CTGF gene-specific double-stranded oligonucleotides and compositions comprising the same for the prevention and treatment of fibrotic diseases and respiratory-related diseases

Abstract

The present invention relates to a double-stranded oligonucleotide capable of inhibiting CTGF expression with extremely high specificity and high efficiency, a double-stranded oligonucleotide structure and a nanoparticle comprising the same, and use thereof in preventing or treating fibrosis or respiratory diseases.

Description

TECHNICAL FIELD

[0001] The present application relates to a double-stranded oligonucleotide capable of inhibiting CTGF expression with high efficiency and high specificity, a double-stranded oligonucleotide construct comprising the same, a nanoparticle comprising the same, and use thereof for preventing or treating fibrosis or a respiratory disease. BACKGROUND

[0002] In 1995, Guo and Kemphues found that, in C. elegans, sense RNA is as effective as antisense RNA in inhibiting gene expression using antisense, and thus conducted a study to determine the reason therefor. In 1998, Fire et al. first discovered a phenomenon in which, upon injection of double-stranded RNA (dsRNA), the corresponding mRNA is specifically degraded, thus inhibiting gene expression, and this phenomenon was named RNA interference (RNAi). RNAi is a method for inhibiting gene expression, which can clearly show the effect of inhibiting gene expression in a simple manner at low cost, and thus its range of application is increasing.

[0003] Because a technique for inhibiting gene expression can regulate the expression of a specific gene, it is possible to eliminate a target gene in cancer, a genetic disease, etc. caused by overexpression of the specific gene at the mRNA level, based on which the technique can be used as an important tool for the development of therapeutic agents for disease treatment and target validation. Conventionally, in order to inhibit the expression of a target gene, a technique for introducing a transgene into the target gene is disclosed, and examples thereof include a method of introducing a transgene in the reverse direction (antisense) of a promoter and a method of introducing a transgene in the forward direction (sense) of a promoter.

[0004] RNA therapy targeting RNA is a method of removing the function of a corresponding gene using an oligonucleotide against a target RNA, and is said to be different from conventional therapies such as those using antibodies and small molecules that mainly target proteins. There are two main methods of targeting RNA: double-stranded RNA-mediated RNAi and the use of antisense oligonucleotides (ASOs). Currently, clinical trials targeting RNA are being attempted against various diseases.

[0005] An antisense oligonucleotide (hereinafter referred to as "ASO") is a short synthetic DNA designed to bind to a target gene based on Watson-Crick base pairing, and since it can specifically inhibit the expression of a certain nucleotide sequence of a gene, it has been used to study the function of a gene and to develop a therapeutic agent capable of treating a disease such as cancer at the molecular level. The advantage of the ASO is that it can be easily produced by diversely setting the inhibition of gene expression, and its use for inhibiting the expression of an oncogene and the growth of cancer cells has been studied. The process by which the ASO inhibits the expression of a specific gene is achieved by eliminating mRNA due to the RNAse H activity induced by binding to the complementary mRNA sequence, or interfering with the formation and progress of the ribosome complex for protein translation. It is also reported that the ASO binds to genomic DNA to form a triple helix structure, thereby inhibiting gene transcription. Although the ASO has the potential described above, in order to use the ASO in clinical practice, the resistance to nucleases must be improved, and the ASO must be effectively delivered into the target tissue or cell to specifically bind to the nucleotide sequence of the gene of interest. In addition, the secondary and tertiary structures of the gene mRNA are important for the specific binding of the ASO, and since the region forming less mRNA secondary structure is very advantageous for the entry of the ASO, efforts have been made to effectively achieve gene-specific inhibition in vitro as well as in vivo by systematically analyzing the region forming less mRNA secondary structure before the synthesis of the ASO. Such an ASO is more stable than siRNA (a kind of RNA), and has the advantage of being easily soluble in water and saline. At present, the Federal Drug Administration (FDA) has approved three ASOs (Jessica, C., J. Postdoc Res., 4:35-50, 2016).

[0006] Since the effect of RNA interference (hereinafter referred to as "RNAi") was discovered, it has been found that RNAi acts on sequence-specific mRNA in various types of mammalian cells (Barik, S., J. Mol. Med. (2005) 83: 764-773). When long-chain double-stranded RNA is delivered to a cell, the delivered double-stranded RNA is processed by an endonuclease called dicer into small interfering RNA (hereinafter referred to as "siRNA") of 21 to 23 base pairs (bp) in length, and the siRNA binds to RISC (RNA-induced silencing complex), thus inhibiting the expression of a target gene in a sequence-specific manner through a process of recognizing and degrading a target mRNA by a guide (antisense) strand. The gene expression inhibition technique using siRNA can be used for research to identify the function of a target gene in a target cell by inhibiting the expression of the target gene in the target cell and observing changes caused thereby. In particular, inhibiting the function of a target gene in an infectious virus or a cancer cell will be useful for developing a therapeutic method for the disease, and it has been reported that siRNA can inhibit the expression of a target gene based on the results of in vitro and in vivo studies using experimental animals.

[0007] According to the research group of Bertrand, it has been found that siRNA against the same target gene has a strong inhibitory effect on the expression of mRNA in vitro and in vivo compared to antisense oligonucleotide (ASO), and this effect lasts for a long time. In addition, since the mechanism of action of siRNA is to regulate the expression of a target gene in a sequence-specific manner by complementary binding to a target mRNA, it is advantageous that the range of targets to which siRNA is applicable is significantly expanded compared to conventional antibody-based drugs or small molecule drugs (M. A. Behlke, MOLECULAR THERAPY. 2006 13(4):664-670).

[0008] Although siRNA has excellent effects and a wide range of uses, for siRNA developed as a therapeutic agent, it is necessary to effectively deliver siRNA to target cells by improving the in vivo stability of siRNA and increasing the efficiency of cellular delivery (F. Y. Xie, Drug Discov. Today, Jan 2006; 11(1-2):67-73). In order to improve in vivo stability and address problems related to non-specific innate immune stimulation of siRNA, modification of some nucleotides or the backbone of siRNA to impart nuclease resistance, the use of carriers such as viral vectors, liposomes, or nanoparticles, etc. are being intensively studied.

[0009] Delivery systems using viral vectors such as adenovirus or retrovirus have high transfection efficiency, but have high immunogenicity and carcinogenicity. On the other hand, non-viral delivery systems including nanoparticles have lower cell delivery efficiency than viral delivery systems, but are advantageous in that they have high in vivo stability, target-specific delivery is possible, RNAi oligonucleotides are taken up by cells or tissues and internalized into cells or tissues, and have little cytotoxicity or immunostimulation, and thus are currently considered as a more powerful delivery method than viral delivery systems (Akhtar S., J. Clin. Invest. 2007 Dec 3; 117(12): 3623-3632).

[0010] Among non-viral delivery systems, a method using nanocarriers includes forming nanoparticles using various polymers such as liposomes, cationic polymer complexes, etc., and loading siRNA on such nanoparticles (i.e., nanocarriers), thereby delivering the siRNA to cells. Here, specific examples of nanocarriers can include polymeric nanoparticles, polymeric micelles, lipoplexes, etc. In particular, lipoplexes composed of cationic lipids interact with anionic lipids of intracellular endosomes to induce destabilization of the endosomes, thereby achieving intracellular delivery.

[0011] Further, it is known that high efficiency can be induced in vivo by linking a chemical substance to the terminal portion of the siRNA passenger (sense) strand to impart enhanced pharmacokinetics (J. Soutschek, Nature 11; 432(7014): 173-8, 2004). Here, the stability of siRNA varies depending on the properties of the chemical substance bound to the terminal of the siRNA sense (passenger) strand or the antisense (guide) strand. For example, siRNA in the form in which a polymeric compound such as polyethylene glycol (PEG) is conjugated interacts with the anionic phosphate group of siRNA in the presence of a cationic material to form a complex, thereby obtaining a delivery carrier having improved siRNA stability (S. H. Kim, J. Control Release 129(2): 107-16, 2008). In particular, micelles composed of a polymer complex have a very small size compared to other systems such as microspheres or nanoparticles used as drug delivery carriers, but are very uniformly distributed and spontaneously formed, and thus are easy to control the quality of the formulation and have reproducibility.

