A one-tube nucleic acid detection method assisted by additives

Abstract

The present invention discloses a one-tube nucleic acid detection method assisted by an additive, the method comprising the following steps: adding a nucleic acid detection reaction solution to the bottom of a reaction tube, adding a nucleic acid amplification reaction solution to the tube wall of the same reaction tube, briefly centrifuging to allow the reaction solution on the tube wall to sink and contact and mix with the reaction solution at the bottom of the tube, and detecting the fluorescent signal in the reaction tube; the nucleic acid detection reaction solution contains glycerol, and the volume percentage of glycerol in the reaction system is 10-20%. Relative to the step-by-step reaction system, the detection method of the present invention achieves the same detection sensitivity, while avoiding the generation of aerosol pollution and simplifying the experimental steps. Relative to the one-tube reaction system based on physical separation, the detection method of the present invention simplifies the experimental operation steps. Relatively optimizing the Cas reaction system, the detection method of the present invention can achieve high-sensitivity nucleic acid detection with only one guide RNA, simplifying the reaction system.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and in particular relates to a one-tube nucleic acid detection method assisted by an additive. Background Art

[0002] At present, CRISPR / Cas systems, such as CRISPR / Cas12 and CRISPR / Cas13 systems, have been widely used in the field of nucleic acid detection due to their advantages such as specificity, programmability and ease of use. However, the sensitivity of the CRISPR-Cas detection system alone is still difficult to meet the clinical analysis requirements. Therefore, most of the nucleic acid detection methods based on CRISPR / Cas technology are currently combined with nucleic acid amplification technology.

[0003] In the one-tube nucleic acid detection method based on nucleic acid amplification and CRISPR / Cas system, the amplification efficiency is greatly reduced because the CRISPR / Cas system can recognize and degrade the amplification target, resulting in the loss of amplification template. In addition, the CRISPR / Cas system activated by the target nucleic acid can non-specifically degrade the primers required for nucleic acid amplification, thereby reducing the amplification efficiency. These factors lead to the low detection efficiency of the existing one-tube method based on the combination of nucleic acid amplification and CRISPR / Cas technology, which cannot meet the requirements of highly sensitive nucleic acid detection.

[0004] In order to solve the above problems, many studies have separated the two processes of CRISPR / Cas detection and nucleic acid amplification. Although this can improve the sensitivity, the detection procedure involves the transfer of amplification products, which can easily cause aerosol contamination and lead to false positive test results. Summary of the invention

[0005] In order to overcome the defects of the prior art, the object of the present invention is to provide a one-tube nucleic acid detection method assisted by additives.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A one-tube nucleic acid detection method comprises the following steps:

[0008] Add the nucleic acid detection reaction solution to the bottom of the reaction tube, add the nucleic acid amplification reaction solution to the wall of the same reaction tube, centrifuge briefly to allow the reaction solution on the wall to sink and contact and mix with the reaction solution at the bottom of the tube (gradually mix after contact, not mix evenly), incubate and detect the fluorescent signal in the reaction tube;

[0009] The nucleic acid detection reaction solution contains glycerol, and the volume percentage of glycerol in the reaction system is 10-20%, preferably 15%; the reaction system includes the nucleic acid detection reaction solution and the nucleic acid amplification reaction solution;

[0010] The nucleic acid detection reaction solution contains a fluorescent reporter probe with a final concentration of 200nM-1uM to ensure that there is sufficient fluorescent reporter probe near the target nucleic acid to be cut;

[0011] The nucleic acid detection reaction solution also contains crRNA with a final concentration of 10-500nM, Cas protein with a final concentration of 10-500nM, and a reaction buffer;

[0012] The volume ratio of the nucleic acid detection reaction solution to the nucleic acid amplification reaction solution is 1:(0.1-10);

[0013] The incubation is carried out at a temperature of 25-65°C;

[0014] The nucleic acid amplification reaction solution includes amplification primers with a final concentration of 120-480 nM, a protease required for amplification, an amplification buffer, and an analyte containing a target nucleic acid;

[0015] The nucleic acid amplification reaction solution can be a reaction system of the following nucleic acid amplification types:

[0016] Recombinase polymerase isothermal amplification (RPA), nucleic acid sequence-dependent amplification (NASBA), recombinase-mediated isothermal nucleic acid amplification (RAA), transcription-mediated amplification (TMA), helicase-dependent isothermal amplification (HDA), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), chimera displacement reaction (RDC), isothermal chimeric amplification of nucleic acids (ICAN), linear isothermal polymerase amplification (LIMA), smart amplification process (SMAP), dual primer isothermal amplification (DAMP), self-extension amplification (SEA), rolling circle amplification (RCA), exponential isothermal amplification (EXPAR) or single primer isothermal amplification (SPIA), preferably recombinase polymerase isothermal amplification

[0017] (RPA).

