Application of circSTX6 in the preparation of a diagnostic and / or prognostic and therapeutic agent for nasopharyngeal carcinoma, and the diagnostic and therapeutic agent

Abstract

The present invention belongs to the technical field of tumor molecular biology, and particularly relates to the application of circSTX6 in the preparation of diagnostic and / or prognostic and therapeutic agents for nasopharyngeal carcinoma, as well as diagnostic and therapeutic agents. It is first discovered that circSTX6 is differentially expressed in nasopharyngeal carcinoma, can be used as a diagnostic or prognostic molecular marker, and may also become a potential target for the treatment of nasopharyngeal carcinoma. In the present invention, antisense oligonucleotides (ASO) are used to design sequences against the splicing sites at the head-to-tail junction of circular RNAs to interfere with circSTX6, and Matrigel invasion experiments and scratch healing experiments are carried out in nasopharyngeal carcinoma cell lines HNE2, CNE2 and HONE1. Compared with the NC group, the invasion and migration abilities of cells in the ASO group are significantly weakened, that is, silencing circSTX6 inhibits the invasion and metastasis of nasopharyngeal carcinoma cells, that is, inhibiting circSTX6 can treat nasopharyngeal carcinoma, which has profound clinical significance and important prospects for popularization and application.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor molecular biology, and specifically relates to an application of circSTX6 in the preparation of diagnostic and / or prognostic and therapeutic preparations for nasopharyngeal carcinoma, and to diagnostic and therapeutic preparations. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a common head and neck malignancy in southern my country, with distinct regional clustering and ethnic predilection. The main risk factors for NPC include genetic factors, Epstein-Barr virus infection, and environmental factors. NPC is mostly a non-keratinizing squamous cell carcinoma with a high malignancy, and cervical lymph node metastasis can occur in the early stages. Currently, NPC treatments primarily rely on radiotherapy, combined chemotherapy, and surgery. Although the 5-year overall survival rate for early-stage NPC patients is as high as 95%, the recurrence rate of nasopharyngeal and cervical lymph nodes ranges from 8.6% to 23.7%. This is because the development and progression of NPC involves complex genetic regulation and a multi-stage process, the molecular mechanisms of which remain largely unknown. Furthermore, due to individual variability caused by tumor heterogeneity and radioresistance, the efficacy of conventional radiotherapy is suboptimal. Therefore, the research on therapeutic targets and diagnostic molecular markers for the treatment of NPC is crucial.

[0003] Circular RNA (circRNA) primarily originates from the exons of protein-coding genes, but can also be formed from introns, UTRs, intergenic regions, non-coding RNA sites, and antisense sites of known transcripts. CircRNAs are a class of non-coding RNA molecules formed by reverse splicing of pre-mRNA precursor messenger RNA (pre-mRNA), lacking a 5'-terminal cap and a 3'-terminal poly(A) tail, and forming a circular lariat structure with covalent bonds.

[0004] The formation process of circRNAs can be divided into two major mechanisms: exon circularization and intron circularization. Jeck et al. proposed that exon-derived circRNAs (ecircRNAs) can be formed by lariat-driven circularization and intron-pairing-driven circularization. In lariat-driven circularization, the 3' end of the exon acts as a splice donor to attack the 5' end of the splice receptor. The Alu region covalently binds to form a lariat structure, which undergoes internal splicing and excises the intron to form a circRNA. Intron-pairing-driven circularization, two introns pair complementary bases to form a circular structure, followed by intron excision to form a circRNA. Intron-pairing-driven circularization, introns themselves can also circularize, forming intron-derived circular RNAs (ciRNAs). CircRNAs are non-coding RNA molecules formed by reverse splicing of pre-mRNAs, lacking a 5' cap and a 3' poly(A) tail, and forming a closed circular structure through covalent bonds. They are characterized by high stability, conservation, specificity, and high abundance.

[0005] CircRNAs were first discovered in RNA viruses in 1976. Subsequently, Hsu MT et al. used electron microscopy to identify circRNAs in the cytoplasm of monkey kidneys. In recent years, an increasing number of circRNAs have been discovered, bringing the total number of known circRNAs to over 30,000. CircRNAs are no longer considered erroneous RNA transcripts but are now emerging as a shining star in non-coding RNA research. The discovery of more novel circRNAs as biomarkers for tumor diagnosis and prognosis, along with their application in patent protection, will significantly enhance my country's international competitiveness in this technology.

[0006] The present invention detected a 391-bp circular RNA, circSTX6. Experiments have shown that this circular RNA is highly expressed in nasopharyngeal carcinoma and can promote the invasion and metastasis of nasopharyngeal carcinoma, potentially serving as a diagnostic or prognostic marker and therapeutic target for nasopharyngeal carcinoma. Summary of the Invention

[0007] The present invention discovered a 391bp circular RNA circSTX6 and found its relationship with nasopharyngeal carcinoma, which may serve as a diagnostic or prognostic marker and therapeutic target for nasopharyngeal carcinoma.

[0008] The first object of the present invention is to provide a use of circSTX6 in preparing a diagnostic and / or prognostic preparation for nasopharyngeal carcinoma, wherein the circSTX6 sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the nasopharyngeal carcinoma diagnosis and / or prognosis preparation includes a reagent for detecting the expression level of circSTX6 by PCR or in situ hybridization.

[0010] Furthermore, the reagent for detecting the expression of circSTX6 by PCR or in situ hybridization comprises:

[0011] Circular RNA circSTX6 real-time quantitative PCR primers

[0012] Upstream primer: 5'-GGCTGGACAATGTGATGAAG-3', as shown in SEQ ID NO. 2;

[0013] Downstream primer: 5'-AGTTCTGGCTGCCACTGTCT-3', as shown in SEQ ID NO. 3;

[0014] Or amplify the full-length primers of circSTX6

[0015] Upstream primer: 5'-CCATCGATGACATGAAAGATCAGATGTCAACTTCAT-3', as shown in SEQ ID NO. 4;

[0016] Downstream primer: 5′-TCCCCGCGGCACTGGTCATATGAGATACTTTTGCAAG-3′, as shown in SEQ ID NO.5.

