An enzyme-linked immunosorbent assay for Toxoplasma gondii antibody IgG based on a novel long-acting antigen TGIMP1C

Abstract

The present invention belongs to the field of genetic engineering technology, specifically the prokaryotic expression and large-scale soluble purification of the Toxoplasma TgIMP1C gene, and the application of the expression product in the immunological detection of Toxoplasma. According to the coding region sequence of Toxoplasma TgIMP1, the present invention designs a core domain TgIMP1c primer that can stably express and purify, and constructs the pET21b-TgIMP1c prokaryotic recombinant expression plasmid by PCR amplification and molecular cloning. After the above expression vector is transformed into Rosetta 2 Escherichia coli, affinity chromatography, ion exchange chromatography and gel filtration chromatography are used to prepare high-purity and high-concentration soluble TgIMP1c recombinant antigen in vitro. After the above soluble antigen is coated on an ELISA 96 microplate, it can be well applied to the detection of Toxoplasma infection in rodent experimental animals by determining its optimal coating concentration, optimal serum sample dilution, optimal coating conditions and blocking conditions, and the working concentration of enzyme-labeled secondary antibody. Compared with similar domestic products, the detection sensitivity is higher, the accuracy is stronger and the cost is lower.

Description

Technical Field

[0001] The invention relates to the field of toxoplasmosis immunology, and in particular to a Toxoplasma gondii antibody IgG enzyme-linked immunosorbent assay method based on a novel long-acting antigen TGIMP1C. Background Art

[0002] Toxoplasmosis is caused by Toxoplasma gondii ( Toxoplasma gondii, Tg ) is a zoonotic infectious disease with worldwide distribution and is one of the three major foodborne pathogens in the world. Toxoplasma gondii can cross the placental barrier and blood-brain barrier of the human body, which can cause serious consequences to immunocompromised people, pregnant women, etc. It can also cause normal adults to suffer from serious eye diseases or induce mental and behavioral disorders. The economic losses caused by toxoplasmosis in the world amount to 300 million US dollars each year.

[0003] At present, the commonly used detection methods for toxoplasmosis mainly include pathogen detection, imaging diagnosis, immunological detection and molecular diagnosis methods. Among them, the pathogen detection method requires repeated breeding and killing of experimental animals, which is complicated and not suitable for large-scale human screening and experimental animal testing. Imaging diagnosis methods are prone to misdiagnosis and must be combined with other detection methods for joint judgment.

[0004] The immunological diagnosis of Toxoplasma gondii is a sensitive and highly specific detection method. It is currently the most widely used, common and accurate test method. The most common one is the detection of serum-specific antibodies. The most widely used in my country are indirect ELISA and agglutination tests. The diagnostic antigens used in indirect ELISA include soluble extracts of tachyzoites, excretory and secretory antigens and various recombinant antigens, such as Toxoplasma surface proteins SAG1 and SAG2, secretory antigens MIC3, GRA1, GRA7, etc. These antigens are mostly specific proteins encoded by Toxoplasma with poor solubility. For example, MIC3 is expressed very briefly and is not suitable for detecting long-term chronic infection; while the soluble extracts of Toxoplasma tachyzoites are complex in composition and have poor specificity. The detection targets are generally IgG and IgM antibodies or circulating antigens CAg.

[0005] Rodents, including rats and mice, are common intermediate hosts of Toxoplasma and are generally susceptible. Rats and mice commonly used in laboratories are common experimental animals in the field of Toxoplasma scientific research, used to construct acute / chronic animal infection models of Toxoplasma and develop new prevention and control measures. my country has currently prepared a variety of detection kits based on the above antigens / antibodies, but their specificity and sensitivity are still far behind similar products abroad, and their reliability in clinical applications needs further evaluation. In particular, the enzyme-linked immunosorbent assay kits that can be used to detect experimental animals are very rare, expensive, and have poor sensitivity, and are on the verge of discontinuation.

[0006] Therefore, developing a method for constructing a rodent Toxoplasma gondii antibody IgG detection reagent that is low-cost, highly sensitive, has a long shelf life, and can be widely used in laboratory research is a technical problem that technical personnel in this field urgently need to solve. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a Toxoplasma antibody IGG enzyme-linked immunosorbent assay method based on a novel long-acting antigen TGIMP1C, which utilizes a surface antigen protein with high expression intensity, long expression time, and stable solubleness in Toxoplasma as a novel detection antigen for detecting chronic Toxoplasma infection in experimental mice.

[0008] The detection method comprises the following steps:

[0009] 1. It can be used for gene amplification of pre-coated TgIMP1c soluble antigen and construction of recombinant expression plasmid; specifically includes the following implementation steps:

[0010] It was obtained by conventional gene cloning and prokaryotic expression purification. Primers were designed based on the IMP1 gene sequence of the virulent RH strain of Toxoplasma gondii in Genbank (JN657189.1). The primer sequence used for gene cloning of TgIMP1c (i.e., the core domain protein fragment between 23-396aa of TgIMP1) is:

[0011] TgIMP1-5'-23-Nde I: GGAATTC CAT ATG GCTGACGAGGCTGAGCGAACAG

[0012] TgIMP1-3'-396-Xho I: TTTCTCGAG GTCCACCATTCGGCCATCAAG

[0013] Using the cDNA of the virulent RH strain of Toxoplasma gondii as a template, the TgIMP1c gene fragment was amplified by conventional PCR. The positive amplified fragment and the pET21b empty vector were double-digested with Nde I and Xho I. After gel recovery, the TgIMP1c fragment was ligated into the pET21b plasmid vector at a molar ratio of vector to target fragment of 1:8. The positive pET21b-TgIMP1c recombinant expression plasmid was constructed and sequenced for identification. The identification results showed that the TgIMP1c gene fragment was successfully ligated into the pET21b expression plasmid.

