sgRNA targeting Aqp1 mRNA and its vector and application

Abstract

The present invention discloses a sgRNA for targeted disruption of Aqp1 mRNA, its vector, and its application, capable of significantly downregulating Aqp1 mRNA levels. Upon delivery to cells via the vector, the sgRNA can target and disrupt Aqp1 mRNA, reducing Aqp1 mRNA levels. These sgRNAs can be used to treat diseases where downregulating Aqp1 expression is beneficial, including but not limited to diseases associated with Aqp1 overexpression, including cancer and glaucoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, relates to an sgRNA for targeted destruction of Aqp1 mRNA, a vector thereof, and applications thereof. Background Art

[0002] Aquaporin 1 (Aqp1) is a transmembrane protein that is widely distributed throughout the body. It primarily regulates water transport in the body and also plays a crucial role in angiogenesis, cell migration, and cell growth. MeiraGTx has developed a gene therapy product, AAV-Aqp1. The Aqp1 gene is overexpressed in damaged salivary glands via an AAV vector to treat radiation-induced xerostomia (RIX). MeiraGTx is currently conducting Phase I / II clinical trials of the AAV-Aqp1 gene therapy. Aqp1 has also been found to be associated with the development of glaucoma.

[0003] Glaucoma is a neurodegenerative disease characterized by the apoptosis of retinal ganglion cells (RGCs) and the degeneration of their axons. Ganglion cell apoptosis is primarily related to intraocular pressure (IOP). IOP is primarily maintained by aqueous humor. When the ciliary body (CB), the tissue that produces aqueous humor, and the trabecular meshwork (TM), the main drainage tissue for aqueous humor, malfunction, this can lead to malfunction of the aqueous humor circulation system, ultimately causing elevated IOP, compression of RGCs, and ultimately irreversible visual field loss. Functional loss of Aqp1 reduces aqueous humor production and lowers intraocular pressure. Currently, lowering intraocular pressure remains a conventional treatment for glaucoma.

[0004] Since the visual field damage caused by glaucoma is irreversible, the main function of current glaucoma treatment drugs is to lower intraocular pressure (IOP). There are currently five main types of drugs that lower IOP: α-adrenergic agonists, β-adrenergic antagonists, cholinergic agonists, prostaglandins, and carbonic anhydrase inhibitors. They are mainly administered in the form of eye drops. Frequent administration is required and there are certain side effects. Suzhou Ruibo Biotechnology Co., Ltd. has developed an innovative siRNA (small interfering RNA) nucleic acid drug QPI-1007 for optic nerve protection, which is currently in a global pivotal clinical II / III study. The drug is designed to temporarily inhibit the expression of the pro-apoptotic protein caspase 2. It prevents the apoptosis of retinal ganglion cells (RGCs) and thereby reduces visual field damage.

[0005] Studies have found that reducing Aqp1 expression can also reduce angiogenesis and slow down tumor progression (Nico et al, Cancer Letters, 2010, 294(2):135-138).

[0006] The CRISPR / Cas (clustered regularly interspaced short palindromic repeats / CRISPR-associated proteins) system is currently the most widely used gene editing technology. As a therapeutic drug, it can significantly reduce dosing frequency and has relatively few side effects. Existing technologies have used the CRISPR / Cas system to edit the Aqp1 gene, but the editing efficiency is low. Furthermore, existing technologies target the exon region of the Aqp1 gene, cutting genomic DNA and causing mutations in the original Aqp1 gene. This method damages the gene and may lead to the production of some toxic proteins. Summary of the Invention

[0007] The present invention provides an sgRNA (single guide RNA, single-molecule gRNA) that can target and destroy human Aqp1 mRNA, as well as a vector and application thereof.

[0008] The technical solution adopted by the present invention is:

[0009] In a first aspect, the present invention provides an sgRNA, which can target and destroy human Aqp1 mRNA.

[0010] The sgRNA includes a targeting domain and a backbone domain (backbone sequence), such as Figure 1 shown.

[0011] In some embodiments, the sequence of the targeting domain of the sgRNA is selected from any one of SEQ ID NO: 1 to SEQ ID NO: 31.

[0012] Through design, the inventors also discovered some sgRNAs with significantly better effects, which can more effectively reduce Aqp1mRNA levels.

[0013] Preferably, the sequence of the targeting domain of the sgRNA is selected from any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, and SEQ ID NO: 31.

[0014] The backbone sequence of the sgRNA of the present invention can be designed in a conventional manner. The sgRNA of the present invention is sufficient to allow Cas13d nuclease (e.g., CasRx) to target Aqp1 mRNA through the targeting domain and the backbone sequence. Those skilled in the art will appreciate that by connecting the sgRNA targeting domain of the present invention to any suitable backbone sequence to form a single molecule gRNA (sgRNA), the function of targeting Cas13d nuclease (e.g., CasRx) to Aqp1 mRNA can be achieved, thereby achieving the technical effects of the present invention.

[0015] In some embodiments, the sgRNA uses a sgRNA backbone sequence that is universal for the Cas13d-sgRNA system.

[0016] Furthermore, in some embodiments, the sgRNA uses a universal sgRNA backbone sequence of the CasRx-sgRNA system. Still further, in some embodiments, the sgRNA backbone sequence is 5'-CAAGUAAACCCCUACCAACUGGUCGGGGUUUGAAAC-3' (SEQ ID NO: 32).

[0017] In some embodiments, the sgRNA is used in combination with a Cas13d nuclease or a nucleic acid molecule encoding a Cas13d nuclease. In some embodiments, the Cas13d nuclease is CasRx.

[0018] In some embodiments, the sgRNA is used in combination with a Cas13d nuclease. In some embodiments, the Cas13d nuclease is CasRx.

[0019] The sgRNA of the present invention can be subjected to appropriate chemical modification on any nucleotide.

[0020] The second aspect of the present invention provides a vector comprising a nucleotide sequence encoding the sgRNA as described in the first aspect.

[0021] Furthermore, the nucleotide sequence encoding the sgRNA is operably linked to a promoter.

[0022] In some embodiments, the vector comprises a nucleotide sequence encoding any one of the sgRNAs described in the first aspect. Further, in some embodiments, the sequence of the targeting domain of the sgRNA is selected from any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, and SEQ ID NO: 31.

[0023] In some embodiments, the vector comprises a nucleotide sequence encoding any two sgRNAs as described in the first aspect. Further, in some embodiments, the sequences of the targeting domains of the two sgRNAs are selected from any two of SEQ ID NO: 1 to SEQ ID NO: 31. Preferably, the sequences of the targeting domains of the two sgRNAs are selected from any two of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, and SEQ ID NO: 31.

[0024] In some embodiments, the vector comprises two or more nucleotide sequences encoding the sgRNA as described in the first aspect.

[0025] The above-mentioned vector can express sgRNA for targeted destruction of Aqp1 mRNA. It can be understood that those skilled in the art can construct it according to conventional techniques.

