and negative control samples, all extracted using the soil genomic DNA extraction kit (TIANGEN). TM DNA from the target bacteria was extracted and eluted with 100 μL TE buffer. Sensitivity evaluation experiments and simulated sample tests were performed using the droplet-based digital PCR multiplex detection method described in Example 1, with a comparison and evaluation using the traditional singlet real-time fluorescence PCR method as a control.
[0076] The primers and probes used for the singleton real-time fluorescence PCR method for each target bacterium are consistent with those used for ddPCR (Table 1). The detection probes are all modified with the fluorescent FAM group at the 5' end and the BHQ-1 group at the 3' end.
[0077] The five target bacteria single real-time fluorescent PCR reaction system was 20 μL system, wherein the DNA of the sample to be detected was 2 μL, and the insufficient volume was supplemented with ultrapure water, and the specific components and concentrations were shown in Table 3:
[0078] Table 3. Preparation of single target real-time fluorescent PCR reaction system
[0079] Singleplex real-time fluorescent PCR main components Final concentration iTaq Universal Probes Supermix (Bio-Rad) 2× Amplification primers 400 nM (each primer) Detection probe 200 nM
[0080] The real-time fluorescent PCR experiment was performed on a Bio-Rad CFX Opus 96 real-time fluorescent instrument, and FAM fluorescent signal channel detection was used. The reaction condition was 95°C initial denaturation for 5 min, 95°C denaturation for 10 s, 60°C annealing (fluorescence collection) for 40 cycles.
[0081] The multiple ddPCR detection results are shown in Figure 2 The minimum detection concentration of Yersinia pestis, Brucella melitensis, Burkholderia pseudomallei and Francisella tularensis in the simulated soil sample detected by the multiple ddPCR detection system established in Example 1 was 10 1 CFU / mL Figure 2 (A)-(D)), and the minimum detection concentration of Bacillus anthracis was 10 3 CFU / mL Figure 2 (E).
[0082] The single real-time fluorescent PCR detection results are shown in Figure 3 The minimum detection concentration of Yersinia pestis, Brucella melitensis and Bacillus anthracis was 10 4 CFU / mL Figure 3 (A)-(C)), and the minimum detection concentration of Brucella melitensis and Francisella tularensis was 10 3 CFU / mL Figure 3 (D) and (E).
[0083] Overall, the minimum detection concentration of the multiple ddPCR reaction of the five target bacteria established in Example 1 was 10-1000 times lower than that of the single real-time fluorescent PCR, which indicated that the multiple ddPCR detection system established in the application had obvious detection sensitivity advantage compared with the traditional real-time fluorescent PCR method.
[0084] Example 5, specificity test
[0085] The five virulent pathogens Yersinia pestis, Bacillus anthracis, Brucella melitensis, Burkholderia mallei and Francisella tularensis were detected by the rapid detection method based on droplet digital PCR established in Example 1. The difference between this example and Example 1 is that, in this example, seven common pathogenic bacteria (including Yersinia pseudotuberculosis, Yersinia enterocolitica, Bacillus cereus, Staphylococcus aureus, Salmonella enterica, Shigella dysenteriae and Escherichia coli) other than the five target bacteria were selected for specific experimental detection. The specific steps are as follows: after the twelve pathogenic bacteria were cultured overnight and inactivated, the DNA of the twelve pathogenic bacteria was extracted by QIAamp DNA Mini Kit (Qiagen 51304), and finally eluted with 100 μL TE buffer, and the DNA concentration was determined by Nanodrop instrument. The obtained DNA was used as the template of the ddPCR reaction system, and the multiplex ddPCR system of Table 2 in Example 1 was used to evaluate the specificity of the ddPCR system.
[0086] The obtained two-dimensional scatter plot results are shown in Figure 4 The droplet clusters produced by Yersinia pseudotuberculosis, Yersinia enterocolitica, Bacillus cereus, Staphylococcus aureus, Salmonella enterica, Shigella dysenteriae and Escherichia coli cannot be distinguished from the negative droplet control cluster, and it is determined that the droplet clusters produced by the seven bacteria are ddPCR negative. Therefore, the rapid detection method based on droplet digital PCR established in Example 1 has good specificity for the detection of Yersinia pestis, Bacillus anthracis, Brucella melitensis, Burkholderia mallei and Francisella tularensis.
[0087] Example 6, soil sample simulation test
[0088] After the bacterial cultures of the five strains of Yersinia pestis, Bacillus anthracis, Brucella melitensis, Burkholderia mallei and Francisella tularensis cultured overnight were inactivated, 15 bacterial liquid samples were prepared. Specifically, two target bacterial liquids were randomly selected and mixed to prepare three double-target mixed bacterial liquid samples; three target bacterial liquids were randomly selected and mixed to prepare two triple-target mixed bacterial liquid samples; single target bacterial liquid samples 5 (1 for each target bacteria); negative control samples (normal saline) 5. A total of 15 samples to be detected, except for the negative control sample, the final concentration of each bacteria was 10 3 CFU / mL.
[0089] Take 1 mL of sample liquid into 0.25 g of soil, and place it at room temperature for 12 h to obtain 15 simulated soil samples. The soil genomic DNA extraction kit (TIANGEN TM ) was used to extract the DNA of the target bacteria, and eluted with 100 μL TE buffer. The soil simulation sample test was carried out using the droplet digital PCR multiplex detection method in Example 1.
