Composition for visualizing detection of leptospirosis based on rpa-lbcas12a system and application thereof

The RPA-LbCas12a system composition and method enables rapid and accurate detection of Burkholderia melioides, solving the problems of long detection cycles and misdiagnosis in existing technologies. It has high sensitivity and specificity and is suitable for rapid point-of-care diagnosis.

CN114807401BActive Publication Date: 2026-04-28ARMY MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ARMY MEDICAL UNIV
Filing Date
2022-05-20
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing methods for detecting melioidosis are characterized by long processing times, high rates of misdiagnosis and false positives/false negatives, and are not suitable for rapid point-of-care diagnosis, failing to meet the need for rapid and accurate testing.

Method used

A combination of RPA primers, crRNA, LbCas12a protease, and ssDNA fluorescent probes was used to achieve rapid detection of Burkholderia melioides via isothermal amplification of recombinase polymerase and CRISPR-Cas12a cleavage reaction. Specific RPA primers were used to amplify the pathogen's genomic DNA, and LbCas12a protease was specifically recognized and cleaved under the guidance of crRNA, triggering a fluorescent signal.

Benefits of technology

It enables rapid and accurate detection of Burkholderia melioides, capable of identifying genomic DNA concentrations as low as 2.7 copies/μL within 1 hour, avoiding reliance on large-scale instruments and equipment, and possessing high sensitivity and specificity, making it suitable for rapid field detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114807401B_ABST
    Figure CN114807401B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular diagnosis, and in particular to a composition for visual detection of glanders based on an RPA-LbCas12a system and application thereof.The present application provides a composition for detecting Burkholderia mallei, which comprises RPA primers, crRNA, LbCas12a protease and ssDNA fluorescent probes; the nucleotide sequence of the RPA primers is shown in SEQ ID NO: 5 and SEQ ID NO: 6; and the nucleotide sequence of the transcription template of the crRNA is shown in SEQ ID NO: 7 and SEQ ID NO: 9.Based on the composition, the present application further provides a method for detecting Burkholderia mallei.The method combines RPA amplification with a CRISPR-Cas12a system, and has a sensitivity of a detection lower limit of 2.7 copies / μL and stronger specificity, and can detect whether the sample contains Burkholderia mallei within 1h without the aid of large instruments and equipment, which is helpful for rapid diagnosis and screening of glanders.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, specifically to a composition for visual detection of Burkholderia melioides based on the RPA-LbCas12a system and its application. Background Technology

[0002] Melioidosis is a disease caused by Burkholderia pseudomallei (Bp) through respiratory aerosols or skin contact. Its natural focus is the subtropical regions of Hainan and the southeastern coast of my country. With increased population movement in recent years, imported cases have also occurred in non-natural focus areas. Currently, there is no effective treatment or vaccine for Bp infection. Bp is easily acquired, easily transmitted, and exhibits widespread drug resistance, and is listed on the verification list of the International Biological Weapons Convention and as a Class I bioterrorism agent by the US CDC. Clinical manifestations of infection are often subtle or resemble various diseases. Without timely treatment, it can easily develop into organ abscesses or even sepsis, with a clinical mortality rate of 10%–60%. Therefore, rapid diagnosis of melioidosis is extremely important.

[0003] Currently, laboratory diagnostic methods for melioidosis mainly include bacterial isolation and culture, serological testing, proteomics analysis, and molecular biological methods. While isolation and culture is the gold standard for infection diagnosis, it is time-consuming, prone to missing the optimal treatment window, and easily misidentified as contamination or other bacteria of the same species when lacking relevant experience, leading to incorrect treatment and delays in patient care. Serological testing is highly susceptible to false negatives or false positives due to the window period and background interference from endemic populations (the seropositivity rate in Hainan is 6%–20%). Bacterial mass spectrometry identification based on proteomics analysis requires high concentration and purity of bacterial samples, and the results for some species are unstable due to regional differences and database update delays. Currently reported molecular biological methods are mainly based on PCR and Lamp (loop-mediated isothermal amplification), detecting target genes including 16S rRNA and type III and VI secretion system gene clusters. The 16S rRNA of Burkholderia melioidosis is compared with those of Burkholderia thamnsis and Burkholderia melioidosis. The small differences in rRNA sequences make identification errors highly likely; PCR methods require sophisticated equipment and skilled personnel, making them unsuitable for point-of-care rapid diagnosis (rapid field testing); and the Lamp method is prone to aerosol contamination, leading to false positives. Therefore, there is an urgent need for a rapid, sensitive, and specific method for detecting melioidosis. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide a composition for detecting Burkholderia melioides to meet the need for rapid and accurate diagnosis of Burkholderia melioides infection, and to effectively avoid missed detection and false detection.

[0005] The composition for detecting Burkholderia melioides provided by the present invention is characterized by comprising RPA primers, crRNA, LbCas12a protease, and ssDNA fluorescent probe; the nucleotide sequences of the RPA primers are shown in SEQ ID NO:5 and SEQ ID NO:6; and the nucleotide sequences of the transcription template of the crRNA are shown in SEQ ID NO:7 and SEQ ID NO:9.

[0006] The sequence of the ssDNA fluorescent probe can be TTATT, with the 5' end labeled with a FAM fluorescent reporter group and the 3' end labeled with a BHQ1 quencher group.

[0007] The composition may also include universal reagents required for recombinase polymerase isothermal amplification (RPA) reaction systems and / or universal reagents required for CRISPR-Cas12a cleavage systems.