[0026] In some embodiments, the vector further comprises a nucleotide sequence encoding a Cas13d nuclease. Further, the nucleotide sequence encoding the sgRNA is operably linked to a promoter. The vector can express sgRNA and Cas13d nuclease for targeted destruction of Aqp1mRNA. It is understood that those skilled in the art can construct with reference to conventional techniques. Further, in some embodiments, the Cas13d nuclease is CasRx.

[0027] The nucleotide sequence encoding the sgRNA and the nucleotide sequence encoding the Cas13d nuclease can be located on the same vector or on different vectors.

[0028] In a third aspect, the present invention provides a recombinant bacterium, recombinant cell line, or virus comprising at least one of the following I to III:

[0029] I. The sgRNA according to the first aspect of the present invention;

[0030] II. A nucleic acid molecule encoding the sgRNA according to the first aspect of the present invention;

[0031] III. The vector according to the second aspect of the present invention.

[0032] The fourth aspect of the present invention provides a composition comprising at least one of the following I to IV:

[0033] I. Cas13d nuclease, and the sgRNA according to the first aspect of the present invention;

[0034] II. A nucleic acid molecule encoding a Cas13d nuclease, and a nucleic acid molecule encoding the sgRNA according to the first aspect of the present invention;

[0035] III. Cas13d nuclease, and a nucleic acid molecule encoding the sgRNA according to the first aspect of the present invention;

[0036] IV. Nucleic acid molecules encoding Cas13d nuclease, and the sgRNA described in the first aspect of the present invention.

[0037] In some embodiments, the Cas13d nuclease is a CasRx nuclease.

[0038] In some embodiments, the number of sgRNAs in the composition is 1.

[0039] In some embodiments, the composition contains two sgRNAs, and the targeting domains of the two sgRNAs are selected from any two of SEQ ID NO: 1 to SEQ ID NO: 31. Further, in some embodiments, the targeting domains of the two sgRNAs are selected from any combination of the following (1)-(10):

[0040] (1) sgRNA 2 + sgRNA 5;

[0041] (2) sgRNA 2 + sgRNA 21;

[0042] (3) sgRNA 2 + sgRNA 24;

[0043] (4) sgRNA 2 + sgRNA 31;

[0044] (5) sgRNA 5 + sgRNA 21;

[0045] (6) sgRNA 5 + sgRNA 24;

[0046] (7) sgRNA 5 + sgRNA 31;

[0047] (8) sgRNA 21 + sgRNA 24;

[0048] (9) sgRNA 21 + sgRNA 31;

[0049] (10)sgRNA 24+sgRNA 31.

[0050] The fifth aspect of the present invention provides a kit, which contains the sgRNA described in the first aspect of the invention, the vector described in the second aspect of the invention, or the composition described in the fourth aspect of the invention.

[0051] The kit can be used to significantly downregulate the expression level of Aqp1.

[0052] The sixth aspect of the present invention provides a drug, which contains the sgRNA described in the first aspect of the present invention, the vector described in the second aspect of the present invention or the composition described in the fourth aspect of the present invention, and a pharmaceutically acceptable excipient.

[0053] Preferably, the drug may be delivered using a delivery system including but not limited to: RNP delivery, liposome delivery, nanoparticle delivery, and viral delivery.

[0054] In some embodiments of the present invention, viral delivery is used. In some embodiments, AAV vector delivery is used.

[0055] In a seventh aspect, the present invention provides use of the sgRNA described in the first aspect of the present invention, the vector described in the second aspect of the present invention, the recombinant bacteria, recombinant cell line or virus described in the third aspect of the present invention, the composition described in the fourth aspect of the present invention, the kit described in the fifth aspect of the present invention, or the drug described in the sixth aspect of the present invention in the preparation of a drug for treating diseases in which downregulation of Aqp1 expression is beneficial.

[0056] In some embodiments, the disease in which downregulation of Aqp1 expression is beneficial is selected from tumors and glaucoma.

[0057] In some embodiments, the disease in which downregulation of Aqp1 expression is beneficial is selected from glaucoma.

[0058] The beneficial effects of the present invention are:

[0059] This invention, for the first time, utilizes the CRISPR / Cas9 system to provide a sgRNA that targets and disrupts the human Aqp1 mRNA sequence, significantly downregulating Aqp1 mRNA levels. After delivery to cells via a vector, the sgRNA targets and disrupts Aqp1 mRNA, reducing Aqp1 mRNA levels. This approach can be used to treat diseases where downregulating Aqp1 expression is beneficial, including but not limited to diseases associated with Aqp1 overexpression (including cancer and glaucoma), or to treat related diseases by downregulating normal Aqp1 expression.

[0060] The sgRNA targeted to the mRNA sequence of the Aqp1 gene provided by the present invention is safer than directly targeting and destroying the Aqp1 gene.

[0061] The sgRNA of the present invention can effectively reduce Aqp1 mRNA levels. Through design, the inventors discovered sgRNAs with significantly better effects near some sgRNA targeting sites, which can more effectively reduce Aqp1 mRNA levels, achieving unexpected technical results.

[0062] In addition, the inventors unexpectedly discovered that a specific combination of two sgRNAs has higher editing efficiency and better Aqp1 inhibition effect than a single sgRNA, thus having a synergistic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 Schematic diagram of the sgRNA molecular structure of the present invention.

[0064] Figure 2 Schematic diagram of the target position of some sgRNAs of the present invention on Aqp1 mRNA Figure 1 .

[0065] Figure 3Schematic diagram of the target position of some sgRNAs of the present invention on Aqp1 mRNA Figure 2 .

[0066] Figure 4 Schematic diagram of the target position of some sgRNAs of the present invention on Aqp1 mRNA Figure 3 .

[0067] Figure 5 This is a map of the RFZH-1 plasmid.

[0068] Figure 6 The sequencing peak diagrams of some vectors of the present invention are given as examples, and Figures AF correspond to the sequencing peak diagrams of RFZH-1-Aqp1-sgRNA1, 2, 4, 7, 8, and 9 vectors, respectively.

[0069] Figure 7 This is a map of the Aqp1-overexpressing plasmid Lv-Aqp1.

[0070] Figure 8 The Q-PCR amplification diagram after sgRNA2 editing of cells in the embodiment is given as an example.

[0071] Figure 9 Intraocular pressure test results of mice 3 weeks after injection of sgRNA 21AAV.

[0072] Figure 10 Intraocular pressure test results of mice 3 weeks after injection of sgRNA C AAV. DETAILED DESCRIPTION

[0073] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0074] Definition: The Cas13d nuclease / Cas13d enzyme described in the present invention can be any Cas13d nuclease; for example, it can be EsCas13d, RfxCas13d (CasRx), AdmCas13d, P1E0Cas13d, UrCas13d, RffCas13d, RaCas13d, fusion proteins thereof with other sequences (including but not limited to nuclear localization sequences [NLS] or tag sequences, etc.), or suitable mutants of the above proteins.