[0012] To improve the intracellular delivery efficiency of siRNA, a technology for achieving efficient cell membrane permeability and stability of siRNA using siRNA conjugates in which a biocompatible polymeric hydrophilic material (e.g., polyethylene glycol (PEG)) is conjugated to siRNA via a simple covalent bond or a covalent bond mediated by a linker has been developed (Korean Patent No. 883471). However, even when siRNA is chemically modified or conjugated with polyethylene glycol (PEG) (PEGylation), it still has drawbacks such as low in vivo stability and poor delivery to target organs. To overcome these drawbacks, a double-stranded oligo RNA construct in which a hydrophilic material and a hydrophobic material are combined with an oligonucleotide, particularly a double-stranded oligo RNA such as siRNA, and the construct forms a self-assembled nanoparticle, called SAMiRNA TM (inhibitory RNA by self-assembled micelles) (Korean Patent No. 1224828) has been developed. Here, SAMiRNA TM technology can achieve homogenous nanoparticles having a very small size.

[0013] In one specific embodiment of SAMiRNA TM , a hydrophilic material such as PEG (polyethylene glycol) or HEG (hexaethylene glycol) is used. PEG is a synthetic polymer and is commonly used to increase the solubility of drugs (particularly proteins) and control pharmacokinetics. PEG is a polydisperse material, and polymers in a batch are composed of a set of different numbers of monomers, so that its molecular weight shows a Gaussian curve, and a polydispersity value (Mw / Mn) represents the degree of homogeneity of the material. Specifically, PEG having a low molecular weight (3 kDa to 5 kDa) shows a polydispersity value of about 1.01, while PEG having a high molecular weight (20 kDa) shows a high polydispersity value of about 1.2. The higher the molecular weight, the lower the homogeneity of the material. Therefore, when PEG is conjugated with a drug, the polydispersity of PEG is reflected in the conjugate, making it difficult to verify a single material, which is undesirable. Therefore, it is necessary to produce a material having a low polydispersity value by improving the PEG synthesis and purification process. However, particularly when PEG is combined with a material having a low molecular weight, there are problems related to the polydispersity of the material, such as inconvenience in determining whether the combination is easy to proceed (Francesco M. V. DRUG DISCOVERY TODAY (2005) 10(21): 1451-1458).

[0014] Therefore, in recent years, as a conventional self-assembled nanoparticle SAMiRNA TMan improved form of SAMiRNA, using an appropriate number of blocks as needed, in which a double-stranded oligonucleotide construct constituting SAMiRNA TM is constructed into a basic unit containing 1 to 15 uniform monomers having a predetermined molecular weight and a linker if necessary, thereby developing a novel delivery carrier technology having a small size and significantly improved polydispersity compared to conventional SAMiRNA TM . It is known that siRNA is rapidly degraded by various enzymes present in the blood when injected in vivo, thus resulting in poor delivery efficiency to target cells or tissues, and improved SAMiRNA TM also showed that variations in stability and expression inhibition efficiency according to target genes were observed. Therefore, in order to use improved self-assembled nanoparticle SAMiRNA TM more stably and effectively inhibit the expression of target genes, the present inventors have attempted to enhance the expression inhibition effect and stability to target genes by applying a double-stranded oligonucleotide in the form of a DNA-RNA hybrid, which uses a DNA sequence as an ASO sense strand as a guide strand and an RNA sequence as an antisense strand as a follower strand.

[0015] Chronic obstructive pulmonary disease (hereinafter referred to as "COPD") is a representative lung disease together with asthma, which is distinguished from asthma in that it is accompanied by irreversible airway obstruction, and is a respiratory disease of incomplete reversibility and progressive limitation of airflow, accompanied by abnormal inflammatory responses of the lung caused by repeated infection, inhalation of harmful particles or gases, or smoking (Pauwels et al., Am J. Respir. Crit. Care Med., 163: 1256-1276, 2001). COPD is a disease caused by pathological changes in the bronchioles and lung parenchyma due to inflammation of the airways and lung parenchyma, and is characterized by occlusive bronchiolitis and emphysema (destruction of lung parenchyma). Examples of COPD include chronic obstructive bronchitis, chronic bronchiolitis, and emphysema. For COPD, the number of neutrophils increases, and the secretion of cytokines such as GM-CSF, TNF-α, IL-8, and MIP-2 increases. In addition, the airway becomes inflamed, the muscle wall becomes thick, and mucus secretion increases, leading to bronchial obstruction. When the bronchi are obstructed, the alveoli are enlarged and damaged, the oxygen and carbon dioxide exchange capacity is reduced, and the incidence of respiratory failure increases.

[0016] The severity of COPD has drawn attention worldwide because COPD was the 6th leading cause of death in 1990, but is predicted to become the 3rd leading cause of death in 2020, and is the only disease in the top 10 diseases with increasing incidence. COPD has a high prevalence, causes respiratory problems, and brings high direct medical expenses for diagnosing and treating COPD, and high indirect medical expenses such as loss due to respiratory distress disorder or leave of absence or loss due to premature death. For this reason, COPD is becoming a major socio-economic problem worldwide (Chronic Obstructive Pulmonary Disease (COPD) Medical Guidelines. 2005. Clinical Research Center for Chronic Obstructive Airway Diseases. pp. 30-31).

[0017] There is no evidence that existing therapies can reduce the long-term decline in lung function characteristic of COPD. Therefore, the drug therapy for COPD is mainly for the purpose of alleviating symptoms or complications. In particular, bronchodilators are representative symptomatic drugs for COPD, and the main prescription is an anti-inflammatory drug or a corticosteroid, but its effectiveness is not significant, the range of application is narrow, and there is a high risk of side effects. As for other drugs, only the influenza vaccine is known to reduce the severe morbidity and mortality of COPD patients by about 50% (Chronic Obstructive Pulmonary Disease (COPD) Medical Guidelines. 2005. Clinical Research Center for Chronic Obstructive Airway Diseases. pp. 52-58).

[0018] Meanwhile, it is presumed that many genetic factors increase (or decrease) the risk of an individual developing COPD. The genetic risk factor that has been proven so far is a genetic defect of alpha 1 -antitrypsin. Although smoking significantly increases the risk of developing COPD, the development of rapidly progressive panlobular emphysema and the decrease in lung function at a young age occur in both non-smokers and smokers with severe genetic defects. No genes other than the alpha 1 -antitrypsin gene have been confirmed to be related to the pathogenesis of COPD, but attempts are being made to identify biomarkers of the disease by studying basic cellular, molecular, and genetic abnormalities in COPD patients, and to use these biomarkers for diagnosis or for finding new treatment methods (P.J. Barnes and R.A. Stockley. Eur. Respir. J. (2005) 25: 1084-1106). In particular, research on the selection of COPD diagnosis and treatment targets through methods such as gene microarray or proteomics is actively being conducted. Analysis of genetic factors that cause susceptibility to COPD and the causes of exacerbation of COPD symptoms induced by smoking is mainly conducted (Peter J. Castaldi et al. Human Molecular Genetics, 2010, Vol. 19, No. 3 526-534).

[0019] Idiopathic pulmonary fibrosis (hereinafter referred to as "IPF") is a type of fibrosis, and is a disease in which chronic inflammatory cells infiltrate the alveolar (alveolus) wall and various changes that harden the lung occur, resulting in severe structural changes in the lung tissue, gradually worsening lung function, and eventually leading to death. However, there is still no effective treatment for IPF, and when symptoms of IPF occur and a patient is diagnosed with IPF, the average survival time of the patient is only about 3 to 5 years, and thus IPF is a disease with a very poor prognosis. It is reported that the incidence of IPF is about 3 to 5 per 100,000 people in foreign countries, and it is known that the incidence of IPF is generally higher after the age of 50, and men are twice as likely to be diagnosed with this disease as women.

