A primer design method for allelic polymorphism typing and application thereof

By inserting a tag sequence into the primer that is identical to the fluorescent probe but does not match the gene to be detected, the high cost and mismatch problems of AS-PCR detection are solved, and efficient and accurate allelic polymorphism typing is achieved.

CN114958972BActive Publication Date: 2026-02-27GENTIDES BIOTECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202210670419.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-14
Publication Date
2026-02-27
Estimated Expiration
2042-06-14

AI Technical Summary

Technical Problem

In existing AS-PCR detection technologies, different fluorescent probe sequences lead to high detection costs, and primer mismatch and non-target genotype template amplification mismatch result in biased detection results.

Method used

A tag sequence that is identical to the fluorescent probe sequence but does not match the gene sequence to be detected is designed into the primers for allele polymorphism typing. The tag sequence is inserted into the primers and introduced into the PCR product through PCR reaction. The fluorescent probe generates a fluorescent signal by conformational change for typing.

Benefits of technology

It effectively reduces detection costs, decreases the mismatch between primers and unmatched genotype templates, and improves the accuracy and efficiency of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114958972B_ABST
    Figure CN114958972B_ABST
Patent Text Reader

Abstract

The application discloses a primer design method for allelic polymorphism typing and application thereof, and belongs to the technical field of molecular biology. The primer design method comprises the following steps: S1, designing specific primer sequences and fluorescent probe sequences according to a to-be-detected target gene sequence; and S2, adding a tag sequence which is completely or partially identical to the fluorescent probe sequence and does not match the to-be-detected target gene sequence to the inside of the specific primer sequence, so that a primer for allelic polymorphism typing is obtained. The tag sequence which is completely or partially identical to the fluorescent probe sequence and does not match the to-be-detected target gene sequence is designed in the inside of the primer (ASP) for allelic polymorphism typing, so that the primer can not only efficiently complete the typing identification of the to-be-detected target gene, but also effectively improve the mismatch condition between the primer and a non-matching genotype template in an AS-PCR reaction.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a primer design method for allelic polymorphism typing and application thereof. BACKGROUND

[0002] Allelic polymorphism (AP) is widely present in the genomes of various species and is associated with various traits, so AP typing detection is widely used in the fields of genetic disease diagnosis, drug development and use, crop breeding, and variety purity identification. AS-PCR is a main technical means for AP typing, and through the design of three primers, two ASPs only differ in the 3' terminal base (complementary to the corresponding polymorphic site, respectively), a locus specific primer (LSP) is commonly used, and PCR reaction is performed in the same reaction system to produce two products that differ at the AP site, and AP typing identification of the sample is completed by identifying whether the two products exist. Using AS-PCR based on fluorescence signal for AP typing detection has the advantages of accuracy, rapidity, high throughput, low cost, no pollution, low equipment requirement, and easy operation.

[0003] Due to the indiscriminate binding of fluorescent dyes and double-stranded DNA, it is difficult to distinguish non-specific amplification products, and fluorescent probes designed based on the principle of fluorescence resonance energy transfer (FRET) are widely used in AS-PCR. When the fluorescent group and the quenching group are close enough (<100A), the emission light generated by the excitation of the fluorescent group is absorbed by the quenching group, and then it is dispersed in the form of longer wavelength light or heat energy, so the fluorescence signal of the fluorescent group cannot be detected. When the two groups are separated, the emission light of the fluorescent group cannot be absorbed by the quenching group, and thus it is detected. Based on this principle, three kinds of fluorescent probes are mainly designed and used:

[0004] The first one is Taqman probe (US 1994 / 5538848 A), which is a nucleotide sequence with no more than 30 bp in length. The probe sequence is complementary to the middle section of the target PCR product, and the two ends are labeled with a fluorescent group and a quencher group, respectively. At this length, the emission light of the fluorescent group is absorbed by the quencher group, resulting in a quenched fluorescence signal. When the target PCR product is present, the probe binds to the target product. In the next round of PCR reaction, when the extension primer extends to the probe binding region, the 5'-3' exonuclease activity of DNA polymerase (such as Taq enzyme) will cut off the fluorescent group or quencher group from the probe, resulting in the separation of the two and the generation of a fluorescence signal. Taqman probe is used to develop a single nucleotide polymorphism (SNP) typing tool - Taqman Assay (K.J. Livak Allelic discrimination using fluorogenic probes and the 5' nuclease assay. Genetic Analysis: Biomolecular Engineering. 1999; 14: 143-9) and is widely used. Taqman Assay is designed to detect SNP sites in the probe sequence, and different SNP sites use different fluorescent groups. Since the cutting of the fluorescent probe by DNA polymerase depends on the complete binding of the fluorescent probe and the target PCR product, only the corresponding fluorescent probe signal will be generated for one SNP genotype, thereby completing the typing identification.

[0005] The second one is Amplifluor probe (I.A. Nazarenko et al. A closed tube format for amplification and detection of DNA based on energy transfer. Nucleic Acids Research. 1997; 25: 2516-21.), which is designed with a stem-loop structure at the 5' end. The fluorescent group and the quencher group are labeled at the stem ends, so they are close to each other and cause fluorescence quenching. The 3' end of the probe is a primer sequence, and the probe participates in the PCR reaction through the primer sequence. During the extension process, the fluorescent group and the quencher group are separated from each other to generate a fluorescence signal, and then the presence or absence of the target PCR product is detected.

[0006] The third is molecular beacon, also a single nucleotide sequence, the beacon probe is not hydrolyzed and not involved in PCR amplification, but by and target sequence pairing binding lead to probe configuration changes and produce fluorescence signal. For example stem loop probe (S. Tyagi et al. Molecular beacons probes that fluoresce upon hybridization. Nature Biotechnology. 1996; 14(3): 303-8.), which is labeled with a fluorescent group and a quencher group at both ends, the two are close to each other through the stem end complementary sequence, the loop sequence and the intermediate segment of the target product are complementary. When the loop sequence and the target product are combined, the conformation changes cause the stem end complementary sequence to separate, the fluorescent group and the quencher group to separate and thus produce a fluorescence signal. The probe can also be used for SNP typing (S. A. E. Marras et al. Multiplex detection of single-nucleotide variations using molecular beacon. Genetic Analysis: Biomolecular Engineering. 1999; 14: 151-6.), the site to be detected is designed on the loop of the stem loop structure, and the SNP is designed at both ends of the special primer to amplify the PCR product containing the SNP site. Only when the loop sequence and the PCR product are completely matched, the stem loop structure is opened, the fluorescent group and the quencher group at the stem end are separated to produce a detection signal.