[0075] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0076] Example 1. sgRNA vector design and construction

[0077] Design an sgRNA targeting Aqp1 mRNA, wherein the nucleic acid sequence of the sgRNA includes a targeting domain sequence and a backbone sequence, wherein the targeting domain sequence is reverse complementary to the target sequence on the Aqp1 mRNA molecule and has a length of 20-30 nt, such as Figure 1 shown.

[0078] In this example, the sgRNA backbone sequence is 5'-CAAGUAAACCCCUACCAACUGGUCGGGGUUUGAAAC-3' (SEQ ID NO: 32).

[0079] The targeting domain sequences of the sgRNAs designed by the inventors are shown in Table 1 below. Figure 2-4 The position of the target sequence corresponding to the designed sgRNA on human Aqp1 mRNA is shown.

[0080] Among them, sgRNA1-sgRNA31 were designed to target the CDS region of human Aqp1 mRNA in plasmid transfection cell experiments using the CRISPR-CasRx system.

[0081] Table 1 Sequences of the targeting domains of sgRNAs

[0082]

[0083]

[0084] Oligo DNA corresponding to the target sequence was synthesized separately, the sense chain was the reverse complementary sequence of the target sequence, and according to the selection of the BpiI restriction site, AAAC was added to the 5' end, the antisense chain was the target sequence, and CTTG was added to the 5' end.

[0085] The sense and antisense strands of the oligo DNA corresponding to the target sequence were mixed, incubated at 95°C for 5 minutes, and then placed on ice to cool and anneal to form double-stranded DNA with sticky ends.

[0086] The map of RFZH-1 plasmid (SEQ ID NO: 33) is as follows Figure 5As shown, it was constructed by the inventors. This plasmid was used to construct CasRx and sgRNA expression vectors.

[0087] The plasmid was linearized using BpiI enzyme digestion at 37°C for 1 hour. The digestion products were electrophoresed on a 1% agarose gel and recovered.

[0088] The annealed product and the RFZH-1-BpiI linearized product were ligated using T4 ligase. The ligated product was transformed into Escherichia coli competent cells Stbl3 using the heat shock method. After transformation, LB liquid culture medium without antibiotics was added to the centrifuge tube, and the tube was placed in a constant temperature shaker at 37°C and 200 rpm for shaking culture to revive the bacteria.

[0089] The revived Stbl3 cells were coated with ampicillin-resistant LB agar plates and inverted in a constant temperature incubator at 37°C. Single colonies were picked from the above plates and inoculated into 50ml liquid LB medium containing 50ul ampicillin. The above bacterial solution was subjected to PCR identification using primers U6 Promoter-F (5'-GGGCCTATTTCCCATGATTCCTT-3', SEQ ID NO: 34) and f1ori-R (5'-GCTGGCAAGTGTAGCGGTCA-3', SEQ ID NO: 35). After 1% agarose gel electrophoresis of the PCR products, the bacterial solution containing positive clones was screened and inoculated into 5ml of 50ml LB liquid medium containing ampicillin and cultured at 37°C and 200rpm for 16 hours.

[0090] After plasmid extraction and plasmid concentration determination, a portion of the plasmid was taken for Sanger sequencing, and the correctly sequenced plasmid was stored at -20°C for future use.

[0091] The vector containing the sequence encoding sgRNAn targeting Aqp1 mRNA was named RFZH-1-Aqp1-sgRNAn (n is a numerical number).

[0092] Figure 6 The sequencing peak graphs of some vectors are given as examples, and Figures AF correspond to the sequencing peak graphs of RFZH-1-Aqp1-sgRNA1, 2, 4, 7, 8, and 9 vectors, respectively.

[0093] Example 2: Plasmid transfection.

[0094] Plasmid transfection of 293T cells.

[0095] Lipofectamine 2000 liposome transfection reagent was diluted in serum-free medium and co-transfected with sgRNA-cloned RFZH-1-Aqp1-sgRNAn1 and RFZH-1-Aqp1-sgRNAn2 (n1 and n2 represent any two plasmids containing sgRNAs 1 to sgRNA 31) and the Aqp1-overexpressing plasmid Lv-Aqp1 at a ratio of 12:12:1 (total 250 ng). Alternatively, only one sgRNA plasmid was transfected, and RFZH-1-Aqp1-sgRNAn1 (n1 represents any plasmid containing sgRNAs 1 to sgRNA 31) was co-transfected with the Aqp1-overexpressing Lv-Aqp1 plasmid at a ratio of 24:1 (total 250 ng).

[0096] The negative control group was transfected with RFZH-1 plasmid and Lv-Aqp1 plasmid.

[0097] The blank control group was transfected with RFZH-1 plasmid only.

[0098] The plasmid Lv-Aqp1 (SEQ ID NO: 36) overexpressing Aqp1 was constructed by the inventors, and its map is shown in FIG. Figure 7 shown.

[0099] After mixing the two plasmid dilutions and incubating for 20 minutes, the complex was added to a 24-well plate and then the cell suspension was added to the complex.

[0100] 72 hours after plasmid transfection, total RNA was extracted from 293T cells using the Acryl Universal RNA Extraction Kit. gDNA was then digested and reverse transcribed using the Evo M-MLV Reverse Transcription Kit to obtain the corresponding cDNA. Q-PCR reactions were performed using the SYSB Green Pro Taq HS Premix qPCR Kit, using GAPDH as an internal control, on a Roche Lightcycler 480 II to measure Aqp1 mRNA levels in each group after targeted editing. Q-PCR was performed in triplicate for each primer pair per sample. Q-PCR primers are shown in Table 2.

[0101] Table 2. Primers used in 293T cell Q-PCR

[0102] Primer name Sequence 5'-3' Sequence number Q-hGAPDH-F CCATGGGGAAGGTGAAGGTC SEQ ID NO:37 Q-hGAPDH-R GAAGGGGTCATTGATGGCAAC SEQ ID NO:38 hAqp1-F gctcttctggagggcagtgg SEQ ID NO:39 hAqp1-R cagtgtgacagccgggttgag SEQ ID NO:40

[0103] Example 3. Aqp1 mRNA expression detection results

[0104] Recombinant plasmid transfection into cells, RNA extraction, reverse cDNA synthesis, and qPCR all require three independent biological replicates, and the average results of the three replicates are obtained by the 2^-ΔΔCt calculation method.

[0105] The results of the Aqp1 mRNA expression test are shown in Table 3 below. The data are expressed as the average of three test results. The Aqp1 mRNA level in the blank control group was calculated as 0, and the Aqp1 mRNA level in the negative control group was calculated as 1. Figure 8 An example of a Q-PCR amplification plot after sgRNA2 editing of cells is given.