[0017] The circSTX6 in situ hybridization probe sequence was: 5′-TGATCTTTCATGTCCACTGGTCATATGAG-3′, as shown in SEQ ID NO.6.

[0018] The diagnostic and / or prognostic reagents of the present invention include, but are not limited to, the above-mentioned primer and probe sequences.

[0019] The second object of the present invention is to provide a diagnostic and / or prognostic preparation for nasopharyngeal carcinoma, comprising a reagent for detecting the expression level of circSTX6 by PCR or in situ hybridization, wherein the circSTX6 sequence is shown in SEQ ID NO.1.

[0020] Furthermore, the nasopharyngeal carcinoma diagnostic preparation comprises the above-mentioned primers or in situ hybridization probes.

[0021] The present invention detected the expression level of circSTX6 in clinical tissues of nasopharyngeal carcinoma by qRT-PCR and found that it was significantly upregulated in nasopharyngeal carcinoma tissues compared with non-tumor nasopharyngeal epithelial tissues, and was correlated with the patient's prognosis and survival. The results were statistically significant. It can be seen that circSTX6 can be used as a marker for auxiliary diagnosis or prognosis of nasopharyngeal carcinoma, providing a new detection approach for the diagnosis and prognosis of nasopharyngeal carcinoma.

[0022] The third object of the present invention is to provide an agent for inhibiting the expression of circSTX6 for use in preparing a preparation for treating nasopharyngeal carcinoma, wherein the circSTX6 sequence is shown in SEQ ID NO.1.

[0023] Furthermore, the reagent for inhibiting circSTX6 expression includes antisense oligonucleotides.

[0024] Furthermore, the antisense oligonucleotide ASO (antisense oligonucleotide):

[0025] Sense strand (5'-3'): CAUAUGACCAGUGGACAUGATT, as shown in SEQ ID NO. 7;

[0026] The antisense strand (5'-3') is UCAUGUCCACUGGUCAUAUGTT, as shown in SEQ ID NO.8.

[0027] The fourth object of the present invention is to provide a preparation for treating nasopharyngeal carcinoma, comprising an agent for inhibiting the expression of circSTX6, wherein the sequence of circSTX6 is shown in SEQ ID NO.1.

[0028] Furthermore, the reagent for inhibiting circSTX6 expression includes an antisense oligonucleotide, preferably the antisense oligonucleotide:

[0029] Sense strand (5'-3') CAUAUGACCAGUGGACAUGATT

[0030] Antisense strand (5'-3') UCAUGUCCACUGGUCAUAUGTT.

[0031] The present invention is not limited to the specific ASOs described above.

[0032] Furthermore, the reagent for inhibiting circSTX6 expression also includes a negative control:

[0033] Sense strand (5'-3'): GAGAACGGGAUAGCAUCGACTT, as shown in SEQ ID NO. 9;

[0034] Antisense strand (5'-3'): GUCGAUGCUAUCCCGUUCUCTT, as shown in SEQ ID NO. 10;

[0035] But it is not limited to the above specific negative controls.

[0036] Currently, ASOs have developed into an important tool for gene function research. To explore the role of circSTX6 in tumorigenesis and development, the present invention designed a pair of ASOs based on the splicing site of circSTX6. ASOs and siNC (control) were transiently transfected into HNE2, CNE2, and HONE1 cell lines using Hiperfect reagent to silence circSTX6 expression. After transfection, cells were cultured for 36 hours and collected. The expression level of circSTX6 was detected by real-time fluorescence quantitative PCR to detect the transfection efficiency of ASOs. It was found that the designed ASOs could significantly inhibit the expression level of circSTX6.

[0037] The present invention has confirmed the above conclusion through a large number of experiments: that agents that inhibit circSTX6 expression can be used to prepare nasopharyngeal carcinoma therapeutic agents. These experiments include: in vitro overexpression of circSTX6 was found to promote the invasion and migration of nasopharyngeal carcinoma cells, while in vitro silencing of circSTX6 inhibited the invasion and migration of nasopharyngeal carcinoma cells.

[0038] Because ASO has a good silencing effect, the present invention uses an ASO designed to interfere with circSTX6 by targeting the splicing site where the head and tail of circular RNA meet (silencing only circRNA and having no effect on linear RNA). Scratch healing experiments and matrigel invasion experiments were performed in nasopharyngeal carcinoma cell lines HNE2, CNE2, and HONE1. Compared with the NC (control) group, the invasion and migration ability of cells in the ASO group were significantly weakened, that is, silencing circSTX6 inhibited the invasion and metastasis of nasopharyngeal carcinoma cells. In other words, inhibiting circSTX6 can treat nasopharyngeal carcinoma, which has far-reaching clinical significance and important promotion and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1.Screening and identification of circSTX6 and qRT-RCR detection of circSTX6 expression levels in nasopharyngeal carcinoma clinical tissues; A. Bioinformatics analysis of nasopharyngeal carcinoma tissue sequencing data of GSE68799 in the GEO database found that circSTX6 expression was significantly upregulated in nasopharyngeal carcinoma tissues; BN is non-tumor nasopharyngeal epithelial tissue, with a sample number of 16 cases; T is nasopharyngeal carcinoma tissue, with a sample number of 26 cases, n is the number of samples, all tested using t-test, and p<0.05 was statistically significant.

[0040] Figure 2 Database comparison and Sanger sequencing confirmed that circSTX6 is formed by reverse splicing of exons 4-7 of the STX6 gene, with a size of 391 nt. a. circSTX6 is formed by the end-to-end splicing of exons 4-7 of STX6. E represents exon, and the underlined sequence represents the end-to-end linker sequence. b. Schematic diagram of circSTX6 formation. c. Peak plot of sequencing results. The black arrow indicates where the end-to-end splicing occurs.

