A method for breeding Hexagrammos otakii with fast growth potential

Abstract

The present invention provides a method for breeding Hexagrammos otakii with fast growth potential, that is, screening the parents of fast-growing Hexagrammos otakii through SNP loci. The detected SNP locus is located at the 361st position of the nucleotide fragment with the sequence of SEQ ID NO: 1, and its base is C or T. The present invention determines that there is an SNP locus related to growth traits at the 361st position of the intron of the growth hormone gene of Hexagrammos otakii, and the growth rate of individuals with the CC homozygous genotype is significantly higher than that of TT genotype and CT genotype individuals. Therefore, in production, individuals with the CC genotype at this locus can be preferentially selected as parents or for large-scale farming.

Description

Technical Field

[0001] The present invention belongs to the technical field of fish genetic breeding, and specifically provides a method for breeding Hexagrammos otakii with fast growth potential. Background Art

[0002] Hexagrammos otakii is a fish of the genus Hexagrammos in the family Hexagrammidae. It is a cold-temperate marine fish that inhabits the bottom layer of the coastal waters. It lives near the rocky reefs along the coast and islands throughout the year, generally at a water depth within 50 meters, with a temperature of 8 - 23 °C and a salinity of 16 - 32‰. It is a carnivorous fish with a wide variety of food intakes.

[0003] Before the breakthrough of artificial breeding technology, the fry of Hexagrammos otakii used for cage culture all came from wild fry. The yield was unstable and showed a decreasing trend year by year, making it difficult to meet the large-scale and high-yield aquaculture requirements. On the other hand, capturing wild fry from nature itself is a plundering and destruction of natural resources, which is contrary to the concepts of fishery resource restoration and ecological protection. Due to overfishing and environmental changes, the natural resources of Hexagrammos otakii are almost exhausted, so artificial breeding has attracted more and more widespread attention in aquaculture.

[0004] However, there are still problems in the large-scale artificial breeding of Hexagrammos otakii at present. Because the living habits of Hexagrammos otakii determine that it is suitable for cage culture in the sea and not for industrialized culture. Therefore, at present, the artificial fry of Hexagrammos otakii mostly uses adult fish from wild or cage culture in the sea. However, whether the wild or cage-cultured adult fish are transferred to the workshop for accelerated maturation and cultivation, it will cause great changes in their living environment and conditions, and it is easy to appear phenomena such as clustering, being frightened, and not feeding, resulting in fish body injuries, infections, fin rot and tail rot, reducing the immune level of the fish body, and then leading to gonadal degeneration and even a large number of deaths, which greatly restricts the success rate of broodstock cultivation of Hexagrammos otakii.

[0005] Molecular marker-assisted breeding is a modern biological breeding method for quickly obtaining ideal families, strains or varieties. Molecular marker breeding has been applied to the genetic breeding field of aquatic animals, but it has also been applied in livestock and poultry and aquatic animals. Compared with traditional methods, it improves the breeding efficiency. However, there are still lacking molecular markers related to growth traits in the breeding field of Hexagrammos otakii. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for breeding Hexagrammos otakii with fast growth potential, which screens the parents of fast-growing Hexagrammos otakii through SNP loci.

[0007] The present invention first provides an SNP locus related to the growth trait of Hexagrammos otakii. The SNP locus is located at the 361st position of the nucleotide fragment with the sequence of SEQ ID NO: 1, and its base is C or T;

[0008] The SNP loci provided by the present invention can be used as molecular markers to breed Hexagrammos otakii individuals with fast growth potential.

[0009] Another aspect of the present invention also provides a method for screening Hexagrammos otakii individuals with fast growth potential, which is to screen by detecting the genotypes of the above SNP loci;

[0010] The method is to amplify the genomic DNA of the Hexagrammos otakii individual to be detected by a primer pair, sequence and analyze the amplification product, and determine whether the individual to be detected has fast growth potential;

[0011] The method, wherein the primer pair used includes:

[0012] Forward primer: 5′-CAATCACAGACAACCAGCGGGA-3′ (SEQ ID NO: 2),

[0013] Reverse primer: 5′-GGGTGCAGTTAGCTTCTGGAAG-3′ (SEQ ID NO: 3);

[0014] The sequencing analysis is to determine the genotypes of the SNP loci, wherein the growth rate of individuals with the CC homozygous genotype is significantly higher than that of TT genotype and CT genotype individuals.