[0106] Table 3. Aqp1 mRNA levels in 293T cells after CRISPR editing

[0107]

[0108]

[0109]

[0110] Note: * indicates statistically significant difference compared with the negative control group (P<0.05).

[0111] The data in Table 3 show that the Aqp1 overexpressing plasmid Lv-Aqp1 model was successfully established. Comparing the results of the group containing sgRNA with the negative control, it can be seen that the sgRNA constructed by the inventors can significantly reduce the expression level of Aqp1 mRNA.

[0112] In human 293T cells, sgRNAs 1-2, 4-5, 7-10, 12, 14-15, 17-18, 20-21, 23-24, 26, 28, and 30-31 had the strongest effect on Aqp1 mRNA knockdown, followed by sgRNAs 3, 6, 11, 13, 16, 19, 22, 25, 27, and 29.

[0113] like Figure 2-4 As shown in the figure, although the targeting sites of sgRNA 26, 28, 30-31 and sgRNA 27, 29 are very close on the Aqp1 mRNA molecule, surprisingly, sgRNA 26, 28, 30-31 have a significantly enhanced editing effect compared with sgRNA 27, 29. After editing, the Aqp1 mRNA level is greatly reduced, achieving an unexpected technical effect.

[0114] Similarly, the inventors also found that sgRNAs 1-2, 4-5, 7-10, and 12 had significantly enhanced editing effects compared to sgRNAs 3, 6, and 11 targeting adjacent sites; sgRNA 14 had significantly enhanced editing effects compared to sgRNA 13 targeting adjacent sites; sgRNAs 15 and 17 had significantly enhanced editing effects compared to sgRNA 16 targeting adjacent sites; sgRNA 18 had significantly enhanced editing effects compared to sgRNA 19 targeting adjacent sites; sgRNAs 20-21 had significantly enhanced editing effects compared to sgRNA 22 targeting adjacent sites; and sgRNAs 23-24 had significantly enhanced editing effects compared to sgRNA 25 targeting adjacent sites.

[0115] In addition, according to the results in Table 3, co-transfection of sgRNA 2+sgRNA 5, sgRNA 2+sgRNA 21, sgRNA2+sgRNA 24, sgRNA 2+sgRNA 31, sgRNA 5+sgRNA 21, sgRNA 5+sgRNA 24, sgRNA 5+sgRNA 31, sgRNA 21+sgRNA 24, sgRNA 21+sgRNA 31, and sgRNA 24+sgRNA 31 combinations had better inhibitory effects on Aqp1 mRNA levels than the group with only one sgRNA.

[0116] In summary, the inventors have successfully constructed a CRISPR-Cas9 system targeting Aqp1 mRNA, which has good sgRNA editing effect and high editing efficiency, and can effectively reduce Aqp1 mRNA levels. Compared with directly targeting and destroying the Aqp1 gene, it is safer.

[0117] Example 4: In vivo animal efficacy test

[0118] The RFZH-1-Aqp1-sgRNA C plasmid (for subsequent positive control) and the RFZH-1-Aqp1-sgRNA 21 plasmid (targeting mouse Aqp1 mRNA) expressing CasRx and sgRNA C (targeting mouse Aqp1 mRNA) were constructed using the method of Example 1. The targeting domain sequence of sgRNA C is ACUUUGGGCCAGAGUAGCGAU (SEQ ID NO: 41).

[0119] AAV-ShH10, expressing both CasRx and sgRNA, was isolated and cultured in 293T cells using conventional methods by transfection with the RFZH-1-Aqp1-sgRNA plasmid. AAV-ShH10 expressing CasRx and sgRNA without sgRNA was also prepared using the same method.

[0120] Ten normal 6-week-old mice with stable intraocular pressure were selected, and 5 mice were injected with AAV expressing sgRNA 21 (2×10 9 GC AAV) and GFP AAV (2×10 8 GC AAV), and the left eye vitreous of the other 5 mice was injected with AAV expressing sgRNAC (2×10 9 GC AAV) and GFP AAV (2×10 8 All 10 mice were injected with sgRNA-free AAV (2×10 9 GC AAV) and GFP AAV (2×10 8 GC AAV), as shown in Table 4 below.

[0121] Table 4. Animal experimental groups

[0122] Grouping Drug administration Negative control sgRNA empty AAV+GFP AAV Experimental group sgRNA 21AAV+GFP AAV Positive control sgRNA C AAV+GFP AAV

[0123] One week after injection, the coverage of ciliary GFP was detected. Fluorescence detection of GFP distribution showed that the drug injection was successful. IOP was measured in both eyes using a TONOLAB tonometer. Numbers for each mouse are denoted by 1 to 5, and the IOP for each eye is expressed as the average of six consecutive measurements. The results are shown in Tables 5 and 6 below.

[0124] Table 5. Intraocular pressure test results of mice 3 weeks after injection of sgRNA 21 AAV

[0125]

[0126] Note: * indicates that the mean value of the experimental group was statistically different from that of the negative control group (P<0.05).

[0127] Table 6. Intraocular pressure test results of mice 3 weeks after injection of sgRNA C AAV

[0128]

[0129] Note: * indicates that the mean value of the experimental group was statistically different from that of the negative control group (P<0.05).

[0130] As shown in Table 5 and Figure 9 The results showed that sgRNA 21 can effectively reduce the intraocular pressure of mice compared with the empty vector. Figure 10 The results showed that sgRNA C can effectively reduce the intraocular pressure of mice compared with the empty vector. Therefore, sgRNA 21 and sgRNA C can be used to treat glaucoma.

[0131] Judging from the magnitude of the reduction in intraocular pressure, sgRNA 21 of the present invention is more effective than sgRNA C. Therefore, when used for the treatment of glaucoma, sgRNA 21 of the present invention can exert a better therapeutic effect.