[0041] Figure 3 Detection of circSTX6 expression in nasopharyngeal carcinoma cell lines. NP69 is an immortalized normal nasopharyngeal epithelial cell line used as a reference, and the rest are nasopharyngeal carcinoma cell lines.

[0042] Figure 4 Detection of circSTX6's resistance to RNase R. After RNase R treatment, the relative RNA levels of circSTX6 and STX6 in nasopharyngeal carcinoma cells were detected by qRT-PCR.

[0043] Figure 5 To detect the stability of circSTX6, qRT-PCR was used to detect the relative RNA levels of circSTX6 and STX6 in NPC cells at different time points after actinomycin D treatment.

[0044] Figure 6 RNA-FISH assay detected the subcellular localization of circSTX6. CircSTX6 was mostly localized in the cytoplasm.

[0045] Figure 7 .Recombinant plasmid map of circSTX6 overexpression vector.

[0046] Figure 8qRT-PCR was used to examine the overexpression efficiency of the circSTX6 overexpression plasmid and the silencing efficiency of the circSTX6 ASO in nasopharyngeal carcinoma cell lines. A. qRT-PCR was used to examine the overexpression efficiency of the circSTX6 plasmid in nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2. β-actin was used as a reference for circSTX6 expression analysis. B. qRT-PCR was used to examine the silencing efficiency of the circSTX6 ASO in nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2. β-actin was used as a reference for circSTX6 expression analysis. C. Expression of linear STX6 RNA was examined in nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2 after ASO transfection. ns indicates not significant. *p < 0.05, **p < 0.01, ***p < 0.001.

[0047] Figure 9 Effects of in vitro overexpression / silencing of circSTX6 on nasopharyngeal carcinoma cell proliferation. A. Nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2 were transiently transfected with pcDNA3.1(+) circRNA Mini Vector and circSTX6 overexpression plasmid using Neofect. Cell proliferation was assessed by MTT assay after 24 hours of culture. The pcDNA3.1(+) circRNA Mini Vector group was normalized to 1. ns indicates no significance. *p<0.05, **p<0.01, ***p<0.001. B. Nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2 were transiently transfected with siNC and circSTX6 ASO using Hiperfect. Cell proliferation was assessed by MTT assay after 24 hours of culture. The siNC group was normalized to 1. ns indicates no significance. *p<0.05, **p<0.01, ***p<0.001.

[0048] Figure 10Effects of overexpression / silencing of circSTX6 on nasopharyngeal carcinoma cell invasion. A. A Matrigel invasion assay was used to simulate cell crossing a matrix barrier. HONE1, HNE2, and CNE2 cells were transfected with pcDNA3.1(+)CircRNA Mini Vector and a circSTX6 overexpression plasmid 24 hours after transfection. The effect of circSTX6 overexpression on nasopharyngeal carcinoma cell invasion was then examined using a Matrigel invasion assay. The figure below shows a statistical graph of cell number (B). pcDNA3.1(+)CircRNA Mini Vector was normalized to 1. *p<0.05, **p<0.01, ***p<0.001. C. Matrigel invasion assay was used to simulate cell crossing the matrix barrier. HONE1, HNE2, and CNE2 cells were transfected with siNC and circSTX6 ASO for 24 hours. The effect of silencing circSTX6 on the invasion of NPC cells was then examined using Matrigel invasion assay. The right figure shows the statistical graph of cell number (D). siNC was normalized to 1. *p<0.05, **p<0.01, ***p<0.001.

[0049] Figure 11 Effects of overexpression / silencing of circSTX6 on the wound healing ability of nasopharyngeal carcinoma cells HONE1, HNE2, and CNE2. A. HONE1, HNE2, and CNE2 cells were transfected with pcDNA3.1(+) circRNA Mini Vector and circSTX6. After the cells reached 100% density, wounds were inoculated. Images were taken at different time points according to the cell healing rate. The following is a statistical graph of wound width (B). pcDNA3.1(+) circRNA Mini Vector was normalized to 1. *p<0.05, **p<0.01, ***p<0.001. A. HONE1, HNE2, and CNE2 cells were transfected with siNC and circSTX6 ASO. After the cells reached 100% density, wounds were inoculated. Images were taken at different time points according to the cell healing rate. The following is a statistical graph of wound width (C). siNC was normalized to 1. *p<0.05, **p<0.01, ***p<0.001.

[0050] Figure 12 .circSTX6 is highly expressed in nasopharyngeal carcinoma (NPC) tissue and correlates with poor patient prognosis. AB.circSTX6 expression was verified by in situ hybridization in paraffin-embedded tissue sections from 95 NPC patients and 25 normal tissues (nasopharyngeal epithelium, NPE). B.High circSTX6 expression is associated with shortened overall survival in NPC patients. DETAILED DESCRIPTION

[0051] The following specific embodiments are intended to further illustrate the present invention, but not to limit the present invention.

[0052] The nasopharyngeal carcinoma cell lines used in this invention, including HNE2, CNE2, and HONE1, were all maintained by the Molecular Genetics Laboratory of the Institute of Oncology at Central South University. Cell culture conditions included RPMI1640 liquid medium supplemented with 10% fetal bovine serum (FBS) and 1% double-streptomycin (penicillin and streptomycin), grown in a constant-temperature incubator at 37°C, 95% humidity, and 5% CO2.

[0053] The circular RNA primers of the present invention are designed differently from linear RNA primers. They are designed based on both sides of the splicing site and are designed online on the Primer3.0 website. The final primer synthesis work was commissioned to the Changsha Synthesis Department of Qingke Biotechnology Co., Ltd.