[0008] The use of any of the compositions described herein for detecting Burkholderia melioides in the preparation of products for detecting Burkholderia melioides is also within the scope of protection of this invention.

[0009] The present invention also provides a kit for detecting Burkholderia melioides, characterized in that it comprises any of the compositions described above for detecting Burkholderia melioides.

[0010] The application of any of the compositions or kits described herein for detecting Burkholderia melioides in the detection of Burkholderia melioides is also within the scope of protection of this invention.

[0011] The present invention also provides a method for detecting Burkholderia melioides, characterized by comprising the following steps:

[0012] S1. Extract genomic DNA from the sample to be tested;

[0013] S2. Using the genomic DNA of the sample to be tested as a template, the above-mentioned RPA primers were used to perform a recombinase polymerase isothermal amplification reaction to obtain the RPA product;

[0014] S3. Mix the above crRNA, LbCas12a protease and ssDNA fluorescent probe with the RPA product obtained in step S2 and perform CRISPR-Cas12a cleavage reaction to obtain the enzyme digestion product.

[0015] S4. Detect the fluorescence signal of the enzyme digestion product obtained in step S3; if the enzyme digestion product produces fluorescence, it is determined that the sample to be tested contains Burkholderia melioides; if the enzyme digestion product does not produce fluorescence, it is determined that the sample to be tested does not contain Burkholderia melioides.

[0016] The method for detecting the fluorescence signal can be either a) or b):

[0017] a) Place the enzyme digestion product under LED blue light and observe with the naked eye whether the enzyme digestion product produces fluorescence;

[0018] b) Place the enzyme digestion product in a fluorescence quantitative analyzer to detect the fluorescence intensity; if the relative fluorescence unit is higher than 659, it is determined that the sample contains Burkholderia melioides; if the relative fluorescence unit is lower than 659, it is determined that the sample does not contain Burkholderia melioides.

[0019] The system and conditions for the recombinase polymerase isothermal amplification reaction can be as follows: 29.5 μL of Rehydration Buffer, 5 μL of genomic DNA, 2.4 μL each of 10 μM RPA forward and reverse primers, 8.2 μL of RNase-free H2O, mixed well, and then 2.5 μL of 280 mM MgOAc is added to start the reaction, and the reaction is carried out at 39 °C for 20 min.

[0020] The system and conditions for the CRISPR-Cas12a cleavage reaction can be as follows: 5.2 μL RNase-free H2O, 2 μL 10×DNase I Reaction Buffer, 1 μL 1.34 μg / μL LbCas12a, 0.8 μL 1.67 μg / μL crRNA, 1 μL 10 μMssDNA fluorescent probe, and 10 μL RPA product. After mixing, the mixture is placed at 37°C for 30 min.

[0021] The composition provided by this invention comprises specific RPA primers and crRNA for Burkholderia melioides. The principle for detecting Burkholderia melioides based on this composition is as follows: RPA amplification (recombinase polymerase isothermal amplification) of the pathogen's genomic DNA sample is performed using the specific RPA primers to obtain the RPA product; then, under the guidance of crRNA, LbCas12a protease specifically recognizes and cis-cleaves the RPA product, while simultaneously stimulating non-specific trans-cleavage of the ssDNA fluorescent probe in the reaction system, thereby generating a visible fluorescent signal.

[0022] The method of this invention, through RPA amplification and persistent trans-cleavage of LbCas12a, can detect *Burkholderia melioides* genomic DNA at concentrations as low as 2.7 copies / μL. The dual recognition of RPA primers and crRNA significantly improves the specificity of *Burkholderia melioides* detection. The method of this invention was also used to detect other species of *Burkholderia* (*Burkholderia thamnoides*, *Burkholderia cepacia*), *Staphylococcus aureus*, and *Acinetobacter baumannii*, all with negative results. Through optimization of reaction conditions, the method of this invention can rapidly detect the presence of *Burkholderia melioides* in samples within 1 hour, without the need for large-scale instruments, thus facilitating rapid diagnosis and screening of melioidosis. Attached Figure Description

[0023] Figure 1 A flowchart for the visual detection of Burkholderia melioides.

[0024] Figure 2 This is the SDS-PAGE electrophoresis result of purified LbCas12a protein. The left lane in the figure represents the protein molecular weight standard, and the right lane represents the purified LbCas12a protein.

[0025] Figure 3 This image shows the agarose gel electrophoresis results of recombinase polymerase amplification products using different RPA primers. From left to right, the lanes in the figure represent the DNA molecular weight standard, the amplification product of the Bp-p3-F / Bp-p3-R primer, the amplification product of the Bp-p2-F / Bp-p2-R primer, and the amplification product of the Bp-p1-F / Bp-p1-R primer. The DNA molecular weight standards, from top to bottom, are 1000 bp, 700 bp, 500 bp, 400 bp, 300 bp, 200 bp, and 100 bp.

[0026] Figure 4 The fluorescence signal detection results of RPA-LbCas12a reactions with different combinations of RPA products and crRNA are shown. The horizontal axis represents the RPA-LbCas12a reaction time (min), and the vertical axis represents the relative fluorescence units (RFU). Bp-p3-crRNA1 represents the combination of RPA product amplified by Bp-p3-F / Bp-p3-R primers and Bp-crRNA1; Bp-p3-crRNA2 represents the combination of RPA product amplified by Bp-p3-F / Bp-p3-R primers and Bp-crRNA2; and so on.

