Kit and application for detecting BRAF gene mutation using Crispr technology

Abstract

The present invention belongs to the field of biotechnology, and discloses a BRAF V600E gene mutation detection method, detection system and kit. The detection system for BRAF V600E mutation disclosed in the present invention comprises a nickase, a guide RNA targeting a mutation site, and a fluorescent reporter system; the nickase has endonuclease activity. The present invention discloses a new application of Crispr technology in BRAF V600E mutation detection. The detection system and detection kit of the present invention can quickly and visually detect BRAF V600E mutations present in inflammation, autoimmune diseases or tumors, and have the characteristics of high sensitivity and high specificity, and have broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to the application of Crispr technology in clinical BRAF gene mutation detection and a detection kit. Background Art

[0002] The BRAF gene is an important human proto-oncogene, located on chromosome 7 and containing 15 exons. Its main function is to regulate cell growth, development and apoptosis. The BRAF gene V600E cell mutation is closely related to disease diagnosis and targeted drug use. It can assist in the diagnosis of diseases such as thyroid cancer and melanoma, and can also provide a reference for the selection of drugs for patients with colorectal cancer, lung cancer and other tumors. Therefore, accurate detection of mutation sites is helpful for medical diagnosis and treatment.

[0003] At present, BRAF mutation detection mainly uses fluorescent quantitative PCR technology, with DNA extracted from paraffin-embedded pathological tissues of patients as the test sample. However, BRAF mutation detection based on fluorescent quantitative PCR technology has the following disadvantages: 1. The quality of specimen sampling and nucleic acid extraction has a great impact on the accuracy of the test results; 2. The operation of fluorescent quantitative PCR technology is relatively complicated and the test takes a long time; 3. The instrument versatility of BRAF mutation probes and amplification kits is poor, and the cost of purchasing and using the instruments is high. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a BRAF V600E mutation rapid detection system and detection kit based on CRISPR / Cas12a, wherein the detection system comprises: specific crRNA for BRAF V600E mutant, efficient isothermal amplification primer combination, Cas12a protein and ssDNA reporting system. The gene editing tool developed based on the CRISPR (Clustered regularly interspaced short palindromic repeats) system of the present invention provides a new direction with great potential for rapid detection of nucleic acid mutation sites. CRISPR-Cas12 protein can specifically identify and cut the target sequence under the guidance of crRNA designed for the target sequence, while playing a powerful trans-enzyme activity to cut non-specific single-stranded DNA (ssDNA). The detection system and detection kit of the present invention can quickly and visually detect BRAF V600E mutation, with the characteristics of high sensitivity and high specificity.

[0005] One of the purposes of the present invention is to provide a detection system for BRAF V600E mutation, the detection system comprising a nickase or its encoding gene (or encoding nucleotide), a guide RNA or its encoding gene (or encoding nucleotide) targeting the mutation site, and a fluorescent reporter system; the nickase has endonuclease activity.

[0006] Another object of the present invention is to provide a product for detecting BRAF V600E mutation sites, wherein the detection product comprises the detection system as described above.

[0007] Another object of the present invention is to provide a detection system or a detection product as described above for use in detecting BRAF V600E mutation sites, preferably for use in detecting BRAF V600E gene mutation sites.

[0008] Another object of the present invention is to provide a use of a nickase and / or a guide RNA or a Crispr system comprising both in the preparation of a detection product for a BRAF V600E mutation site; the nickase and crRNA are respectively as described in the above-mentioned detection system.

[0009] Another object of the present invention is to provide a method for rapid detection of BRAF V600E gene mutation sites.

[0010] For a blood sample, the method comprises the following steps:

[0011] Step a: treating a blood sample with a red blood cell lysis buffer and centrifuging to obtain enriched white blood cells;

[0012] Step b: using a nucleic acid rapid release agent to release nucleic acids in leukocytes;

[0013] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers RPA-F2 and RPA-R3 covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system to perform an amplification reaction;

[0014] Step d: adding the product of step c to the detection system as described above to perform a fluorescence detection reaction;

[0015] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0016] For a tissue sample, the method comprises the following steps:

[0017] Step a: obtaining tissue samples, including fresh tissue and / or paraffin and frozen sections;

[0018] Step b: using a rapid DNA extraction reagent to process the sample to obtain genomic DNA;

[0019] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers RPA-F2 and RPA-R3 covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system to perform an amplification reaction;

[0020] Step d: adding the product of step c to the detection system as described above to perform a fluorescence detection reaction;

[0021] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0022] Compared with the existing detection technology, the beneficial effects of the present invention are:

[0023] (1) The present invention provides a sensitive, specific, rapid and visual BRAFV600E mutation detection technology based on CRISPR / Cas12a. In order to ensure the specificity of the detection, the designed crRNA has been searched by the NCBI nucleic acid database, and it is determined that there is no high homology match with genomes including humans, animals, plants and microorganisms. In order to improve the discrimination of crRNA for mutant and wild types, a mismatched base is artificially introduced into the designed crRNA to further eliminate the mixed signals generated by the combination of crRNA and wild type.

[0024] (2) The rapid detection technology involved in the present invention can be used for direct interpretation of the test results by naked eyes under fluorescent light, which is convenient and fast, and is suitable for bedside detection and promotion to grassroots laboratories.

[0025] (3) The present invention is the first to use Cas12a fluorescence method to detect BRAF V600E gene mutation, which has the advantages of high sensitivity, strong specificity, short time, low operation difficulty, and no dependence on large experimental instruments and expensive reagents. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the method for rapid detection of BRAF V600E gene mutation based on Cas12a.

[0027] Figure 2 Histogram of different crRNA screening for BRAF V600E mutation.

[0028] Figure 3 Fluorescence ratio of different crRNA detection mutants and wild type.

[0029] Figure 4 Fluorescence values ​​of products obtained by amplifying equal amounts of plasmid using different RPA primer combinations.

[0030] Figure 5 Sensitivity of Cas12a fluorescence detection of BRAF V600E mutant plasmid (ELISA assay).