[0007] The above three probes can be directly used for allele typing detection based on AS-PCR, but the defect is that different target genes or different polymorphism sites of the same target gene require different fluorescent probe sequences, which will greatly increase the detection cost. Therefore, subsequent typing detection technology adds a tag sequence at the 5' end of the ASP, which is completely or partially consistent with the probe sequence, and one ASP corresponds to one tag and fluorescent probe. The presence or absence of the PCR product with the tag sequence detected by the fluorescent probe has determined whether the target PCR product exists, so that the detection of different target genes polymorphism can use the same fluorescent probe combination, only need to redesign the ASP, for example:

[0008] Ribonuclease H-dependent PCR genotyping technology (rhAmp SNP Genotyping) (disclosed in US 2017 / 10886006 B2), the principle of fluorescent probe signal generation used is the same as Taqman Assay. This technology uses a four-primer system, that is, a universal primer (UP) is added. The 5' end of the ASP is sequentially added with a tag and a universal sequence matching the UP. When the target product appears, the probe and the tag match, the UP and the universal sequence match, the probe is hydrolyzed to produce a fluorescent signal through the extension reaction, and the corresponding fluorescence intensity is detected to complete the SNP genotyping identification of the target gene.

[0009] KASP (Kompetitive Allele Specific PCR) technology (disclosed in US 2009 / 7615620 B2). The probe of this technology is a double-molecule design, that is, a piece of complementary double-stranded DNA, and the 5' end of one strand and the 3' end of the complementary strand are respectively provided with a fluorescent group and a quenching group. The 5' end of the ASP is added with a tag. The probe fluorescent group chain is used as a primer to amplify the PCR product containing the corresponding tag as a template to be incorporated into the final PCR product, resulting in the separation of the fluorescent group and the quenching group and thus generating a fluorescent signal, and the corresponding fluorescence intensity is detected to complete the SNP genotyping identification of the target gene.

[0010] Amplifluor SNP Assay (M.V. Myakishev et al. High-throughput SNP genotyping by allele-specific PCR with universal energy-transfer-labeled primers. Genome Res. 2001; 11(1): 163-9.) uses Amplifluor probes for detection, and a tag matching the 3' end of the Amplifluor fluorescent probe is added to the 5' end of the ASP. During the PCR reaction process, the ASP introduces the corresponding tag into the PCR product according to the SNP site, the Amplifluor probe amplifies the PCR product containing the corresponding tag as a template and generates a fluorescent signal, and the corresponding fluorescence intensity is detected to complete the SNP genotyping identification of the target gene.

[0011] The Taqman probe can also not generate a fluorescent signal by hydrolysis. The principle is that when the probe is not combined with the target sequence, the probe is in a coiled configuration, at which time the fluorescent group and the quenching group are close to each other, resulting in fluorescence quenching. When the probe and the target sequence are combined to become a straight chain configuration, the distance between the fluorescent group and the quenching group becomes larger, that is, a fluorescent signal can be generated (disclosed in US 1998 / 5723591). The PACE (PCR Allele Competitive Extension Genotyping) technology (disclosed in WO 2020 / 144480 A1) uses this light-emitting principle. A tag is added to the 5' end of the ASP. During the PCR reaction process, the ASP introduces the corresponding tag into the PCR product according to the SNP site. The complementary sequence of the tag sequence on the probe and the amplified product is combined to become a straight chain configuration. The distance between the fluorescent group and the quenching group becomes larger and a fluorescent signal is generated. The corresponding fluorescence intensity can be detected to complete the SNP genotyping identification of the target gene.

[0012] Adding a tag to the 5' end of the ASP can use the same fluorescent probe combination to achieve polymorphism detection of different target genes, but primer mismatching between the ASP and non-target genotype templates can easily occur during the AS-PCR detection process, resulting in two fluorescent signals in the detection of homozygous genotype samples and causing deviations in the typing determination process.

[0013] Therefore, it is necessary to provide a primer design method for allelic polymorphism genotyping to solve the above technical problems. SUMMARY

[0014] The purpose of the present application is to overcome the shortcomings of the prior art and provide a primer design method for allelic polymorphism genotyping and its application. The primer not only efficiently completes the genotyping identification of the target gene to be detected, but also effectively improves the mismatching between the primer and the non-matching genotype template in the AS-PCR reaction.

[0015] The first purpose of the present application is to provide a primer design method for allelic polymorphism genotyping.

[0016] A primer design method for allelic polymorphism genotyping comprises the following steps:

[0017] S1, designing a specific primer sequence and a fluorescent probe sequence according to the sequence of the target gene to be detected;

[0018] S2, adding a tag sequence that is completely or partially the same as the fluorescent probe sequence and does not match the sequence of the target gene to be detected to the inside of the specific primer sequence, that is, a primer for allelic polymorphism genotyping is obtained.

[0019] Further, the insertion site of the tag sequence on the primer is not less than 10 bases from the 3' end of the primer and not less than 1 base from the 5' end of the primer.

[0020] Further, the length of the tag sequence is 15-50 bases.

[0021] Further, the fluorescent probe is a type I fluorescent probe, and the two ends of the type I fluorescent probe are labeled with a fluorescent group and a quenching group, respectively.

[0022] Further, the fluorescent probe is a type II fluorescent probe, and the 5' end of the type II fluorescent probe is a stem loop structure, and a fluorescent group and a quenching group are labeled at the stem ends, respectively.