[0015] The present invention determines that there is an SNP locus related to growth traits at the 361st position of the intron of the growth hormone gene of Hexagrammos otakii, and the growth rate of individuals with the CC homozygous genotype is significantly higher than that of TT genotype and CT genotype individuals. Therefore, in production, individuals with the CC genotype at this locus can be preferentially selected as parents or for large-scale farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Sequencing peak maps of TT genotype, CC genotype and CT genotype of SNP markers. DETAILED DESCRIPTION OF THE INVENTION

[0017] Single nucleotide polymorphism (SNP) refers to the DNA sequence polymorphism caused by single nucleotide mutations on genomic DNA. Selecting seeds by determining SNPs and genotype typing has been widely applied in the aquaculture field.

[0018] The present invention constructs a family of Hexagrammos otakii with growth advantages. By comparing the sequences of growth hormone genes between family members and non-family members, SNP sites are screened out, and the correlation between the genotype frequencies of the sites and the growth traits of Hexagrammos otakii is analyzed. It is found that there is an SNP site related to growth traits at the 361st position of the intron of the growth hormone gene. The growth rate of individuals with the CC homozygous genotype is significantly higher than that of individuals with the TT genotype and the CT genotype. Therefore, in production, individuals with the CC genotype at this site can be preferentially selected as parents or for large-scale farming.

[0019] The present invention will be described in detail below through examples and drawings.

[0020] Example 1: Establishment of a family of Hexagrammos otakii

[0021] A family of Hexagrammos otakii with growth advantages is established in the pilot base of the Shandong Marine Biology Research Institute. Individuals with obvious growth advantages among the same batch of fry reproduced from wild Hexagrammos otakii are selected as parents to establish a family during the breeding season of Hexagrammos otakii.

[0022] Among them, the hatching of fry refers to the conventional fertilization and hatching operation steps of Hexagrammos otakii, which are specifically as follows:

[0023] 1) Artificial insemination

[0024] Collect the mature eggs of female fish and place them on a flat plate covered with a mesh sheet. The mesh sheet is made of hard polyethylene flat net with a mesh aperture of 0.5 - 1 cm; cut into a size of 30 cm × 30 cm. Spread the fish eggs to form a single layer of fish eggs.

[0025] While spreading the fish eggs, squeeze the semen of male fish into a glass cup filled with seawater to activate it, gently shake the glass cup to mix the semen, and slowly pour the semen onto the single layer of fish eggs to make the sperm and eggs fully contact.

[0026] 2) Fixation of fertilized egg slices

[0027] After artificial insemination, rinse the fertilized egg slices with seawater. Clamp the egg slices between two layers of hard polyethylene flat nets and fix them to prevent the egg slices from moving and damaging the fertilized eggs.

[0028] 3) Incubation of fertilized eggs

[0029] Put the egg slices fixed with hard polyethylene flat nets into an incubation net cage for incubation, and adopt the method of flowing water, continuous aeration, and constant temperature incubation at a water temperature of 16°C for incubation.

[0030] During the incubation period, the fertilized eggs are taken out of the hatching pond at 8:30 - 10:00 in the morning and 15:00 - 16:30 in the evening every day and exposed to the air. They are irradiated with warm light from fluorescent lamps in the air, with a light intensity of 2000 lux and a lighting time of 1.5 hours. Water flow stimulation is carried out every 15 minutes, and the stimulating water is seawater at 16 °C. After repeated stimulation for 1.5 hours, they are put back into the hatching pond to continue hatching.

[0031] After the fertilized eggs hatch, the newly hatched larvae gather at the bottom of the hatching net cage. After the larvae float to the surface, the larvae are promptly removed and transferred to the cultivation pond for seedling cultivation. The cultivated seedlings are used as the F1 generation of the constructed family.

[0032] After cultivating the F1 generation larvae to sexual maturity, individuals with a fast growth rate under the same conditions are selected again as parents to construct the F2 generation of the family; at the same time, individuals with a relatively low relative growth rate are selected as parents to construct a control family.

[0033] When the Hexagrammos otakii fry grow to a total length of 10 - 12 cm, 100 fry are selected from the constructed F2 family and the control family. The fry of different families are marked with fluorescent pigments, and the marked fry are mixed and cultured in the same water body. After 8 months of cultivation, the fry of each family are collected for measurement of total length and body weight. 5 fry from each family are sampled for measurement, and the average value of the body weight of each family is calculated. The results show that the average body weight of the F2 family (193 ± 5.2) is significantly greater than that of the control family (145 ± 3.5).

[0034] The pure growth hormone genes of the individuals in the F2 family and the control family are analyzed by Sanger sequencing using an ABI3730 sequencer, and it is found that there is an SNP site at the 361st base of the sequence with SEQ ID NO: 1, which is C and T, and there are three genotypes of CC, CT, and TT ( Figure 1 ).