[0031] Figure 6 Sensitivity of Cas12a fluorescence detection of BRAF V600E mutant plasmid (read by naked eye).

[0032] Figure 7 Cas12a fluorescence detection of plasmids with different mutation rates (detected by microplate reader).

[0033] Figure 8 Cas12a fluorescence detection of plasmids with different mutation rates (read by naked eye).

[0034] Fig. 9 Cas12a fluorescence detection of thyroid cancer patient tissue samples and patient first-generation sequencing peaks (read by naked eye). DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with the accompanying drawings and specific examples. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0036] Based on the above characteristics of Cas12a, the present invention has developed a precise and rapid detection method for the detection of BRAF V600E gene mutations in clinical blood and tissue samples. First, the clinical blood sample is subjected to red blood cell lysis and centrifugation to obtain enriched leukocytes, and genomic DNA is released using a nucleic acid releaser; a nucleic acid releaser is also used to release genomic DNA in tissue samples (fresh tissue samples or paraffin section samples can be used); then the DNA fragment containing the BRAF V600E site is amplified using recombinase polymerase amplification (RPA) technology; finally, the Cas12a-crRNA complex specifically binds to V600E mutant double-stranded DNA (dsDNA), activates its nonspecific enzyme activity, cuts single-stranded DNA (ssDNA) coupled to a fluorescent reporter molecule, and releases a fluorescent signal. The method is fast, accurate and easy to operate, does not require large instruments, and has the potential to become a new type of tumor gene mutation screening and bedside detection technology.

[0037] On one hand, the present invention provides a detection system for BRAF V600E gene mutation, the detection system comprising a nickase, a guide RNA targeting a mutation site, and a fluorescent reporter system; the nickase has endonuclease activity.

[0038] In the detection system of the present invention, the nickase such as Cas protein itself does not show activity, and needs to be activated after crRNA recognizes the V600E mutation sequence, and then non-specifically recognizes the fluorescent probe in the cutting reaction system; that is, the nickase and guide RNA form a nickase-guide RNA complex, and the complex specifically binds to the target sequence containing the mutation site, activates the nickase to non-specifically cut the fluorescent reporter system, and releases the fluorescent group. The reaction mechanism is: the effect of the CRISPR reaction system on the SNP detection of BRAF V600E is mainly reflected in the specificity, that is, the specific base recognition characteristics of the CRISPR system give it the ability to perform SNP detection. The crRNA provided by the present invention can effectively recognize the BRAF V600E mutation sequence and activate the corresponding Cas protein, cut the surrounding fluorescent reporter probe, and show that the V600E mutation detection is positive. When the crRNA detects the original sequence without mutation, the corresponding Cas protein cannot be activated due to base mismatch, thereby showing that the V600E mutation detection is negative.

[0039] In the detection system of the present invention, the nucleic acid is selected from one of DNA, cDNA, RNA, siRNA, antisense oligonucleotide, ribozyme, aptamer nucleic acid analog, peptide-nucleic acid chimera or any combination thereof. Preferably, the nucleic acid is DNA. Further preferably, the nucleic acid mutation site refers to BRAF V600E gene mutation.

[0040] In the detection system of the present invention, the nickase is a CRISPR / Cas effector protein or a variant thereof; preferably, the Cas protein is selected from any one or a combination of Cas12 and Cas14 family proteins; more preferably, the Cas12 family protein is selected from one or any combination of Cas12a, Cas12i, Cas12j, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, and Cas12h; more preferably, the Cas12 family protein is selected from Cas12a.

[0041] The preparation method of the Cas12a protein includes: optimizing the prokaryotic codon of the Cas12a protein nucleic acid sequence, constructing it into a pET28a expression vector, inducing soluble protein expression by low temperature, and then obtaining the target protein through affinity purification and molecular sieve purification.

[0042] The detection system of the present invention may include an expression vector of the nicking enzyme. Furthermore, the detection system is a system suitable for the expression of the nicking enzyme. In the detection system, the expression vector expresses the nicking enzyme to form a complex with the guide RNA, which is then used for the fluorescence detection reaction.

[0043] In the detection system of the present invention, the guide RNA comprises crRNA, and the sequences are shown in SEQ ID NO.1 to 20, respectively. Preferably, the guide RNA is crRNA. In some preferred embodiments, the crRNA is 23bp in length, covers the mutation point and matches the mutant targeting sequence, and is selected from E600-cr1-3, E600-cr1-4, E600-cr1-6, and the sequences are shown in SEQ ID NO.4, 5 and 7, respectively. In some preferred embodiments, the crRNA comprises one or more mismatched bases. In some preferred embodiments, the crRNA comprises one mismatched base. In some more preferred embodiments, the crRNA has high sensitivity and specificity, which is obtained by screening from 20 crRNAs designed for the BRAF gene V600E mutation site, which is E600-cr1-6, and the sequence is as shown in SEQ ID NO.7.

[0044] Preferably, the method for preparing the specific crRNA comprises: searching for a targeting sequence comprising a Cas12a recognition sequence (PAM) TTTN near the V600E site of the BRAF gene, designing a crRNA with a length of 23 bp covering the mutation point and matching the mutant targeting sequence; after completing the design, preparing the crRNA.

[0045] Preferably, the crRNA can be prepared by constructing a vector pUC57-T7-crRNA and obtaining the target crRNA by in vitro transcription; or directly synthesizing the RNA corresponding to the crRNA sequence.

[0046] In the detection system of the present invention, the fluorescent reporter system is a reporter system in which a fluorescent tracer and a fluorescent quencher are respectively labeled at both ends of ssDNA.

[0047] Preferably, the fluorescent tracer is selected from small molecule fluorescein, fluorescent protein or tandem fluorescent dye; wherein the pairing principle of the fluorescent tracer and the fluorescent quencher is that the emission wavelength of the fluorescent tracer is the absorption wavelength of the fluorescent quencher.