[0132] The above embodiments are preferred implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered equivalent replacement methods and are included in the scope of protection of the present invention. SEQUENCE LISTING <110> Guangzhou Ruifeng Biotechnology Co., Ltd. <120> sgRNA targeting Aqp1 mRNA and its vector and application <130> <160> 41 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> RNA <213> Artificial sequence <400> 1 gcccuccaga agagcuucuu cuuga 25 <210> 2 <211> twenty three <212> RNA <213> Artificial sequence <400> 2 ccuccagaag agcuucuucu uga 23 <210> 3 <211> twenty three <212> RNA <213> Artificial sequence <400> 3 caggaacucg gccaccacug ccc 23 <210> 4 <211> twenty three <212> RNA <213> Artificial sequence <400> 4 aagacaaaga gggucguggc cag 23 <210> 5 <211> 26 <212> RNA <213> Artificial sequence <400> 5 agggcagaac cgaugcugau gaagac 26 <210> 6 <211> twenty two <212> RNA <213> Artificial sequence <400> 6 caggaacucg gccaccacug cc 22 <210> 7 <211> twenty three <212> RNA <213> Artificial sequence <400> 7 auuugaagcc cagggcagaa ccg 23 <210> 8 <211> twenty four <212> RNA <213> Artificial sequence <400> 8 ugguuguucc ccaccgggua uuug 24 <210> 9 <211> twenty four <212> RNA <213> Artificial sequence <400> 9 ccgucugguu guuccccacc gggu 24 <210> 10 <211> twenty three <212> RNA <213> Artificial sequence <400> 10 ccgccgucug guuguucccc acc 23 <210> 11 <211> 30 <212> RNA <213> Artificial sequence <400> 11 gcgccagcgu ggcgaugcuc agcccgaagg 30 <210> 12 <211> 30 <212> RNA <213> Artificial sequence <400> 12 gccagcgaca ccuucacguu gccuggacc 30 <210> 13 <211> twenty three <212> RNA <213> Artificial sequence <400> 13 aagaugcuga ucuggcagcu gag 23 <210> 14 <211> twenty three <212> RNA <213> Artificial sequence <400> 14 augauguaca ugagggcacg gaa 23 <210> 15 <211> twenty three <212> RNA <213> Artificial sequence <400> 15 cgaguucaca ccaucagcca ggu 23 <210> 16 <211> twenty three <212> RNA <213> Artificial sequence <400> 16 gcccaggccc uggcccgagu uca 23 <210> 17 <211> twenty three <212> RNA <213> Artificial sequence <400> 17 ucccgaugau cucgaugccc agg 23 <210> 18 <211> twenty three <212> RNA <213> Artificial sequence <400> 18 gccaguguag ucaauagcca gga 23 <210> 19 <211> twenty three <212> RNA <213> Artificial sequence <400> 19 aucccacagc caguguaguc aau 23 <210> 20 <211> twenty three <212> RNA <213> Artificial sequence <400> 20 cugaaguugu gugugaucac cgc 23 <210> twenty one <211> twenty three <212> RNA <213> Artificial sequence <400> twenty one cccacccaga aaauccagug guu 23 <210> twenty two <211> twenty three <212> RNA <213> Artificial sequence <400> twenty two cccagaaaau ccagugguug cug 23 <210> twenty three <211> twenty three <212> RNA <213> Artificial sequence <400> twenty three aagucguaga ugaguacagc cag 23 <210> twenty four <211> 26 <212> RNA <213> Artificial sequence <400> twenty four cugcugcgug gggccaggau gaaguc 26 <210> 25 <211> 26 <212> RNA <213> Artificial sequence <400> 25 caccuucacg cggucuguga ggucac 26 <210> 26 <211> 29 <212> RNA <213> Artificial sequence <400> 26 gcauccaggu cauacuccuccaccuggcc 29 <210> 27 <211> twenty three <212> RNA <213> Artificial sequence <400> 27 gucauacucc uccaccuggc cgc 23 <210> 28 <211> 20 <212> RNA <213> Artificial sequence <400> 28 gucauacucc uccaccuggc 20 <210> 29 <211> twenty three <212> RNA <213> Artificial sequence <400> 29 gcauccaggu cauacuccuc cac 23 <210> 30 <211> 30 <212> RNA <213> Artificial sequence <400> 30 cuucaucucc acccuggagu ugaugucguc 30 <210> 31 <211> 24 <212> RNA <213> Artificial sequence <400> 31 uuugggcuuc aucuccaccc ugga 24 <210> 32 <211> 36 <212> RNA <213> Artificial sequence <400> 32 caaguaaacc ccuaccaacu ggucgggguu ugaaac 36 <210> 33 <211> 7102 <212> DNA <213> Artificial sequence <400> 33 cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60 ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120 aggggttcct gcggcctcta gactcgaggc gttgacattg attattgact agttattaat 180 agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac 240 ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa 300 tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt 360 atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc 420 ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat 480 gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc 540 ggttttggca gtacatcaat gggcgtggat agcggtttga ctcacgggga tttccaagtc 600 tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa 660 aatgcgtaa caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg 720 tctatatag cagagctctc tggctaacta ccggtgccac catgagcccc aagaagaaga 780 gaaaggtgga ggccagcatc gaaaaaaaa agtccttcgc caagggcatg ggcgtgaagt 840 ccacactcgt gtccggctcc aaagtgtaca tgacaacctt cgccgaaggc agcgacgcca 900 ggctggaaaa gatcgtggag ggcgacagca tcaggagcgt gaatgagggc gaggccttca 960 gcgctgaaat ggccgataaa aacgccggct ataagatcgg caacgccaaa ttcagccatc 1020 ctaagggcta cgccgtggtg gctaacaacc ctctgtatac aggacccgtc cagcaggata 1080 tgctcggcct gaaggaaact ctggaaaaga ggtacttcgg cgagagcgct gatggcaatg 1140 acaatatttg tatccaggtg atccataaca tcctggacat tgaaaaaatc ctcgccgaat 1200 acattaccaa cgccgcctac gccgtcaaca atatctccgg cctggataag gacattattg 1260 gattcggcaa gttctccaca gtgtatacct acgacgaatt caaagacccc gagcaccata 1320 gggccgcttt caacaataac gataagctca tcaacgccat caaggcccag tatgacgagt 1380 tcgacaactt cctcgataac cccagactcg gctatttcgg ccaggcctttt ttcagcaagg 1440 agggcagaaa ttacatcatc aattacggca acgaatgcta tgacattctg gccctcctga 1500 gcggactgag gcactgggtg gtccataaca acgaagaaga gtccaggatc tccaggacct 1560 ggctctacaa cctcgataag aacctcgaca acgaatacat ctccaccctc aactacctct 1620 acgacaggat caccaatgag ctgaccaact ccttctccaa gaactccgcc gccaacgtga 1680 actatattgc cgaaactctg ggaatcaacc ctgccgaatt cgccgaacaa tatttcagat 1740 tcagcattat gaaagagcag aaaaacctcg gattcaatat caccaagctc agggaagtga 1800 tgctggacag gaaggatatg tccgagatca ggaaaaatca taaggtgttc gactccatca 1860 ggaccaaggt ctacaccatg atggactttg tgatttag gttacacatc gaagaggtg 1920s ccaaggtggc tgccgccaat aagtccctcc ccgataatcga gaagtccctg agcgagaagg 1980 atatctttgt gattaacctg aggggctcct tcaacgacga caggaaggat gccctctact 2040 windows multiply windows multiply windows multiply windows 2100 ttaggggaaa cagacaga gagtataaga agagacgc ccctagactg cccagaatcc 2160 tgcccgctgg ccgtgatgtt tccgccttca gcaactcat gtatgccctg accatgttcc 2220 tggatggcaa ggagatcaac gaccctga ccaccctgat tataaattc gataacatcc 2280 agagcttcct gaggtgatg cctctcatcg gagtcaaccc taagttcgtg gaggaatacg 2340 cctttttcaa agactccgcc aagatcgccg atgagctgag gctgatcaag tccttcgcta 2400 gatgggaga acctattgcc gatgccagga gggccatgta tatcgacgcc atccgtattt 2460 taggaaccaa cctgtcctat gatgagctca aggccctcgc cgacaccttt tccctggacg 2520 agaacggaaa caagctcaag aaaggcaagc acggcatgag aaatttcatt attaataacg 2580 tgatcagcaa taaaaggttc cactacctga tcagatacgg tgatcctgcc cacctccatg 2640 agatcgccaa aaacgaggcc gtggtgaagt tcgtgctcgg caggatcgct gacatccaga 2700 aaaaacaggg ccagaacggc aagaaccaga tcgacaggta ctacgaaact tgtatcggaa 2760 aggataaggg caagagcgtg agcgaaaagg tggacgctct cacaaagatc atcaccggaa 2820 tgaactacga ccaattcgac aagaaaagga gcgtcattga ggacaccggc agggaaaacg 2880 ccgagaggga gaagtttaaa aagatcatca gcctgtacct caccgtgatc taccacatcc 2940 tcaagaatat tgtcaatatc aacgccaggt acgtcatcgg attccattgc gtcgagcgtg 3000 atgctcaact gtacaaggag aaaggctacg acatcaatct caagaaactg gaagagaagg 3060 gattcagctc cgtcaccaag ctctgcgctg gcattgatga aactgccccc gataagagaa 3120 aggacgtgga aaaggagatg gctgaaagag ccaaggagag cattgacagc ctcgagagcg 3180 ccaaccccaa gctgtatgcc aattacatca aatacagcga cgagaagaaa gccgaggagt 3240 tcaccaggca gattaacagg gagaaggcca aaaccgccct gaacgcctac ctgaggaaca 3300 ccaagtggaa tgtgatcatc agggaggacc tcctgagaat tgacaacaag acatgtaccc 3360 tgttcagaaa caaggccgtc cacctggaag tggccaggta tgtccacgcc tatatcaacg 3420 acattgccga