[0020] The cause of IPF has not been clearly identified. IPF is common in smokers, and it is reported that antidepressants, chronic lung inhalation due to gastroesophageal reflux, inhalation of metal dust, wood chips, or solvents, etc. are risk factors associated with the occurrence of IPF. However, in most patients, no definite causative factor has been reported. For the most frequently mentioned factor, regardless of the cause, when the Th1 / Th2 reaction, the coagulation cascade, etc. are activated, it is known that fibrotic cytokines are secreted therefrom, and the activated cytokines stimulate fibroblasts, thereby increasing ECM (extracellular matrix) and causing pulmonary fibrosis. Therefore, this process is naturally accompanied by lung inflammation, which can lead to pulmonary fibrosis, but the more prevalent view at present is that pulmonary fibrosis can occur directly regardless of lung inflammation. A recent hypothesis is that pathological pulmonary fibrosis occurs due to abnormal signaling systems in epithelial-mesenchymal interactions during wound healing. When epithelial cells are damaged, the apoptosis of epithelial cells increases, their migration is limited, their differentiation is uncontrolled, and their proliferation is inhibited, thus secreting soluble factors (TGF, HGF, KGF, angiotensin II, ROS, etc.), and the apoptosis of mesenchymal cells is inhibited together with ECM, resulting in increased differentiation of myofibroblasts, pulmonary fibrosis due to ECM deposition, or restimulation of epithelial cells. It cannot be said that lung inflammation directly leads to pulmonary fibrosis, but this means that due to the difference between IPF patients and normal people in the process of healing to restore normal tissue, lung inflammation occurs first, and then pulmonary fibrosis occurs. In addition, IPF can be induced by Th1 / Th2 cytokine imbalance. The Th1 cytokine response is associated with cell-mediated immunity, which restores damaged tissue areas to normal tissue, whereas the Th2 cytokine induces ECM deposition and fibrosis through the activation and proliferation of fibroblasts. It is reported that when IFN-γ is administered to a bleomycin-induced pulmonary fibrosis model, it can prevent pulmonary fibrosis by reducing the mRNA of TGF-β and procollagen. However, since the cause of pulmonary fibrosis is not exactly known, it is necessary to identify the initial pathogenic factor that leads to fibrosis, and to develop a substance that can inhibit IPF-related genes and the TGF-β signaling system.

[0021] IPF is known to continue to worsen without treatment, and about 50% or more of patients die within 3-5 years. In addition, once the disease has progressed and fully hardened to fibrosis, there is no improvement regardless of the treatment administered. For treatment, it is predicted that there is a high probability of effectiveness if administered at an early stage. Although a combination therapy of steroids with azathioprine or cyclophosphamide is a currently known treatment method, no significant effects are obtained therefrom, and several fibrosis inhibitors have been tried in animal experiments and a small number of patients, but none has been proven to be effective. In particular, for patients with advanced IPF, there is no effective treatment method other than lung transplantation. Therefore, there is an urgent need to develop a more effective therapeutic agent for IPF.

[0022] Fibrosis is a general term for a condition in which a tissue or organ is hardened due to excessive fibrosis of connective tissue for some reason, and all processes in which fibrosis occurs follow the same path as the scarring process, regardless of the area. To date, there have been few cures for fibrosis symptoms, and treatment methods are being developed and researched. An effective fibrosis therapeutic agent can not only be applied to typical fibrosis such as cirrhosis, liver fibrosis, myelofibrosis, myocardial fibrosis, kidney fibrosis, and lung fibrosis, but also to various diseases accompanied by fibrosis, and thus there is an urgent need to develop an effective therapeutic agent for fibrosis.

[0023] CTGF (connective tissue growth factor; CCN2) is a stromal cell protein belonging to the CCN family, and is a secreted cytokine known to be involved in multiple biological processes such as cell adhesion, migration, proliferation, angiogenesis, wound repair, etc., and overexpression of CTGF is considered a major cause of symptoms such as scleroderma, fibrotic diseases, and scarring (Brigstock DR. J. Cell Commun. Signal (2010) 4(1): 1-4). In particular, with respect to fibrotic diseases, it is known that CTGF plays a role in promoting the production of ECM (extracellular matrix) under conditions in which TGF-β growth factor-β is induced to continuously fibrosis, and in recent years, it is known that ocular disorders or muscular dystrophy caused by abnormal expression of CTGF can be treated using a sample or material that inhibits the expression or action of CTGF (U.S. Patent No. 7622454, U.S. Patent Application Publication No. 20120164151).

[0024] As described above, the technical development of RNAi therapeutic agents against CTGF and their delivery systems is still insufficient, and the market demand for double-stranded oligonucleotide therapeutic agents capable of specifically inhibiting CTGF expression with high efficiency and their delivery technology is very high.

[0025] Accordingly, the present inventors identified CTGF as a gene associated with respiratory diseases including COPD and fibrosis including IPF, selected a double-stranded oligonucleotide targeting CTGF, and verified an RNAi therapeutic agent capable of inhibiting the expression of CTGF and a delivery vehicle thereof, thereby finally arriving at the present application. SUMMARY

[0026] It is an object of the present application to provide a double-stranded oligonucleotide capable of inhibiting the expression of CTGF with high efficiency and high specificity, preferably a double-stranded oligonucleotide in the form of RNA / RNA, DNA / DNA, or DNA / RNA hybrid, most preferably a double-stranded oligonucleotide comprising a sequence in the form of DNA / RNA hybrid; a double-stranded oligonucleotide construct comprising the same; and a nanoparticle comprising the same.

[0027] It is another object of the present application to provide a pharmaceutical composition for preventing or treating respiratory diseases and fibrosis, the pharmaceutical composition comprising the double-stranded oligonucleotide, the double-stranded oligonucleotide construct, and / or the nanoparticle as an active ingredient.

[0028] It is still another object of the present application to provide a method of preventing or treating fibrosis or respiratory diseases, the method comprising administering the double-stranded oligonucleotide, the double-stranded oligonucleotide construct, and / or the nanoparticle to a subject in need of preventing or treating fibrosis or respiratory diseases.

[0029] It is yet another object of the present application to provide the double-stranded oligonucleotide, the double-stranded oligonucleotide construct comprising the same, and the nanoparticle comprising the same or the double-stranded oligonucleotide construct for use in preventing or treating fibrosis or respiratory diseases.

[0030] It is still yet another object of the present application to provide the pharmaceutical composition for use in preventing or treating fibrosis or respiratory diseases.

[0031] It is a further object of the present application to provide the double-stranded oligonucleotide, the double-stranded oligonucleotide construct comprising the same, and the nanoparticle comprising the same or the double-stranded oligonucleotide construct for use in the manufacture of a medicament for preventing or treating fibrosis or respiratory diseases.

[0032] To achieve the above object, the present application provides a double-stranded oligonucleotide comprising a sense strand comprising a sequence selected from any one of SEQ ID NOs: 1 to 16, preferably selected from any one of SEQ ID NOs: 1, 2, 10, and 15, more preferably SEQ ID NO: 10, and an antisense strand comprising a sequence complementary to the sequence.

[0033] Further, the present application provides a double-stranded oligonucleotide construct comprising the double-stranded oligonucleotide and a nanoparticle comprising the double-stranded oligonucleotide or the double-stranded oligonucleotide construct.