[0014] Prokaryotic expression and in vitro large-scale separation and purification of TgIMP1c soluble antigen recombinant protein;

[0015] 3. Determination of the optimal coating antigen concentration and the optimal serum sample dilution of the pre-coated TgIMP1c soluble antigen;

[0016] 4. Determination of the optimal coating conditions for pre-coated TgIMP1c soluble antigen;

[0017] 5. Determination of the optimal blocking conditions for pre-coated TgIMP1c soluble antigen;

[0018] 6. Determination of the working concentration of enzyme-labeled secondary antibody;

[0019] 7. Determination of the result judgment criteria of the test kit;

[0020] 8. Determination of the specificity, sensitivity and compliance rate of the test kit;

[0021] 9. Determination of cross-reactivity of the kit;

[0022] 10. Determination of the repeatability of the kit;

[0023] 11. Determination of the shelf life and stability response of the kit.

[0024] Furthermore, the prokaryotic expression and in vitro large-scale separation and purification method of the TgIMP1c soluble antigen recombinant protein is as follows: the positive pET21b-TgIMP1c recombinant expression plasmid is conventionally transformed into Escherichia coli Rosetta 2 competent cells, the TgIMP1c recombinant protein is prokaryotically expressed in Escherichia coli, and the recombinant protein is separated and purified by three steps of chromatography, including affinity chromatography, ion exchange chromatography and gel filtration chromatography, to finally obtain a TgIMP1c soluble protein antigen that can be stably stored in phosphate buffer and has high concentration, high purity and high biological activity.

[0025] Further, the specific method for determining the optimal coating antigen concentration and the optimal serum sample dilution of the pre-coated TgIMP1c soluble antigen is as follows: the purified recombinant TgIMP1c protein is diluted into 6 concentration gradients of 40μg / mL, 20μg / mL, 10μg / mL, 5μg / mL, 2.5μg / mL and 1.25μg / mL with antigen coating solution to coat ELISA 96-well plate, 100μL / well, 12 wells are coated horizontally for each dilution, and 2 columns are repeated vertically. Coat overnight at 4°C, discard the coating solution, wash 3 times with PBST (0.05% Tween20+0.01mol / LPBS), 2 min each time, and spin dry. Add 200μL of 10% calf serum blocking solution to each well, block at 37°C for 2.0 h, spin dry, and wash 3 times with PBST washing solution. 40 Toxoplasma standard positive sera and 20 Toxoplasma standard negative sera were diluted with PBST at a ratio of 1:10, 1:40, 1:80, 1:100, 1:150, and 1:200, respectively. Each dilution was repeated 3 times, and added to the ELISA reaction wells, 100 μL / well, and reacted at 37°C for 60 minutes. Dry, wash 3 times, add enzyme-labeled secondary antibody, 100 μL / well, react at 37°C for 45 minutes, dry, wash 3 times, add TMB substrate, stand at room temperature in the dark for 20 minutes, and measure OD 450 nm, meanwhile, negative serum OD 450 The lower nm is the optimal reaction condition, and the best antigen coating concentration and the most suitable serum dilution multiple are determined by the "square matrix method".

[0026] Further, the method for determining the optimal coating conditions of the pre-coated TgIMP1c soluble antigen is as follows: coating the ELISA 96-well plate with the determined optimal antigen concentration, 100 μL / well. Four coating conditions are set respectively, Group 1: coating at 4°C overnight; Group 2: coating at 37°C for 2.0h; Group 3: 37°C 30min+4°C overnight; Group 4: 37°C 1.0h+4°C overnight. The optimal coating conditions are determined by testing according to the optimal serum dilution multiple and the conventional ELISA operating procedure.

[0027] Further, the method for determining the optimal blocking conditions for the pre-coated soluble antigen of TgIMP1c is as follows: coat the ELISA plate with the optimal antigen coating concentration, and after washing, divide it into 3 groups: Group 1: 10% calf serum; Group 2: 5% skim milk powder; Group 3: 1% BSA, with 3 replicates for each treatment. At the same time, set 4 blocking reaction conditions: Group 1: block overnight at 4°C; Group 2: block for 2.0 h at 37°C; Group 3: block for 1.0 h at 37°C; the fourth group: block for 1.0 h at 37°C + 4°C for 4.0 h. Perform the test operations according to the optimal serum dilution ratio and the conventional ELISA method to determine the optimal blocking solution type and blocking conditions.

[0028] Further, the method for determining the working concentration of the enzyme-labeled secondary antibody in the kit is as follows: establish the ELISA reaction conditions according to the determined antigen coating concentration, serum dilution ratio, blocking solution and blocking conditions, select 5 working concentration gradients of enzyme-labeled antibodies such as 1:2000, 1:3000, 1:5000, 1:8000 and 1:10000 for ELISA detection, and determine the optimal working concentration of the enzyme-labeled antibody.