[0048] Further preferably, the fluorescent protein is selected from at least one of phycoerythrin, phycocyanin, phycoerythrocyanin and allophycocyanin.

[0049] Further preferably, the small molecule fluorescein is selected from at least one of FAM, FITC, Cy5, Cy3, Cy5.5, Alexa Flour series fluorescein, Dylight series fluorescein, Pacific blue, TRITC, TAMRA and rhodamine; the small molecule fluorescein is selected from 6-carboxyfluorescein (6-FAM);

[0050] Further preferably, the tandem fluorescent dye is streptavidin-phycoerythrin (SAPE);

[0051] Further preferably, the fluorescence quencher is selected from at least one of BHQ1, DABCYL, BHQ2, QSY7, QSY9, QSY21, QSY35, ATTO540Q, ATTO580Q, ATTO612Q, DYQ660 and DYQ661.

[0052] In some preferred embodiments, the fluorescent reporter system is a ssDNA reporter system, and the ssDNA is TTTATTT, which comprises a ssDNA FQ reporter that can be detected by fluorescence with a microplate reader or directly read by the naked eye under a fluorescent lamp, i.e., ssDNA labeled with 6-carboxyfluorescein (6-FAM) and a fluorescence quencher (BHQ1), and the labeled product is as follows: / 5 6FAM / TTTATTT / 3BHQ1 / , named ssDNA FQ reporter / 56FAM / TTTATTT / 3BHQ1 / .

[0053] The detection system of the present invention may also include primers for amplifying the nucleic acid mutation site; the amplification is preferably isothermal amplification. In some preferred embodiments, the high-efficiency isothermal amplification primer combination is the amplification primer pair RPA-F2 and RPA-R3 selected after screening for the BRAF gene V600E mutation site, and the sequences are SEQ ID NO.24 and SEQ ID NO.28, respectively.

[0054] In the detection system of the present invention, the V600E nucleic acid mutation site can be any suitable gene mutation site, including but not limited to BRAF V600E; in some preferred embodiments, the nucleic acid mutation site refers to BRAFV600E, for example, it can be BRAF V600E in inflammation, autoimmune diseases or tumors, that is, the detection system can be used for at least any one of the BRAF gene detection in inflammation, autoimmune diseases or tumors.

[0055] Wherein, the inflammation is selected from skin inflammation, vascular inflammation, allergy, fibrosis, scleroderma or transplant rejection. Preferably, the inflammation is caused by an infectious pathogen. Further preferably, the inflammation is caused by a viral or bacterial infection, and the virus includes but is not limited to one or more of influenza virus, parainfluenza virus, measles virus, mumps virus, herpes virus, adenovirus, respiratory syncytial virus, polio virus, coxsackie virus, or echovirus. The bacteria are selected from one or more of Escherichia coli, Lactobacillus casei, Bacteroides fragilis, Acinetobacter lwoffii, Fusobacterium nucleatum, Bacteroides johnsii, Bacteroides thaliana, Lactobacillus rhamnosus, Bacteroides massiliense, Bacteroides ovatus, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Bacteroides feces parabacterium, Fusobacterium death and Bifidobacterium breve.

[0056] The autoimmune disease is selected from one or more of rheumatoid arthritis, systemic sclerosis, systemic lupus erythematosus, Sjögren's syndrome-like disease, polymyositis, etc., or others.

[0057] The tumor is selected from lymphoma, hematologic tumor or solid tumor; specifically selected from adrenocortical carcinoma, bladder urothelial carcinoma, breast cancer, cervical squamous cell carcinoma, endocervical adenocarcinoma, bile duct cancer, colon adenocarcinoma, lymphoid tumor, diffuse large B-cell lymphoma, esophageal cancer, multiforme glioblastoma, head and neck squamous cell carcinoma, renal chromophobe cell carcinoma, renal clear cell carcinoma, renal papillary cell carcinoma, acute myeloid leukemia, brain low-grade glioma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, mesothelial cell carcinoma, ovarian cancer, pancreatic cancer, Adenocarcinoma, pheochromocytoma and paraganglioma, prostate cancer, rectal cancer, malignant sarcoma, melanoma, gastric cancer, testicular germ cell tumor, thyroid cancer, thymic cancer, endometrial cancer, uterine sarcoma, uveal melanoma, multiple myeloma, acute lymphoid leukemia, chronic lymphoid leukemia, chronic myeloid leukemia, T cell lymphoma, one or more of B cell lymphoma tumor cells; preferably, the tumor is one or more of thyroid cancer, colorectal cancer, lung cancer and / or melanocytoma, etc. or others.

[0058] For the nucleic acid mutation site BRAF V600E, preferably, the nickase is Cas12a; the PAM sequence recognized by the Cas12a is TTTN. The crRNA is 23bp in length, covers the mutation point and matches the mutant targeting sequence, and contains one or more artificially introduced mismatched bases; further preferably, the crRNA covers the BRAF V600E mutation site and contains an introduced mismatched base, named BRAF E600-cr1-6, and the sequence is shown in SEQ ID NO.7. The fluorescent reporter system is / 56FAM / TTTATTT / 3BHQ1 / . The amplification primer pair is RPA-F2 and RPA-R3, and the sequences are shown in SEQ ID NO.24 and SEQ ID NO.28, respectively.

[0059] In the detection system of the present invention, the sample includes but is not limited to blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swabs, oral swabs, nasal swabs or lavage; preferably, the sample is at least one of a blood sample or a tissue sample. In some embodiments, the biological sample comprises cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from a target source by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the following: biopsy (e.g., fine needle aspiration or tissue biopsy), surgical tissue, collection of body fluids (e.g., blood, lymph, feces, etc.), etc.

[0060] The present invention also provides a nucleic acid mutation site detection product, the detection product comprising the detection system as described in any one of the above items. The detection product can be in any suitable form, such as a kit, a chip or a membrane strip.