[0054] (1)β-actin

[0055] Upstream primer: 5'-TCACCAACTGGGACGACATG-3'; as shown in SEQ ID NO.11;

[0056] Downstream primer: 5'-GTCACCGGAGTCCATCACGAT-3'; as shown in SEQ ID NO.12;

[0057] (2) Circular RNA circSTX6 real-time quantitative PCR primers

[0058] Upstream primer: 5'-GGCTGGACAATGTGATGAAG-3'

[0059] Downstream primer: 5'-AGTTCTGGCTGCCACTGTCT-3'

[0060] (3) Primers for amplifying the full length of circSTX6

[0061] Upstream primer: 5'-CCATCGATGACATGAAAGATCAGATGTCAACTTCAT-3'

[0062] Downstream primer: 5'-TCCCCGCGGCACTGGTCATATGAGATACTTTTGCAAG-3'

[0063] In order to specifically knock down circular RNA without affecting its linear gene expression, the present invention designs ASO according to the splicing site to target and silence circSTX6.

[0064] circSTX6 ASO sequence:

[0065] Sense strand (5'-3') CAUAUGACCAGUGGACAUGATT

[0066] Antisense strand (5'-3') UCAUGUCCACUGGUCAUAUGTT.

[0067] Negative control:

[0068] Sense strand (5'-3') GAGAACGGGAUAGCAUCGACTT

[0069] Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCTT.

[0070] All experimental results were statistically analyzed: t-tests were used to evaluate differences between groups. Chi-square tests were used to assess differences in gene expression or non-expression across clinical parameters such as gender, age, tumor stage, clinical staging, and metastasis. A p value < 0.05 was considered statistically significant, and all p-values ​​were two-sided. Statistical analyses were performed using SPSS 13.0 and Graphpad 7.0 software.

[0071] Example 1: Screening and identification of circSTX6

[0072] The present invention downloaded a set of RNA-seq data from the GEO database, including 4 normal nasopharyngeal tissue samples and 41 nasopharyngeal carcinoma tissue samples, a total of 45 clinical samples, with the number GSE68799. By analyzing this set of nasopharyngeal carcinoma tissue RNA-seq data, 8884 circRNAs were identified. Subsequently, the data were differentially analyzed using SAM software, and 178 circRNA molecules with significant differences between normal nasopharyngeal tissue and nasopharyngeal carcinoma tissue were obtained. Among them, hsa_circ_23135 (circSTX6) ( Figure 1 ).

[0073] Example 2: Sanger sequencing confirmed that circular RNA was formed

[0074] To prove that circSTX6 forms a circular RNA rather than a linear one, Figure 1The qRT-PCR product in B was recovered and sent to the company for Sanger sequencing (Qingke Company). The sequence returned by the company was compared with DNASTAR software, and the peak graph was viewed with chromas software to judge the quality of sequencing. The results showed that circSTX6 was indeed formed by the head-to-tail connection of exons 4-7 of the parent gene STX6. a.circSTX6 is formed by the head-to-tail splicing of exons 4-7 of STX6, E represents exon (exon), and the underlined sequence represents the head-to-tail junction sequence; b. Schematic diagram of circRNA formation; c. Peak graph of sequencing results, the black arrow indicates the head-to-tail connection from here (see Figure 2 ).

[0075] Example 3: Expression of circSTX6 in nasopharyngeal carcinoma cells

[0076] 1. Extraction of total cell RNA

[0077] Preparation: Sterile RNase-free water, 75% ethanol (RNase-free preparation), chloroform, isopropanol, 1× PBS, enzyme-free tips and EP tubes. Precool a high-speed low-temperature centrifuge to 4°C. Before the experiment, wipe the laboratory table and pipette with 75% alcohol.

[0078] 1) Take the cells to be extracted RNA and wash them twice with 1× PBS or D-hanks;

[0079] 2) Add 500 μL of Trizol lysis buffer to each well of a 12-well plate and lyse at room temperature for 1-2 minutes. Gently dislodge the cells with a pipette, gently invert up and down 10 times, and let stand at room temperature for 5 minutes.

[0080] 3) Add 100 μL of chloroform (1 mL Trizol: 0.2 mL chloroform: 0.5 mL isopropanol), shake vigorously for 15-30 seconds, and place on ice for 5 minutes;

[0081] 4) 4°C, 12000 rpm / 20 min;

[0082] 5) Place the upper aqueous phase in a pre-chilled tube, add 250 μL of isopropanol, and mix thoroughly using a vortex mixer or pipette (-20°C for >1 hour).

[0083] 6) 4°C, 12,000 rpm / 30 min, discard the supernatant;

[0084] 7) Add 1 mL of 75% ethanol (pre-cooled) and mix thoroughly;

[0085] 8) Incubate at 4°C, 7600 rpm for 5 min; discard the supernatant and repeat steps 8 and 9;

[0086] 9) Flash for 10 seconds, aspirate as much supernatant as possible, and invert to dry for 10 minutes;

[0087] 10) Add 20-30 μL DEPC and measure RNA concentration and OD value.

[0088] 2. circRNA reverse transcription PCR reaction

[0089] (According to the experimental instruction manual of abm's 5×All-In-OneRTMasterMix (withAccuRTGenomicDNARemovalKit) (#G492))

[0090] Configure the following reaction system:

[0091]

[0092] The reverse transcription PCR reaction procedure is as follows:

[0093] 25℃ 10min,

[0094] 42℃ 15min,

[0095] 85℃ 5min.

[0096] After the reaction was completed, the product was stored at -20°C for later use.

[0097] 3. Real-time fluorescence quantitative PCR

[0098] First, dilute the reverse transcription reaction product 5-fold, and then follow the abm company's EvaGreen qPCR MasterMix (MasterMix-R) experimental instructions to configure the following reaction system:

[0099]

[0100] The reaction program on the real-time fluorescence quantitative PCR machine is as follows: (Cycle × 39)

[0101]

[0102] After completing the above reaction using a Bio-Rad IQ5 real-time fluorescence quantitative PCR instrument, the target gene expression levels were normalized to the internal reference gene β-actin. The relative expression levels of the target genes were displayed as 2-ΔΔCT values ​​to determine gene expression differences. The p-value was calculated using the unpaired t-test.

[0103] Results: The expression of circSTX6 in NPC cells was significantly higher than that in normal nasopharyngeal epithelial cells NP69 ( Figure 3). Therefore, circSTX6 is highly expressed in NPC cell lines, and circSTX6 may have important biological functions in the occurrence and development of NPC. Based on this, antisense oligonucleotides can be used for the treatment of NPC.