[0035] CAATCACAGACAACCAGCGGGAATTCACTAGTGATTCAACCAGC GGGGAGCCGTTTATTGCTTGTACAAAAACACAATCTTCATACAACAAGTTCAACAAACTCCTGACATCAGAATCTCTTAATCGTTACTTTATACTTC TCTTCACGCTACTGTTCACCAATCAGGTTCGAGCACGTGTTAATCCCACGTGTTTTGTTCTGGTCAAGATGACATTTTGGCTGGCAATTGGTTTTTG GCAAGTCACATCCTGTTTACACAATGAAGCTTCCTGACCTGTCAGGCAGGCCCAATCTCTAGGGTCCCTGTGTATTATTCCTAATACTGTATCATGAC AGTTATATTAGACTTGTTTTCAGATGCCATTCAGATGCTTGCTCTAGCT TCCACAGCTGGGTCTATAACTATTGTGGACGTGCAAAACGATGCTAACACCACAAAAATTGTCCGTAAGGGAAAACCTTCAAACATCACACTTATC AAATCCGAAGGACAAGTAGTACCAGTGGCAACGACCAAGGATAAAATCTTTGTTGGCAGCGAAAAAACATCATTACAATTTCATCACGTTATATAG TCATAAGGTCACGTATCACGATTGGCCGAGATACATGTGACGTGGCTT GGCAGAGCCATGTACGGCGTGTGTGTGTATCGGTATTGTTGTGTGTATCGGTGCATCTTAGCACTGAAAAATTATTTCCTGCAGTTGTTAAATCTGGA TATTAAAGTTACCCTGTGGAATTCTTTGTACATTTACACGTATTCATTTG GCAGACTCTTTTAACATTACATTCATAATGTTTAATGTATACCATAAAGACTGAGCAATCCCACTCACTAAATATTATAATGAGTCAGTAATAGTCCAC AGCCAGCCCTTCACATAAGTTCTTCCAGAAGCTAACTGCACCC(SEQ ID NO:1).

[0036] In the F2 family, the CC genotype is dominant, while the TT genotype is the least; in the control strain, the CT genotype is the main one.

[0037] The results showed that there was a SNP locus related to growth traits at the 361st position of the growth hormone gene intron, and the growth rate of individuals with the CC homozygous genotype was significantly higher than that of individuals with the CT genotype and the TT genotype.

[0038] Example 2: Screening of the parents of Hexagrammos otakii with growth potential

[0039] After culturing the fry hatched from the fertilized eggs of wild Hexagrammos otakii obtained in the breeding factory of Mishangdao Marine Technology (Changdao) Co., Ltd. for 30 days, a part of the caudal fin fin rays was cut to extract genomic DNA as a template, and the following were used:

[0040] Forward primer: 5′-CAATCACAGACAACCAGCGGGA-3′ (SEQ ID NO: 2),

[0041] Reverse primer: 5′-GGGTGCAGTTAGCTTCTGGAAG-3′ (SEQ ID NO: 3);

[0042] The primer pair was used to detect the genotype at the 361st position of the fragment with the nucleotide sequence of SEQ ID NO: 1; and the weight (g) and body length (cm) of the corresponding individuals were recorded.

[0043] 1) Data collection and genomic DNA extraction:

[0044] Randomly select 50 individuals of Hexagrammos otakii, measure and record the weight and body length of the selected individuals, and cut fin rays for genomic DNA extraction. The extracted DNA is used as a template for PCR amplification.

[0045] The genomic DNA in the fin rays of Hexagrammos otakii was extracted by the conventional phenol-chloroform method. Take 100 mg of the caudal fin tissue of the fry to be detected and place it in a 1.5 ml centrifuge tube, then cut it into pieces; add 500 μL of DNA extraction solution to the centrifuge tube with the cut caudal fin; add 5 μL of proteinase K (20 mg / ml), mix gently, and place it in a water bath at 55 °C for digestion for 2 hours; cool the solution to room temperature, add an equal volume of phenol, extract for 10 minutes, and centrifuge at 12000 rpm for 10 minutes; take the supernatant and add it to a new 1.5 ml centrifuge tube, add an equal volume of phenol and chloroform, extract for 10 minutes, and centrifuge at 12000 rpm for 10 minutes; take the supernatant and add it to a new 1.5 ml centrifuge tube, add an equal volume of chloroform to extract for 10 minutes, and centrifuge at 12000 rpm for 10 minutes; take the supernatant and add it to a new centrifuge tube, add 2 volumes of absolute ethanol, and centrifuge at 12000 rpm for 5 minutes; discard the ethanol solution, wash the precipitate with 70% ethanol twice, and centrifuge at 5000 rpm for 5 minutes; discard the ethanol, place it at room temperature for 10 minutes, and dissolve the precipitated DNA with 100 μL of TE. Detect the DNA by 1% agarose gel electrophoresis, and store the DNA solution at -4 °C or -20 °C for later use.