[0027] Figure 5The results show the sensitivity evaluation of the RPA-LbCas12a detection system for Burkholderia melioides. The x-axis represents the RPA-LbCas12a reaction time (min), and the y-axis represents the relative fluorescence units (RFU). 1.35-270000 copies / μL represents the concentration of Burkholderia melioides genomic DNA in the nucleic acid sample.

[0028] Figure 6 This is the result of a specificity evaluation experiment of the RPA-LbCas12a detection system for Burkholderia melioides. The x-axis represents the RPA-LbCas12a reaction time (min), and the y-axis represents the relative fluorescence units (RFU). Bp represents Burkholderia melioides, Bt represents Burkholderia thamnida, Bc represents Burkholderia cepacia, "Staphylococcus aureus" represents Staphylococcus aureus, "Acinetobacter baumannii" represents Acinetobacter baumannii, and the negative control is normal blood genomic DNA.

[0029] Figure 7 ROC curve of Burkholderia melioides RPA-LbCas12a detection system.

[0030] Figure 8 This is a visualization of the RPA-LbCas12a reaction product of Burkholderia melioides under LED blue light. "Negative" indicates a negative control, "blank" indicates a blank control, and 2.7-270,000 copies / μL indicates the concentration of Burkholderia melioides genomic DNA in the sample.

[0031] Figure 9 The fluorescence intensity of the RPA-LbCas12a reaction product of Burkholderia melioides is detected by real-time quantitative PCR. The x-axis represents the RPA-LbCas12a reaction time (min), and the y-axis represents the relative fluorescence units (RFU). Detailed Implementation

[0032] The present invention will be further described below with reference to embodiments. It should be understood that the following embodiments are only for explanation and illustration of the present invention and do not limit the scope of the present invention in any way.

[0033] Unless otherwise specified, all reagents used in the following examples are conventional reagents in the art, commercially available or prepared according to conventional methods in the art; the experimental methods and conditions used are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0034] The Burkholderia pseudomallei used in the following examples is strain BPC006, which is described in the literature (Yao Fang, et al. 2012. First Genome Sequence of a Burkholderia pseudomallei Isolate in China, Strain BPC006, Obtained from a Melioidosis Patient in Hainan. Journal of Bacteriology. 194(23):6604-6605.) and was provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0035] The Burkholderia thailandensis (BT) strain used in the following examples is ATCC700388, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0036] The Burkholderia cepacia (BC) strain used in the following examples is ATCC25416, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0037] The Staphylococcus aureus strain used in the following examples is ATCC25923, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0038] The Acinetobacter baumannii strain used in the following examples is ATCC19606, provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0039] The Escherichia coli (BL21 DE3) with the LbCas12a expression plasmid (PUC57-ZB011) used in the following examples were purchased from Nanjing Maixike Biotechnology Co., Ltd.

[0040] Main reagents and consumables:

[0041] Quick DNA / RNA Pathogen miniprep Kit: ZYMO RESEARCH, catalog number R1042. Human DNA Quantitation Standard: NIST, catalog number SRM2372a. TwistAmp Basic Kit: TwistDx, catalog number TABAS03KIT. T7 RiboMAX TM Express Large Scale RNA Production System: Promega, catalog number P1320. RNA Clean & Concentrator Kits: ZYMO RESEARCH, catalog number R1015. DNase IReaction Buffer: NEB, catalog number B0303S. NEB buffer: NEB, catalog number B7203S.

[0042] Example 1: Establishment of a detection system for Burkholderia melioides RPA-LbCas12a

[0043] 1. Target sequence selection

[0044] Through analysis, we selected the nucleotide sequence 2381740-2382182 bp on chromosome 1 (GenBank: CP003781.1) of Burkholderia melioides strain BPC006 as the target sequence for Burkholderia melioides gene detection, as shown in SEQ ID NO:10.

[0045] Target sequence (443bp) for Burkholderia melioides gene detection:

[0046] GGGACGCATACACTACCAGATTTGATAGTTTCGTCCTTTCAAAATCTAGACTCTAATAAACTCGCACACTTTTCCCATCACATCGATGGCGATTAACCAATAAATCCAGTGGAGTTAAAAATGGGCAAAGCGAATACCATCGAGCTCACAAACACATCATTTACTCTCGTCCTGCATACGATATACGCCAACACGGGCAATTGGTCCGGCGATTATCCGCC GGCCTATTTACGGCCGAACGATACGCTATTTTTACGAGTACGCTTGATGGAAAAGGAGATCTAAACGGCTCAGCCCGTTTCGACATCCTTGATACAGCGGTCAAGAGATGTCCGGACGCGACCTACGTACAGTCCAACTGGGACAATCCCGTCGGAGCGGACAATGGGGGATCCTCGTCCGTAGTCGGCGCCACAGCACAGTTCTTCAACGTAAGTGG(SEQID NO:10).

[0047] 2. Design of RPA primers and crRNA

[0048] For the selected target sequence (SEQ ID NO:10), we designed several theoretically feasible RPA primers and crRNAs. However, most of them were not effective, and some of the usable sequences are shown in Tables 1 and 2.

[0049] Table 1 Candidate RPA primers

[0050]

[0051]

[0052] Table 2. Transcription templates for candidate crRNAs

[0053]

[0054] Note: In the transcription template sequence of crRNA, the underlined part is the anchoring sequence and transcription promoter sequence that binds to LbCas12a protein, and the rest is the guide sequence that binds to the bases complementary to the RPA amplification product.