[0061] In some preferred embodiments, the present invention provides a CRISPR / Cas12a-based BRAFV600E mutation detection kit, the detection kit comprising a Cas12a fluorescence detection system for specific detection of BRAF V600E mutant DNA; the detection system comprises: Cas12a protein, specific crRNA for BRAF V600E mutant, efficient isothermal amplification primer combination and ssDNA reporting system. The kit may also include as needed: container, control (negative or positive control), buffer, auxiliary agent, etc., and those skilled in the art may select it according to the specific circumstances.

[0062] Preferably, the crRNA is 23 bp in length, which covers the mutation point and matches the mutant targeting sequence. In some preferred embodiments, the crRNA contains one or more mismatched bases. In some preferred embodiments, the crRNA contains one mismatched base. In some more preferred embodiments, the crRNA has high sensitivity and specificity, which is obtained by screening from 20 crRNAs designed for the BRAF gene V600E mutation site, which is E600-cr1-6, which covers the BRAF V600E mutation site and contains an introduced mismatched base, and the sequence is such as SEQ ID NO.7. The preparation of the crRNA can be obtained by constructing the vector pUC57-T7-crRNA and obtaining it by in vitro transcription; or by direct synthesis.

[0063] Preferably, the ssDNA reporter system comprises a ssDNA FQ reporter that can be detected by fluorescence using an enzyme reader or directly read by the naked eye under a fluorescent lamp, i.e., ssDNA labeled with 6-carboxyfluorescein (6-FAM) and a fluorescence quencher (BHQ1), and the labeled product is as follows: / 5 6FAM / TTTATTT / 3BHQ1 / , named ssDNA FQ reporter / 56FAM / TTTATTT / 3BHQ1 / .

[0064] Preferably, the high-efficiency isothermal amplification primer combination is amplification primers RPA-F2 and RPA-R3 targeting the BRAF gene V600E mutation site, and the sequences are SEQ ID NO.24 and SEQ ID NO.28, respectively.

[0065] The present invention also provides use of the detection system or detection product as described in any one of the above items for use in nucleic acid mutation sites, preferably for use in detection of BRAF V600E gene mutation sites.

[0066] The present invention also provides the use of a nickase and / or a guide RNA or a Crispr system comprising both in the preparation of a product for detecting nucleic acid mutation sites; the nickase and crRNA are respectively as described in the above-mentioned detection system.

[0067] The present invention also provides a rapid detection method for BRAF V600E gene mutation sites. The sample includes, but is not limited to, blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swabs, oral swabs, nasal swabs or lavage; preferably, the sample is a blood sample or a tissue sample. In some embodiments, the biological sample comprises cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from a target source by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the following: biopsy (e.g., fine needle aspiration or tissue biopsy), surgical tissue, collection of body fluids (e.g., blood, lymph, feces, etc.), etc.

[0068] For a blood sample, the detection method of the present invention comprises the following steps:

[0069] Step a: treating a blood sample with a red blood cell lysis buffer and centrifuging to obtain enriched white blood cells;

[0070] Step b: using a nucleic acid rapid release agent to release nucleic acids in leukocytes;

[0071] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers RPA-F2 and RPA-R3 covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system to perform an amplification reaction;

[0072] Step d: adding the product of step c to the detection system as described in any one of the above items to perform a fluorescence detection reaction;

[0073] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0074] In step d, the temperature of the amplification reaction can be selected according to actual needs, such as 25-39° C., which can be 25-28° C., 28-30° C., 30-32° C., 32-35° C., 35-37° C., 37-39° C.; preferably, 37° C. The time of the amplification reaction can be selected according to actual needs, such as 10-60 min, which can be 10-20 min, 20-30 min, 30-40 min, 40-50 min, 50-60 min; preferably, 20 min.

[0075] In the step e, the temperature of the fluorescence detection reaction can be selected according to actual needs, such as 25-39° C., which can be 25-28° C., 28-30° C., 30-32° C., 32-35° C., 35-37° C., 37-39° C.; preferably, 37° C. The time of the fluorescence detection reaction can be selected according to actual needs, such as 10-60 min, which can be 10-20 min, 20-30 min, 30-40 min, 40-50 min, 50-60 min; preferably, 20 min.

[0076] For tissue samples, the detection method of the present invention comprises the following steps:

[0077] Step a: taking tissue samples, including fresh tissue and / or paraffin sections;

[0078] Step b: using a rapid DNA extraction reagent to process the sample to obtain genomic DNA;

[0079] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers RPA-F2 and RPA-R1 covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system to perform an amplification reaction;

[0080] Step d: adding the product of step c to the detection system as described in any one of the above items to perform a fluorescence detection reaction;

[0081] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0082] In step d, the temperature of the amplification reaction can be selected according to actual needs, such as 25-39° C., which can be 25-28° C., 28-30° C., 30-32° C., 32-35° C., 35-37° C., 37-39° C.; preferably, 37° C. The time of the amplification reaction can be selected according to actual needs, such as 10-60 min, which can be 10-20 min, 20-30 min, 30-40 min, 40-50 min, 50-60 min; preferably, 20 min.

[0083] In the step e, the temperature of the fluorescence detection reaction can be selected according to actual needs, such as 25-39° C., which can be 25-28° C., 28-30° C., 30-32° C., 32-35° C., 35-37° C., 37-39° C.; preferably, 37° C. The time of the fluorescence detection reaction can be selected according to actual needs, such as 10-60 min, which can be 10-20 min, 20-30 min, 30-40 min, 40-50 min, 50-60 min; preferably, 20 min.