[0046] 2) Perform PCR reaction and sequencing using the primer pair of SEQ ID NO:2 and SEQ ID NO:3. The reaction system is 25 μl, and the specific composition is as follows: 10×buffer 2.5 μl, dNTPs 2 μl, upstream primer 1 μl, downstream primer 1 μl, genomic DNA 1 μl, Taq enzyme 0.25 μl, and ddH2O is added to make up to 25 μl.

[0047] The PCR reaction procedure is as follows: 98 °C, 30 s; 98 °C for 10 s, 65 °C for 30 s, 72 °C for 45 s, for 30 cycles; 72 °C for 3 min. The amplified product is detected by 1.5% agarose electrophoresis.

[0048] 3) TA cloning of the target fragment. The PCR product is recovered using a column gel recovery kit to obtain the target fragment, then ligated to the pMD18-T vector, transformed into Escherichia coli DH5α, positive clones are selected, inoculated into 200 μl of LB liquid medium, and cultured overnight with shaking at 200 rpm, and sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing.

[0049] 4) Analyze the genotype of the SNP locus and the phenotypic values of the traits of the body weight and body length of Hexagrammos otakii to determine the correlation between different genotypes of the SNP locus and growth traits (Table 1).

[0050] Table 1: Information table of SNP genotypes and growth traits of Hexagrammos otakii

[0051]

[0052] As can be seen from Table 1, the phenotypic values of body weight, body length, and total body length of individuals with the CC homozygous genotype are significantly higher than those of individuals with the TT and CT genotypes in terms of growth traits.

[0053] In summary, the above results indicate that the growth rate of Hexagrammos otakii individuals with the CC genotype screened by using the SNP primers and methods of the present invention is significantly higher than that of TT and CT individuals in the same family, providing an effective molecular marker for the genetic breeding of Hexagrammos otakii. Sequence Listing <110> Mishangdao Marine Technology (Changdao) Co., Ltd. Shandong Marine Science Research Institute (Qingdao National Marine Science Research Center) <120> A Method for Selectively Breeding Hexagrammos otakii with Fast Growth Potential <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 915 <212> DNA <213> Artificial Sequence <400> 1 caatcacaga caaccagcgg gaattcacta gtgattcaac cagcggggag ccgtttattg 60 cttgtacaaa aacacaatct tcatacaaca agttcaacaa actcctgaca tcagaatctc 120 ttaatcgtta ctttatactt ctcttcacgc tactgttcac caatcaggtt cgagcacgtg 180 ttaatcccac gtgttttgtt ctggtcaaga tgacattttg gctggcaatt ggtttttggc 240 aagtcacatc ctgtttacac aatgaagctt cctgacctgt caggcaggcc caatctctag 300 ggtccctgtg tattattcct aatactgtat catgacagtt atattagact tgttttcaga 360 tgccattcag atgcttgctc tagcttccac agctgggtct ataactattg tggacgtgca 420 aaacgatgct aacaccacaa aaattgtccg taagggaaaa ccttcaaaca tcacacttat 480 caaatccgaa ggacaagtag taccagtggc aacgaccaag gataaaatct ttgttggcag 540 cgaaaaaaca tcattacaat ttcatcacgt tatatagtca taaggtcacg tatcacgatt 600 ggccgagata catgtgacgt ggcttggcag agccatgtac ggcgtgtgtg tgtatcggta 660 ttgttgtgtg tatcggtgca tcttagcact gaaaaattat ttcctgcagt tgttaaatct 720 ggatattaaa gttaccctgt ggaattcttt gtacatttac acgtattcat ttggcagact 780 cttttaacat tacattcata atgtttaatg tataccataa agactgagca atcccactca 840 ctaaatatta taatgagtca gtaatagtcc acagccagcc cttcacataa gttcttccag 900 aagctaactg caccc 915 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <400> 2 caatcacaga caaccagcgg ga 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <400> 3 gggtgcagtt agcttctgga ag 22

Claims

1. A method for screening individuals of Hexagrammos otakii with fast growth potential, characterized in that, The method described is to screen by detecting the genotypes of SNP loci related to the growth of Hexagrammos otakii; the SNP locus is located at the 361st position of the nucleotide fragment with the sequence of SEQ ID NO: 1, and its base is C or T; the genotype is the CC homozygous individual.

2. The method according to claim 1, characterized in that, The method described is to amplify the genomic DNA of the individual Hexagrammos otakii to be detected by a primer pair, sequence the amplification product, and then analyze the genotype.

3. The method according to claim 2, wherein For the primer pair described, the sequence of the upstream primer is SEQ ID NO: 2, and the sequence of the downstream primer is SEQ ID NO: 3.

Images