[0055] Universal reporter probe (ssDNA): 5'-FAM-TTATT-BHQ1-3'. The 5' end FAM is a fluorescent reporter group, and the 3' end BHQ1 is a quencher group.

[0056] Shanghai Sangon Biotech Co., Ltd. was commissioned to synthesize the RPA primers in Table 1, the transcription templates for crRNA in Table 2, and the aforementioned universal reporter probe (ssDNA).

[0057] 3. Preparation and quantitative detection of bacterial genomic DNA

[0058] Test bacteria: Burkholderia melioides strain BPC006.

[0059] Genomic DNA was extracted from the tested bacteria using the Quick DNA / RNA Pathogen miniprep Kit (Zymo, R1042) according to the kit instructions. A positive plasmid standard (PUC57-BP-G14-3) containing the BPC006 target sequence gene was synthesized. The positive standard was quantified using the international standard Human DNA Quantitation Standard (NIST, SRM 2372a) and the PUC57-GAPDH plasmid.

[0060] Genomic DNA from Burkholderia melioides strain BPC006 was serially diluted, and the 10-fold dilution was labeled Bp10. -1 Similarly, real-time quantitative PCR was used to quantify the genomic DNA of Burkholderia melioides at various dilutions. The real-time quantitative PCR system (25 μL) consisted of: 2.5 μL 10×PCR reaction buffer (Takara, 9151AM), 3 μL MgCl2 solution, 0.2 μL Taq DNA polymerase, 7.5 μL primer and probe mixture, 5 μL sample, 0.0625 μL dUTP (100 mM), 0.0625 μL dTTP (100 mM), 0.125 μL dATP (100 mM), 0.125 μL dGTP (100 mM), 0.125 μL dCTP (100 mM), and 6.3 μL DEPC water. The primer and probe mixture consisted of: 2.5 μL of upstream primer (100 μM), 2.5 μL of downstream primer (100 μM), 5 μL of probe (100 μM), and 365 μL of DEPC water. The quantitative PCR program was as follows: 37℃ for 10 minutes; 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 10 seconds; 58.3℃ annealing for 40 seconds, for 40 cycles. Fluorescence signals were collected after each cycle to complete the PCR amplification reaction and analyze the collected fluorescence signals.

[0061] The upstream primer sequence (5'-3') for real-time PCR is: CGCTCACAGTTCCTTTCCC (SEQ ID NO: 11);

[0062] The downstream primer sequence (5'-3') for real-time PCR is: AGTGCAGTTCTTCGCTTGG (SEQ ID NO:12);

[0063] Real-time PCR probe sequence (5'-3'): GAGATCGGAGGCTTGATAG (SEQ ID NO:13).

[0064] The results of the genomic DNA quantification experiment of Burkholderia melioides are shown in Table 3. The standard curve was calculated using the formula: CT value = -3.3797Log(copy) + 37.593, R 2 =0.9962, amplification efficiency E ranges from 90% to 110%.

[0065] Table 3. Results of genomic DNA quantification experiments for Burkholderia melioides.

[0066]

[0067] 4. Expression and purification of LbCas12a protein

[0068] Escherichia coli BL21(DE3) containing the LbCas12a expression plasmid (PUC57-ZB011) was inoculated into LB medium (kanamycin final concentration 50 μg / μL) and cultured overnight. The overnight culture was then inoculated into 1 L of fresh LB medium at a 1:100 volume ratio and cultured until OD600 = 0.5-0.6. Then, 400 μL of 0.5 M IPTG was added, and the culture was induced for 20 h. The induced bacterial cells were sonicated and centrifuged to obtain the supernatant. The LbCas12a protein in the supernatant was purified using a Ni column (GE Healthcare), concentrated using ultrafiltration tubes, quantitatively aliquoted, and stored at -80°C. The purified LbCas12a protein was analyzed by SDS-PAGE. Results are as follows: Figure 2 As shown, the LbCas12a protein band is visible at 170 kD.

[0069] 5. Screening of RPA primer pairs and crRNA

[0070] (1) Preparation of RPA products

[0071] Prepare a 10 μM solution of RPA primers (Bp-p1-F, Bp-p1-R, Bp-p2-F, Bp-p2-R, Bp-p3-F, Bp-p3-R). Dilute the Burkholderia melioides genomic DNA solution 10 μM. 3The template DNA was doubled, and ddH2O was used as a negative control instead of template DNA. RPA amplification was performed using the TwistAmp Basic kit (TwistDx, TABAS03KIT) according to the kit instructions. First, prepare 47.5 μL of the following premix: 29.5 μL Primer-Free Rehydration Buffer, 2.4 μL each of forward and reverse primers (10 μM), 8.2 μL RNase-free ddH2O, and 5 μL template DNA. Mix the premix thoroughly in a PCR tube, then add 2.5 μL of 280 mM magnesium acetate solution (MgOAc) to the PCR tube cap. After capping, centrifuge briefly and immediately incubate at 39°C for 20 min for the RPA reaction. After the reaction, perform agarose gel electrophoresis to detect the amplification.

[0072] The results are as follows Figure 3 As shown, primer pairs Bp-p1-F / Bp-p1-R, Bp-p2-F / Bp-p2-R, and Bp-p3-F / Bp-p3-R can amplify bands of 369bp, 382bp, and 443bp, respectively. The three RPA products were used in the RPA-LbCas12a reaction.