[0104] Example 4: RNase R digestion experiment

[0105] 1 Reaction system

[0106] RNase R digestion reaction system

[0107]

[0108] 2 Reaction conditions

[0109] 37℃, 10-30min.

[0110] Note: 1) Digestion time can be extended as the amount of RNA increases. Generally, 10-30 minutes is sufficient to digest most linear RNAs, but PCR analysis reveals a several hundred-fold decrease in linear RNA abundance. Digestion times exceeding 1 hour are not necessary, as prolonged digestion may result in the digestion of a few weakly resistant circRNAs. 2) After incubation, the cells can be purified and recovered, or the enzyme can be inactivated at 70°C for 10 minutes before proceeding directly to downstream experiments.

[0111] 3. Purification and recovery

[0112] The digested RNA can be extracted with phenol:chloroform:isoamyl alcohol (25:24:1, V:V) solution and then recovered by ethanol precipitation; or purified and recovered using RNA purification columns and magnetic beads. qRT-PCR detection of circSTX6 and linear mRNA STX6 (see Figure 4 ).

[0113] Note: Phenol:chloroform:isoamyl alcohol (25:24:1, V:V) solution is best prepared and used immediately. If the reagent is unavailable, Trizol Reagent can be used instead.

[0114] Example 5: Actinomycin D treatment experiment

[0115] To detect the stability of circRNA and linear RNA, nasopharyngeal carcinoma cells were seeded into 12-well plates at a density of about 50%. After the cells adhered, actinomycin D was added at a final concentration of 1 μg / mL for 0, 8, 16, and 24 hours, respectively. RNA was extracted from the cells and reverse transcribed into cDNA. The expression of circSTX6 and STX6 mRNA was detected by qRT-PCR, with 18s as the internal reference ( Figure 5 ).

[0116] Example 6: RNA-fish assay to detect the localization of circSTX6 in cells

[0117] Since ASOs mainly act in the cytoplasm, detecting the localization of circSTX6 can determine whether it can effectively interfere with the expression of circSTX6. Using RNA-FISH to detect the proportion of circSTX6 expression in the nucleus and cytoplasm, it was found that circSTX6 is mainly localized in the cytoplasm. (See Figure 6 ).

[0118] RNA-fish steps:

[0119] 1) Slide culture: Seed adherent cells into a 24-well plate at 1000 cells / well (with slides placed in the wells in advance) and culture in an incubator overnight.

[0120] 2) Aspirate the culture medium and wash twice with 37°C preheated PBS for 5 minutes each time;

[0121] 3) Fixation: Add 200 μL of 4% paraformaldehyde to each well and fix at room temperature for 15 minutes;

[0122] 4) Permeabilization: Aspirate and discard the fixative solution, add 200 μL of 0.25% Triton X-100 (freshly prepared, dissolved in PBS) to each well, and treat at room temperature for 15 minutes;

[0123] 5) Wash twice with PBS, 5 min each time;

[0124] 6) Prehybridization: Prepare a wet chamber. Add 20 mL of 20% glycerol to the bottom of the chamber to maintain temperature. Add 20 μL of prehybridization solution to each section. Incubate in a 37°C incubator for 2-4 hours. Aspirate excess liquid without washing.

[0125] 7) Dilute the digoxigenin-labeled circSTX6 RNA probe with hybridization solution, add 20 μL of hybridization solution to each section (concentration is generally 4 μM / 8 μM, volume 15-20 μL), and incubate in a constant temperature box at 37°C overnight (more than 16 hours);

[0126] 8) Washing of hybridization slides: Wash twice in 2xSSC at 30-37°C for 5 minutes each; wash once in 0.5xSSC for 5 minutes; wash once in 0.2xSSC for 5 minutes. If necessary, wash again in 0.2xSSC for 5 minutes.

[0127] 9) Add blocking solution dropwise at 37°C for 30 min, remove excess liquid, and do not wash;

[0128] 10) Add biotinylated mouse anti-digoxigenin antibody dropwise and incubate at 37°C for 60 min or at room temperature for 2 h. Wash four times with 0.5 M x PBS, 5 min each time.

[0129] 11) Add fluorescent secondary antibody (1:200) and incubate at 37°C for 60 min. Wash three times with 0.5 M x PBS, 5 min each time.

[0130] 12) Add DAPI working solution and stain for 10 minutes in the dark;

[0131] 13) Wash three times with 0.5M x PBS, 5 min each time;

[0132] 14) Seal the film and take photos.

[0133] Example 7: Detection of the effect of circSTX6 overexpression in nasopharyngeal carcinoma cell lines

[0134] First, we selected the restriction enzyme sites and put the full-length sequence of circSTX6 into the NEB cutter 2.0 online website for analysis. The results showed that the ClaI and SacII restriction enzyme sites were not present in the full-length sequence of circSTX6. At the same time, the DNA restriction enzymes were present only in the pcDNA3.1(+)CircRNA Mini Vector plasmid (purchased from Sangon Biotech Co., Ltd.). The full-length sequence of circSTX6 was cloned into the pcDNA3.1(+)CircRNA Mini Vector plasmid empty vector. Figure 7 The figure shows the overexpression vector map.

[0135] In order to detect the circularization efficiency of circSTX6, we first overexpressed the constructed pcDNA3.1(+)CircRNA MiniVector / circSTX6 eukaryotic overexpression vector in nasopharyngeal carcinoma cells. The third and fourth generation nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 with good growth conditions were seeded into 12-well plates. When the cell confluence reached 60%-80%, the endotoxin-free plasmid pcDNA3.1(+)CircRNA Mini Vector empty vector and circSTX6 overexpression vector were transiently transfected into nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 using Neofect. The cells were cultured for 36 hours and then collected. The expression level and circularization efficiency of circSTX6 were detected by real-time fluorescence quantitative PCR. The qPCR results showed that the expression level of circSTX6 in the cells transfected with the circSTX6 overexpression plasmid group was significantly increased compared with the cells in the pcDNA3.1(+)CircRNA MiniVector empty plasmid group, and the results were statistically significant (see Figure 8 A).