[0023] Further, the sequence identity of the tag sequence and the type I fluorescent probe is not less than 50%.

[0024] Further, the sequence identity of the tag sequence and the 3' end of the type II fluorescent probe is not less than 50%.

[0025] The second object of the present application is to provide a primer for allelic polymorphism typing.

[0026] The primer for allelic polymorphism typing is designed by the primer design method for allelic polymorphism typing described in any one of the above.

[0027] The third object of the present application is to provide a primer design system for allelic polymorphism typing.

[0028] The primer design system for allelic polymorphism typing comprises the following modules:

[0029] The information acquisition module is used to acquire the target gene sequence to be detected, and then design a specific primer sequence and a fluorescent probe sequence according to the target gene sequence to be detected;

[0030] The primer design module is used to add a tag sequence which is completely or partially identical to the fluorescent probe sequence and does not match the target gene sequence to be detected to the inside of the specific primer sequence, so as to obtain a primer for allelic polymorphism typing.

[0031] Further, the primer design module further comprises a primer-related parameter optimization module, which is used to optimize the position of the primer on the template, the primer length, the annealing temperature, the GC content, the tag sequence selection, and the insertion site of the tag sequence on the primer.

[0032] The fourth object of the present application is to provide a detection system for allelic polymorphism typing.

[0033] A detection system for allelic polymorphism typing, comprising the primer for allelic polymorphism typing according to any one of the above, the primer is applied to the detection of one or more AS-PCR products, the detection system further comprises a universal reverse primer capable of pairing with the primer, a fluorescent probe, a buffer system, a DNA polymerase, dNTPs and a target gene to be detected.

[0034] Further, the distance between the insertion site of the tag sequence in different primers and the 3' terminal base can be the same or different.

[0035] Further, the length of the tag sequence in different primers can be the same or different.

[0036] Further, the primer is upstream of the polymorphic site or downstream of the polymorphic site.

[0037] The fifth object of the present application is to provide a detection kit for allelic polymorphism typing.

[0038] A detection kit for allelic polymorphism typing, comprising the detection system for allelic polymorphism typing according to any one of the above.

[0039] Further, the detection kit further comprises some other components in the kit.

[0040] The sixth object of the present application is to provide a detection method for allelic polymorphism typing.

[0041] A detection method for allelic polymorphism typing, comprising the following steps:

[0042] S1, designing the primer for allelic polymorphism typing according to any one of the above;

[0043] S2, adding the required reagents according to the detection system for allelic polymorphism typing according to any one of the above, and performing AS-PCR reaction;

[0044] S3, after the reaction is completed, the typing identification of the target gene to be detected can be completed by analyzing the fluorescence signal intensity.

[0045] The seventh object of the present application is to provide the application of the above primer or detection system.

[0046] The application of the primer for allelic polymorphism typing according to any one of the above or the detection system for allelic polymorphism typing according to any one of the above in allelic polymorphism typing detection.

[0047] Further, the allelic polymorphism typing detection is a rice allelic polymorphism typing detection.

[0048] In the present application, a tag sequence which is completely or partially identical to a sequence of a fluorescent probe and does not match a sequence of a target gene to be detected is designed inside a primer (ASP) for allelic polymorphism typing. The annealing of the ASP to a template forms a DNA bubble structure and participates in a PCR reaction, and the tag sequence is introduced into a PCR product. When a fluorescent probe used is a type I fluorescent probe (Taqman probe, which generates a signal by conformation change upon binding to a target sequence), as the PCR product with the tag sequence is continuously produced, the fluorescent probe and the tag sequence in the PCR product are complementary to each other and bind to each other, and a fluorescent group and a quenching group are separated to generate a fluorescent signal. The polymorphism typing detection of the target gene can be completed by analyzing the fluorescent signal intensity. When a fluorescent probe used is a type II fluorescent probe (Amplifluor probe), the fluorescent probe is amplified using a product containing the tag sequence produced in the initial several rounds of PCR as a template. During the amplification, as the complementary strand is extended, the hairpin structure of the Amplifluor probe is opened, a fluorescent group and a quenching group are separated to generate a fluorescent signal, and the polymorphism typing detection of the target gene to be detected can be completed by analyzing the fluorescent signal intensity.

[0049] Compared with the prior art, the present application has the following advantages:

[0050] 1) In the present application, a tag sequence which is completely or partially identical to a sequence of a fluorescent probe and does not match a sequence of a target gene to be detected is designed inside a primer (ASP) for allelic polymorphism typing. The primer not only can efficiently complete the typing identification of the target gene to be detected, but also can effectively improve the mismatch between the primer and a non-matching genotype template in an AS-PCR reaction.

[0051] 2) The primer and the detection system in the present application can be widely used in allelic polymorphism typing detection. BRIEF DESCRIPTION OF DRAWINGS

[0052] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort.

[0053] Figure 1Figure 1 is a schematic diagram of the principle and process of the application for detecting allelic polymorphism typing (type I fluorescent probe); taking single nucleotide polymorphism allele (SNP Allele) as C / T genotype, ASP is located upstream of the polymorphism site, and the fluorescent group of the fluorescent probe is located at the 5' end as an example for illustration; wherein, Figure (A) is a reaction system composition diagram, including target DNA of SNP Allele1 and SNP Allele2, two same direction primers ASP (ASP1 and ASP2, respectively containing HEXtag and FAMtag), one universal reverse primer LSP, and two fluorescent probes 1 (probe1) and fluorescent probes 2 (probe2) corresponding to tag1 and tag2 respectively, the fluorescent group and the quenching group are respectively located at the two ends of the probe (H represents HEX, F represents FAM, and Q represents quenching group), the sequences are completely or partially consistent with HEXtag and FAMtag, at this time the fluorescent probe is in a curled configuration, the quenching group and the fluorescent group are close to each other, so that the fluorescent signal is in a quenched state; Figure (B) is a schematic diagram of initial several rounds of PCR reaction, wherein, ASP1 and ASP2 are paired with LSP to amplify target DNA containing corresponding polymorphism sites (a, b, f, g), if the primer and the polymorphism site do not match, the extension reaction cannot be carried out (c, d), and the HEXtag and FAMtag on ASP1 and ASP2 are introduced into the PCR product (h, i); Figure (C) is a schematic diagram of multiple rounds of PCR reaction, wherein, ASP1 and ASP2 are paired with LSP, and the products in h and i in Figure (B) are used as templates to amplify to produce a large amount of PCR products containing HEXtag and FAMtag; Figure (D) is a schematic diagram of fluorescent signal generation, probe1 and probe2 are respectively matched and combined with the PCR products containing HEXtag and FAMtag, the fluorescent probe becomes a straight chain configuration, the fluorescent group and the quenching group are separated, the fluorescent signal is generated, and allelic typing identification is carried out according to the intensity of each fluorescent signal.