[0084] In some preferred embodiments, the method for rapid detection of BRAF V600E gene mutation in a blood sample comprises the following steps:

[0085] Step a: treating a fresh blood sample with red blood cell lysis buffer and centrifuging to obtain enriched white blood cells;

[0086] Step b: using a nucleic acid rapid release agent to release nucleic acids in leukocytes;

[0087] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system, and reacting at 37° C. for 20 minutes;

[0088] Step d: Add the product of step c to the Cas12a detection system and react at 37°C for 20 minutes;

[0089] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0090] In some preferred embodiments, the method for rapid detection of BRAF V600E gene mutation in tissue samples comprises the following steps:

[0091] Step a: Weigh 5-8 fresh tissue or paraffin sections (5-10 μm thick, 1×1 cm2 size);

[0092] Step b: using a rapid DNA extraction reagent to treat a tissue sample (such as a fresh tissue or a paraffin sample) to obtain genomic DNA;

[0093] Step c: amplifying the nucleic acid in the sample to be tested by isothermal amplification technology: adding specific primers covering the BRAF V600E region and the product obtained in step b to the RPA isothermal amplification system, and reacting at 37° C. for 20 minutes;

[0094] Step d: Add the product of step c to the Cas12a detection system and react at 37°C for 20 minutes;

[0095] Step e: Read the results using an ELISA reader or visually observe under fluorescent light.

[0096] The present invention also provides a method for preparing the above-mentioned Cas12a kit for rapid detection of BRAF V600E mutation.

[0097] The preparation method of the Cas12a protein includes: optimizing the prokaryotic codon of the Cas12a protein nucleic acid sequence to obtain a sequence, constructing it into a pET28a expression vector, inducing soluble protein expression by low temperature, and then obtaining the target protein through affinity purification and molecular sieve purification.

[0098] The method for preparing the specific crRNA comprises: searching for a targeting sequence containing a Cas12a recognition sequence (PAM) TTTN near the V600E site of the BRAF gene, and designing a crRNA with a length of 23 bp that covers the mutation point and matches the mutant targeting sequence; after completing the design, preparing the crRNA;

[0099] Preferably, the crRNA can be prepared by constructing a vector pUC57-T7-crRNA and obtaining the target crRNA by in vitro transcription; or directly synthesizing the RNA corresponding to the crRNA sequence.

[0100] The prepared Cas12a protein, crRNA and fluorescent reporter system are matched in a certain ratio to prepare the Cas12a kit.

[0101] The result of the BRAF V600E gene mutation rapid detection kit provided by the present invention can be interpreted by using a microplate reader for fluorescence reading, or by visual observation under a fluorescent lamp for qualitative determination. For the ssDNA FQreporter in the present invention, the detection excitation light of the microplate reader should be set to 485nm-520nm, and the fluorescent lamp used for visual observation can be a 485nm wavelength light source.

[0102] During the fluorescence detection process, if the test sample contains BRAF V600E mutant DNA, it can specifically bind to the Cas12a-crRNA complex and activate the endonuclease activity of Cas12a. Cas12a non-specifically cuts the ssDNAFQ reporter, releasing the activated fluorescent group. The rising fluorescence reading can be detected by the microplate reader, or the green reaction under the fluorescent light can be observed by the naked eye. On the contrary, if the BRAF V600E mutation is not present in the test sample, there will be no rising fluorescence reading, and the green reaction will not be observed by the naked eye.

[0103] The present invention also provides a composition, which comprises a detection system as described in any of the above items, and a pharmaceutically acceptable carrier. The acceptable carriers include sterile water or saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), adhesives, etc. In addition, it may also contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin or immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol or sorbitol. When preparing an aqueous solution for injection, such as saline, an isotonic solution containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), non-ionic surfactants (Tween 80, HCO-50), etc. can be used in combination.

[0104] As used herein, the terms "protein", "peptide" and "polypeptide" are used interchangeably and in their broadest sense, referring to compounds of amino acids, amino acid analogs or peptide mimetics of two or more subunits. The subunits may be linked by peptide bonds. In another aspect, the subunits may be linked by other bonds, such as esters, ethers, etc. A protein or peptide must contain at least two amino acids, and there is no restriction on the maximum number of amino acids constituting a protein or peptide sequence. It is known that proteins and peptides have a C-terminus and an N-terminus, wherein the C-terminus refers to the end at which an unbound carboxyl group is present on the terminal amino acid, and the N-terminus refers to the end at which an unbound amino group is present on the terminal amino acid. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including glycine, as well as D and L optical isomers, amino acid analogs and peptide mimetics. The term "fusion" in the context of a protein or polypeptide refers to the connection between the ends of two or more proteins or polypeptides (or their domains) to form a fusion protein.

[0105] In the present invention, the variant of protein is a fragment, derivative and analog of the original protein, which can be (i) a protein with one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) replaced, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein with a substitution group in one or more amino acid residues, or (iii) a protein formed by the fusion of an additional amino acid sequence to this protein sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify this protein). According to the definition of the present invention, these fragments, derivatives and analogs belong to the scope known to those skilled in the art. For example, in some embodiments, the variant of the nickase fragment refers to a protein having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the amino acid sequence of the nickase, and having the same or similar function of the nickase. The above-mentioned 75% or more identity can be 75%, 80%, 85%, 90% or more identity; specifically, it can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. The above-mentioned 90% or more identity can be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity. The similar function refers to retaining 75% or more, or 85% or more, or 90% or more, or 95% or more of the function of the original protein.

[0106] The detection system, detection product, kit, method, composition and the like of the present invention are suitable for detecting the BRAF V600E gene mutation in diseases caused by any cause.

[0107] As used herein, sequence similarity or identity can be evaluated with the naked eye or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0108] As used herein, "include", "comprises", etc. should be understood as having an inclusive meaning rather than an exclusive or exhaustive meaning; that is, the meaning is "including but not limited to".

[0109] As used herein, the terms "nucleic acid" and "nucleic acid component" are used interchangeably and refer to compounds having a core base and an acidic portion, such as a polymer of nucleosides, nucleotides, or nucleotides. In some embodiments, "nucleic acid" refers to a single nucleic acid residue (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising three or more single nucleotide residues. The terms "oligonucleotide" and "polynucleotide" used herein are used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, "nucleic acid" includes RNA and single-stranded and / or double-stranded DNA. Nucleic acids can be naturally occurring or non-naturally occurring molecules.

[0110] As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide or protein. If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells. The expression level of a gene can be determined by measuring the amount of mRNA or protein in a cell or tissue sample.