[0034] Further, the present application provides a pharmaceutical composition for preventing or treating fibrosis or a respiratory disease, the pharmaceutical composition comprising: a double-stranded oligonucleotide comprising a sense strand comprising a sequence selected from any one of SEQ ID NOs: 1 to 16, preferably selected from any one of SEQ ID NOs: 1, 2, 10, and 15, more preferably SEQ ID NO: 10, and an antisense strand comprising a sequence complementary to the sequence; a double-stranded oligonucleotide construct comprising the double-stranded oligonucleotide; and / or a nanoparticle comprising the double-stranded oligonucleotide or the double-stranded oligonucleotide construct.

[0035] Further, the present application provides a method of preventing or treating fibrosis or a respiratory disease, the method comprising administering the double-stranded oligonucleotide, the double-stranded oligonucleotide construct, and / or the nanoparticle to a subject in need of preventing or treating fibrosis or a respiratory disease.

[0036] Further, the present application provides a method of preventing or treating fibrosis or a respiratory disease, the method comprising administering the pharmaceutical composition for preventing or treating fibrosis or a respiratory disease to a subject in need of preventing or treating fibrosis or a respiratory disease.

[0037] The double-stranded oligonucleotide according to one aspect of the present application, the double-stranded oligonucleotide construct comprising the double-stranded oligonucleotide, and / or the nanoparticle comprising the double-stranded oligonucleotide or the double-stranded oligonucleotide construct can very effectively inhibit the expression of CTGF, and thus the double-stranded oligonucleotide according to the present application, the double-stranded oligonucleotide construct, and the nanoparticle can be used for preventing or treating fibrosis or a respiratory disease, the double-stranded oligonucleotide comprising a sense strand comprising a sequence selected from any one of SEQ ID NOs: 1 to 16, preferably selected from any one of SEQ ID NOs: 1, 2, 10, and 15, more preferably SEQ ID NO: 10, and an antisense strand comprising a sequence complementary to the sequence.

[0038] The sequences of SEQ ID NOs: 1, 2, 10, and 15 contained in the preferred double-stranded oligonucleotide provided to achieve the above object are as follows.

[0039] 5'-ATGTACAGTTATCTAAGTT-3' (SEQ ID NO: 1)

[0040] 5'-TGTACAGTTATCTAAGTTA-3' (SEQ ID NO: 2)

[0041] 5'-TGATTTCAGTAGCACAAGT-3' (SEQ ID NO: 10)

[0042] 5'-TCAGTAGCACAAGTTATTT-3' (SEQ ID NO: 15)

[0043] The double-stranded oligonucleotide according to the present application is understood to include any material having a general RNAi (RNA interference) effect, and it will be apparent to those skilled in the art to which the present application pertains that the mRNA-specific double-stranded oligonucleotide encoding the CTGF protein also includes a CTGF-specific shRNA. Simply, the oligonucleotide can be an siRNA, an shRNA, or an miRNA.

[0044] Further, it will be apparent to those skilled in the art that, as long as the specificity for CTGF is maintained, a CTGF-specific siRNA and an antisense oligonucleotide including a sense strand comprising a sequence in which at least one nucleotide is substituted, deleted, or inserted and an antisense strand thereof in a sense strand comprising any one sequence selected from the group consisting of SEQ ID NOs: 1, 2, 10, and 15 or in an antisense strand complementary to the sequence are also included in the scope of the present application.

[0045] In the present application, the sense strand and the antisense strand can each independently be DNA or RNA, and a hybrid form in which the sense strand is DNA and the antisense strand is RNA or in which the sense strand is RNA and the antisense strand is DNA can be used.

[0046] In the present application, SEQ ID NOs: 1, 2, 10, and 15 are described in the form of DNA, but when RNA is used, the sequence of SEQ ID NOs: 1, 2, 10, and 15 can be provided in the form of a corresponding RNA sequence in which T is changed to U.

[0047] In addition, the double-stranded oligonucleotide according to the present application not only includes a perfect match in which the sense strand of the sequence is 100% complementary to the binding site of the CTGF gene, but also includes a mismatch in which some nucleotide sequences do not match, as long as the specificity for CTGF is maintained.

[0048] The double-stranded oligonucleotides according to the invention may comprise single-stranded overhang structures, wherein one or more unpaired nucleotides are provided at the 3' end of one or both strands.

[0049] In this invention, the sense strand or antisense strand preferably consists of 19 to 31 nucleotides, but the invention is not limited thereto.

[0050] In this invention, a double-stranded oligonucleotide comprising a sense strand containing any one of the sequences selected from SEQ ID NO: 1, 2, 10 and 15 and an antisense strand containing a sequence complementary to it is specific for CTGF (connective tissue growth factor), but the invention is not limited thereto.

[0051] In this invention, the sense or antisense strand of the double-stranded oligonucleotide contains any chemical modifications to improve in vivo stability or confer nuclease resistance and reduce nonspecific immune responses. The chemical modification may include, but is not limited to, at least one of the following: a modification in which the hydroxyl group (-OH) at the 2' carbon position of the sugar structure in the nucleotide is substituted by any one of methyl (-CH3), methoxy (-OCH3), amine (-NH2), fluorine (-F), O-2-methoxyethyl, O-propyl, O-2-methylthioethyl, O-3-aminopropyl, O-3-dimethylaminopropyl, ON-methylacetamido, and O-dimethylamidooxyethyl; a modification in which the oxygen in the sugar structure of the nucleotide is substituted by sulfur; a modification in which the nucleotide bond is any one of thiophosphate bond, borane phosphate bond, and methylphosphonate bond; a modification as PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid); and a modification in the form of a DNA-RNA hybrid (Ann. Rev. Med. 55, 61-65 2004; US 5,660,985; US 5,958,691; US ​​6,531,584; US 5,808,023; US 6,326,358; US 6,175,001; Bioorg.Med.Chem.Lett.14:1139-1143,2003; RNA,9:1034-1048,2003; Research, 38(17)5761-773, 2010; Nucleic Acids Research, 39(5):1823-1832, 2011).

[0052] In this invention, at least one phosphate ester group, preferably one to three phosphate ester groups, may be attached to the 5' end of the antisense strand of the double-stranded oligonucleotide.

[0053] Another aspect of the present application relates to a double-stranded oligonucleotide construct having a structure of the following structural formula (1), wherein A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is a double-stranded oligonucleotide.

[0054] Structural formula (1)

[0055] A-X-R-Y-B

[0056] In a preferred embodiment, the double-stranded oligonucleotide construct comprising a CTGF-specific sequence according to the present application has a structure of the following structural formula (1).

[0057] Structural formula (1)

[0058] A-X-R-Y-B

[0059] In structural formula (1), A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is a CTGF-specific double-stranded oligonucleotide.

[0060] The double-stranded oligonucleotide according to the present application is preferably in the form of a DNA-RNA hybrid, siRNA (short interfering RNA), shRNA (short hairpin RNA), or miRNA (micro RNA), but is not limited thereto, and also includes a single-stranded miRNA inhibitor acting as an miRNA antagonist.

[0061] Hereinafter, the double-stranded oligonucleotide according to the present application will be described based on RNA, but it will be apparent to those skilled in the art that this can also be applied to other double-stranded oligonucleotides (e.g., DNA / RNA hybrid) having the same properties as the double-stranded oligonucleotide of the present application.

[0062] More preferably, the double-stranded oligonucleotide construct comprising a CTGF-specific double-stranded oligonucleotide according to the present application has a structure of the following structural formula (2).

[0063] Structural formula (2)

[0064] A-X-S-Y-B

[0065] AS

[0066] In structural formula (2), A, B, X, and Y are as defined in structural formula (1), S represents a sense strand of a CTGF-specific nucleotide sequence, and AS represents an antisense strand of a CTGF-specific double-stranded oligonucleotide.

[0067] More preferably, the double-stranded oligonucleotide construct comprising a CTGF-specific double-stranded oligonucleotide has a structure of the following structural formula (3) or (4).