[0054] Figure 2Figure 1 is a schematic diagram of the principle of the present application for detecting allelic polymorphism (type II fluorescent probe); taking SNP Allele as C / T genotype, ASP is located upstream of the polymorphic site, and the fluorescent group of the fluorescent probe is located at the 5' end as an example for illustration; wherein, Figure (A) is a schematic diagram of the reaction system, including target DNA of SNP Allele 1 and SNP Allele 2, two same direction primers ASP (ASP1 and ASP2, respectively with HEXtag and FAMtag), one universal reverse primer LSP, and fluorescent probe 1 (probe1) and fluorescent probe 2 (probe2) corresponding to tag1 and tag2 respectively, the 5' end of the probe is a stem-loop structure, and the fluorescent group and the quenching group are located at the two ends of the stem (H represents HEX, F represents FAM, and Q represents quenching group), at this time, the quenching group and the fluorescent group are close to each other, so that the fluorescent signal is in a quenched state, and the 3' end of the fluorescent probe is a sequence identical or partially identical to HEXtag and FAMtag; Figure (B) is a schematic diagram of the initial several rounds of PCR reaction, wherein, ASP1 and ASP2 are paired and amplified with LSP to contain the corresponding polymorphic site of the target DNA (a, b, f, g), if the primer and the polymorphic site do not match, the extension reaction cannot be carried out (c, d), and HEXtag and FAMtag on ASP1 and ASP2 are introduced into the PCR product (h, i); Figure (C) is a schematic diagram of the multiple rounds of PCR reaction, probe1 and probe2 take the products in h and i in Figure (B) as templates to amplify to produce DNA strands with stem-loop structure at the 5' end (c, d); Figure (D) is a schematic diagram of the generation of fluorescent signal, LSP takes the DNA strands in c and d in Figure (C) as templates to carry out extension reaction, which causes the stem-loop structure at the 5' end of the fluorescent probe to open, the fluorescent group and the quenching group to separate, and the fluorescent signal to be generated, and the genotyping identification is carried out according to the intensity of each fluorescent signal.

[0055] Figure 3 Figure 2 is the SNP typing test results of the rice Target 1 gene (OsTarget1) in Example 1 of the present application, wherein, in Figure a, HEXtag1 and FAMtag1 are located at the 5' end of ASP1 and ASP2 respectively; in Figure b, HEXtag1 and FAMtag1 are both located inside the respective ASP, 20 bases away from the 3' end; in Figure c, HEXtag2 and FAMtag2 are both located inside the respective ASP, 20 bases away from the 3' end; in Figure d, HEXtag1 and FAMtag1 are both located inside the respective ASP, 23 bases away from the 3' end.

[0056] Figure 4Figure a is a comparison of the mismatch detection of the SNP Allele 1 homozygous sample, and figure b is a comparison of the mismatch detection of the SNP Allele 2 homozygous sample.

[0057] Figure 5 Figure a is a comparison of the mismatch detection of the SNP Allele 1 homozygous sample, and figure b is a comparison of the mismatch detection of the SNP Allele 2 homozygous sample.

[0058] Figure 6 Figure a is a comparison of the mismatch detection of the SNP Allele 1 homozygous sample, and figure b is a comparison of the mismatch detection of the SNP Allele 2 homozygous sample.

[0059] Figure 7 Figure a is a comparison of the mismatch detection of the SNP Allele 1 homozygous sample, and figure b is a comparison of the mismatch detection of the SNP Allele 2 homozygous sample.

[0060] Figure 8The test results of the SNP typing of the rice Target 2 gene (OsTarget2) in Example 5 of the present application are shown in the figures, wherein the HEX tag 1 and the FAM tag 1 in figure a are located at the 5' end of the ASP 1 and the ASP 2 respectively, and a type I fluorescent probe is used; the HEX tag 2 and the FAM tag 2 in figure b are both located inside the respective ASPs at a distance of 17 bases from the 3' end, and a type I fluorescent probe is used; the HEX tag 1 and the FAM tag 1 in figure c are located at the 5' end of the ASP 1 and the ASP 2 respectively, and a type II fluorescent probe is used; the HEX tag 2 and the FAM tag 2 in figure d are both located inside the respective ASPs at a distance of 17 bases from the 3' end, and a type II fluorescent probe is used.

[0061] Figure 9 The comparison results of the mismatch conditions when the rice Target 2 gene (OsTarget2) homozygous genotype samples are detected by the respective primer combinations in Example 5 of the present application are shown in the figures, wherein figure a is the comparison of the mismatch conditions of the SNP Allele 1 homozygous sample and the SNP Allele 2 homozygous sample when a type I fluorescent probe is used; figure b is the comparison of the mismatch conditions of the SNP Allele 1 homozygous sample and the SNP Allele 2 homozygous sample when a type II fluorescent probe is used.

[0062] Figure 10 The SNP typing detection results of the rice Target 2 gene (OsTarget2) in a large population sample in Example 6 of the present application are shown in the figures, wherein the HEX tag 2 and the FAM tag 2 are both located inside the respective ASPs at a distance of 17 bases from the 3' end, and a type I fluorescent probe is used. DETAILED DESCRIPTION

[0063] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by a person of ordinary skill in the art without any creative effort fall within the protection scope of the present application.