[0111] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0112] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0113] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0114] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields in the art. These techniques have been fully described in existing literature.

[0115] Attached Figure 1 This is a schematic diagram of the overall process of the method for rapid detection of BRAF V600E gene mutation based on Cas12a in the present invention, which includes the following four parts: pretreatment of the sample to be tested, nucleic acid release, construction of Cas12a fluorescence detection system and fluorescence detection.

[0116] Example 1: Screening for crRNA targeting BRAF V600E mutant

[0117] 1.1 Nucleic acid preparation

[0118] The BRAF V600 wild-type gene fragment used in this example was amplified from the genome of the 293T cell line and integrated into the pGem-T vector to obtain a plasmid simulating the wild-type genome (BRAF-V600 wild-type plasmid). The full-length plasmid was amplified using primers carrying the V600E mutation (F: gattttggtctagctacagAgaaatc (SEQ ID NO.29), R: ctagaccaaaatcaccta (SEQ ID NO.30)), and then a plasmid simulating the mutant genome (V600E mutant plasmid) was obtained by self-ligation.

[0119] 1.2 Design and preparation of BRAF V600E mutant-specific crRNA

[0120] A targeting sequence containing the Cas12a recognition sequence (PAM) TTTN was searched near the V600 site of the BRAF gene, and a 23bp-long crRNA was designed to cover the mutation point and match the mutant targeting sequence. In order to further reduce the WT mixed signal, another mismatch base was designed at the non-mutation site on the crRNA. A total of 20 crRNAs were designed (Table 1). After the design was completed, it was directly synthesized by Nanjing GenScript Co., Ltd.

[0121] Table 1 crRNA targeting BRAF V600E mutant

[0122]

[0123]

[0124] 1.3 Amplification of genomic plasmid using PCR products

[0125] The wild-type genome and mutant genome plasmids constructed in 1.1 were amplified using PCR primers (SEQ ID NO. 21 and 22, Table 2), and the PCR product purified by AxyPrep PCR Clean-up Kit (Axygen, CA, USA) was diluted with ddH2O to 1*e10 copies / μL, and 1 μL was taken as a test sample for Cas12a fluorescence detection reaction.

[0126] Table 2 PCR primer sequences

[0127]

[0128] The Cas12a preparation step includes: optimizing the prokaryotic codons of the Cas12a protein nucleic acid sequence, then constructing it into a pET28a expression vector, inducing soluble protein expression through low temperature, and then obtaining the target protein through affinity purification and molecular sieve purification.

[0129] The ssDNA FQ reporter was synthesized by the company.

[0130] 1.4 Construction and detection steps of Cas12a fluorescence detection system

[0131] The present invention adopts a 20 μL detection system, the components of which are shown in Table 3:

[0132] Table 3 Cas12a fluorescence detection system

[0133]

[0134] For each crRNA, three reaction tubes were designed, including wild type, mutant and ddH2O (negative control) test samples, to detect and compare cross-reaction, sensitivity and background signal.

[0135] 1.5 Cas12a fluorescence detection reaction and full-wavelength microplate reader detection and screening of crRNA

[0136] The Cas12a fluorescence detection system constructed in 1.4 above was mixed and reacted at 37°C for 20 minutes. The product after the reaction was detected by fluorescence using a full-wavelength microplate reader. The excitation wavelength was 485nm, the emission wavelength was 520nm, and the fluorescence value was read when the reaction was carried out at 37°C for 20 minutes.

[0137] Test results such as Figure 2 and Figure 3As shown in the figure, the larger the ratio of mutant to wild type, the higher the specificity and sensitivity. The results show that the specificity and sensitivity of BRAF E600-cr1-6 detection are good, and the specificity and sensitivity of E600-cr1-3 and E600-cr1-4 are also good. Therefore, BRAF E600-cr1-6 (SEQ ID NO.7) is selected as the optimal crRNA for detecting BRAF V600E mutation.

[0138] Example 2: Screening of RPA primers for amplifying the BRAF V600E region

[0139] 2.1RPA primer design and synthesis

[0140] The present invention uses isothermal amplification technology to pre-amplify the BRAF V600 region of the simulated plasmid for subsequent Cas12a fluorescence detection reaction. According to the requirements of isothermal amplification primer design, 3 forward primers (Forward primers) and 3 reverse primers (Reverse primers) are designed, and the sequences are SEQ ID NO.23-28 (Table 4), which are directly synthesized by Nanjing GenScript. The forward primers and reverse primers are matched in pairs to screen out the most efficient primer combination. The primer screening diagram is shown in FIG. Figure 4 shown.

[0141] 2.2RPA isothermal amplification reaction

[0142] In this example, the BRAF V600E simulation plasmid, i.e., the BRAF V600 wild-type plasmid and the BRAF V600E mutant plasmid constructed in 1.1 of Example 1, were used as templates to screen RPA amplification primers. The copy number was calculated based on the plasmid size and molecular weight, and the plasmid sample was diluted in a 10-fold gradient to obtain a sample containing 1*e4 copies of the BRAF V600E simulation plasmid per microliter.

[0143] The specific operation steps are as follows: 2.5 μL RPA-F (forward primer), 2.5 μL RPA-R (reverse primer), 1 μL simulated plasmid sample and 42 μL reaction buffer are mixed in a reaction tube, and finally 2 μL activator is added and mixed to obtain the RPA isothermal amplification reaction system; after mixing, react at 37°C for 20 minutes. The product can be directly used for the next step of detection.

[0144] Table 4 Primer sequences for RPA amplification of the BRAF V600 region

[0145]

[0146]

[0147] 2.3 Cas12a fluorescence detection reaction

[0148] This example uses a 20 μL Cas12a detection system, the components of which are shown in Table 3, where the sample is the product of the amplification reaction in 2.2 above, and 5 μL of the product is taken for detection. The full-wavelength microplate reader fluorescence detection results are shown in Table 3. Figure 3 The results showed that the primer combination of RPA-F2 and RPA-R3 had the best amplification efficiency, so RPA-F2 and RPA-R3 were selected as the primer combination for subsequent patient sample amplification.