[0136] Example 8: Detection of the effect of silencing circSTX6 expression in nasopharyngeal carcinoma cell lines

[0137] Antisense oligonucleotides (ASOs) are a class of molecules that inhibit the expression of target genes by binding to the target gene DNA or mRNA in a sequence-specific manner. ASOs are hybrids of single-stranded DNA and RNA and act through Rnase-H. This enzyme is also present in the nucleus, so it can interfere with genes in the nucleus and cytoplasm at the same time. ASOs are designed for splicing sites and sequences complementary to the target sequence, thereby avoiding interference with the expression of linear RNA. Currently, ASOs have developed into an important tool for studying gene function. In order to explore the role of circSTX6 in the occurrence and development of tumors, we designed ASOs based on the splicing site of circSTX6, and used Hiperfect reagent to transiently transfect ASOs and siNC (blank control) into HONE1, HNE2 and CNE2 cell lines to silence the expression of circSTX6. After transfection, the cells were cultured for 36 hours and collected, and the expression level of circSTX6 was detected by real-time fluorescence quantitative PCR to detect the transfection efficiency of ASO and confirm the circSTX6 knockdown effect (see Figure 8 B). However, when linear primers were designed based on the circSTX6 sequence, real-time fluorescence quantitative PCR revealed that ASO did not knock down the expression of linear RNA, indicating that ASO specifically silenced the expression of circSTX6 (see Figure 8 C).

[0138] In this example, the antisense oligonucleotide:

[0139] Sense strand (5'-3') CAUAUGACCAGUGGACAUGATT

[0140] Antisense strand (5'-3') UCAUGUCCACUGGUCAUAUGTT.

[0141] Blank control:

[0142] Sense strand (5'-3') GAGAACGGGAUAGCAUCGACTT

[0143] Antisense strand (5'-3') GUCGAUGCUAUCCCGUUCUCTT.

[0144] Example 9: MTT assay to detect cell proliferation

[0145] We first used Hiperfect to transfect siNC and ASO circSTX6, or used Neofect to transiently transfect the endotoxin-free plasmid pcDNA3.1(+)CircRNA Mini Vector and circSTX6 overexpression vector into nasopharyngeal carcinoma cells HONE1, HNE2, and CNE2. After culturing for 24 hours, we performed MTT assays to verify their effects on cell proliferation. The results showed that ASO circSTX6 significantly inhibited the proliferation of the three cell lines, while overexpression of circSTX6 significantly promoted the proliferation of the three cell lines ( Figure 9 )

[0146] 1) Preparation: Tips, autoclaved D-hanks, pipettes, markers, 15 mL centrifuge tubes, etc., disinfected with alcohol and then placed in a biosafety cabinet under UV irradiation for 30 minutes, followed by ventilation for 10 minutes.

[0147] 2) Seeding and transfection: The day before, place a 25 cm 2 The cells in good condition in the cell flask were digested and seeded into 6-well plates. When the cell density reached about 70%, ASO circSTX6 was transfected, or when the cell density reached about 80-90%, the overexpression vector was transfected.

[0148] 3) 12 hours after transfection, discard the cell supernatant by aspiration, wash three times with D-hanks, add 100 μL of trypsin to each well of a 6-well plate, and after digestion, dislodge the cells until they are rounded. Transfer the cells to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, add 1-2 mL of culture medium, mix thoroughly, and aspirate 10 μL of the supernatant onto a cell counting plate for cell counting. Based on the cell count results, dilute the cells to 5000 cells / mL.

[0149] 4) Add the diluted cell suspension to a 96-well plate, adding 200 μL of cell suspension to each well. Add 200 μL of Dank's buffer to the outermost wells of the 96-well plate and place the plate in an incubator for continued culture.

[0150] 5) After approximately 6–8 hours of cell attachment, add 20 μL of MTT to each well and continue incubation for another 4 hours. Carefully aspirate the culture supernatant and add 200 μL of DMSO to each well. Shake on a shaker for 10 minutes. Measure the absorbance of the DMSO-added wells using an enzyme-linked immunosorbent assay (ELISA) at 490 nm and record the results. Add MTT and DMSO daily at the same time point for 6 consecutive days and analyze the absorbance.

[0151] Example 10: Cell transwell invasion assay:

[0152] 1) Matrigel Preparation: One day in advance, thaw BD Matrigel stored at -20°C in a 4°C refrigerator until liquid. Place the tips and EP tubes used for diluting the Matrigel at -20°C overnight to prevent the Matrigel from solidifying too quickly when spreading the gel the next day.

[0153] 2) Matrigel dilution: BD Matrigel gel: serum-free medium = 1:8, i.e., add 20 μL of Matrigel to 160 μL of 1640 medium and mix thoroughly by pipetting gently;

[0154] 3) Add 100 μL of diluted Matrigel to the transwell chamber, aspirate 80 μL along the edge, layer the cells in a 37°C incubator, and incubate for 2-3 hours. When the layer turns white, the liquid Matrigel has solidified.

[0155] 4) Digest the cells 24 hours after transfection, wash twice with serum-free medium, and then resuspend the cells in serum-free medium. Count the cells and adjust the cell concentration to 20,000 cells per 200 μL.

[0156] 5) Add 800 μL of 1640 medium containing 20% ​​FBS to the lower chamber. Tilt the 24-well plate at a 45° angle when inserting the chamber to avoid bubbles forming between the chamber and the liquid surface during the insertion process.

[0157] 6) Add 200 μL of counted cell suspension to each chamber of the transwell. Return the 24-well plate to the 37°C incubator and incubate for approximately 24-48 hours, depending on the cell status and cell invasion rate.

[0158] 7) Take out the 24-well plate, wash it twice with PBS or D-hanks, soak it in 4% paraformaldehyde for 10 minutes, and wash it three times with clean water.