[0068] Structure (3)

[0069] A-X-5'S 3'-Y-B

[0070] AS

[0071] Structure (4)

[0072] A-X-3'S S'-Y-B

[0073] AS

[0074] In Structure (3) and Structure (4), A, B, S, AS, X and Y are as defined in Structure (2), and 5' and 3' respectively indicate the 5' end and 3' end of the sense strand of the CTGF-specific double-stranded oligonucleotide.

[0075] The hydrophilic material can be selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone and polyoxazoline, but is not limited thereto.

[0076] It will be apparent to those skilled in the art that, in the double-stranded oligonucleotide construct containing the CTGF-specific double-stranded oligonucleotide according to Structure (1) to Structure (4), one to three phosphate groups can be bound to the 5' end of the antisense strand, and shRNA can be used instead of RNA.

[0077] The hydrophilic material in Structure (1) to Structure (4) is preferably a polymeric material having a molecular weight of 200 to 10,000, and more preferably a polymeric material having a molecular weight of 1,000 to 2,000. For example, the hydrophilic polymeric material can be a non-ionic hydrophilic polymeric compound such as polyethylene glycol, polyvinylpyrrolidone, polyoxazoline, etc., but is not necessarily limited thereto.

[0078] In particular, the hydrophilic material (A) in Structure (1) to Structure (4) can be used in the form of a hydrophilic material block represented by the following Structure (5) or Structure (6). When these hydrophilic material blocks are used in an appropriate amount (n in Structure (5) or Structure (6)) as needed, problems that can occur in the case of using general synthetic polymeric materials due to polydispersity can be greatly alleviated.

[0079] Structure (5)

[0080] (A' m -J) n

[0081] Structure (6)

[0082] (J-A' m ) n

[0083] In Structural Formula (5), A' is a hydrophilic material monomer, J is a linker that connects m number of hydrophilic material monomers to each other or connects m number of hydrophilic material monomers and an oligonucleotide to each other, m is an integer of 1 to 15, n is an integer of 1 to 10, and (A' m -J) or (J-A' m ) represents a repeating unit of the hydrophilic material block.

[0084] When the hydrophilic material block represented by Structural Formula (5) or Structural Formula (6) is provided, the double-stranded oligonucleotide construct containing a CTGF-specific double-stranded oligonucleotide according to the present application can have a structure of the following Structural Formula (7) or Structural Formula (8).

[0085] Structural Formula (7)

[0086] (A' m -J) n -X-R-Y-B

[0087] Structural Formula (8)

[0088] (J-A' m ) n -X-R-Y-B

[0089] In Structural Formula (7) and Structural Formula (8), X, R, Y, and B are as defined in Structural Formula (1), and A', J, m, and n are as defined in Structural Formula (5) and Structural Formula (6).

[0090] In Structural Formula (5) and Structural Formula (6), among the monomers of the non-ionic hydrophilic polymer, any hydrophilic material monomer (A') can be used without limitation as long as it satisfies the purpose of the present application. Preferably, a monomer selected from the compounds (1) or (3) shown in Table 1 below is used, more preferably a monomer of the compound (1), and G in the compound (1) is preferably selected from O, S, and NH.

[0091] In particular, among the hydrophilic material monomers, the monomer represented by the compound (1) can be introduced into various functional groups, can exhibit excellent biocompatibility such as having good in vivo affinity and inducing a less immune response, and can have the advantage of increasing the in vivo stability of the double-stranded oligonucleotide contained in the construct according to Structural Formula (7) or Structural Formula (8) and increasing the delivery efficiency, and thus it is very suitable for producing the construct according to the present application.

[0092] [Table 1]

[0093] Structure of the hydrophilic material monomer in the present application

[0094]

[0095] The hydrophilic material in structural formula (5) to structural formula (8) preferably has a total molecular weight in the range of 1,000 to 2,000. Thus, for example, in structural formula (7) and structural formula (8), when using hexaethylene glycol according to compound (1) (i.e., a material in which G is O and m is 6), the molecular weight of the hexaethylene glycol spacer is 344, and thus the number of repetitions (n) is preferably 3 to 5. In particular, as needed, structural formula (5) and structural formula (6) can be used with an appropriate number of repetitions denoted by n, using different hydrophilic material monomers for each hydrophilic material block. For example, when using three hydrophilic material blocks (n = 3), different hydrophilic material monomers can be used for the respective hydrophilic material blocks, such as, for example, a hydrophilic material monomer according to compound (1) for the first block, a hydrophilic material monomer according to compound (2) for the second block, and a hydrophilic material monomer according to compound (3) for the third block, or alternatively, any one of the hydrophilic material monomers selected from compounds (1) or (3) can be used equally for all of the hydrophilic material blocks. Likewise, as the linker mediating the binding of the hydrophilic material monomers, the same or different linkers can be used for the hydrophilic material blocks. In addition, as the number of hydrophilic material monomers, m, can be the same or different between the hydrophilic material blocks. In particular, different numbers of hydrophilic material monomers can be used in such a way that three hydrophilic material monomers are linked (m = 3) in the first hydrophilic material block, five hydrophilic material monomers are linked (m = 5) in the second hydrophilic material block, and four hydrophilic material monomers are linked (m = 4) in the third hydrophilic material block, or alternatively, the same number of hydrophilic material monomers can be used for all of the hydrophilic material blocks. m -J) n or a repeating unit of a hydrophilic group represented by (J-A' m ) n denotes a hydrophilic material block (i.e., a repeating unit of a hydrophilic group). The hydrophilic material monomer A and the linker J included in each hydrophilic material block can be independently the same or different between the hydrophilic material blocks. Specifically, when using three hydrophilic material blocks (n = 3), different hydrophilic material monomers can be used for the respective hydrophilic material blocks, such as, for example, a hydrophilic material monomer according to compound (1) for the first block, a hydrophilic material monomer according to compound (2) for the second block, and a hydrophilic material monomer according to compound (3) for the third block, or alternatively, any one of the hydrophilic material monomers selected from compounds (1) or (3) can be used equally for all of the hydrophilic material blocks. Likewise, as the linker mediating the binding of the hydrophilic material monomers, the same or different linkers can be used for the hydrophilic material blocks. In addition, as the number of hydrophilic material monomers, m, can be the same or different between the hydrophilic material blocks. In particular, different numbers of hydrophilic material monomers can be used in such a way that three hydrophilic material monomers are linked (m = 3) in the first hydrophilic material block, five hydrophilic material monomers are linked (m = 5) in the second hydrophilic material block, and four hydrophilic material monomers are linked (m = 4) in the third hydrophilic material block, or alternatively, the same number of hydrophilic material monomers can be used for all of the hydrophilic material blocks.

[0096] In addition, in the present application, the linker (J) is preferably selected from -PO3 - -, -SO3-, and -CO2-, but is not limited thereto. It will be clear to those skilled in the art that, depending on the monomer of the hydrophilic material used, any linker can be used as long as it satisfies the purpose of the present application.

[0097] The hydrophobic material (B) in Structural Formula (1) to Structural Formula (4) and Structural Formula (7) and Structural Formula (8) is used to form a nanoparticle composed of the double-stranded oligonucleotide construct according to Structural Formula (1) to Structural Formula (4) and according to Structural Formula (7) and Structural Formula (8) by hydrophobic interaction. The hydrophobic material preferably has a molecular weight of 250 to 1,000, and examples thereof can include, but are not limited to, a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, C 12 to C 50 an unsaturated or saturated hydrocarbon, a diacylphosphatidylcholine, a fatty acid, a phospholipid, a lipopolyamine, etc. It will be apparent to those skilled in the art that any hydrophobic material can be used as long as it satisfies the purpose of the present application.

[0098] The steroid derivative can be selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanol formate, and choline, and the glyceride derivative can be selected from the group consisting of monoglyceride, diglyceride, and triglyceride. Here, the fatty acid of the glyceride is preferably C 12 to C 50 an unsaturated or saturated fatty acid.