[0018] The reaction system of the recombinase polymerase isothermal amplification comprises a single-stranded DNA binding protein (SSB), a recombinase and a strand displacement polymerase.

[0019] The nucleic acid detection reaction solution can be a reaction system of the following detection system:

[0020] V-type CRISPR / Cas detection system, bioluminescent detection system, colorimetric detection system or electrochemical detection system, preferably V-type CRISPR / Cas detection system;

[0021] The reaction system of the V-type CRISPR / Cas detection system includes Cas12, Cas13, Cas9 or Cas14 endonuclease, a CRISPR RNA (crRNA) and a single-stranded reporter probe, wherein the crRNA contains a sequence that can be complementary to the target nucleic acid.

[0022] The principle of the present invention is as follows:

[0023] Cas protein binds to guide RNA to form a protein-nucleic acid complex. When target nucleic acid is present, the protein-nucleic acid complex recognizes and degrades the nucleic acid target under the guidance of guide RNA. At the same time, the activated trans-cleavage activity of Cas protein cleaves the surrounding fluorescent reporter probe in a non-specific manner. The fluorescent reporter probe is modified with a fluorescent group at one end and a quenching group at the other end. After being degraded, it is excited to produce a fluorescent signal.

[0024] The present invention adds glycerol to the CRISPR-Cas system to increase viscosity.

[0025] When these two CRISPR-Cas detection systems and amplification system technologies with certain viscosity are combined into one tube reaction, the fusion of the two systems is delayed due to the viscosity of each other, and then in the early stage of the amplification reaction, the nucleic acid amplification template and amplification primer will not be degraded by CRISPR-Cas, so the amplification efficiency is not affected. As time goes on, the two systems gradually merge, and when the nucleic acid amplification is completed, the two systems are completely fused, and CRISPR-Cas detects the amplification product.

[0026] Compared with the prior art, the present invention has the following advantages and effects:

[0027] 1. Compared with the step-by-step reaction system, the detection method of the present invention achieves the same detection sensitivity, while avoiding the generation of aerosol pollution and simplifying the experimental steps.

[0028] 2. Compared with a one-tube reaction system based on physical separation, the detection method of the present invention simplifies the experimental operation steps.

[0029] 3. Compared with the optimized Cas reaction system (for example, requiring two or more guide RNAs), the detection method of the present invention can achieve high-sensitivity nucleic acid detection with only one guide RNA, thus simplifying the reaction system. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1It is the fluorescence signal intensity obtained when different additives at different concentrations are added to a tube of detection method based on the combination of isothermal amplification and CRIPSR / Cas system; the slash in the legend represents the "or" relationship, glycerol and DMSO are liquids, and their added amounts are expressed as the volume percentage (%) of the reaction system; betaine, aminobutyric acid, taurine and aminobutyric acid are solids, and their added amounts are expressed as the molar concentration (M) of the reaction system.

[0031] Figure 2 It is the fluorescence signal intensity obtained when different target amounts (DNA) are detected using the method of the present invention.

[0032] Figure 3 It is the fluorescence signal intensity obtained by using the method of the present invention for different target amounts (RNA).

[0033] Figure 4 It is the fluorescence signal intensity obtained when different target amounts (DNA) are detected using a conventional one-tube detection method based on isothermal amplification combined with the CRIPSR / Cas system.

[0034] Figure 5 It is the fluorescence signal intensity obtained when different target amounts (DNA) are detected using a typical two-tube nucleic acid detection method based on isothermal amplification and CRISPR / Cas detection. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0036] Example 1

[0037] A one-tube nucleic acid detection method comprises the following steps:

[0038] (1) Preparation of CRISPR / Cas detection reaction solution

[0039] The CRISPR / Cas detection reaction solution includes 1×Cas protein buffer, 100nM Cas12 protein (purchased from Guangzhou Bolais Biotechnology Co., Ltd., the same below), 100nM crRNA (uaauuucuacuaaguguagaugggguuugagguccauuaca), 400nM FQ probe (FAM-CCCCCC-BHQ1), and different types and concentrations of additives (such as Figure 1 ).