[0029] Further, the method for determining the result judgment standard of the kit is as follows: use a commercially available kit to detect 40 serum samples, detect them by the established method, calculate the average OD value X and standard deviation SD of the serum samples, calculate its judgment standard critical value = X + 2SD, judge as positive when ≥ X + 3SD, judge as negative when < X + 2SD, and the test result is suspicious when it is between the two, and establish the corresponding ELIA result judgment standard.

[0030] Further, the method for determining the specificity, sensitivity and coincidence rate of the kit is as follows: sensitivity, specificity and coincidence rate tests: select 150 serum samples, among which 90 are positive for Toxoplasma gondii antibodies and 60 are negative for Toxoplasma gondii antibodies, and parallelly detect the ELISA antibody levels by the indirect ELISA method of TgIMP1c developed in this experiment and commercially available products. With the commercially available kit as a reference, evaluate the sensitivity, specificity and coincidence rate of this kit.

[0031] Further, the method for determining the cross-reaction of the kit is as follows: use the kit to detect the standard positive sera infected with cytomegalovirus, herpes virus and rubella virus, and set negative control and blank control at the same time.

[0032] Further, the method for determining the repeatability reaction of the kit is as follows: perform the within-batch repeatability test with the ELISA kits produced in the same batch, measure the OD 450 nm value, perform the between-batch repeat with 3 batches of ELISA kits, calculate the coefficient of variation, and judge the within-batch and between-batch repeatability of the kit.

[0033] Furthermore, the method for determining the shelf life and stability of the kit is as follows: assemble the kit in sequence, store it at 4°C, take it out at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 months, perform ELISA test with Toxoplasma standard positive serum, and evaluate the shelf life of the kit. At the same time, the kit is subjected to an accelerated stability test at 37°C, and the kit is taken out every day for ELISA test, and the test is continuously measured for 15 days to evaluate the stability of the kit.

[0034] Furthermore, the kit prepared by the Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C includes a 96-well microplate pre-coated with TgIMP1c soluble antigen; a washing reagent; a sample dilution reagent; an enzyme-labeled secondary antibody; a positive serum control and a negative serum control; a colorimetric reagent; and a stop reagent;

[0035] Preferably, the kit includes 96 microwell plates (2 pieces / box) pre-coated with TgIMP1c soluble antigen; washing reagent (20× concentrated phosphate buffer, 30 mL / bottle, 1 bottle / box); 10× sample dilution reagent (10 mL / bottle, 1 bottle / box); enzyme-labeled secondary antibody (10 mL working solution, used directly); positive serum control and negative serum control (1 mL / tube, 2 tubes / box); colorimetric reagent (TMB substrate solution 20 mL / bottle, 1 bottle / box); stop reagent (25 mL / bottle, 1 bottle / box); instruction manual 1 copy / box. Each reagent is fixed with a perforated sponge partition, and the 96-well plate, light-shielding plate and instruction manual are placed in the upper part in turn. The outer packaging of the kit is made of hard cardboard for one-time solid pressing, with the kit label printed on the front and the storage conditions and precautions marked on the back.

[0036] The beneficial effects of the present invention are:

[0037] (1) The protein TgIMP1c used for antigen coating in the kit can be expressed almost throughout the life cycle of Toxoplasma gondii, is located on the surface of the parasite, can be expressed in large quantities in the prokaryotic expression system, and is highly soluble; the expressed antigen purified by the three-step method has high purity, large yield, strong and long-lasting protein activity, ensuring the specificity, sensitivity, stability, high reproducibility, long shelf life, low cost, and no cross-reaction of the kit.

[0038] (2) The present invention optimizes the ELISA reaction conditions and standardizes the corresponding reaction reagents and result determination, making the operation simple and quick and the result determination accurate.

[0039] (3) The existing test kits for detecting antibodies against Toxoplasma gondii in experimental mice are of few types, low sensitivity, and low specificity. The present invention optimizes the above-mentioned problems, and the application proves that the present kit has high sensitivity and strong specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 It is a schematic diagram of the PCR amplification results of the TgIMP1 gene in the Toxoplasma gondii antibody IgG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention;

[0041] Figure 2 It is a schematic diagram of the affinity chromatography results of TgIMP1c recombinant protein in a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention;

[0042] Figure 3 It is a schematic diagram of the anion exchange chromatography purification results of the TgIMP1c recombinant protein in the Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention;

[0043] Figure 4 This is a gel filtration chromatography result diagram of TgIMP1c recombinant protein in a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention;

[0044] Figure 5 Schematic diagram of the stability test of the kit ELISA test prepared by the enzyme-linked immunosorbent assay method for Toxoplasma gondii antibody IGG based on the novel long-acting antigen TGIMP1C of the present invention at 4°C;

[0045] Figure 6 Schematic diagram of the stability test of the kit ELISA test at 37°C prepared by the enzyme-linked immunosorbent assay method for Toxoplasma gondii antibody IGG based on the novel long-acting antigen TGIMP1C of the present invention;

[0046] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0047] 1. Supplementary description of the attached figures:

[0048] Figure 1 It is a schematic diagram of the PCR amplification results of the TgIMP1 gene in the Toxoplasma gondii antibody IgG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention; wherein: M: DL2000 DNA molecular weight marker; 1-3: amplified TgIMP gene fragments, with a size of 1119 bp.