[0149] Example 3: Detection sensitivity of BRAF V600 gene fragment

[0150] In this example, in order to determine the detection sensitivity of the method for BRAF V600E, the copy number was calculated according to the plasmid size and molecular weight, and the V600E mutant plasmid sample constructed in 1.1 of Example 1 was diluted in a 10-fold gradient to obtain test samples containing 1*e7, 1*e6, 1*e5, 1*e4, 1*e3, 1*e2, 1*e1 and 1*e0 copies per microliter (copy / μL) (corresponding to Figure 4 E7, E6, E5, E4, E3, E2, E1, NC).

[0151] The above gradient dilution samples were detected using the fluorescence detection method described in Example 2. The operation was as follows: 2.5 μL RPA-F2, 2.5 μL RPA-R3, 1 μL sample (as a template) and 42 μL reaction buffer were mixed in a reaction tube, and finally 2 μL activator was added and mixed to obtain 50 μL RPA isothermal amplification reaction system; after mixing, the mixture was reacted at 37°C for 20 minutes.

[0152] Take 5 μL of the product, add it to 20 μL of Cas12a detection system (Table 3), react at 37 ° C for 20 min, and then interpret the fluorescence results.

[0153] In this embodiment, the results are as follows: Figure 5 As shown by Figure 5 It can be seen that the method of the present invention can achieve high-sensitivity detection of 1*e1 copy plasmid. When the fluorescence reaction is directly judged by the naked eye, the detection system after reacting at 37°C for 20 minutes is placed under 485nm excitation light, and the fluorescence reaction is directly observed by the naked eye. A positive result is that the reaction product emits green fluorescence, and a negative result is colorless. Figure 6 As shown, it can be seen that the method of the present invention can achieve high-sensitivity detection of 1*e1 copy plasmid.

[0154] Example 4: Detection specificity of BRAF V600 gene fragment

[0155] In this example, in order to determine the detection specificity of the method for BRAF V600E, the copy number was calculated according to the plasmid size and molecular weight, and samples containing 1*e4 copy number (copy / μL) of BRAF V600 wild-type plasmid and V600E mutant plasmid were obtained respectively, and the two were mixed in different proportions to obtain test samples with mutation rates of 100%, 50%, 25%, 10%, 1%, 0.1%, and 0%, respectively.

[0156] The above gradient dilution samples were detected respectively using the fluorescence detection method described in Example 3. The operation was as follows: 2.5 μL RPA-F2, 2.5 μL RPA-R3, 1 μL sample (as a template) and 42 μL reaction buffer were mixed in a reaction tube, and finally 2 μL activator was added and mixed to obtain 50 μL RPA isothermal amplification reaction system; reacted at 37°C for 20 minutes.

[0157] Take 5 μL of the product, add it to 20 μL of Cas12a detection system (Table 3), react at 37 ° C for 20 min, and then interpret the fluorescence results.

[0158] In this example, when the total copy number of the template is 1*e4, the result is as follows: Figure 7 As shown in Figure 2, the method of the present invention can detect samples with a mutation rate of 1%. The fluorescence reaction is directly observed with the naked eye, and the results are as follows: Figure 8 As shown, the method of the present invention can detect samples with a mutation rate of 1%.

[0159] Example 5: Rapid detection of patient samples using Cas12a fluorescence detection method

[0160] The thyroid cancer patient blood, puncture samples and paraffin section samples used in this embodiment were all obtained in accordance with relevant laws and regulations.

[0161] First, 200-500 μL of peripheral blood sample was mixed with 800 μL of red blood cell lysis solution, inverted several times to fully lyse the red blood cells, and then centrifuged at 13000 rpm for 30 seconds to obtain enriched white blood cell pellets. 150 μL of nucleic acid rapid release agent was added to the pellet, and incubated at 95°C for 3 minutes to obtain the nucleic acid release agent treated product.

[0162] Take 30-50 mg of the puncture sample or 5-8 paraffin sections (5-10 μm thick, 1×1 cm2 size), add 500 μl PBS (10 mM, pH 7.4), vortex and mix, centrifuge at 12000 rpm (~13400×g) at room temperature for 1 min, discard the supernatant, and repeat 3 times. Add 150 μL of nucleic acid rapid release agent to the precipitate, incubate at 95°C for 3 min, and obtain the nucleic acid release agent treated product.

[0163] Take 1 μL of incubation product for subsequent RPA and Cas12a fluorescence detection, the steps are the same as the previous embodiment, the steps are as follows: take 1 μL of nucleic acid releaser treated product and add it to 50 μL RPA reaction system, that is, 2.5 μL RPA-F2, 2.5 μL RPA-R3, 1 μL nucleic acid releaser treated product (as a template) and 42 μL reaction buffer are mixed in a reaction tube, and finally 2 μL activator is added to mix to obtain 50 μL RPA isothermal amplification reaction system; after mixing, react at 37 ° C for 20 min.

[0164] Take 5 μL of RPA reaction product and add it to the Cas12a fluorescence detection system (Table 3) to make a total volume of 20 μL, mix well and react at 37 ° C for 20 min.

[0165] Fig. 9 The naked eye results of Cas12a fluorescence detection of BRAF V600E thyroid cancer patient tissue samples and the patient's first-generation sequencing peak diagram. In this embodiment, the naked eye interpretation results of 15 patient samples (numbered P1 to P15, respectively) under fluorescent light are consistent with the first-generation sequencing and second-generation sequencing results, that is, 14 cases are wild-type and 1 case is a BRAF V600E mutant with a mutation rate of 25% ( Fig. 9 ).