[0099] In particular, among the examples of the hydrophobic material, the saturated or unsaturated hydrocarbon or cholesterol is preferred in that it facilitates binding in the synthesis step of the double-stranded oligonucleotide construct according to the present application, and C 24 A hydrocarbon, in particular, a form including a disulfide bond, is most preferred.

[0100] The hydrophobic material is bound to the distal end of the hydrophilic material, and can be bound to any position on the sense strand or the antisense strand of the siRNA.

[0101] The CTGF-specific double-stranded oligonucleotide and the hydrophilic or hydrophobic material in Structural Formula (1) to Structural Formula (4) and Structural Formula (7) and Structural Formula (8) according to the present application are bound by a simple covalent bond or a covalent bond mediated by a linker (X or Y). The linker mediating the covalent bond is covalently bound to the hydrophilic material or the hydrophobic material at the terminal end of the CTGF-specific double-stranded oligonucleotide, and is not particularly limited as long as it provides a bond that is degradable in a certain environment as needed. Thus, the linker can be any compound that is bound to activate the CTGF-specific double-stranded oligonucleotide and / or the hydrophilic material (or the hydrophobic material) during the production of the double-stranded oligonucleotide construct according to the present application. The covalent bond can be a non-degradable bond or a degradable bond. Here, the non-degradable bond includes an amide bond or a phosphate ester bond, and the degradable bond includes a disulfide bond, an acid-degradable bond, an ester bond, an acid anhydride bond, a biodegradable bond, or an enzyme-degradable bond, but the present application is not limited thereto.

[0102] Further, the CTGF-specific double-stranded oligonucleotide represented by R (or S and AS) in Structural Formula (1) to Structural Formula (4) and Structural Formula (7) and Structural Formula (8) can be used without limitation as long as it is a double-stranded oligonucleotide capable of specifically binding to the mRNA of CTGF. Preferably, in the present application, the CTGF-specific double-stranded oligonucleotide consists of a sense strand comprising any one sequence selected from the group consisting of SEQ ID NO: 1, 2, 10, and 15, and an antisense strand comprising a sequence complementary to the sequence.

[0103] In the double-stranded oligonucleotide construct comprising the CTGF-specific double-stranded oligonucleotide according to the present application, an amine group or a polyhistidine group can be additionally introduced at the end of the hydrophilic material opposite to the end to which the oligonucleotide is bound.

[0104] This facilitates intracellular introduction of the carrier and endosomal escape of the double-stranded oligonucleotide construct comprising the CTGF-specific double-stranded oligonucleotide according to the present application, and the introduction of an amine group and the use of a polyhistidine group and their effects have been reported in order to facilitate intracellular introduction and endosomal escape of carriers such as quantum dots, dendrimers, and liposomes.

[0105] Specifically, it is known that a primary amine group modified at the end or outside of the carrier forms a conjugate with a negatively charged gene through electrostatic interaction, while being protonated at the in vivo pH, and it is also known that the carrier can be protected from lysosomal degradation because, after intracellular introduction, endosomal escape is facilitated due to the buffering effect of the internal tertiary amine at the low pH of the endosome (Gene transfer and expression inhibition using polymer-based hybrid material. Polymer Sci. Technol., Vol. 23, No. 3, pp. 254-259).

[0106] It is known that histidine, which is a non-essential amino acid, has an imidazole ring (pK R 6.04) at the residue (-R), and thus increases the buffering capacity in endosomes and lysosomes, and thus histidine modification can be used to increase the endosomal escape efficiency in non-viral gene carriers, including liposomes (Novel histidine-conjugated galactosylated cationic liposomes for efficient hepatocyte selective gene transfer in human hepatoma HepG2 cells. J. Controlled Release 118, pp. 262-270).

[0107] The amine group or the polyhistidine group can be linked to the hydrophilic material or the hydrophilic material block via at least one linker.

[0108] When the amine group or the polyhistidine group is introduced into the hydrophilic material of the double-stranded oligonucleotide construct according to Structural Formula (1) of the present application, a structure represented by the following Structural Formula (9) can be provided.

[0109] Structural Formula (9)

[0110] P-J1-J2-A-X-R-Y-B

[0111] In Structural Formula (9), A, B, R, X, and Y are as defined in Structural Formula (1).

[0112] In addition, P is an amine group or a polyhistidine group, and J1and J2are linkers. Here, J1and J2may be independently selected from a simple covalent bond, PO3 - , SO3, CO2, C 2-12 alkyl, alkenyl, and alkynyl, but are not limited thereto, and it will be apparent to those skilled in the art that, depending on the hydrophilic material used, any linker can be used as J1and J2that satisfies the purpose of the present application.

[0113] When the amine group is introduced, it is preferable that J2is a simple covalent bond or PO3 - , and J1is C6alkyl, but the present application is not limited thereto.

[0114] In addition, when the polyhistidine group is introduced, in Structural Formula (9), it is preferable that J2is a simple covalent bond or PO3 - , and J1is Compound (4), but the present application is not limited thereto.

[0115] Compound (4)

[0116]

[0117] Further, when the hydrophilic material of the double-stranded oligonucleotide construct according to Structural Formula (9) is a hydrophilic material block according to Structural Formula (5) or Structural Formula (6) and an amine group or a polyhistidine group is introduced thereto, a structure represented by the following Structural Formula (10) or Structural Formula (11) can be provided.

[0118] Structural Formula (10)

[0119] P-J1-J2-(A' m -J) n -X-R-Y-B

[0120] Structural Formula (11)

[0121] P-J1-J2-(J-A' m ) n -X-R-Y-B

[0122] In Structural Formula (10) and Structural Formula (11), X, R, Y, B, A', J, m, and n are as defined in Structural Formula (5) or Structural Formula (6), and P, J1, and J2 are as defined in Structural Formula (9).

[0123] In particular, in Structural Formula (10) and Structural Formula (11), the hydrophilic material is preferably in the form of binding to the 3' end of the sense strand of the CTGF-specific double-stranded oligonucleotide. Here, Structural Formula (9) to Structural Formula (11) can be represented by the following Structural Formula (12) to Structural Formula (14).

[0124] Structural Formula (12)

[0125] P-J1-J2-A-X-3'S 5'-Y-B

[0126] AS

[0127] Structural Formula (13)

[0128] P-J1-J2-(A' m -J) n -X-3'S 5'-Y-B

[0129] AS

[0130] Structural Formula (14)

[0131] P-J1-J2-(J-A' m ) n -X-3'S 5'-Y-B

[0132] AS

[0133] In Structural Formula (12) to Structural Formula (14), X, R, Y, B, A, A', J, m, n, P, J1, and J2 are as defined in Structural Formula (9) to Structural Formula (11), and 5' and 3' represent the 5' end and the 3' end of the sense strand of the CTGF-specific double-stranded oligonucleotide, respectively.

[0134] The amine group that can be introduced in the present application can include a primary amine group to a tertiary amine group, and a primary amine group is particularly preferred. The introduced amine group can be provided in the form of an amine salt, and the salt of the primary amine group can be provided in the form of, for example, NH3 + .

[0135] Further, the polyhistidine group that can be introduced in the present application can comprise 3 to 10 histidines, preferably 5 to 8 histidines, most preferably 6 histidines. Further, at least one cysteine can be included in addition to the histidines.

[0136] Meanwhile, when a targeting moiety is provided to the double-stranded oligonucleotide construct comprising the CTGF-specific double-stranded oligonucleotide according to the present application and the nanoparticle formed therefrom, efficient delivery to target cells can be facilitated, and thus, it can be delivered to the target cells even at a relatively low concentration, thereby exhibiting a strong effect of modulating target gene expression and preventing non-specific delivery of the CTGF-specific double-stranded oligonucleotide to other organs and cells.