[0090] The results are shown in Table 4. The droplet digital PCR multiplex detection method established in Example 1 can accurately detect 10 positive simulated samples (10 / 10, 100%) in 15 simulated soil samples; and the method can also accurately detect 3 double-target mixed bacterial liquid samples and 2 three-target mixed bacterial liquid samples. Therefore, the droplet digital PCR multiplex detection method established in Example 1 can be used for simultaneous screening of five virulent pathogens, i.e., Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia pseudomallei and Shigella dysenteriae in soil samples.
[0091] Table 4. Detection results of 15 simulated soil samples by digital PCR multiplex detection system (copy number / reaction)
[0092]
[0093] Note: "√" indicates that the target bacteria exist in the sample design, and the detection results are consistent with the actual situation.
[0094] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims. SEQUENCE LISTING <110> Academy of Military Medical Sciences, Chinese People's Liberation Army <120> Primer probe combination for rapid detection of five virulent pathogens based on droplet digital PCR and application method thereof Method <130> GNCSQ220044 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 gggtgtaatg tgaagtaact cgcta 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 aaaccgctgt aagaatggaa ttacg 25 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 cgatctcgtc aaggtgtcgg 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <400> 4 ttgacctgga tggcaaagaa g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 ggacggcatc acgattctct 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 cctgaaaact tggcagcagt t 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <400> 7 tcagggcggt gatttgaac 19 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <400> 8 gcgcgcctcgttgatc 16 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <400> 9 gcagggcgagcaccatt 17 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <400> 10 atcttgcatgtcaccacttga 22 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <400> 11 cgttgtaacatcggcttagagaaccaca 28 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <400> 12 cgttgtaacatcggcttagagaaccaca 28 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <400> 13 ttgcctcagtcacgcgcacg t 21 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <400> 14 ccctcgaatc gctggccaac tg 22 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <400> 15 tggtcaatga taatccctcc gccg 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <400> 16 cgatatttgc ctgttagcac tcct 24
Claims
1. A composition for detecting or assisting in the detection of pathogens based on droplet digital PCR, said composition comprising multiplex PCR primer pairs and probe composition; The multiplex PCR primer pair consists of primer pair A, primer pair B, primer pair C, primer pair D, and primer pair E; The probe composition comprises probes A-T1 and A-T2, probe BT, probe CT, probe DT, and probe ET, wherein, The probe has a fluorescent group labeled on its 5' nucleotide, and a quenching group labeled on its 3' nucleotide. The probe A-T1 and probe A-T2 have different fluorescent groups labeled on their 5' nucleotides. Primer pair A and probes A-T1 and A-T2 are used to detect Bacillus anthracis; primer pair B and probe BT are used to detect Burkholderia melioides; primer pair C and probe CT are used to detect Yersinia pestis; primer pair D and probe DT are used to detect Brucella; primer pair E and probe ET are used to detect Tulafrancsis. The concentration of each primer is 900 nM; the concentrations of probes A-T1 and A-T2 are 250 nM each; the concentration of probe BT is 250 nM; the concentration of probe CT is 500 nM; the concentration of probe DT is 500 nM; and the concentration of probe ET is 750 nM. Primer pair A is a primer pair composed of single-stranded DNA shown in sequence 1 and sequence 2 of the sequence listing; primer pair B is a primer pair composed of single-stranded DNA shown in sequence 3 and sequence 4 of the sequence listing; primer pair C is a primer pair composed of single-stranded DNA shown in sequence 5 and sequence 6 of the sequence listing; primer pair D is a primer pair composed of single-stranded DNA shown in sequence 7 and sequence 8 of the sequence listing; primer pair E is a primer pair composed of single-stranded DNA shown in sequence 9 and sequence 10 of the sequence listing. The nucleotide sequence of probe A-T1 is sequence 11 in the sequence listing; the nucleotide sequence of probe A-T2 is sequence 12 in the sequence listing; the nucleotide sequence of probe BT is sequence 13 in the sequence listing; the nucleotide sequence of probe CT is sequence 14 in the sequence listing; the nucleotide sequence of probe DT is sequence 15 in the sequence listing; and the nucleotide sequence of probe ET is sequence 16 in the sequence listing.
2. Reagents and / or kits for identifying or assisting in the identification of pathogenic bacteria, characterized in that: The reagent and / or kit contains the composition of claim 1; The pathogens are Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia melioides, and / or Tula Francisella.
3. A system for identifying or assisting in the identification of pathogenic bacteria, characterized in that: The system contains the reagents and / or kits as described in claim 2.
4. The system according to claim 3, characterized in that: The system also includes a digital PCR system.
5. A method for detecting or assisting in the detection of pathogens for purposes other than disease diagnosis and treatment, characterized in that: The method includes performing droplet digital PCR on the sample to be tested using the composition of claim 1, or the reagent or kit of claim 2, or the system of claim 3 or 4, and determining or assisting in determining whether the sample to be tested is the pathogen or whether it contains the pathogen based on the droplet digital PCR product, wherein the pathogen is Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia melioides, and / or Tula Francisella.
6. The use of the composition of claim 1 in the preparation of products for the detection or auxiliary detection of Yersinia pestis, Bacillus anthracis, Brucella, Burkholderia melioides and / or Tula Francisella.
Citation Information
Patent Citations
Genetic liquid phase chip for joint detection of five drastic pathogenic bacteria and detection method thereof
CN101560557A
Method for detecting suspension chip of multiple PCR products
CN101560558A
Primer, probe and kit for detecting brucella based on recombinase polymerase amplification method
CN108220461A