[0166] The above is only a preferred embodiment of the present invention, and is not any formal or substantial limitation of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention, and these improvements and supplements should also be regarded as the protection scope of the present invention. Any technician familiar with this profession, without departing from the spirit and scope of the present invention, can make some changes, modifications and evolutions of the technical content disclosed above, which are equivalent embodiments of the present invention; at the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention are still within the scope of the technical solution of the present invention. Sequence Listing <110> Shanghai Dage Biotechnology Co., Ltd. <120> Kit and application for detecting BRAF gene mutation using Crispr technology <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 44 <212> RNA <213> Artificial Sequence <400> 1 uaauuucuac uaaguguagaugucuagcua cagagaaauc ucga 44 <210> 2 <211> 44 <212> RNA <213> Artificial Sequence <400> 2 uaauuucuac uaaguguagaugucuagcua cacagaaauc ucga 44 <210> 3 <211> 44 <212> RNA <213> Artificial Sequence <400> 3 uaauuucuac uaaguguaga ugucuagcua cauagaaauc ucga 44 <210> 4 <211> 44 <212> RNA <213> Artificial Sequence <400> 4 uaauuucuac uaaguguagaugucuagcua cagacaaauc ucga 44 <210> 5 <211> 44 <212> RNA <213> Artificial Sequence <400> 5 uaauuucuac uaaguguagaugucuagcua cagauaaauc ucga 44 <210> 6 <211> 44 <212> RNA <213> Artificial Sequence <400> 6 uaauuucuac uaaguguaga ugucuagcua cugagaaauc ucga 44 <210> 7 <211> 44 <212> RNA <213> Artificial Sequence <400> 7 uaauuucuac uaaguguagaugucuagcua cagagcaauc ucga 44 <210> 8 <211> 44 <212> RNA <213> Artificial Sequence <400> 8 uaauuucuac uaaguguagaugucuagcua cagagacauc ucga 44 <210> 9 <211> 41 <212> RNA <213> Artificial Sequence <400> 9 uaauuucuac uaaguguaga uucuguagcu agaccaaaau c 41 <210> 10 <211> 41 <212> RNA <213> Artificial Sequence <400> 10 uaauuucuac uaaguguaga uuguguagcu agaccaaaau c 41 <210> 11 <211> 41 <212> RNA <213> Artificial Sequence <400> 11 uaauuucuac uaaguguaga uucaguagcu agaccaaaau c 41 <210> 12 <211> 41 <212> RNA <213> Artificial Sequence <400> 12 uaauuucuac uaaguguaga uucucuagcu agaccaaaau c 41 <210> 13 <211> 41 <212> RNA <213> Artificial Sequence <400> 13 uaauuucuac uaaguguaga uucugcagcu agaccaaaau c 41 <210> 14 <211> 43 <212> RNA <213> Artificial Sequence <400> 14 uaauuucuac uaaguguaga ugcuacagag aaaucucgau gga 43 <210> 15 <211> 43 <212> RNA <213> Artificial Sequence <400> 15 uaauuucuac uaaguguaga ugcuacagac aaaucucgau gga 43 <210> 16 <211> 43 <212> RNA <213> Artificial Sequence <400> 16 uaauuucuac uaaguguaga ugcuacacag aaaucucgau gga 43 <210> 17 <211> 43 <212> RNA <213> Artificial Sequence <400> 17 uaauuucuac uaaguguaga ugcuacagag caaucucgau gga 43 <210> 18 <211> 43 <212> RNA <213> Artificial Sequence <400> 18 uaauuucuac uaaguguaga ugcuacugag aaaucucgau gga 43 <210> 19 <211> 43 <212> RNA <213> Artificial Sequence <400> 19 uaauuucuac uaaguguaga ugcuacagag acaucucgau gga 43 <210> 20 <211> 43 <212> RNA <213> Artificial Sequence <400> 20 uaauuucuac uaaguguaga ugcuagagag aaaucucgau gga 43 <210> twenty one <211> 25 <212> DNA <213> Artificial Sequence <400> twenty one ctcttcataa tgcttgctct gatag 25 <210> twenty two <211> 25 <212> DNA <213> Artificial Sequence <400> twenty two atactatagt tgagaccttc aatga 25 <210> twenty three <211> 33 <212> DNA <213> Artificial Sequence <400> twenty three tacacctcag atatatttct tcatgaagac ctc 33 <210> twenty four <211> 34 <212> DNA <213> Artificial Sequence <400> twenty four tatttcttca tgaagacctc acagtaaaaa tagg 34 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 agacctcaca gtaaaaatag gtgattttgg 30 <210> 26 <211> 33 <212> DNA <213> Artificial Sequence <400> 26 agcctcaatt cttaccatcc acaaaatgga tcc 33 <210> 27 <211> 31 <212> DNA <213> Artificial Sequence <400> 27 ggatccagac aactgttcaa actgatggga c 31 <210> 28 <211> 31 <212> DNA <213> Artificial Sequence <400> 28 atccagacaa ctgttcaaac tgatgggacc c 31 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <400> 29 gattttggtc tagctacaga gaaatc 26 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <400> 30 ctagaccaaa atcaccta 18

Claims

1. A BRAF V600E mutation detection kit based on CRISPR / Cas12a, characterized in that: The detection kit comprises a Cas12a fluorescence detection system for specifically detecting BRAFV600E mutant DNA; the detection system comprises: Cas12a protein, crRNA specific for BRAFV600E mutant, a high-efficiency isothermal amplification primer combination and a ssDNA reporter system; The crRNA sequence is shown as SEQ ID NO.7; The sequences of the efficient isothermal amplification primer sets are SEQ ID NO.24 and SEQ ID NO.28 respectively; The ssDNA reporter system comprises ssDNA, wherein the ssDNA is TTTATTT, the 5' end of which is modified with 6FAM, and the 3' end of which is modified with 3BHQ1.

2. The detection kit according to claim 1, characterized in that The crRNA can be prepared by constructing a vector pUC57-T7-crRNA and obtaining it by in vitro transcription; or by direct synthesis.

3. Use of the detection kit according to claim 1 or 2 in the preparation of a detection product for detecting BRAFV600E gene mutation in a disease.

4. The use according to claim 3, characterized in that The disease is selected from at least one of inflammation, autoimmune disease or tumor.

Images