[0040] (2) Preparation of isothermal amplification reaction solution

[0041] This embodiment adopts recombinase polymerase isothermal amplification to amplify DNA targets, using TwistAmpBasic Kit. The recombinase polymerase isothermal amplification reaction solution includes a final concentration of 240nM primers (F Primer: gccgaagggaatggatactgagggaatagcaa; R Primer: gccgaagggaatggatactgagggaatagcaa), an amplification buffer, an amplification enzyme, a PCR product containing a partial sequence of the B646L gene of the African swine fever virus (ASFV), and 280mM magnesium acetate.

[0042] (3) Place 10uL of CRISPR / Cas detection reaction solution at the bottom of the reaction tube, place 10uL of isothermal amplification reaction solution on the tube wall, centrifuge briefly (5000rpm for 5s), incubate at 37°C for 60min, and measure the fluorescence signal intensity of the reaction solution using a real-time quantitative PCR instrument.

[0043] The experimental results are as follows Figure 1 As shown in the figure, at a concentration of 10-20%, the glycerol additive has a very obvious enhancement effect on the detection efficiency of the one-tube nucleic acid detection method based on isothermal amplification combined with the CRISPR / Cas system. Its enhancement effect is concentration-dependent, and the best enhancement effect is achieved when the final concentration of the system is 15%.

[0044] Example 2

[0045] A one-tube nucleic acid detection method for African swine fever virus (ASFV) comprises the following steps:

[0046] (1) Preparation of CRISPR / Cas detection reaction solution

[0047] The CRISPR / Cas detection reaction solution includes 1×Cas protein buffer, 100nM Cas12 protein, 100nM crRNA, 400nM FQ probe, and 30% glycerol (relative to the entire reaction system, the volume percentage is 15%).

[0048] (2) Preparation of isothermal amplification system reaction solution

[0049] This embodiment adopts recombinase polymerase isothermal amplification to amplify DNA targets, using TwistAmpBasic Kit. The recombinase polymerase isothermal amplification reaction solution includes primers, amplification buffer, amplification enzyme, DNA targets of different concentrations, and magnesium acetate.

[0050] (3) Place the CRISPR / Cas detection reaction solution at the bottom of the reaction tube, place the isothermal amplification system reaction solution on the tube wall, centrifuge briefly, incubate at 37°C for 60 minutes, and measure the fluorescence signal intensity of the reaction solution using a real-time quantitative PCR instrument.

[0051] The target DNA was a PCR product of a partial sequence of the B646L gene of the African swine fever virus. The target amounts added were 10 3 aM, 10 2 aM, 10 1 aM, 10 0 aM, 10 -1 aM, 0aM (NTC).

[0052] like Figure 2 As shown in the figure, when used for the sensitivity detection of ASFV, this method has good detection sensitivity, and its minimum detection limit can reach 10 0 aM.

[0053] Example 3

[0054] A one-tube nucleic acid detection method for the N gene of the new coronavirus (SARS-CoV-2) includes the following steps:

[0055] (1) Targeting the N gene of the novel coronavirus (SARS-CoV-2) (genomic coordinates: 28274-29533, GenBnak: MN908947.3).

[0056] (2) preparing a CRISPR / Cas detection reaction solution, as in Example 2;

[0057] (3) Prepare a reverse transcription amplification reaction solution, and amplify the RNA target by reverse transcription recombinase polymerase isothermal amplification (RT-RPA), using TwistAmp Basic Kit. The reverse transcription recombinase polymerase isothermal amplification reaction solution includes primers, amplification buffer, amplification enzyme, reverse transcriptase, target, and magnesium acetate.

[0058] (4) Place the CRISPR / Cas detection reaction solution at the bottom of the reaction tube, place the isothermal amplification system reaction solution on the tube wall, and centrifuge briefly. Incubate at 37°C for 60 minutes, and use a real-time quantitative PCR instrument to measure the fluorescence signal intensity of the reaction solution.

[0059] The target used in this example is an RNA standard containing part of the N gene sequence of the new coronavirus (SARS-CoV-2) purchased from the China Institute of Metrology. The amount of target added is 10 5 copies, 10 4 copies, 10 3copies, 10 2 copies, 10 1 copies, 10 0 copies, 0 copies (NTC).

[0060] like Figure 3 As shown in the figure, when used for the sensitivity detection of SARS-CoV-2, this method has good detection sensitivity, and its minimum detection limit can reach 10 copies.

[0061] Comparative Example 1

[0062] This comparative example is a conventional single-tube detection method based on isothermal amplification combined with the CRISPR / Cas system, and the target DNA, Cas12a protein, guide RNA, fluorescent reporter probe and buffer in Example 2 are selected.