[0049] Figure 2It is a schematic diagram of the affinity chromatography results of TgIMP1c in the Toxoplasma antibody IgG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention; wherein: M: protein molecular weight marker; CE: bacterial disruption liquid; S: soluble protein supernatant; F: nickel column flow-through liquid; W: impurity protein; E: target protein TgIMP1c eluate.

[0050] Figure 3 It is a schematic diagram of the anion exchange chromatography (Source-Q) purification results of the TgIMP1c recombinant protein in the Toxoplasma antibody IGG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention; wherein: A: Source-Q column peak diagram; B: SDS-PAGE electrophoresis result diagram.

[0051] Figure 4 It is a gel filtration chromatography (Superdex-200) result diagram of TgIMP1c recombinant protein in a Toxoplasma gondii antibody IgG enzyme-linked immunosorbent assay method based on the novel long-acting antigen TGIMP1C described in the present invention; wherein A: Superdex-200 peak diagram; B: SDS-PAGE electrophoresis result.

[0052] Figure 5 Schematic diagram of the stability test of the kit ELISA test prepared by the enzyme-linked immunosorbent assay method for toxoplasma antibody IGG based on the novel long-acting antigen TGIMP1C of the present invention at 4°C; wherein: X-axis: OD 450 ; Y-axis is sample dilution factor (×100).

[0053] Figure 6 Schematic diagram of the stability test of the kit ELISA test prepared by the enzyme-linked immunosorbent assay method for toxoplasma antibody IGG based on the novel long-acting antigen TGIMP1C of the present invention at 37°C; wherein the X-axis: OD 450 ; Y-axis is sample dilution factor (×100).

[0054] 2. Implementation Method

[0055] 1. It can be used for gene amplification of pre-coated TgIMP1c soluble antigen and construction of recombinant expression plasmid; specifically includes the following implementation steps:

[0056] It was obtained by conventional gene cloning and prokaryotic expression purification. Primers were designed based on the IMP1 gene sequence of the virulent RH strain of Toxoplasma gondii in Genbank (JN657189.1). The primer sequence used for gene cloning of TgIMP1c (i.e., the core domain protein fragment between 23-396aa of TgIMP1) is:

[0057] TgIMP1-5'-23-Nde I: GGAATTC CAT ATG GCTGACGAGGCTGAGCGAACAG

[0058] TgIMP1-3'-396-Xho I: TTTCTCGAG GTCCACCATTCGGCCATCAAG

[0059] Using the cDNA of the virulent RH strain of Toxoplasma gondii as a template, the TgIMP1c gene fragment was amplified by conventional PCR. The positive amplified fragment and the pET21b empty vector were double-digested with Nde I and Xho I. After gel recovery, the TgIMP1c fragment was ligated into the pET21b plasmid vector at a molar ratio of vector to target fragment of 1:8. The positive pET21b-TgIMP1c recombinant expression plasmid was constructed and sequenced for identification. The identification results showed that the TgIMP1c gene fragment was successfully ligated into the pET21b expression plasmid.

[0060] Prokaryotic expression and in vitro large-scale separation and purification of TgIMP1c soluble antigen recombinant protein;

[0061] Methods: The positive pET21b-TgIMP1c recombinant expression plasmid was routinely transformed into E. coli Rosetta 2 competent cells, and the TgIMP1c recombinant protein (protein size is about 45 kDa) was expressed prokaryotically in E. coli. The recombinant protein was purified by affinity chromatography (results in Figure 2 ), ion exchange chromatography (results see Figure 3 ) and gel filtration chromatography (results see Figure 4 ) After a total of three steps of chromatographic separation and purification, the TgIMP1c soluble protein antigen that can be stably stored in phosphate buffer was finally obtained.

[0062] Results: The yield of TgIMP1c soluble antigen was: purity>90%, stable storage at 4℃ for 2 months without degradation, protein concentration could reach above 1mg / mL, and stored at 4℃ for 2 months without degradation.

[0063] 3. Determination of the optimal coating antigen concentration and the optimal serum sample dilution of the pre-coated TgIMP1c soluble antigen;

[0064] Methods: The purified recombinant TgIMP1c protein was diluted into 6 concentration gradients of 40μg / mL, 20μg / mL, 10μg / mL, 5μg / mL, 2.5μg / mL and 1.25μg / mL with antigen coating solution to coat ELISA 96-well plates, 100μL / well, 12 wells were coated horizontally for each dilution, and 2 columns were repeated vertically. Coating was carried out overnight at 4℃, the coating solution was discarded, and the plates were washed 3 times with PBST (0.05% Tween20+0.01mol / LPBS), 2 min each time, and then dried. 200μL of 10% calf serum blocking solution was added to each well, blocked at 37℃ for 2.0 h, dried, and washed 3 times with PBST washing solution. 40 standard positive sera of Toxoplasma gondii and 20 standard negative sera of Toxoplasma gondii were diluted with PBST at a ratio of 1:10, 1:40, 1:80, 1:100, 1:150, and 1:200, respectively. Each dilution was repeated 3 times, and added to the ELISA reaction wells, 100 μL / well, and reacted at 37°C for 60 min. Dry, wash 3 times, add enzyme-labeled secondary antibody, 100 μL / well, react at 37°C for 45 min, dry, wash 3 times, add TMB substrate, stand at room temperature in the dark for 20 min, and measure OD 450 nm, meanwhile, negative serum OD 450 The lower nm is the optimal reaction condition, and the best antigen coating concentration and the most suitable serum dilution multiple are determined by the "square matrix method".