[0073] (2) Preparation of crRNA

[0074] Prepare an annealing reaction mixture by mixing 1 μL of Bp-crRNA1 transcription template (10 μM) and 1.5 μL of Bp-crRNA transcription template (10 μM). Prepare another annealing reaction mixture by mixing 1 μL of Bp-crRNA2 transcription template (10 μM) and 1.5 μL of Bp-crRNA transcription template (10 μM). Place the annealing reaction mixture in a PCR instrument and preheat at 95 °C for 2 min; then slowly cool to 25 °C at a rate of 0.1 °C / s. Obtain a linear DNA template.

[0075] Using T7 RiboMAX TMThe in vitro transcription reaction system of the Promega Express Large Scale RNA Production System (P1320) was prepared according to the product instructions: 10 μL Ribomax express T7 2×buffer, 2.5 μL linear DNA template, 2 μL Enzyme Mix T7 express, and Nuclease-free water to a final volume of 20 μL. The in vitro transcription reaction system was incubated at 37°C for 30 min to obtain the in vitro transcription reaction solution. Then, the following mixture was prepared: 5 μL NEB buffer (B7203S), 4 μL DNase I, 20 μL in vitro transcription reaction solution, and DEPC-treated water to a final volume of 100 μL. The mixture was incubated at 37°C for 20-30 min, then 1 μL of 0.5M EDTA was added to the mixture, and after centrifugation, the mixture was incubated at 75°C for 10 min. The crRNA in the mixture was purified using RNA Clean & Concentrator Kits (ZYMO RESEARCH, R1015) according to the product instructions to obtain purified Bp-crRNA1 and Bp-crRNA2, which were then quantified and stored at -80℃ for later use.

[0076] (3) RPA-LbCas12a reaction

[0077] The three prepared RPA products were used as cleavage substrates and combined with Bp-crRNA1 or Bp-crRNA2 to prepare an RPA-LbCas12a reaction system (20 μL): 10 μL RPA product, 0.2 μL crRNA (1.67 μg / μL), 2 μL DNase I Reaction Buffer (NEB, B0303S), 1 μL LbCas12a (1.34 μg / μL), 1 μL reporter probe ssDNA (10 μM), and RNase-free ddH2O to a final volume of 20 μL. After vortexing and mixing, the mixture was briefly centrifuged and placed in a Bio-Rad CFX 96 real-time quantitative PCR instrument. The reaction was carried out at 37℃ for 30 min, and the fluorescence signal intensity (RFU) was detected. For the negative control, the elution buffer from the Quick DNA / RNA Pathogen miniprep Kit was used as the template to prepare the RPA product, which was then reacted with crRNA in an RPA-LbCas12a reaction.

[0078] The results are as follows Figure 4As shown, the fluorescence signal value of the RPA product of the Bp-p3-F / Bp-p3-R primer pair combined with Bp-crRNA1 in the RPA-LbCas12a reaction is higher than that of other combinations. Therefore, Bp-p3-F / Bp-p3-R is preferred as the primer pair for the RPA amplification reaction, and Bp-crRNA1 is preferred as the crRNA for the RPA-LbCas12a reaction.

[0079] 6. Optimization of the RPA-LbCas12a reaction system

[0080] The following RPA-LbCas12a reaction system was prepared: 1-10 μL of RPA product from the Bp-p3-F / Bp-p3-R primer pair, 0.1-1 μL of Bp-crRNA1 (1.67 μg / μL), 2 μL of DNase I Reaction Buffer (NEB, BO303S), 0.5-3 μL of LbCas12a (1.34 μg / μL), 1 μL of reporter probe ssDNA (10 μM), and RNase-free ddH2O to a final volume of 20 μL. After vortexing and briefly centrifuging, the system was placed in a Bio-Rad CFX 96 real-time quantitative PCR instrument and incubated at 37℃ for 30 min. The fluorescence signal intensity (RFU) was then measured. Based on the fluorescence signal detection results, the reaction concentrations of RPA product, Bp-crRNA1, and LbCas12a protein in the RPA-LbCas12a reaction system were optimized.

[0081] The results are shown in Tables 4-6. Table 4 shows that when the LbCas12a protein concentration in the reaction system was 67 ng / μL or 134 ng / μL, and the RPA product volume was 6 μL or 10 μL, the fluorescence signal value of the reaction system was positive and higher than other groups. Table 5 shows that when the Bp-crRNA1 concentration in the reaction system was 67 ng / μL and the RPA product volume was 10 μL, the fluorescence signal value of the reaction system was positive and higher than other groups. Table 6 shows that when the LbCas12a protein concentration and the Bp-crRNA1 concentration in the reaction system were both 67 ng / μL, the fluorescence signal value of the reaction system was positive and higher than other groups. Based on comprehensive analysis, the optimal reaction system concentrations were 67 ng / μL for LbCas12a protein and 67 ng / μL for Bp-crRNA1, and 10 μL for the RPA product.

[0082] Table 4 Results of the concentration optimization experiment of LbCas12a protein and RPA product in the reaction system

[0083]

[0084] Note: The initial concentration of the LbCas12a protein solution was 1.34 μg / μL. The LbCas12a protein concentrations in the table are the final concentrations of LbCas12a protein in the reaction system, with the initial solution volume added to the reaction system in parentheses.