[0064] The principle of the SNP typing detection using the AS-PCR in the present application (taking the SNP site as C / T, the ASP being located at the upstream of the polymorphic site, and the fluorescent group being labeled at the 5' end of the probe as an example for description) is as follows:

[0065] For example, Figure 1As shown, when using Type I fluorescent probe, the AS-PCR reaction is carried out by three normal primers, two same direction primers ASP1 and ASP2 are used to distinguish different SNP alleles, the inner part of ASP1 and ASP2 respectively carries HEX tag and FAM tag, the other part is completely matched with the target amplification segment, only the terminal base is different, only when the terminal base and the base of SNP site are completely matched, the reaction can be started. In the starting stage, ASP1 and ASP2 respectively pair with LSP to complete the amplification of the target segment containing different SNP sites, and HEX tag and FAM tag are respectively introduced into the corresponding PCR product. When there is no PCR product containing HEX tag and FAM tag, the fluorescent probes probe1 and probe2 are in the curled configuration, the quenching group and the fluorescent group are close to make the fluorescence signal in the quenching state. With the progress of PCR reaction, HEX tag and FAM tag are introduced into the corresponding PCR product, probe1 and probe2 respectively combine with the complementary sequence of HEX tag and FAM tag in the PCR product to become straight chain configuration, the distance between the quenching group and the fluorescent group becomes larger, which can lead to the generation of fluorescence signal. After the reaction is completed, the reaction plate is placed on the fluorescence analyzer to read the signal, the ratio of FAM fluorescence value and ROX fluorescence value is set as X axis, and the ratio of HEX fluorescence value and ROX fluorescence value is set as Y axis, the allele typing chart is obtained, the sample is clustered and analyzed, and thus the SNP typing identification is completed.

[0066] As Figure 2As shown, when using Type II fluorescent probe, the AS-PCR reaction is carried out by three normal primers and two fluorescent probe primers, two same direction primers ASP1 and ASP2 are used to distinguish different SNP alleles, the inner part of ASP1 and ASP2 respectively carries HEX tag and FAM tag, the other part is completely matched with the target amplification segment, and only the terminal base is different, only when the terminal base and the SNP site base are completely matched, the reaction can be initiated. In the initiation stage, ASP1 and ASP2 are paired with LSP respectively to complete the amplification of the target segment containing different SNP sites, and HEX tag and FAM tag are introduced into the corresponding PCR product respectively. When there is no PCR product containing HEX tag and FAM tag, the 5' end of fluorescent probe probe1 and probe2 is a stem-loop structure, and the quenching group and the fluorescent group are close to make the fluorescence signal in the quenching state. With the progress of PCR reaction, HEX tag and FAM tag are introduced into the corresponding PCR product, probe1 and probe2 are respectively amplified with the PCR product containing HEX tag and FAM tag as the template to produce a DNA chain with a stem-loop structure at the 5' end, and LSP is used as the template for extension reaction, which causes the opening of the terminal stem-loop structure, the separation of the fluorescent group and the quenching group, and the generation of the fluorescence signal. After the reaction is completed, the reaction plate is placed on the fluorescence analyzer to read the signal, the ratio of FAM fluorescence value and ROX fluorescence value is set as X axis, and the ratio of HEX fluorescence value and ROX fluorescence value is set as Y axis, to obtain the allele typing diagram, and the sample is subjected to cluster analysis, so as to complete the SNP typing identification.

[0067] The conventional reagents and equipment used in the present application can be commercially available, unless otherwise specified.

[0068] In the following examples, the SNP typing detection of rice genes will be described, but the primers and detection system in the present application are not only used for SNP typing detection of rice genes, but also can be used for identification of allele polymorphism of other species.

[0069] The naming rules of the primers ASP in the present application are as follows:

[0070] The naming of ASP without tag sequence: target gene name + ASP and serial number; for example, OsTarget1ASP1 represents allele specific primer 1 of target gene OsTarget1.

[0071] Nomenclature of ASP with tag sequence: Target gene name + ASP and serial number + tag type + addition position + distance to 3' end (if addition site is inside ASP), for example, OsTarget1 ASP1-HEXtag1-5' means adding HEXtag1 at 5' end of allele-specific primer 1 of target gene OsTarget1; OsTarget1 ASP2-FAMtag2-3' {-20} means embedding FAMtag2 at 20 bases away from 3' end of allele-specific primer 2 of target gene OsTarget1.

[0072] The present application uses fluorescent groups and quenching groups as follows:

[0073] FAM: Carboxy Fluorescein, 6 carboxyfluorescein;

[0074] HEX: Hexachlorofluorescein, hexachloro-6-methylfluorescein;

[0075] BHQ1: Black Hole Quencher 1, black hole quenching group 1.

[0076] Example 1

[0077] Using rice target gene 1 (OsTarget1) as template (see Table 1 for sequence), the genotyping detection effect of adding HEXtag and FAMtag at the same position of ASP1 and ASP2 was tested, the allelic polymorphism site was C / T genotype, a total of 13 primers, 4 tag sequences and 2 fluorescent probes were designed, as shown in Table 1 below:

[0078] Table 1 primer, tag and fluorescent probe sequence list

[0079]

[0080]

[0081] The reaction system was prepared according to Table 2, wherein the combination of ASP1 and ASP2 was: SEQ ID NO: 11 & SEQ ID NO: 12, SEQ ID NO: 13 & SEQ ID NO: 14, SEQ ID NO: 15 & SEQ ID NO: 16 and SEQ ID NO: 17 & SEQ ID NO: 18. The combination of fluorescent probes was SEQ ID NO: 1 & SEQ ID NO: 2, HEX fluorescent probe labeled SNP Allele1 site, and FAM fluorescent probe labeled SNP Allele2 site.