[0063] (1) The CRISPR / Cas detection reaction solution includes 1×Cas protein buffer, 100nM Cas12 protein, 100nM crRNA, and 400nM FQ probe.

[0064] (2) Preparation of isothermal amplification reaction solution

[0065] DNA target amplification was performed by recombinase polymerase isothermal amplification, using TwistAmp Basic Kit. The recombinase polymerase isothermal amplification reaction solution included 240 nM primers, amplification buffer, amplification enzyme, PCR product containing a partial sequence of the B646L gene of African swine fever virus (ASFV), and 280 mM magnesium acetate.

[0066] (3) Place the CRISPR / Cas detection reaction solution at the bottom of the reaction tube, place the isothermal amplification system reaction solution on the tube wall, centrifuge briefly, incubate at 37°C for 60 minutes, and measure the fluorescence signal intensity of the reaction solution using a real-time quantitative PCR instrument.

[0067] like Figure 4 As shown, when a conventional single-tube isothermal amplification-CRIPSR / Cas system-based detection method is used to detect DNA targets, the method can only detect 100aM. In contrast, the detection sensitivity of the method of the present invention (Example 2) is 1aM, which is 2 orders of magnitude higher than the conventional method.

[0068] Comparative Example 2

[0069] This comparative example is a typical two-tube nucleic acid detection method based on isothermal amplification and CRISPR / Cas detection.

[0070] (1) Isothermal amplification reaction

[0071] This example adopts recombinase polymerase isothermal amplification to amplify DNA targets, using TwistAmpBasic Kit. The recombinase polymerase isothermal amplification reaction solution includes primers, amplification buffer, amplification enzyme, different concentrations of DNA targets (same as in Example 2), and magnesium acetate. The reaction solution is placed at 37°C for 30 minutes.

[0072] (2) CRISPR / Cas detection reaction

[0073] The CRISPR / Cas detection reaction system includes a Cas protein reaction buffer, a Cas12 protein, a guide RNA, an FQ probe, and the amplification product obtained in step (1). The final concentrations of the components in the reaction solution are: the final concentration of the Cas protein reaction buffer is 1×, the final concentration of the Cas12 protein is 100 nM, the final concentration of the silencing guide RNA is 10 nM, and the final concentration of the FQ probe is 400 nM.

[0074] The CRISPR / Cas detection reaction system was reacted at 37° C. for 60 min. The fluorescence signal intensity of the reaction system was measured every minute.

[0075] like Figure 5 As shown, when a typical two-tube nucleic acid detection method based on isothermal amplification and CRISPR / Cas detection is used to detect DNA targets, the method detects 1aM of the target. In contrast, the detection sensitivity of the method of the present invention (Example 2) is also 1aM, achieving the same detection sensitivity as the typical two-tube monitoring method.

[0076] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A one-tube nucleic acid detection method, characterized in that The following steps are involved: Add the nucleic acid detection reaction solution to the bottom of the reaction tube, add the nucleic acid amplification reaction solution to the wall of the same reaction tube, centrifuge briefly to allow the reaction solution on the wall to sink and contact and mix with the reaction solution at the bottom of the tube, incubate and detect the fluorescent signal in the reaction tube; The nucleic acid detection reaction solution contains glycerol, and the volume percentage of glycerol in the reaction system is 10-20%; The reaction system is composed of a nucleic acid detection reaction solution and a nucleic acid amplification reaction solution; The volume ratio of the nucleic acid detection reaction solution to the nucleic acid amplification reaction solution is 1:1; The nucleic acid detection reaction solution also contains a fluorescent reporter probe, crRNA, Cas 12 protein and a reaction buffer; The nucleic acid amplification reaction solution includes amplification primers, a protease required for amplification, an amplification buffer, and an analyte containing a target nucleic acid; The nucleic acid amplification reaction solution is a recombinase polymerase isothermal amplification (RPA) reaction system; The reaction system of the recombinase polymerase isothermal amplification comprises a single-stranded DNA binding protein (SSB), a recombinase and a strand displacement polymerase; The one-tube nucleic acid detection method is a detection method for non-diagnostic and non-therapeutic purposes.

2. The one-tube nucleic acid detection method according to claim 1, characterized in that: The volume percentage of the glycerol in the reaction system is 15%; The incubation is carried out at a temperature of 25-65°C; In the nucleic acid detection reaction solution, the final concentration of the fluorescent reporter probe is 200 nM-1 uM.

Images