ggtcaattcc tacttccaac tgtaccatta catcatgcag agaattatca 3480 3540 acgaagaa gtacaacgat aggctcctga aactgctgtg tgtgcctttc ggctactgta 3600 tccccaggtt taagaacctg agcatcgagg ccctgttcga taggaacgag gccgccaagt 3660 tcgacaagga gaaaagaag gtgtccggca attccggatc cggacctaag aaaaagaga 3720 aggtggcggc cgcttaccca tacgatgttc cagattacgc ttgaggtacc ctagagctcg 3780 ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt 3840 3900 tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg ggcaggacag 3960 caagggggag gattgggaag agaatagcag gcatgctggg gagagggcct atttcccatg 4020 attccttcat atttgcatat acgatacaag gctgttagag agataattgg aattaatttg 4080 actgtaaaca caaagatatt agtacaaaat acgtgacgta gaaagtaata atttcttggg 4140 tagtttgcag ttttaaaatt atgttttaaa atggactatc atatgcttac cgtaacttga 4200 aagtatttcg atttcttggc tttatatatc ttgtggaaag gacgaaacac cgcaagtaaa 4260 cccctaccaa ctggtcgggg tttgaaacgg gtcttcgaga agacctcaag taaaccccta 4320 ccaactggtc ggggtttgaa actttttttc ccgggaatgg ccgcaggaac ccctagtgat 4380 ggagttggcc actccctctc tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt 4440 cgcccgacgc ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct 4500 gcaggggcgc ctgatgcggt atttctcct tacgcatctg tgcggtattt cacaccgcat 4560 acgtcaaagc aaccatagta cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg 4620 gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctc tttcgctttc 4680 ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc 4740 cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgatttgggt 4800 gatggttcac gtagtgggcc atcgccctga tagacggtttt ttcgcccttt gacgttggag 4860 tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg 4920 ggctattct ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag 4980 ctgatttaac aaaaatttaa cgcgaatttt aaaaaat taacgtttac aattttatgg 5040 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagccccg acacccgcca 5100 acaccgctg acgcgccctg acgggcttgt ctgctcccgg catcgctta cagacaagct 5160 gtgaccgtct ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg 5220 agacgaaagg gcctcgtgat acgcctattt ttataggtta atgtcatgat aataatggtt 5280 tcttagacgt caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt 5340 ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa 5400 taatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt 5460 tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctgggtgaa agtaaaagat 5520 gctgaagaatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag 5580 atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg 5640 ctatgtggcg cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata 5700 cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat 5760 ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc 5820 aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg 5880 ggggatcatg taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac 5940 gacgagcgtg acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact 6000 ggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa 6060 gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct 6120 ggagccggtg agcgtggaag ccgcggtatc attgcagcac tggggccaga tggtaagccc 6180 tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga 6240 cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac 6300 tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag 6360 atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg 6420 tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc 6480 tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag 6540 ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc 6600 cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac 6660 ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc 6720 gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt 6780 tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt 6840 gagctatgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc 6900 ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt 6960 tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca 7020 ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt 7080 tgctggcctt ttgctcacat gt 7102 <210> 34 <211> 23 <212> DNA <213> Artificial sequence <400> 34 gggcctattt cccatgattc ctt 23 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <400> 35 gctggcaagt gtagcggtca 20 <210> 36 <211> 9363 <212> DNA <213> Artificial sequence <400> 36 gtcgacggat cgggagatct cccgatcccc tatggtgcac tctcagtaca atctgctctg 60 atgccgcata gttaagccag tatctgctcc ctgcttgtgt gttggaggtc gctgagtagt 120 gcgcgagcaa aatttaagct acaacaaggc aaggcttgac cgacaattgc atgaagaatc 180 tgcttagggt taggcgtttt gcgctgcttc gcgatgtacg ggccagatat acgcgttgac 240 attgattatt gactagttat taatagtaat caattacggg gtcattagtt catagcccat 300 atatggagtt ccgcgttaca taacttacgg taaatggccc gcctggctga ccgcccaacg 360 acccccgccc attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt 420 tccattgacg tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag 480 tgtatcatat gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc 540 attatgccca gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag 600 tcatcgctat taccatggtg atgcggtttt ggcagtacat caatgggcgt ggatagcggt 660 ttgactcacg gggatttcca agtctccacc ccattgacgt caatgggagt ttgttttggc 720 accaaaatca acgggacttt ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg 780 gcggtaggcg tgtacggtgg gaggtctata gaccagatct gagcctggga gctctctggc 840 taactaggga acccactgct taagcctca taaagcttgc cttgagtgct tcaagtagtg 900 tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc tcagacctt ttagtcagtg 960 tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa agcgaaggg aaaccagagg 1020 agctctctcg acgcaggact cggcttgctg aagcgcgcac ggcaagaggc gaggggcggc 1080 gactggtgag tacgccaaaa atttgacta gcggaggcta gaaggagaga gatgggtgcg 1140 agagcgtcag tattaagcgg gggagaatta gatcgcgatg ggaaaaaatt cggttaaggc 1200 cagggggaaaaaaaat aaaaaacat atagtaggg caagcaggga gctagaacga 1260 ttcgcagtta atcctggcct gttagaaca tcagaaggct gtagacaat actgggacag 1320 ctacaccacat cccttcagac multicage catacacat catacacat catacaca 1380 accctctt gtgtgcatca aaggatagag aaaagaca ccaggaagc tttagacaag 1440 atagaggaag agcaaaaaaaagtaagacc accgcacagc aagcggccgg ccgcgctgat 1500 cttcagacct gaggagg attagaggga cattgagg agggaggt father 1560 agtagtaaaa attgaaccat taggagtagc acccaccaag gcaagagaa gagtggtgca 1620 gagagaaaaa agagcagtgg gataggagc ttgttcctt gggttctgg gagcagcagg 1680 aagcactatg ggcgcagcgt caatgacgct gacggtacag gccagacaat tattgtctgg 1740 tatagtgcag cagcagaaca atttgctgag ggctattgag gcgcaacagc atctgttgca 1800 actcacagtc tgggcatca agcagctcca ggcaagaatc ctggctgtgg aagatacct 1860 aaaggatcaa cagctcctgg ggatttgggg tgctctgga aactcattt gcaccactgc 1920 tgtgccttgg atgctagtt ggagtaataa atctctggaa cagatttgga atcacacgac 1980 ctggatggag tgggacagag aattacaa ttacacaagc ttatacact ccttaattga 2040 agaatcgca aaccagcaag aaagaatga acagatta ttggattag ataatgggc 2100 aagtttgtgg aattggttta acatacaaa ttggctgtgg tataaaat tattcataat 2160 gatgtagga ggcttggtag gtttaagaat agtttttgct gtactttcta tagtgaatag 2220 agttaggcag ggatattcac cattatcgtt tcagacccac ctcccaaccc cgaggggacc 2280 cgacaggccc gaggaagg agagaagg tggagagaga gagagaca gatccattcg 2340 attagtgaac ggatcggcac tgcgtgcgcc aattctgcag acaaatggca gtattcatcc 2400 acaatttaa aagaaaggg gggattgggg ggtacagtgc agggaaga atagtagaca 2460 tatagcaac agacataca actaagaat tachaaaaaattacaaa attcaaatt 2520 ttcggtttta ttacagggac agcagagatc cagttttggtt agtaccggc ccgctctagc 2580 gtcgaggagc ttggccatt gcatacgttg tatccatatc atatatgta catttatatt 2640 ggctcatgtc cacattacc gccatgttga cattgatt tgactagtta ttatagtaa 2700 tcattacgg gtcattagt tcatagccca tattggag tccgcgttac atacttacg 2760 gtaaatggcc cgcctggctg acccccac gaccccgcc cattgacgtc aaatgacg 2820 tatgttccca tagtaacgcc atagggact ttccattgac gtcaatgggt ggagtattta 2880 cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac gccccctatt 2940 gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac cttatgggac 3000 tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggt gatgcggttt 3060 tggcagtaca tcaatgggcg tggatagcgg tttgactcac ggggatttcc aagtctccac 3120 cccattgacg tcaatgggag tttgttttgg caccaaaatc aacgggactt tccaaaatgt 3180 cgtaacaact ccgccccatt gacgcaaatg ggcggtaggc gtgtacggtg ggaggtctat 3240 ataagcagag ctcgtttagt gaaccgtcag atcgcctgga gacgccatcc acgctgtttt 3300 gacctccata gaagacaccg ggaccgatcc agcctccgcg gccccgaatt cgccaccatg 3360 gccagcgagt tcaagaagaa gctcttctgg agggcagtgg tggccgagtt cctggccacg 3420 accctctttg tcttcatcag catcggttct gccctgggct tcaaataccc ggtggggaac 3480 aaccagacgg cggtccagga caacgtgaag gtgtcgctgg ccttcgggct gagcatcgcc 3540 acgctggcgc agagtgtggg ccacatcagc ggcgcccacc tcaacccggc tgtcacactg 3600 gggctgctgc tcagctgcca gatcagcatc ttccgtgccc tcatgtacat catcgcccag 3660 tgcgtggggg ccatcgtcgc caccgccatc ctctcaggca tcacctcctc cctgactggg 3720 aactcgcttg gccgcaatga cctggctgat ggtgtgaact cgggccaggg cctgggcatc 3780 gagatcatcg ggaccctcca gctggtgcta tgcgtgctgg ctactaccga ccggaggcgc 3840 cgtgaccttg gtggctcagc cccccttgcc atcggcctct ctgtagccct tggacacctc 3900 ctggctattg actacactgg ctgtgggatt aaccctgctc ggtcctttgg ctccgcggtg 3960 atcacacaca acttcagcaa ccactggatt ttctgggtgg ggccattcat cgggggagcc 4020 ctggctgtac tcatctacga cttcatcctg gccccacgca gcagtgacct cacagaccgc 4080 gtgaaggtgt ggaccagcgg ccaggtggag gagtatgacc tggatgccga cgacatcaac 4140 tccagggtgg agatgaagcc caaataccca tacgatgttc cagattacgc tggatccgct 4200 agcggcagtg gagagggcag aggaagtctg ctaacatgcg gtgacgtcga ggagaatcct 4260 ggcccagtga gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg 4320 gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc 4380 tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc 4440 accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg 4500 aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc 4560 ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc 4620 ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg 4680 cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga caagcagaag 4740 aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag cgtgcagctc 4800 gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct gcccgacaac 4860 cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg cgatcacatg 4920 gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga gctgtacaag 4980 taaggatcct aggcggccgc gcatgccctg caggtgatct atcgatcggc cggcccctct 5040 ccctcccccc ccccctaacg ttactggccg aagccgcttg gaataaggcc ggtgtgcgtt 5100 tgtctatatg ttattttcca ccatattgcc gtcttttggc aatgtgaggg cccggaaacc 5160 tggccctgtc ttcttgacga gcattcctag gggtctttcc cctctcgcca aaggaatgca 5220 aggtctgttg aatgtcgtga aggaagcagt tcctctggaa gctcttgaa gatacaac 5280 gtctgtagcg acccttgca ggcagcggaa ccccacct ggcgacaggt gcctctgcgg 5340 ccaaaagcca cgtgtataag atacacctgc aaaggcggca CAccccagt gccacgttgt 5400 gagttggata gttgtggaaa gagtcaatg gctctcctca agcgtattca acaaggggct 5460 gaaggatgcc cagaaggtac cccattgtat gggatctgat ctggggccctc ggtacacatg 5520 ctttacatgt gtttagtcga ggttaaaaaa acgtctaggc cccccgaacc acgggacgt 5580 ggttttcctt tgaaaaacac gatgataata tggccacac cggggccggat atcacgcgtg 5640 atctgatcag cacgtgttga cattaatca tcggcatagt attcggcat agtatatac 5700 vakaaggtga ggaactaaac catggccaag ccttgtctc aagagaatc caccctcatt 5760 gaaagagcaa cggctacaat caacacc cccatctctg aagactacag cgtcgccagc 5820 gcagctctct ctagcgacgg ccgcatctc actgtgtca atgtatatca tttactggg 5880 ggaccttgtg cagaactcgt ggtgctggggc actgctgctg ctgcggcagc tggcaacctg 5940 acttgtatcg tcgcgatcgg aaatgagaac aggggcatct tgagcccctg cggacggtgc 6000 cgacaggtgc ttctcgatct gcatcctggg atcaaagcca tagtgaagga cagtgatgga 6060 cagccgacgg cagttgggat tcgtgaattg ctgccctctg gttatgtgtg ggagggctaa 6120 gcaatgcata catgtgttta aacctcgact taattaagtc gagggtcgac ggtatcgata 6180 agctcgcttc acgagatcat gtttaagggt tccggttcca ctaggtacaa ttcgatatca 6240 agcttatcga taatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 6300 actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 6360 ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 6420 atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 6480 caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 6540 tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 6600 gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc 6660 cttggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 6720 cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 6780 ttccgcgtct tcgcttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 6840 atcgataccg tcgacctcga tcgagaccta gaaaaacatg gagcaatcac aagtagcaat 6900 acagcagcta ccaatgctga ttgtgcctgg ctagaagcac aagaggga ggaggtgggt 6960 tttccagtca cacctcaggt acctttaaga ccaatgactt aaaggcagc tgtagatctt 7020 agccactttt taaaagaaaa gggggactg gaagggctaa ttcactccca acgaagacaa 7080 gatatccttg atctgtggat ctaccacaca caaggctact tccctgattg gcagaactac 7140 acaccagggc cagggatcag atatccactg acctttggat ggtgctacaa gctagtacca 7200 7260 gtgagcctgc atgggatgga tgacccggag agagaagtat tagagtggag gtttgacagc 7320 cgcctagcat ttcatcacat ggcccgagag ctgcatccgg actgtactgg gtctctctgg 7380 ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact gcttaagcct 7440 caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt 7500 aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag catgtgagca 7560 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 7620 ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 7680 acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 7740 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 7800 tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 7860 tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 7920 gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 7980 agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 8040 tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 8100 agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg ttttttgtt 8160 tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatctttct 8220 acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 8280 tcaaaaagga tcttcaccta attaaaaat gaagttttaa atcaatctaa 8340 agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 8400 tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 8460 acgatacggg agggcttacc atctggccc agtgctgcaa tgataccgcg agacccacgc 8520 tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 8580 ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 8640 agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 8700 tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 8760 acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 8820 agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 8880 actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 8940 tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 9000 gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 9060 ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 9120 tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 9180 aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 9240 tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 9300 tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 9360 gac 9363 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <400> 37 ccatggggaa ggtgaaggtc 20 <210> 38 <211> twenty one <212> DNA <213> Artificial sequence <400> 38 gaaggggtca ttgatggcaa c 21 <210> 39 <211> 20 <212> DNA <213> Artificial sequence <400> 39 gctcttctgg agggcagtgg 20 <210> 40 <211> twenty one <212> DNA <213> Artificial sequence <400> 40 cagtgtgaca gccgggttga g 21 <210> 41 <211> twenty one <212> RNA <213> Artificial sequence <400> 41 acuuugggcc agaguagcga u 21