[0159] 8) Staining: Add 0.1% crystal violet to the bottom of the transwell chamber, let it stand at room temperature for 5-10 minutes, wash it with PBS 2-3 times, and carefully wipe off the Matrigel on the chamber with a cotton swab;

[0160] 9) Add 800 μL of distilled water to the 24-well plate and approximately 200 μL of distilled water to the upper chamber of the transwell. Then, take pictures at 5 different fields of view under an inverted microscope. Use Image J software to count and statistically analyze the significance of the differences.

[0161] Silencing circSTX6 expression in vitro inhibits nasopharyngeal carcinoma invasion

[0162] In order to explore whether silencing circSTX6 can affect the invasion of nasopharyngeal carcinoma, we conducted Transwell chamber matrix gel invasion experiments in three cell lines, and used Hiperfect reagent to transiently transfect circSTX6 ASO and siNC into HONE1, HNE2 and CNE2 cell lines to silence the expression of circSTX6. Transwell chamber matrix gel invasion experiments were performed in nasopharyngeal carcinoma cell lines HONE1, HNE2 and CNE2 in which circSTX6 was silenced. The results showed that the number of tumor cells observed on the lower surface of the Transwell chamber in the ASO group was significantly less than that in the NC group, and the trends of the results of the three cell lines were consistent. Five photos were taken randomly and the number of cells was recorded. There were significant differences between the two groups in each cell line, and they were statistically significant. The above results show that silencing the expression of circSTX6 in nasopharyngeal carcinoma cell lines can inhibit the in vitro invasion ability of nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 ( Figure 10 ).

[0163] Overexpression of circSTX6 in vitro promotes invasion of nasopharyngeal carcinoma cells

[0164] We conducted a Transwell chamber matrix gel invasion experiment on the nasopharyngeal carcinoma cell lines HONE1, HNE2 and CNE2 to observe the effect of silencing circSTX6 on cell invasion ability. We also used Neofect to transiently transfect nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 with the endotoxin-free plasmid pcDNA3.1(+)CircRNA Mini Vector and the circSTX6 overexpression vector, and continued to culture for 48 hours. The cells were collected and the expression level and circularization efficiency of circSTX6 were detected using real-time fluorescence quantitative PCR. After confirming the good overexpression effect of the circSTX6 overexpression plasmid, we inoculated the cells into the Transwell chamber covered with matrix gel and found that the number of cells in the overexpression plasmid group that invaded the lower surface of the chamber was significantly greater than that in the empty group, and the trends of the results of the three cell lines were consistent. Three photos were taken randomly and the number of cells was recorded. There were significant differences between the data of the two groups in each cell line, and they were statistically significant (see the results). Figure 10 The above results show that overexpression of circSTX6 in nasopharyngeal carcinoma cell lines promotes the invasion ability of nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 in vitro. It was proved in both positive and negative directions that circular RNA circSTX6 can promote the invasion of nasopharyngeal carcinoma cells (see the results). Figure 10 ).

[0165] Example 11: Cell scratch healing and migration assay

[0166] 1) Illuminate the cell stage: 1000μL / 10μL Tip, autoclaved D-Hank's, ruler, 1000μL / 10μL pipette, marker pen, etc. Sterilize with alcohol and place in a clean bench under UV light for 30 minutes.

[0167] 2) When the cells grow to about 50% to 70%, transfect them with ASO and NC groups or plasmids respectively;

[0168] 3) After the cells have spread across the bottom of the plate, begin scratching the next day: Hold a 10 μL pipette tip perpendicular to a ruler and quickly make a cross or well scratch on the bottom of the 6-well plate. Do not tilt the tip and use consistent force to ensure the scratch width is as consistent as possible.

[0169] 4) Aspirate the culture medium and gently wash the tube three times with D-hanks to remove as much debris as possible caused by scratching.

[0170] 5) 1640 medium containing 1% double antibody and 2% fetal bovine serum;

[0171] 6) Take a photo and record the width of the scratch next to the cross at this time, which is recorded as 0h;

[0172] 7) Place the 6-well plate back into the incubator and photograph the same location every 12 hours, marking the time as 12 hours.

[0173] 8) Take pictures of the same location again every 24 hours until the scratch heals, organize all pictures, and perform statistical analysis.

[0174] Silencing circSTX6 in vitro inhibits the migration of nasopharyngeal carcinoma cells

[0175] ASO and siNC were transiently transfected into HONE1, HNE2 and CNE2 cell lines using Hiperfect reagent to silence the expression of circSTX6. A scratch experiment was performed in the nasopharyngeal carcinoma cell lines HONE1, HNE2 and CNE2 in which circSTX6 was silenced to verify its effect on cell migration. The scratch healing experiment confirmed at multiple time points in these cells that the migration ability of the ASO group cells was significantly weakened compared with the NC group. The difference in scratch width was obvious and statistically significant. The above results show that silencing the expression of circSTX6 in nasopharyngeal carcinoma cell lines can inhibit the migration ability of nasopharyngeal carcinoma cells HONE1, HNE2 and CNE2 in vitro ( Figure 11 ).

[0176] Overexpression of circSTX6 promotes the migration of nasopharyngeal carcinoma cells in vitro

[0177] Neofect was used to transiently transfect nasopharyngeal carcinoma cells HONE1, HNE2, and CNE2 with the endotoxin-free plasmid pcDNA3.1(+)CircRNA Mini Vector and the circSTX6 overexpression vector. After confirming the good overexpression effect of the circSTX6 overexpression plasmid, we performed a cell scratch healing experiment on the nasopharyngeal carcinoma cell lines HONE1, HNE2, and CNE2. The scratch healing experiment confirmed at multiple time points in these cells: compared with the empty pcDNA3.1(+)CircRNA Mini Vector plasmid group, the migration ability of cells in the circSTX6 overexpression plasmid group was significantly enhanced. The difference in scratch width was large and statistically significant. The above results show that overexpression of circSTX6 in nasopharyngeal carcinoma cell lines can promote the migration ability of nasopharyngeal carcinoma cells HONE1, HNE2, and CNE2 in vitro. Verification in both positive and negative directions has proved that circSTX6 can promote the migration of nasopharyngeal carcinoma cells ( Figure 11 ).