[0085] Table 5 Results of the concentration optimization experiment of Bp-crRNA1 and RPA products in the reaction system

[0086]

[0087] Note: The initial concentration of the Bp-crRNA1 solution was 1.675 μg / μL. The Bp-crRNA1 concentrations in the table are the final concentrations of Bp-crRNA1 in the reaction system, and the numbers in parentheses represent the initial volume of the solution added to the reaction system.

[0088] Table 6 Results of the concentration optimization experiment of LbCas12a protein and Bp-crRNA1 in the reaction system

[0089]

[0090] Note: The initial concentration of the LbCas12a protein solution was 1.34 μg / μL, and the initial concentration of the Bp-crRNA1 solution was 1.675 μg / μL. The LbCas12a protein concentration and Bp-crRNA1 concentration in the table are the final concentrations of LbCas12a protein and Bp-crRNA1 in the reaction system, respectively. The numbers in parentheses represent the initial solution volumes added to the reaction system.

[0091] 7. Optimization experiments of RPA reaction time and reaction temperature

[0092] Dilute Burkholderia malformans genomic DNA 10 3The template DNA was doubled and used as a negative control, with ddH2O used instead of template DNA. RPA amplification was performed using the TwistAmp Basic kit (TwistDx, TABAS03KIT) according to the kit instructions. First, a 47.5 μL premix was prepared: 29.5 μL Primer-Free Rehydration buffer, 2.4 μL each of Bp-p3-F / Bp-p3-R primers (10 μM), 8.2 μL RNase-free ddH2O, and 5 μL template DNA. The premix was then thoroughly mixed in a PCR tube. 2.5 μL of 280 mM magnesium acetate solution (MgOAc) was added to the PCR tube cap. After capping, the tube was briefly centrifuged and then immediately placed at different reaction temperatures (37℃ or 39℃) for different times (20-40 min). The resulting RPA product was used for CRISPR-Cas12a detection. The following RPA-LbCas12a reaction system was prepared: 10 μL of RPA product at different reaction temperatures and times, 0.8 μL of Bp-crRNA1 (1.67 μg / μL), 2 μL of DNase I Reaction Buffer (NEB, BO303S), 1 μL of LbCas12a (1.34 μg / μL), 1 μL of reporter probe ssDNA (10 μM), and RNase-free ddH2O to a final volume of 20 μL. After vortexing and briefly centrifuging, the system was placed in a Bio-Rad CFX 96 real-time quantitative PCR instrument and incubated at 37℃ for 30 min. The fluorescence signal intensity (RFU) was then detected.

[0093] The experimental results are shown in Table 7. The RPA product obtained by reacting the RPA reaction system at 39℃ for 20 min showed the strongest fluorescence signal of the RPA-LbCas12a reaction. Therefore, 39℃ for 20 min was selected as the optimal condition for the RPA reaction.

[0094] Table 7. Optimization results of RPA reaction time and temperature.

[0095]

[0096] Based on the above screening and optimization experiments, the following detection system for Burkholderia melioides RPA-LbCas12a was established:

[0097] Step S1: RPA reaction

[0098] RPA amplification was performed using the TwistAmp Basic kit (TwistDx, TABAS03KIT). Premixed solution was prepared as follows: 29.5 μL Primer-Free Rehydration buffer, 2.4 μL each of Bp-p3-F / Bp-p3-R primers (10 μM), 5 μL template DNA, and RNase-free ddH2O to a final volume of 47.5 μL. After thoroughly mixing the premixed solution in a PCR tube, 2.5 μL of 280 mM magnesium acetate solution (MgOAc) was added to the PCR tube cap. The tube was then capped, centrifuged briefly, and immediately incubated at 39°C for 20 min to obtain the RPA product.

[0099] Step S2: RPA-LbCas12a reaction

[0100] Prepare the RPA-LbCas12a reaction system: 10 μL of the RPA product obtained in step S1, 0.8 μL of Bp-crRNA1 (1.67 μg / μL), 2 μL of DNase I Reaction Buffer (NEB, BO303S), 1 μL of LbCas12a (1.34 μg / μL), 1 μL of reporter probe ssDNA (10 μM), and add RNase-free ddH2O to a final volume of 20 μL. After vortexing and mixing the reaction system, briefly centrifuge and place it in a Bio-Rad CFX 96 real-time quantitative PCR instrument. Incubate at 37℃ for 30 min and detect the fluorescence signal intensity (RFU).

[0101] Example 2: Sensitivity and specificity evaluation of the Burkholderia melioides RPA-LbCas12a detection system

[0102] Normal blood genomic DNA was extracted from normal human blood samples using the Quick DNA / RNA Pathogen miniprep Kit (ZYMO RESEARCH, R1042) for the following sensitivity and specificity evaluation experiments. Normal human blood samples were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0103] 1. Sensitivity Evaluation

[0104] Genomic DNA of Burkholderia melioides BPC006 strain, quantified by real-time quantitative PCR, was added to normal blood genomic DNA solution to obtain Burkholderia melioides nucleic acid samples at concentrations of 1.35 copies / μL, 2.7 copies / μL, 27 copies / μL, 270 copies / μL, 2700 copies / μL, 27000 copies / μL, and 270000 copies / μL. 5 μL of each concentration of Burkholderia melioides nucleic acid sample was used as a template for RPA amplification. Simultaneously, RPA amplification was performed using ddH2O as a template as a negative control. The Burkholderia melioides RPA-LbCas12a detection system established in Example 1 was used for detection.