Claims

1. An sgRNA, wherein the sgRNA can target and destroy human Aqp1 mRNA; the nucleic acid sequence of the sgRNA includes a targeting domain and a backbone sequence, and the sequence of the targeting domain of the sgRNA is SEQ ID NO:

5.

2. A vector comprising a nucleotide sequence encoding any one of the following: The sgRNA according to claim 1; The sgRNA and sgRNA 2 according to claim 1; The sgRNA and sgRNA 21 according to claim 1; The sgRNA and sgRNA 24 of claim 1; The sgRNA and sgRNA 31 according to claim 1; The nucleic acid sequences of sgRNA 2, sgRNA 21, sgRNA 24, and sgRNA 31 include a targeting domain and a backbone sequence. The sequence of the targeting domain of sgRNA 2 is SEQ ID NO: 2, the sequence of the targeting domain of sgRNA 21 is SEQ ID NO: 21, the sequence of the targeting domain of sgRNA 24 is SEQ ID NO: 24, and the sequence of the targeting domain of sgRNA 31 is SEQ ID NO:

31.

3. vector according to claim 2, further comprising a nucleotide sequence encoding Cas13d nuclease.

4. Recombinant bacteria, recombinant cell lines, or viruses containing at least one of the following: I. The sgRNA of claim 1; II. A nucleic acid molecule encoding the sgRNA of claim 1; III. The vector according to any one of claims 2 to 3.

5. A composition comprising at least one of the following: Ⅰ. Cas13d nuclease and sgRNA; II. A nucleic acid molecule encoding a Cas13d nuclease and a nucleic acid molecule encoding an sgRNA; III. Cas13d nuclease, and a nucleic acid molecule encoding a sgRNA; IV. Nucleic acid molecules encoding Cas13d nuclease, and sgRNA; The sgRNA is any one of the following: The sgRNA according to claim 1; The sgRNA and sgRNA 2 according to claim 1; The sgRNA and sgRNA 21 according to claim 1; The sgRNA and sgRNA 24 of claim 1; The sgRNA and sgRNA 31 according to claim 1; The nucleic acid sequences of sgRNA 2, sgRNA 21, sgRNA 24, and sgRNA 31 include a targeting domain and a backbone sequence. The sequence of the targeting domain of sgRNA 2 is SEQ ID NO: 2, the sequence of the targeting domain of sgRNA 21 is SEQ ID NO: 21, the sequence of the targeting domain of sgRNA 24 is SEQ ID NO: 24, and the sequence of the targeting domain of sgRNA 31 is SEQ ID NO:

31.

6. A kit comprising the sgRNA of claim 1, the vector of claim 2 or 3, or the composition of claim 5.

7. A drug comprising the sgRNA of claim 1, the vector of claim 2 or 3 or the composition of claim 5, and a pharmaceutically acceptable excipient.

8. Use of the sgRNA of claim 1, the vector of claim 2 or 3, the recombinant bacterium, recombinant cell line or virus of claim 4, the composition of claim 5, the kit of claim 6 or the drug of claim 7 in the preparation of a medicament for treating a disease for which down-regulation of Aqp1 expression is beneficial, wherein the disease for which down-regulation of Aqp1 expression is beneficial is glaucoma.

Images