[0137] Accordingly, the present application provides a double-stranded oligo RNA construct in which a ligand (L), in particular a ligand that specifically binds to a receptor that facilitates internalization into a target cell by receptor-mediated endocytosis (RME), is additionally bound to the construct according to Structural Formula (1) to Structural Formula (4) and according to Structural Formula (7) and Structural Formula (8). For example, a form in which a ligand is bound to a double-stranded oligo RNA construct according to Structural Formula (1) has the structure of the following Structural Formula (15).

[0138] Structural Formula (15)

[0139] (L i -Z)-A-X-R-Y-B

[0140] In Structural Formula (15), A, B, X, and Y are as defined in Structural Formula (1), L is a ligand that specifically binds to a receptor that facilitates internalization into a target cell by receptor-mediated endocytosis (RME), and i is an integer of 1 to 5, preferably an integer of 1 to 3.

[0141] The ligand in Structural Formula (15) is preferably selected from the group consisting of a target receptor-specific antibody, an aptamer, and a peptide having RME characteristics that facilitate specific cellular internalization into a target cell; and a chemical substance including a hexosamine such as N-acetylgalactosamine (NAG) and a sugar or a carbohydrate such as glucose and mannose, but is not limited thereto.

[0142] In addition, the hydrophilic material A in Structural Formula (15) can be used in the form of a hydrophilic material block according to Structural Formula (5) and Structural Formula (6).

[0143] Still another aspect of the present application relates to a method of producing a double-stranded oligonucleotide construct comprising a CTGF-specific double-stranded oligonucleotide.

[0144] Methods for generating double-stranded oligonucleotide constructs comprising CTGF-specific double-stranded oligonucleotides according to the present invention include, for example:

[0145] (1) Integrating hydrophilic materials into solid supports;

[0146] (2) Synthesize single-chain oligonucleotides on a solid support incorporating the hydrophilic material;

[0147] (3) Covalently attach hydrophobic material to the 5' end of the single-stranded oligonucleotide;

[0148] (4) Synthesize a single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide;

[0149] (5) After synthesis, the oligonucleotide / polymer construct and the single-chain oligonucleotide are isolated and purified from the solid support; and

[0150] (6) A double-stranded oligonucleotide construct is generated by annealing the oligonucleotide / polymer construct and the single-stranded oligonucleotide having a complementary sequence.

[0151] The solid support in this invention is preferably porous glass (CPG), but is not limited to it, and polystyrene (PS), polymethyl methacrylate (PMMA), silica gel, cellulose paper, etc., can also be used. The CPG preferably has a diameter of 40 μm to 180 μm and... to The pore size. After step (5), the molecular weight of the purified RNA / polymer construct and single-stranded oligonucleotide is measured using a MALDI-TOF mass spectrometer to determine whether the desired oligonucleotide / polymer construct and single-stranded oligonucleotide have been generated. In the above generation method, step (4), which synthesizes single-stranded oligonucleotides having a sequence complementary to the sequence of the single-stranded oligonucleotide synthesized in step (2), can be performed before step (1) or during any of steps (1) to (5).

[0152] In addition, single-chain oligonucleotides having a sequence complementary to the sequence of the single-chain oligonucleotide synthesized in step (2) can be used in the form of a phosphate ester group attached to the 5' end.

[0153] Additionally, a method for generating a double-stranded oligonucleotide construct is provided, wherein a ligand is further bound to a double-stranded oligonucleotide construct comprising a CTGF-specific double-stranded oligonucleotide according to the present invention.

[0154] Methods for generating ligand-binding double-stranded oligonucleotide constructs containing CTGF-specific double-stranded oligonucleotides include, for example:

[0155] (1) Integrating hydrophilic materials into solid supports containing functional groups;

[0156] (2) synthesizing a single-stranded oligonucleotide on a solid support combined with a functional group and a hydrophilic material;

[0157] (3) covalently binding a hydrophobic material to the 5' end of the single-stranded oligonucleotide;

[0158] (4) synthesizing a single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide synthesized in step (3);

[0159] (5) separating the functional group / oligonucleotide / polymer construct and the single-stranded oligonucleotide having a complementary sequence from the solid support after completion of the synthesis;

[0160] (6) producing a ligand / oligonucleotide / polymer construct in a single-stranded form by binding a ligand to the end of the hydrophilic material using the functional group; and

[0161] (7) producing a ligand / double-stranded oligonucleotide construct by annealing the ligand / oligonucleotide / polymer construct and the single-stranded oligonucleotide having a complementary sequence.

[0162] After step (6), the produced ligand / oligonucleotide / polymer construct and the single-stranded oligonucleotide having a complementary sequence are separated and purified, and then their molecular weights are measured using a MALDI-TOF mass spectrometer to determine whether the desired ligand / oligonucleotide / polymer construct and the complementary oligonucleotide are produced. The ligand / double-stranded oligonucleotide construct can be produced by annealing the ligand / oligonucleotide / polymer construct and the single-stranded oligonucleotide having a complementary sequence. In the above production method, step (4) of synthesizing a single-stranded oligonucleotide having a sequence complementary to the sequence of the single-stranded oligonucleotide synthesized in step (3) can be an independent synthesis process, and can be performed before step (1) or during any one of steps (1) to (6).

[0163] Yet another aspect of the present application relates to a nanoparticle comprising the double-stranded oligonucleotide construct according to the present application. The double-stranded oligonucleotide construct according to the present application forms a self-assembled nanoparticle through hydrophobic interaction of the hydrophobic material (Korean Patent No. 1224828). These nanoparticles not only have extremely excellent in vivo delivery efficiency and in vivo stability, but also have excellent particle size uniformity, which facilitates quality control (QC), thereby simplifying the process of manufacturing a drug.

[0164] In the present application, the nanoparticles can be characterized in that the double-stranded oligonucleotide construct comprising double-stranded oligonucleotides having different sequences is mixed. In one embodiment, the nanoparticles can comprise one type of CTGF-specific double-stranded oligonucleotide comprising a sense strand comprising a sequence selected from any one of SEQ ID NOs: 1, 2, 10, and 15, and an antisense strand comprising a sequence complementary to the sequence, and in another embodiment, the nanoparticles can comprise different types of CTGF-specific double-stranded oligonucleotide comprising a sense strand comprising a sequence selected from any one of SEQ ID NOs: 1, 2, 10, and 15, and an antisense strand comprising a sequence complementary to the sequence, and can further comprise a CTGF-specific double-stranded oligonucleotide not disclosed in the present application.

[0165] Still another aspect of the present application relates to a pharmaceutical composition for preventing or treating fibrosis or a respiratory disease, containing the double-stranded oligonucleotide, the double-stranded oligonucleotide construct, or the nanoparticle according to the present application as an active ingredient.

[0166] The pharmaceutical composition for preventing or treating fibrosis or a respiratory disease according to the present application inhibits connective tissue remodeling, particularly pulmonary arterial remodeling and airway remodeling, and thus is effective in preventing or treating fibrosis or a respiratory disease.

[0167] In the present application, the respiratory disease can be chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, expectorant cough, bronchitis, bronchiolitis, laryngitis, tonsillitis, or laryngitis, and the fibrosis can be selected from idiopathic pulmonary fibrosis (IPF), liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis, but the present application is not limited thereto. In the present application, radiation-induced fibrosis is a side effect generally induced by radiotherapy commonly used to treat cancer, tumors, etc., and the radiation-induced fibrosis can be used interchangeably with radiation fibrosis syndrome (RFS).

[0168] In addition to the active ingredients described above for administration, the composition of the present application can be prepared by including at least one pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier must be compatible with the active ingredients of the present application, and can include saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, and ethanol, which can be used alone or in the form of a combination of two or more thereof. Other typical additives such as antioxidants, buffers, and bacteriostats can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to form an injectable formulation such as an aqueous solution, a suspension, an emulsion, etc. In particular, it is preferable to provide a lyophilized formulation. To prepare a lyophilized formulation, methods generally known in the art to which the present application pertains can be used, and stabilizers for lyophilization can be added. Preferably, the formulation can be prepared according to an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton, PA) according to each disease or component.