[0105] The results are as follows Figure 5 As shown, the RPA-LbCas12a detection system of the present invention has a detection limit of 2.7 copies / μL of Burkholderia melioides nucleic acid sample, and has high sensitivity.

[0106] 2. Specificity evaluation

[0107] Using normal blood genomic DNA as a negative control and Burkholderia melioides strain BPC006 as a positive control, the RPA-LbCas12a detection system for Burkholderia melioides established in Example 1 was used to detect genomic DNA samples of Burkholderia thaiensis (Bt), Burkholderia cepacia (Bc), Staphylococcus aureus (Sa), and Acinetobacter baumannii to evaluate the specificity of the RPA-LbCas12a detection system for Burkholderia melioides.

[0108] The results are as follows Figure 6 As shown, the negative control and the genomic DNA samples of Burkholderia thamnoides (Bt), Burkholderia cepacia (Bc), Staphylococcus aureus (Sa), and Acinetobacter baumannii (Ab) were all negative, while the positive control was positive. This demonstrates that the established RPA-LbCas12a detection system has good specificity for Burkholderia melioides (Bp), and other strains of Burkholderia, as well as Staphylococcus aureus and Acinetobacter baumannii, do not interfere with the detection and analysis of Burkholderia melioides (Bp).

[0109] Example 3: ROC curve validation of the Burkholderia melioides RPA-LbCas12a detection system

[0110] The normal blood samples used in this experiment were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University. The Burkholderia melioides culture used in this experiment was Burkholderia melioides strain BPC006.

[0111] First, prepare the following samples:

[0112] Sample 1: Twenty normal blood samples were collected, and genomic DNA was extracted from each sample.

[0113] Sample 2: Twenty normal blood samples were taken, and a certain amount of Burkholderia melioides bacterial suspension was added to each sample. Genomic DNA was then extracted from each sample. The copy number of Burkholderia melioides genomic DNA in the extracted genomic DNA was approximately 1-2.7 copies / μL.

[0114] Sample 3: Twenty normal blood samples were taken, and a certain amount of Burkholderia melioides bacterial suspension was added to each sample. Genomic DNA was then extracted from each sample. The copy number of Burkholderia melioides genomic DNA in the extracted genomic DNA was approximately 10-27 copies / μL.

[0115] Sample 4: Twenty normal blood samples were taken, and a certain amount of Burkholderia melioides bacterial suspension was added to each sample. Genomic DNA was then extracted from each sample. The copy number of Burkholderia melioides genomic DNA in the extracted genomic DNA was approximately 100-270 copies / μL.

[0116] Sample 5: Ten Staphylococcus aureus strains, ten Acinetobacter baumannii strains, ten Burkholderia tsinica strains, and ten Burkholderia cepacia strains were collected, and genomic DNA was extracted from each.

[0117] Then, each sample was tested according to the Burkholderia melioides RPA-LbCas12a detection system established in Example 1. The obtained fluorescence signal values ​​(RFU) were input into SPSS software to generate ROC curves. Figure 7 The results of SPSS software analysis of the Ct values ​​of each sample are shown in Table 8. The AUC (area under ROC) was 0.988, the Youden index (correctness index) was the highest at 0.933, and the RFU value corresponding to the highest Youden index, 659, was the critical value for positive judgment.

[0118] Table 8

[0119]

[0120] Notes: a. Assume nonparametric conditions; b. Null assumption: true region = 0.5.

[0121] Example 4: Composition and Method for Visual Detection of Burkholderia melioides Based on RPA-LbCas12a System 1. Composition for Visual Detection of Burkholderia melioides Based on RPA-LbCas12a System

[0122] The composition includes reagents required for RPA primers, crRNA, ssDNA fluorescent probes, RPA reaction system, and CRISPR / Cas12a cleavage detection system.

[0123] The RPA primers are as follows:

[0124] Bp-p3-F: 5'-GGGACGCATACACTACCAGATTT-3' (SEQ ID NO: 5),

[0125] Bp-p3-R: 5'-CCACTTACGTTGAAGAACTGTGC-3' (SEQ ID NO: 6);

[0126] The transcription template sequence of the crRNA is as follows:

[0127] Upstream template: 5'-TAATACGACTCACTATAGG-3' (SEQ ID NO: 9);

[0128] Downstream template:

[0129] 5'-TATCGTATGCAGGACGAGAG ATCTACACTTAGTAGAAATTACCTATAGTGAGTCGTATTA -3'(SEQ ID NO:7);

[0130] The ssDNA fluorescent probe is as follows:

[0131] 5'-FAM-TTATT-BHQ1-3';

[0132] The FAM and BHQ1 modified ssDNA fluorescent probes are used to determine the presence of Burkholderia melioides in the target system under naked-eye detection under LED blue light.

[0133] 2. A method for visual detection of Burkholderia melioides based on the RPA-LbCas12a system

[0134] A method for visually detecting Burkholderia melioides using the aforementioned composition includes the following steps:

[0135] (1) Extract genomic DNA from the sample to be tested;

[0136] (2) Perform the following RPA reaction: 29.5 μL Primer Free Rehydration buffer, 2.4 μL each of Bp-p3-F / Bp-p3-R primers (10 μM), 5 μL Genomic DNA of the sample to be tested, add RNase-free ddH2O to make up to 47.5 μL, mix well, add 2.5 μL 280 mM magnesium acetate solution (MgOAc), and quickly place at 39℃ for 20 min to obtain RPA product;

[0137] (3) Perform the following RPA-LbCas12a reaction: 10 μL of the RPA product obtained in step (2), 0.8 μL of crRNA (1.67 μg / μL), 2 μL of DNase I Reaction Buffer (NEB, B0303S), 1 μL of LbCas12a (1.34 μg / μL), 1 μL of reporter probe ssDNA (10 μM), and RNase-free ddH2O to 20 μL. Mix well and react at 37℃ for 30 min to obtain the RPA-LbCas12a product.