[0178] Example 12: In situ hybridization experiment

[0179] In this study, 95 NPC clinical tissue samples were collected, including 25 NPE (para-cancer tissue) and 95 NPC (nasopharyngeal carcinoma tissue). The expression of circSTX6 in paraffin-embedded NPC tissues and para-cancer tissues was detected using an in situ hybridization kit (BOSTER, Wuhan, China). The probe sequence (5'-TGATCTTTCATGTCCACTGGTCATATGAG-3') was designed to span the circSTX6 splice site (~30 nt). A semi-quantitative scoring system was used to assess staining density and depth. Double-blind scoring was performed by two experienced pathologists. (1) Staining intensity: 0, no staining; 1, light brown; 2, brown without background or dark brown with light brown background (moderate positive); 3, dark brown without nonspecific background (strong positive). (2) Score based on the ratio of positive signal to total cell number: 0, no positive cells; 1, 0–25%; 2, 25–50% positive rate; 3, 50–70% positive rate; 4, 70–100% positive rate. The present invention used in situ hybridization to detect the expression of circSTX6 in nasopharyngeal carcinoma tissues and adjacent non-tumor tissues, and found that circSTX6 was highly expressed in nasopharyngeal carcinoma tissues ( Figure 12 A). When simultaneously analyzing the high and low expression of circSTX6 in NPE (paracancerous tissue) and NPC (nasopharyngeal carcinoma tissue), the positive rate of circSTX6 greater than 25% was defined as high expression. The distribution of high and low expression of circSTX6 in NPE and NPC was obtained ( Figure 12B). In addition, overall survival (OS) curves were generated using Kaplan-Meier survival analysis, which revealed that patients with higher levels of circSTX6 in nasopharyngeal tissues had significantly shorter overall survival ( Figure 12 C). When analyzing the overall survival rate of nasopharyngeal carcinoma patients, the present invention defines circSTX6 low expression as circSTX6 in nasopharyngeal carcinoma with a positive rate of less than 50%, and circSTX6 high expression as circSTX6 high expression as greater than 50%. In the circSTX6 low expression group, 41 cases died, 22 survived, and the overall survival rate of nasopharyngeal carcinoma patients was 35%. In the circSTX6 high expression group, 28 cases died, 4 survived, and the overall survival rate of nasopharyngeal carcinoma patients was 12.5% ​​( Figure 12 C). Sequence Listing <110> central south university <120> Application of circSTX6 in the preparation of diagnostic and / or prognostic and therapeutic preparations for nasopharyngeal carcinoma and diagnostic and therapeutic preparations <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 391 <212> RNA <213> Homo sapiens <400> 1 gacaugaaag aucagauguc aacuucaucu gugcaggcau uagcugaaag aaaaaauaga 60 caggcacugc ugggagacag uggcagccag aacuggagca cuggaacaac agauaaauau 120 gggcgucugg accgagagcu ccagagagcc aauucucau ucauugagga gcagcaggca 180 cagcagcagu ugaucgugga acagcaggau gagcaguugg agcuggucuc uggcagcauc 240 ggggugcuga agaacauguc ccagcgcauc ggaggggagc uggaggaaca ggcaguuaug 300 uuggaagauu ucucucacga auuggagagc acucagucccc ggcuggacaa ugugaugaag 360 aaacuugcaa aaguaucuca uaugaccagu g 391 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ggctggacaa tgtgatgaag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 agttctggct gccactgtct 20 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <400> 4 ccatcgatga catgaaagat cagatgtcaa cttcat 36 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <400> 5 tccccgcggc actggtcata tgagatactt ttgcaag 37 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <400> 6 tgatctttca tgtccactgg tcatatgag 29 <210> 7 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 7 cauaugacca guggacauga tt 22 <210> 8 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 8 ucauguccac uggucauaug tt 22 <210> 9 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 9 gagaacggga uagcaucgac tt 22 <210> 10 <211> twenty two <212> DNA / RNA <213> Artificial Sequence <400> 10 gucgaugcua ucccguucuc tt 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 tcaccaactg ggacgacatg 20 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <400> 12 gtcaccggag tccatcacga t 21

Claims

1. Use of a reagent for detecting circSTX6 gene expression in the preparation of a diagnostic and / or prognostic preparation for nasopharyngeal carcinoma, wherein the circSTX6 sequence is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The nasopharyngeal carcinoma diagnosis and / or prognosis preparation includes a reagent for detecting the expression level of circSTX6 by PCR or in situ hybridization.

3. The use according to claim 2, characterized in that The reagents for detecting the expression of circSTX6 by PCR or in situ hybridization include: Circular RNA circSTX6 real-time quantitative PCR primers: Upstream primer: 5'-GGCTGGACAATGTGATGAAG-3' Downstream primer: 5′- AGTTCTGGCTGCCACTGTCT -3′; Or amplify the full-length primers of circSTX6 Upstream primer: 5'- CCATCGATGACATGAAAGATCAGATGTCAACTTCAT -3' Downstream primer: 5′- TCCCCGCGGCACTGGTCATATGAGATACTTTTGCAAG -3′; circSTX6 in situ hybridization probe sequence: 5′-TGATCTTTCATGTCCACTGGTCATATGAG-3′.

4. Application of reagents that inhibit circSTX6 expression in the preparation of preparations for the treatment of nasopharyngeal carcinoma, The circSTX6 sequence is shown in SEQ ID NO. 1; The reagents for inhibiting circSTX6 expression include antisense oligonucleotides; The antisense oligonucleotide: Sense strand (5'-3') CAUAUGACCAGUGGACAUGATT Antisense strand (5'-3') UCAUGUCCACUGGUCAUAUGTT.

Images