[0065] Results: The results of the matrix titration test with different antigen coating concentrations and serum sample dilutions showed that under the conditions of coating antigen concentration of 5 µg / mL and serum dilution of 1:40, the OD of the Toxoplasma gondii standard positive serum was 450 nm value / Toxoplasma standard negative serum OD 450 nm value, that is, the P / N value is high, and the negative serum OD 450 The value is lower, positive serum OD 450 The values ​​were stable, so the optimal antigen coating concentration was determined to be 5 µg / mL and the optimal serum dilution was determined to be 1:40 (see Table 1).

[0066] Table 1 ELISA test results of different antigen coating concentrations and serum dilutions

[0067]

[0068] 4. Determination of the optimal coating conditions for pre-coated TgIMP1c soluble antigen;

[0069] Methods: ELISA 96-well plates were coated with the determined optimal antigen concentration, 100 μL / well. Four coating conditions were set, Group 1: 4℃ coating overnight; Group 2: 37℃ coating for 2.0 h; Group 3: 37℃ 30 min + 4℃ overnight; Group 4: 37℃ 1.0 h + 4℃ overnight. The optimal coating conditions were determined by testing according to the optimal serum dilution multiple and conventional ELISA operating procedures.

[0070] Results: The ELISA reaction plate was coated with the optimal recombinant protein coating concentration and divided into 4 groups for coating condition optimization. The ELISA test was performed according to the optimal serum dilution to determine the optimal coating conditions. The results showed (Table 2) that in group III, the ELISA reaction plate was coated at 37°C for 30 min + 4°C overnight. The OD of positive serum was 450 The nm value is high, the results of 5 repeated tests are stable, and the negative serum OD 450 The nm value was lower and the P / N value was the highest, and 37℃ 30min+4℃ was determined to be the best antigen coating condition.

[0071] Table 2 Determination of the optimal coating conditions for recombinant protein antigens

[0072]

[0073] 5. Determination of the optimal blocking conditions for pre-coated TgIMP1c soluble antigen;

[0074] Methods: The ELISA plate was coated with the optimal antigen coating concentration and divided into 3 groups after washing: Group 1: 10% calf serum; Group 2: 5% skim milk powder; Group 3: 1% BSA, and each treatment was repeated 3 times. At the same time, 4 blocking reaction conditions were set: Group 1: 4℃ blocking overnight; Group 2: 37℃ blocking for 2.0 h; Group 3: 37℃ 1.0 h; Group 4: 37℃ 1.0 h + 4℃ 4.0 h. The test operation was carried out according to the optimal serum dilution multiple and the conventional ELISA method to determine the best blocking solution type and blocking conditions.

[0075] Results: Using the standard positive serum and negative serum of Toxoplasma gondii, three different components of blocking solution were selected, namely 10% calf serum, 5% skim milk powder, and 1% BSA. Four different blocking conditions were used, namely Ⅰ was blocked at 4℃ overnight; Ⅱ was blocked at 37℃ for 2.0 h; Ⅲ was blocked at 37℃ for 1.0 h; Ⅳ was blocked at 37℃ for 1.0 h+4℃ for 4.0 h; the sample OD was detected. 450 nm value, compared with the P / N value, to determine the best blocking solution type and blocking conditions. The results showed that the blocking solution group IV, that is, 10% calf serum, under the conditions of 37℃ for 1.0h+4℃ for 4h, the test results of positive serum OD 450The nm value is the highest, and the OD of the negative serum 450 The nm value is the lowest, the P / N value is the largest, and the test result is stable and reliable (Table 3)

[0076] Table 3 Determination of the type and conditions of the blocking solution

[0077]

[0078] 6. Determination of the working concentration of the enzyme-labeled secondary antibody;

[0079] Method: According to the determined antigen coating concentration, serum dilution, blocking solution and blocking conditions, establish ELISA reaction conditions, and select 5 working concentration gradients of enzyme-labeled antibodies such as 1:2000, 1:3000, 1:5000, 1:8000 and 1:10000 for ELISA detection to determine the optimal working concentration of the enzyme-labeled antibody.

[0080] Result: Add the goat anti-mouse IgG enzyme-labeled antibody to the ELSA reaction wells at 5 different dilution ratios of 1:2000, 1:3000, 1:5000, 1:8000 and 1:10000 respectively. After the reaction, measure the OD 450 nm value, calculate the P / N values of the positive serum and negative serum. The results are shown in Table 4. When the working concentration of the enzyme-labeled antibody is diluted at 1:8000, the P / N value is the largest. Therefore, the optimal working concentration of the enzyme-labeled antibody is determined to be 1:8000.