[0138] (4) The RPA-LbCas12a product is placed under LED blue light for naked-eye judgment, or the RPA-LbCas12a product is placed in a real-time fluorescence quantitative PCR instrument for detection; if the RPA-LbCas12a product has no fluorescence brightness or the fluorescence intensity is lower than the critical value (RFU=659), it indicates that the sample to be tested is not infected with Burkholderia melioides or the amount of Burkholderia melioides infected is lower than the detection limit; if the RPA-LbCas12a product has fluorescence brightness or the fluorescence intensity is higher than the critical value (RFU=659), it indicates that the sample to be tested is infected with Burkholderia melioides.

[0139] Figure 8 The results of naked-eye evaluation of the RPA-LbCas12a product under LED blue light are shown. It can be seen that when the concentration of Burkholderia melioides genomic DNA in the genomic DNA of the sample is greater than 2.7 copies / μL, the RPA-LbCas12a product has fluorescence brightness under LED blue light, while the negative control and blank control have no fluorescence brightness. Figure 9 The results of detecting the fluorescence intensity of the RPA-LbCas12a product in a real-time quantitative PCR instrument are shown. The negative control used ddH2O as the sample for both the RPA and RPA-LbCas12a reactions, and the blank control was the nucleic acid elution buffer from the Zymo Quick DNA / RNA Pathogen genomic DNA extraction kit. SEQUENCE LISTING <110> Army Medical University of the Chinese People's Liberation Army <120> Compositions for Visual Detection of Melioidosis Based on RPA-LbCas12a System and Their Application <130> P2230478-LJD-CQ-TXH <160> 13 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Bp-p1-F <400> 1 gctgtatcaa ggatgtcgaa acg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Bp-p1-R <400> 2 ttgcaatcct ccatccattt tcg 23 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Bp-p2-F <400> 3 atctcttgac cgctgtatca agg 23 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Bp-p2-R <400> 4 ccttgcaatc ctccatccat ttt 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Bp‐p3‐F <400> 5 gggacgcata cactaccaga ttt <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Bp‐p3‐R <400> 6 ccacttacgt tgaagaactg tgc <210> 7 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Bp‐crRNA1 disruption <400> 7 tatcgtatgc aggacgagag atctacactt agtagaatt acctatagtg agtcgtatta <210> 8 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Bp‐crRNA2protein <400> 8 fathers cgttcggcca tatctacact fathers tacctatags gagtcgtatt a 61 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Bp-crRNA upstream template <400> 9 taatacgact cactatagg 19 <210> 10 <211> 443 <212> DNA <213> Artificial Sequence <220> <223> Target sequences for Burkholderia melioides gene detection <400> 10 gggacgcata cactaccaga tttgatagtt tcgtcctttc aaaatctaga ctctaataaa 60 ctcgcacact tttcccatca catcgatggc gattaaccaa taaatccagt ggagttaaaa 120 atgggcaaag cgaataccat cgagctcaca aacaacacat catttactct cgtcctgcat 180 acgatatacg ccaacacggg caattggtcc ggcgattatc cgccggccta tttacggccg 240 aacgatacgc ttattttac gagtacgctt gatggaaaag gagatctaaa cggctcagcc 300 cgtttcgaca tccttgatac agcggtcaag agatgtccgg acgcgaccta cgtacagctc 360 aactgggaca atcccgtcgg agcggacaat gggggatcct cgtccgtagt cggcgccaca 420 gcacagttct tcaacgtaag tgg 443 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> upstream primers for real-time PCR <400> 11 cgctcacagt tcctttccc 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> downstream primers for real-time PCR <400> 12 agtgcagttc ttcgcttgg 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Real-time PCR probes <400> 13 gagatcggag gcttgatag 19

Claims

1. A composition for detecting Burkholderia melioides, characterized in that, It includes an RPA primer pair, crRNA, LbCas12a protease, and an ssDNA fluorescent probe; the nucleotide sequences of the RPA primer pair are shown in SEQ ID NO:5 and SEQ ID NO:6; the transcription template of the crRNA is formed by annealing the nucleotide sequences shown in SEQ ID NO:7 and SEQ ID NO:9; the sequence of the ssDNA fluorescent probe is TTATT, with a FAM fluorescent reporter group labeled at the 5' end and a BHQ1 quencher group labeled at the 3' end.

2. The composition according to claim 1, characterized in that, The composition also includes universal reagents required for recombinase polymerase isothermal amplification (RPA) reaction systems and / or universal reagents required for CRISPR-Cas12a cleavage systems.

3. The use of the composition for detecting Burkholderia melioides according to claim 1 or 2 in the preparation of a product for detecting Burkholderia melioides.

4. A kit for detecting Burkholderia melioides, characterized in that, Includes the composition for detecting Burkholderia melioides as described in claim 1 or 2.

Citation Information

Patent Citations

  • CRISPR-Cas12a detection primer group for francisella tularensis and application thereof

    CN111394490A

  • Method for detecting bacillus anthracis by combining RPA with CRISPR technology and complete set of reagents

    CN112522429A