[0082] Table 2 reaction system preparation

[0083]

[0084] Take 10-100 ng of rice standard material parent 1 (SNP Allele 1), parent 2 (SNP Allele 2) and hybrid generation material genomic DNA in the reaction well of 96 well PCR reaction plate, the SNP type of standard has been confirmed by PARMS (Wuhan Jingpeibio Technology Co., Ltd.), two repeats and two negative controls (No-Template Control, NTC) for each primer combination, each template, 65℃ treatment for 30 minutes to dry the template DNA, add 10 μl of reaction mixture to each well, seal the hole with mineral oil, and place it on the PCR instrument, set the program according to table 3 to complete the amplification reaction.

[0085] Table 3 PCR reaction program

[0086]

[0087] After the reaction is completed, the reaction plate is placed on the fluorescence analyzer to read the FAM, HEX and ROX fluorescence signals of each well according to the parameters in table 4. The ratio of FAM fluorescence value to ROX fluorescence value is set as X axis, and the ratio of HEX fluorescence value to ROX fluorescence value is set as Y axis to obtain the allele typing chart, and the results are shown in Figure 3 and Figure 4 .

[0088] Table 4 Fluorescent group function parameters

[0089]

[0090] As can be seen from Figure 3 , the four ASP combinations can be correctly typed and the results are consistent with the identification results of PARMS (Wuhan Jingpeibio Technology Co., Ltd.), indicating that, like the tag located at the 5' end of ASP, the tag located inside ASP can also successfully complete the genotyping identification. Unlike the tag located inside ASP ( Figure 3 b, c, d), when the tag is located at the 5' end of ASP ( Figure 3 a), there is an obvious deviation in the position of parent 1 and parent 2 on the typing chart, that is, there is a certain parent 2 signal in the detection of parent 1 sample, and there is a certain parent 1 signal in the detection of parent 2 sample, which is caused by the mismatch of ASP and non-matching genotype template.

[0091] Compare the difference between the FAM / ROX of parent 1 and the FAM / ROX of NTC ( Figure 4 a) and the difference between the HEX / ROX of parent 2 and the HEX / ROX of NTC ( Figure 4b) It can be found that the mismatch signal of the tag located at the 5' end of the ASP (SEQ ID NO:11 & SEQ ID NO:12 combination) is significantly stronger than that of other primer combinations with the tag located inside the ASP, indicating that placing the tag inside the ASP can effectively improve the mismatch between the ASP and the non-matching genotype template.

[0092] Example 2

[0093] Using rice target gene 1 (OsTarget1) as a template, the genotyping detection effects of adding HEXtag and FAMtag at different positions of ASP1 and ASP2 were tested. The allele polymorphism site was the C / T genotype. One primer and two fluorescent probes were designed, as shown in Table 5 below:

[0094] Table 5 Primer and fluorescent probe sequence list

[0095]

[0096] The combinations of ASP1 and ASP2 are SEQ ID NO:13 & SEQ ID NO:18 and SEQ ID NO:15 & SEQ ID NO:20, respectively, and LSP uses SEQ ID NO:19; the fluorescent probe combinations are SEQ ID NO:1 & SEQ ID NO:2 and SEQ ID NO:3 & SEQ ID NO:4, with HEX fluorescent probes labeling SNP Allele1 sites and FAM fluorescent probes labeling SNP Allele2 sites.

[0097] Except for the primer and probe combination, the specific implementation method, including the test samples, reagents and experimental procedures used, are the same as in Example 1. The specific test results are as follows: Figure 5 As shown.

[0098] from Figure 5 As can be seen, both ASP combinations, when used with two types of fluorescent probes, can correctly genotype the genes, and the results are consistent with the PARMS identification results (Wuhan Jingtai Biotechnology Co., Ltd.). Therefore, tags located at different positions within the ASP can be used to complete genotyping identification, and both type I and type II fluorescent probes are applicable.

[0099] Example 3

[0100] Using rice target gene 1 (OsTarget1) as a template, the genotyping detection effect of ASP1 and ASP2 with different lengths of HEXtag and FAMtag was tested. The allele polymorphism site was the C / T genotype.

[0101] The combinations of ASP1 and ASP2 are SEQ ID NO:15 & SEQ ID NO:14 and SEQ ID NO:15 & SEQ ID NO:18, respectively, with LSP using seq19; the fluorescent probe combination is SEQ ID NO:1 & SEQ ID NO:2, with HEX fluorescent probes labeling SNPAllele1 sites and FAM fluorescent probes labeling SNPAllele2 sites.

[0102] Except for the primer and probe combination, the specific implementation method, including the test samples, reagents and experimental procedures used, are the same as in Example 1. The specific test results are as follows: Figure 6 As shown.

[0103] from Figure 6 As can be seen, both ASP combinations can correctly genotype and the results are consistent with the PARMS identification results (Wuhan Jingtai Biotechnology Co., Ltd.). Therefore, genotyping identification can be completed even if tags of different lengths are located in the same or different positions within the ASP.

[0104] Example 4

[0105] A large number of population samples were genotyped using rice target gene 1 (OsTarget1), and the allele polymorphism site was C / T genotype.

[0106] ASP1, ASP2 and LSP were tested using SEQ ID NO:15, SEQ ID NO:20 and SEQ ID NO:19 respectively; the fluorescent probe combinations were SEQ ID NO:1 & SEQ ID NO:2 and SEQ ID NO:3 & SEQ ID NO:4, with HEX fluorescent probes labeling the SNPAllele1 site and FAM fluorescent probes labeling the SNPAllele2 site. A total of 92 samples and 4 NTCs were tested.

[0107] The specific implementation method, including the test samples, reagents, and experimental procedures used, is the same as in Example 1. Specific test results are as follows: Figure 7 As shown.

[0108] from Figure 7 As can be seen, both fluorescent probes can correctly genotype a large number of population samples, and the results are consistent with the PARMS identification results (Wuhan Jingtai Biotechnology Co., Ltd.). Therefore, the tag located inside the ASP can be used for genotyping identification of a large number of population samples, and both type I and type II fluorescent probes are applicable.