[0081] Table 4 Determination of the working concentration of the enzyme-labeled antibody

[0082]

[0083] 7. Determination of the result judgment standard of the kit;

[0084] Method: Use commercially available products to detect 40 serum samples, detect them by the established method, calculate the average OD value X and standard deviation SD of the serum samples, calculate the critical value of its judgment standard = X + 2SD, judge as positive with ≥ X + 3SD, judge as negative with < X + 2SD, and the test result is suspicious between the two, and establish the corresponding ELIA result judgment standard.

[0085] Result: Conduct a statistical analysis on the ELSIA test results of 40 negative serum samples of Toxoplasma gondii. The statistical results show that the average OD value of the samples is 0.175, the standard deviation (SD) is 0.063, and the critical value = the average OD value of the samples + 3SD. The calculated critical value is 0.364. Determine the judgment standard: The sample OD value ≥ 0.371 is judged as positive, the result is suspicious between 0.371 and 0.301 (the average OD value of the samples + 2×SD), and < 0.301 is judged as negative (Table 5).

[0086] Table 5 Determination of positive and negative critical values ​​of ELISA kit

[0087] serial number <![CDATA[OD 450 Value]]> serial number <![CDATA[OD 450 Value]]> serial number <![CDATA[OD 450 Value]]> serial number <![CDATA[OD 450 Value]]> 1 0.197 11 0.198 21 0.197 31 0.218 2 0.207 12 0.218 22 0.212 32 0.213 3 0.201 13 0.221 23 0.237 33 0.191 4 0.171 14 0.059 24 0.218 34 0.192 5 0.227 15 0.047 25 0.218 35 0.038 6 0.193 16 0.212 26 0.196 36 0.214 7 0.185 17 0.061 27 0.225 37 0.086 8 0.219 18 0.047 28 0.037 38 0.217 9 0.189 19 0.198 29 0.188 39 0.048 10 0.195 20 0.215 30 0.192 40 0.194

[0088] 8. Determination of the specificity, sensitivity and compliance rate of the test kit;

[0089] Methods: Sensitivity, specificity and coincidence test: 150 serum samples were selected, of which 90 were Toxoplasma antibody positive and 60 were Toxoplasma antibody negative. The IMP1 indirect ELISA kit developed in this experiment and the commercial product kit were used in parallel to perform ELISA antibody level detection. The commercial product kit was used as a reference to evaluate the sensitivity, specificity and coincidence of this kit.

[0090] Results: Using the commercially available ELISA kit as a reference, 150 sera were tested in parallel using the two kits, of which 90 were positive for Toxoplasma antibody and 60 were negative. Statistical analysis showed (Table 6) that the sensitivity of the ELISA kit developed in this experiment was 93.3% (84 / 90), the specificity was 95.0% (57 / 60), and the compliance rate was 94.0% (141 / 150).

[0091] Table 6 Evaluation of ELISA kit specificity, sensitivity and compliance rate

[0092] Test results Commercially available ELISA kits ELISA kit for this study Number of matches Real number Positive 86 89 84 90 Negative 58 58 57 60 suspicious 6 3 0 0 total 150 150 141 150

[0093] 9. Determination of cross-reactivity of the kit;

[0094] Methods: The kit was used to detect the standard positive serum infected with cytomegalovirus, herpes virus and rubella virus, and negative control and blank control were set up at the same time.

[0095] Results: The developed indirect ELISA antibody detection kit was used to detect the standard positive serum infected with cytomegalovirus, herpes virus and rubella virus. The results showed that the OD values ​​of the three standard positive serum samples were 450 The nm values ​​were all less than 0.301, showing a negative reaction, indicating that the developed ELISA antibody detection kit had no serological cross-reactivity with cytomegalovirus, herpes virus, and rubella virus infection (Table 7).

[0096] Table 7 Serum cross-reaction test

[0097] Positive serum type Cytomegalovirus Herpes virus Rubella virus <![CDATA[OD 450 Value]]> 0.217 0.189 0.235 Result determination Negative Negative Negative

[0098] 10. Determination of the repeatability of the kit;

[0099] Methods: The same batch of ELISA kits were used to perform intra-batch repeatability test, and the OD450 nm value was determined. Three batches of ELISA kits were used for inter-batch repeatability test, and the coefficient of variation was calculated to determine the intra-batch and inter-batch repeatability of the kits.

[0100] Results: 10 samples of sera including strong positive, weak positive and negative toxoplasma antibody were used to perform the batch repeatability test with ELISA kits from the same batch. Each sample was repeated 5 times, and the OD of each serum was calculated. 450 The mean (AV), standard error (S) and coefficient of variation (CV) are shown in Table 8. The same batch of ELISA kits were used to detect OD of 10 serum samples. 450 The coefficient of variation of the values ​​ranged from 1.44% to 2.94%, all less than 3.0%, indicating that the kit had good intra-batch repeatability. Ten serum samples were selected and antibody detection was performed on three batches of ELISA kits (20200408, 20200807, and 20201012). The OD of each serum was calculated. 450 The mean (AV), standard error (S) and coefficient of variation (CV) show that the OD values ​​of 10 serum samples tested by different batches of kits are 450 The coefficient of variation of the values ​​was between 2.18% and 2.35%, all less than 5.0%, indicating that the ELISA kit had good batch-to-batch reproducibility.