[0109] Example 5

[0110] Using rice target gene 2 (OsTarget2) as template (see Table 6 for sequence), the genotyping detection effect was tested, the allelic polymorphism site was T / A genotype, and 7 primers were designed as shown in Table 6 below:

[0111] Table 6 Primer sequence table

[0112]

[0113] The combinations of ASP1 and ASP2 were SEQ ID NO: 23 & SEQ ID NO: 24 and SEQ ID NO: 25 & SEQ ID NO: 26 respectively, and the fluorescent probe combinations were SEQ ID NO: 1 & SEQ ID NO: 2 and SEQ ID NO: 3 & SEQ ID NO: 4, the HEX fluorescent probe labeled SNP Allele1 site, and the FAM fluorescent probe labeled SNP Allele2 site.

[0114] In addition to the primer and probe combinations, the specific embodiments, including the test samples used, reagents and experimental procedures were the same as in Example 1, and the specific test results are shown in Tables 7 and 8. Figure 8 and 9 .

[0115] As can be seen from Figure 8 , both primer combinations with two types of fluorescent probes can correctly genotype and the results are consistent with the identification results of PARMS (Wuhan Jingpeibiological Technology Co., Ltd.). Similar to the OsTarget1 genotyping detection results in Example 1, in the OsTarget2 genotyping detection, compared to the tag placed inside the ASP ( Figure 8 b, d), when the tag is placed at the 5' end of the ASP ( Figure 8 a, c), there is an obvious shift in the position of parent 1 and parent 2 on the genotyping chart, whether using type I fluorescent probe or type II fluorescent probe.

[0116] Comparing the FAM / ROX difference of parent 1 ( Figure 9 a) and the HEX / ROX difference of parent 2 ( Figure 9 b) of each primer combination with NTC can find that the mismatch signal of the tag located at the 5' end of the ASP (SEQ ID NO: 23 & SEQ ID NO: 24) is significantly stronger than the tag located inside the ASP (SEQ ID NO: 25 & SEQ ID NO: 26), so placing the tag inside the ASP can effectively improve the mismatch between the ASP and the non-matching genotype template.

[0117] Example 6

[0118] The large population sample typing detection is performed using rice target gene 2 (OsTarget2), and the allelic polymorphism site is T / A genotype.

[0119] ASP1, ASP2 and LSP use SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27 respectively. The fluorescent probe combination is SEQ ID NO: 1 & SEQ ID NO: 2, the FAM fluorescent probe labels SNP Allele1 site, and the HEX fluorescent probe labels SNP Allele2 site, and 92 samples and 4 NTCs are tested.

[0120] The specific implementation, including the test sample used, reagent and experimental procedure are the same as those in Example 1, and the specific test results are shown in Figure 10 .

[0121] As can be seen from Figure 10 , the primer combination can correctly type the large population sample and the result is consistent with the identification result of PARMS (Wuhan Jingpeibio Technology Co., Ltd.), so the tag located in the ASP can be used for large population sample genotyping identification.

[0122] The above examples are only specific embodiments of the present application, which are used to illustrate the technical solutions of the present application, but not to limit the present application, the protection scope of the present application is not limited to this, although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that any person skilled in the art within the technical range disclosed by the present application, still can modify or easily think of changes to the technical solutions recorded in the foregoing examples, or make equivalent replacement to part of the technical features, and these modifications, changes or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and all should be covered in the protection scope of the present application. SEQUENCE LISTING <110> Wuhan Jingpeibio Technology Co., Ltd. <120> A primer design method for allelic polymorphism typing and application thereof <160> 31 <170> SIPOSequenceListing 1.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <400> 1 gaaggtcgga gtcaacggat t 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 gaaggtgacc aagttcatgc t 21 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <400> 3 aggacgctga gatgcgtcct gaaggtcgga gtcaacggat t 41 <210> 4 <211> 43 <212> DNA <213> Artificial Sequence <400> 4 agcgatgcgt tcgagcatcg ctgaaggtga ccaagttcat gct 43 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 gaaggtcgga gtcaacggat t 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence <400> 6 gaaggtgacc aagttcatgc t 21 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <400> 7 ccagaaggtc ggagtcaacg gatttgg 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <400> 8 ccagaaggtg accaagttca tgcttgg 27 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <400> 9 tatttaatac tttatgcaga tgttaaatct tc 32 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <400> 10 tatttaatac tttatgcaga tgttaaatct tt 32 <210> 11 <211> 53 <212> DNA <213> Artificial Sequence <400> 11 gaaggtcgga gtcaacggat ttatttaata ctttatgcag atgttaaatc ttc 53 <210> 12 <211> 53 <212> DNA <213> Artificial Sequence <400> 12 gaaggtgacc aagttcatgc ttatttaata ctttatgcag atgttaaatc ttt 53 <210> 13 <211> 53 <212> DNA <213> Artificial Sequence <400> 13 tatttaatac ttgaaggtcg gagtcaacgg atttatgcag atgttaaatc ttc 53 <210> 14 <211> 53 <212> DNA <213> Artificial Sequence <400> 14 tatttaatac ttgaaggtga ccaagttcat gctttatgcag atgttaaatc ttt 53 <210> 15 <211> 59 <212> DNA <213> Artificial Sequence <400> 15 tatttaatac ttccagaagg tcggagtcaa cggatttggt atgcagatgt taaatcttc 59 <210> 16 <211> 59 <212> DNA <213> Artificial Sequence <400> 16 tatttaatac ttccagaagg tgaccaagtt catgcttggt atgcagatgt taaatcttt 59 <210> 17 <211> 53 <212> DNA <213> Artificial Sequence <400> 17 tatttaatag aaggtcggag tcaacggatt ctttatgcag atgttaaatc ttc 53 <210> 18 <211> 53 <212> DNA <213> Artificial Sequence <400> 18 tatttaatag aaggtgacca agttcatgct tttatgcagatgttaaatcttt 53 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <400> 19 tgtttagatt ccatcctaaa actttaca 28 <210> 20 <211> 59 <212> DNA <213> Artificial Sequence <400> 20 tatttaatac cagaaggtga ccaagttcat gcttggcttt atgcagatgt taaatcttt 59 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <400> 21 ttttaatact aaatgtacaa atcctggagt 30 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <400> 22 ttttaatact aaatgtacaa atcctggaga 30 <210> 23 <211> 51 <212> DNA <213> Artificial Sequence <400> 23 gaaggtcgga gtcaacggat tttttaatac taaatgtaca aatcctggag t 51 <210> 24 <211> 51 <212> DNA <213> Artificial Sequence <400> 24 gaaggtgacc aagttcatgc tttttaatac taaatgtaca aatcctggag a 51 <210> 25 <211> 57 <212> DNA <213> Artificial Sequence <400> 25 ttttaatact aaaccagaag gtcggagtca acggatttgg tgtacaaatc ctggagt 57 <210> 26 <211> 57 <212> DNA <213> Artificial Sequence <400> 26 ttttaatact aaaccagaag gtgaccaagt tcatgcttgg tgtacaaatc ctggaga 57 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <400> 27 caaagttagt gaattttcac caatgat 27 <210> 28 <211> 72 <212> DNA <213> Artificial Sequence <400> 28 tatttaatac tttatgcaga tgttaaatct tcgatgtgat agggtgtaaa gttttaggat 60 ggaatctaaa ca 72 <210> 29 <211> 72 <212> DNA <213> Artificial Sequence <400> 29 tatttaatac tttatgcaga tgttaaatct ttgatgtgat agggtgtaaa gttttaggat 60 ggaatctaaa ca 72 <210> 30 <211> 59 <212> DNA <213> Artificial Sequence <400> 30 ttttaatact aaatgtacaa atcctggagt aaatcattgg tgaaaattca ctaactttg 59 <210> 31 <211> 59 <212> DNA <213> Artificial Sequence <400> 31 ttttaatact aaatgtacaa atcctggaga aaatcattgg tgaaaattca ctaactttg 59