[0101] Table 8 Recombinant TgIMP1c protein-ELISA intra-batch repeatability test

[0102]

[0103] 11. Determination of the shelf life and stability response of the kit.

[0104] Methods: The kits were assembled sequentially, stored at 4°C, and taken out at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 months, respectively, and tested by ELISA with standard positive serum of Toxoplasma gondii to evaluate the shelf life of the kits. At the same time, the kits were subjected to accelerated stability test at 37°C, and ELISA test was performed every day for 15 consecutive days to evaluate the stability of the kits.

[0105] Results: The test kit was stored at 4°C and taken out for sampling every month. The sampling was continued for 12 months. The Toxoplasma gondii positive samples were measured at four gradient OD values ​​of 1:40, 1:80, 1:150 and 1:200. 450 nm value, set negative control, the results show (see Table 9), different dilution gradient OD from January to August 450The values ​​did not change significantly, the 4P logarithmic fitting curve was smooth, and R2 was above 0.99. After 8 months, the OD value dropped significantly, and R2 dropped significantly, below 0.99. By December, the OD value dropped by 41.53%. Therefore, the shelf life of the kit at 4°C was determined to be 7 months (see Figure 1 ).

[0106] Table 9 Stability test of ELISA kit at 4°C

[0107]

[0108] The results of the ELISA kit for the Toxoplasma standard positive serum test at 37°C for different days are shown in Table 10. The results show that when the positive serum was stored at 37°C for 8 days, the OD 450 The value decrease rate was less than 5%. The simulated standard curve of 4P logarithmic fitting showed that the R2 value of the curve from day 1 to day 8 was greater than 0.99. Later, as time went on, the OD 450 The value showed a rapid downward trend. Based on the test results at 4℃ and 37℃, the shelf life of the developed ELISA kit was determined to be 7 months.

[0109] Table 10 Stability test of ELISA kit at 37℃

[0110]

[0111] Application of the kit: The established ELISA test kit was used to test 300 serum samples from KM mice infected with 4 Toxoplasma gondii isolates (LHG, Wh6, Pru, RH) used for seed culture in this laboratory. The first three Toxoplasma gondii isolates can cause chronic toxoplasmosis in experimental mice, and the RH strain causes acute toxoplasmosis in mice. The positive rate was calculated. At the same time, the Toxoplasma gondii indirect hemagglutination antibody detection (IHA) kit was used for detection to compare the positive rates of the two.

[0112] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0113] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A method for constructing a Toxoplasma gondii antibody IgG enzyme-linked immunosorbent assay kit based on a novel long-acting antigen TGIMP1C, comprising the following steps: (1) It can be used for gene amplification of pre-coated TgIMP1c soluble antigen and construction of recombinant expression plasmid; specifically includes the following implementation steps: It was obtained by conventional gene cloning and prokaryotic expression purification; primers were designed based on the IMP1 gene sequence JN657189.1 of the tachyzoites of the virulent RH strain of Toxoplasma gondii in Genbank; The primer sequences used for cloning the gene of TgIMP1c, i.e., the core domain protein fragment between 23-396aa of TgIMP1, are: TgIMP1-5'-23-Nde I: GGAATTC CAT ATG GCTGACGAGGCTGAGCGAACAG TgIMP1-3'-396-Xho I: TTTCTCGAG GTCCACCATTCGGCCATCAAG The cDNA of the virulent RH strain of Toxoplasma gondii was used as a template to amplify the TgIMP1c gene fragment by conventional PCR. The positive amplified fragment and the pET21b empty vector were double-digested with Nde I and Xho I. After gel recovery, the TgIMP1c fragment was ligated into the pET21b plasmid vector at a molar ratio of 1:8 between the vector and the target fragment to construct the positive pET21b-TgIMP1c recombinant expression plasmid and sequenced for identification. (2) Prokaryotic expression and in vitro large-scale separation and purification of TgIMP1c soluble antigen recombinant protein; (3) Determination of the optimal coating antigen concentration and the optimal serum sample dilution of the pre-coated TgIMP1c soluble antigen; (4) Determination of the optimal coating conditions for pre-coated TgIMP1c soluble antigen; (5) Determination of the optimal blocking conditions for pre-coated TgIMP1c soluble antigen; (6) Determination of the working concentration of enzyme-labeled secondary antibody; (7) Determination of the result judgment criteria of the test kit; (8) Determination of the specificity, sensitivity and compliance rate of the test kit; (9). Determination of cross-reactivity of the kit; (10). Determination of the repeatability of the kit; (11). Determination of the shelf life and stability of the kit; The method for prokaryotic expression and in vitro large-scale separation and purification of the TgIMP1c soluble antigen recombinant protein is as follows: the positive pET21b-TgIMP1c recombinant expression plasmid is conventionally transformed into Escherichia coli Rosetta 2 competent cells, the TgIMP1c recombinant protein is prokaryotically expressed in Escherichia coli, and the recombinant protein is separated and purified by three steps of chromatography, namely affinity chromatography, ion exchange chromatography and gel filtration chromatography, to finally obtain a TgIMP1c soluble protein antigen that can be stably stored in a phosphate buffer and has high concentration, high purity and high biological activity.

2. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The specific method for determining the optimal coating antigen concentration and the optimal serum sample dilution of the pre-coated TgIMP1c soluble antigen is as follows: the purified recombinant TgIMP1c protein is diluted with antigen coating solution into 6 concentration gradients of 40 μg / mL, 20 μg / mL, 10 μg / mL, 5 μg / mL, 2.5 μg / mL and 1.25 μg / mL for coating ELISA 96-well plate, 100 μL / well, 12 wells are coated horizontally for each dilution, and 2 columns are repeated vertically; the plate is coated overnight at 4°C, the coating solution is discarded, and the plate is washed 3 times with PBST for 2 min each time, and then dried; 200 μL of 10% calf serum blocking solution is added to each well, the plate is blocked at 37°C for 2.0 h, dried, and washed 3 times with PBST washing solution; 40 Toxoplasma gondii standard positive sera and 20 Toxoplasma gondii standard negative sera are washed with PBST Dilute at a ratio of 1:10, 1:40, 1:80, 1:100, 1:150, and 1:200, and repeat each dilution 3 times. Add to ELISA reaction wells, 100 μL / well, react at 37°C for 60 min; spin dry, wash 3 times, add enzyme-labeled secondary antibody, 100 μL / well, react at 37°C for 45 min, spin dry, wash 3 times, add TMB substrate, stand at room temperature in the dark for 20 min, and measure OD 450 nm, and the optimal antigen coating concentration and the most suitable serum dilution multiple were determined by the "square array method".

3. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The method for determining the optimal coating conditions of the pre-coated TgIMP1c soluble antigen is as follows: coating an ELISA 96-well plate with the determined optimal antigen concentration, 100 μL / well; setting four coating conditions respectively, Group 1: coating at 4°C overnight; Group 2: coating at 37°C for 2.0 h; Group 3: 37°C 30 min+4°C overnight; Group 4: 37°C 1.0 h+4°C overnight; performing detection according to the optimal serum dilution multiple and conventional ELISA operating procedures to determine the optimal coating conditions.

4. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The method for determining the optimal blocking conditions of the pre-coated TgIMP1c soluble antigen is as follows: coating the ELISA plate with the optimal antigen coating concentration, and dividing it into 3 groups after washing: Group 1: 10% calf serum; Group 2: 5% skim milk powder; Group 3: 1% BSA, and each treatment is repeated 3 times; and 4 blocking reaction conditions are set at the same time: Group 1: blocking at 4°C overnight; Group 2: blocking at 37°C for 2.0 h; Group 3: 37°C for 1.0 h; Group 4: 37°C for 1.0 h+4°C for 4.0 h; and performing experimental operations according to the optimal serum dilution multiple and the conventional ELISA method to determine the optimal blocking solution type and blocking conditions.

5. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The method for determining the working concentration of the enzyme-labeled secondary antibody in the kit is as follows: according to the determined antigen coating concentration, serum dilution, blocking solution and blocking conditions, ELISA reaction conditions are established, and 5 enzyme-labeled antibody working concentration gradients of 1:2000, 1:3000, 1:5000, 1:8000 and 1:10000 are selected for ELISA detection to determine the optimal enzyme-labeled antibody working concentration.

6. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The method for determining the result judgment standard of the kit is as follows: 40 serum samples are tested using a commercially available kit, and the established method is used to calculate the average OD value X and standard deviation SD of the serum samples, and the judgment standard critical value is calculated = X+2SD, and ≥ X+3SD is judged as positive, < X+2SD is judged as negative, and the test result is suspicious between the two, and the corresponding ELISA result judgment standard is established; The method for determining the specificity, sensitivity and coincidence rate of the kit is as follows: Sensitivity, specificity and coincidence rate test: 150 serum samples were selected, of which 90 were positive for Toxoplasma antibody and 60 were negative for Toxoplasma antibody, and the ELISA antibody level was detected in parallel using the TgIMP1c indirect ELISA method developed in this test and the commercially available product, and the sensitivity, specificity and coincidence rate of the kit were evaluated with the commercially available kit as a reference; The method for determining the cross reaction of the kit is: using the kit to detect standard positive serum infected with cytomegalovirus, herpes virus and rubella virus, and setting a negative control and a blank control at the same time.

7. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The method for determining the repeatability of the kit is to perform an intra-batch repeatability test using ELISA kits produced in the same batch to determine the OD 450 nm value, three batches of ELISA kits were used for inter-batch repetition, and the coefficient of variation was calculated to determine the intra-batch and inter-batch reproducibility of the kit; The method for determining the shelf life and stability reaction of the kit is as follows: assemble the kit in sequence, store it at 4°C, take it out at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 months, perform ELISA test with Toxoplasma standard positive serum, and evaluate the shelf life of the kit; at the same time, perform an accelerated stability test on the kit at 37°C, take it out every day for ELISA test, and continuously measure for 15 days to evaluate the stability of the kit.

8. The method for constructing a Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C according to claim 1, characterized in that: The Toxoplasma gondii antibody IGG enzyme-linked immunosorbent assay kit based on the novel long-acting antigen TGIMP1C comprises a 96-well microplate pre-coated with TgIMP1c soluble antigen; a washing reagent; a sample dilution reagent; an enzyme-labeled secondary antibody; a positive serum control and a negative serum control; a colorimetric reagent; and a stop reagent.

Images