Claims

1. A primer design method for allele polymorphism typing, characterized in that, Includes the following steps: S1. Based on the target gene sequence to be detected, design specific AS-PCR primers and fluorescent probes. The fluorescent probes are Taqman probes or Amplifluor probes. The two ends of the Taqman probe are labeled with a fluorescent group and a quenching group, respectively. The 5' end of the Amplifluor probe has a stem-loop structure, and the fluorescent group and the quenching group are labeled at the stem end, respectively. S2. For the two ASP primers in the AS-PCR primers, add a tag sequence that does not match the target gene sequence to be detected to each of them to obtain primers for allelic polymorphism typing; The tag sequence is inserted at a location at least 10 bases from the 3' end of the primer and at least 1 base from the 5' end of the primer; the length of the tag sequence is 15 to 50 bases; the tag sequence is completely identical to the Taqman probe sequence or completely identical to the 3' end sequence of the Amplifluor probe.

2. A primer for allele polymorphism typing, characterized in that, The primers were designed using the primer design method for allele polymorphism typing as described in claim 1.

3. A primer design system for allele polymorphism typing, characterized in that, Includes the following modules: Information acquisition module: used to acquire the target gene sequence to be detected, and then design specific AS-PCR primers and fluorescent probes based on the target gene sequence. The fluorescent probe is a Taqman probe or an Amplifluor probe. The two ends of the Taqman probe are labeled with a fluorescent group and a quenching group, respectively. The 5' end of the Amplifluor probe has a stem-loop structure, and the fluorescent group and the quenching group are labeled at the stem end. Primer design module: Used to add a tag sequence that does not match the target gene sequence to each of the two ASP primers in the AS-PCR primers, so as to obtain primers for allelic polymorphism typing; The tag sequence is inserted at a location at least 10 bases from the 3' end of the primer and at least 1 base from the 5' end of the primer; the length of the tag sequence is 15 to 50 bases; the tag sequence is completely identical to the Taqman probe sequence or completely identical to the 3' end sequence of the Amplifluor probe.

4. The primer design system for allele polymorphism typing according to claim 3, characterized in that, The primer design module also includes a primer-related parameter optimization module, which is used to optimize the primer position on the template, primer length, annealing temperature, GC content, tag sequence selection, and tag sequence insertion site on the primer.

5. A detection system for allele polymorphism typing, characterized in that, The system includes the primers for allelic polymorphism typing as described in claim 2, wherein the primers are used to detect one or more AS-PCR products, and the detection system further includes a universal reverse primer that can pair with the primers, the fluorescent probe as described in claim 1, a buffer system, DNA polymerase, dNTPs, and the target gene to be detected.

6. The detection system for allele polymorphism typing according to claim 5, characterized in that, The insertion site and the distance between the 3' terminal bases of the tag sequence are the same or different in different primers.

7. The detection system for allele polymorphism typing according to claim 5, characterized in that, The tag sequences within different primers may be of the same or different lengths.

8. The detection system for allele polymorphism typing according to claim 5, characterized in that, The primers are located upstream or downstream of the polymorphic site.

9. A detection kit for allele polymorphism typing, characterized in that, The detection system for allele polymorphism typing as described in any one of claims 5 to 8.

10. A non-diagnostic detection method for allele polymorphism typing, characterized in that, Includes the following steps: S1. Design the primers for allelic polymorphism typing as described in claim 2; S2. The detection system for allele polymorphism typing according to any one of claims 5 to 8, after adding the required reagents, and performing an AS-PCR reaction; S3. After the reaction is complete, the genotyping of the target gene can be completed by analyzing the fluorescence signal intensity.

11. The application of the primers for allele polymorphism typing as described in claim 2 or the detection system for allele polymorphism typing as described in any one of claims 5 to 8 in allele polymorphism typing detection, wherein the application is for non-diagnostic purposes.

12. The application according to claim 11, characterized in that, The allele polymorphism typing detection is for rice allele polymorphism typing.

Citation Information

Patent Citations

  • Method for detecting a nucleic acid sequence

    WO2020144480A1

  • Technology and kit for detecting gene polymorphism site

    CN108998505A

  • Human aspirin resistance gene polymorphism detection kit as well as preparation method and application thereof

    CN109055530A