[0169] The type of the composition of the present application can be determined by a person skilled in the art based on the symptoms of a typical patient and the severity of the disease. In addition, the composition can be formulated in various forms such as a powder, a tablet, a capsule, a solution, an injection, an ointment, a syrup, etc., and can be provided in a unit dose or a multiple dose container (e.g., a sealed ampoule and a bottle).

[0170] The composition of the present application can be administered orally or parenterally. The administration route of the composition according to the present application is not limited thereto, and can be administered orally, inhaled, intravenously, intramuscularly, intra-arterially, intramedullary, intradurally, intracardially, transdermally, subcutaneously, intraperitoneally, enterally, sublingually, or topically, for example. In particular, for the treatment of respiratory diseases, it can also be administered to the lung by intrabronchial instillation. The dose of the composition according to the present application varies depending on the body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, disease severity, etc. of the patient, and can be easily determined by a person skilled in the art. In addition, the composition of the present application can be formulated into a suitable dosage form for clinical administration using known techniques.

[0171] Still another aspect of the present application relates to a lyophilized formulation comprising the pharmaceutical composition according to the present application.

[0172] Another aspect of the present application relates to a method of preventing or treating fibrosis or a respiratory disease, the method comprising administering the pharmaceutical composition for preventing or treating fibrosis or a respiratory disease according to the present application to a subject in need of preventing or treating fibrosis or a respiratory disease.

[0173] In this invention, the respiratory disease may be chronic obstructive pulmonary disease (COPD), asthma, acute and chronic bronchitis, allergic rhinitis, expectorant cough, bronchitis, bronchiolitis, pharyngitis, tonsillitis, or laryngitis, and the fibrosis may be idiopathic pulmonary fibrosis (IPF), cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, liver fibrosis, or radiation-induced fibrosis, but this invention is not limited thereto.

[0174] Another aspect of the present invention relates to the use of double-stranded oligonucleotides, double-stranded oligonucleotide constructs comprising said double-stranded oligonucleotides, and nanoparticles comprising said double-stranded oligonucleotides for the prevention or treatment of fibrosis or respiratory diseases.

[0175] Another aspect of the invention relates to the use of the pharmaceutical composition for the prevention or treatment of fibrosis or respiratory diseases.

[0176] Another aspect of the present invention relates to the use of the double-stranded oligonucleotide, a double-stranded oligonucleotide construct comprising the double-stranded oligonucleotide, and nanoparticles comprising the double-stranded oligonucleotide or the double-stranded oligonucleotide construct for the prevention or treatment of fibrosis or respiratory diseases.

[0177] The present invention also relates to a method for preventing or treating fibrosis or respiratory diseases, the method comprising administering the double-stranded oligonucleotide, the double-stranded oligonucleotide construct, and / or the nanoparticles to a subject who requires prevention or treatment of fibrosis or respiratory diseases.

[0178] The present invention also relates to the use of the double-stranded oligonucleotide, a double-stranded oligonucleotide construct comprising the double-stranded oligonucleotide, and nanoparticles comprising the double-stranded oligonucleotide or the double-stranded oligonucleotide construct in the manufacture of a medicament for the prevention or treatment of fibrosis or respiratory diseases. Attached Figure Description

[0179] Figure 1 The results of screening 1,162 SAMiRNAs targeting human CTGF are shown, including the results of quantitative analysis of CTGF mRNA expression levels in Example 3;

[0180] Figure 2is a graph showing the results of quantitative analysis of the mRNA expression level of CTGF in Example 4, wherein the relative mRNA expression level (%) of CTGF was determined after treating lung cancer cell line A549 with SAMiRNAs having each of the sequences of SEQ ID NOs: 1, 2, 10, and 15 of the present application as a sense strand at different concentrations (50 nM, 100 nM, 200 nM, 500 nM, and 1000 nM);

[0181] Figure 3 is a graph showing the results of quantitative analysis of the mRNA expression level of CTGF in Example 4, wherein the IC 50 value of SAMiRNAs was determined by analyzing the relative mRNA expression level (%) of CTGF after treating lung cancer cell line A549 with different concentrations of SAMiRNAs having the sequence of SEQ ID NO: 10 of the present application as a sense strand;

[0182] Figure 4 is a graph showing the results of quantitative analysis of the mRNA expression level of CTGF in Example 4, wherein the IC 50 value of SAMiRNAs was determined by analyzing the relative mRNA expression level (%) of CTGF after treating lung cancer cell line A549 with different concentrations of SAMiRNAs having each of the sequence of SEQ ID NO: 10 of the present application and the sequence of Rxi-109 as a sense strand;

[0183] Figure 5 is a graph showing the results of quantitative analysis of the mRNA expression level of CTGF in Example 5, wherein the relative mRNA expression level (%) of CTGF was analyzed using double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids containing selected CTGF-specific SAMiRNAs, and the relative mRNA expression level (%) of CTGF was determined after treating lung cancer cell line A549 with SAMiRNAs having the sequence of SEQ ID NO: 10 of the present application as a sense strand at different concentrations (200 nM and 600 nM);

[0184] Figure 6 shows the results of screening 94 SAMiRNAs targeting rat CTGF, and the effects of 12 candidate sequences selected therefrom;

[0185] Figure 7is a graph showing the results of quantitative analysis of mRNA expression levels of rat CTGF in Example 6, wherein the relative mRNA expression levels (%) of rat CTGF were determined after treating rat hepatoma cell line H4-II-E with SAMiRNAs having each of 12 selected candidate sequences including the sequences of SEQ ID NOs: 46, 47, and 48 of the present application as a sense strand at different concentrations (200 nM and 500 nM);

[0186] Figure 8 is a graph showing the results of quantitative analysis of mRNA expression levels of rat CTGF in Example 6, wherein the IC values of SAMiRNAs having each of the sequences of SEQ ID NOs: 46, 47, and 48 of the present application as a sense strand were determined by analyzing the relative mRNA expression levels (%) of rat CTGF after treating rat hepatoma cell line H4-II-E with SAMiRNAs at different concentrations (25 nM, 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM); 50

[0187] Figure 9 is a graph showing the results of quantitative analysis of mRNA expression levels of rat CTGF in Example 6, wherein the relative mRNA expression levels (%) of rat CTGF were analyzed using double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids containing selected SAMiRNAs specific for rat CTGF, and the relative mRNA expression levels (%) of rat CTGF were determined after treating hepatoma cell line H4-II-E with SAMiRNAs having each of the sequences of SEQ ID NOs: 46, 47, and 48 of the present application as a sense strand at different concentrations (200 nM and 600 nM); and

[0188] Figure 10 is a graph showing the results of real-time PCR analysis of skin tissues after intradermally administering 1200 μg of each of SAMiRNA-rCTGF(D / R) #46 and SAMiRNA-rCTGF(R / R) #46 to a wound-induced keloid model mouse in Example 7, and the relative mRNA expression levels (%) of the target gene CTGF. DETAILED DESCRIPTION

[0189] A better understanding of the present application can be obtained from the following examples. It will be apparent to those skilled in the art that these examples are intended to be illustrative only and are not to be construed as limiting the scope of the present application. Therefore, the true scope of the present application is defined by the appended claims and their equivalents.

[0190] ​In the present invention, it was confirmed that specific sequences capable of inhibiting the expression of CTGF were finally determined, and the expression of CTGF was effectively inhibited by the complementary binding of the sequences to mRNA encoding CTGF, thereby effectively treating fibrosis and respiratory diseases.

[0191] Example 1. Algorithm for screening of SAMiRNA for targeting CTGF and selection of candidate sequences

[0192] The high-throughput screening of SAMiRNA-based drugs is a method of generating all possible candidate sequences by applying a 1-base or 2-base sliding window algorithm to the entire mRNA sample, removing unnecessary candidate sequences by performing homology filtering, and determining the degree of inhibition of the expression of the corresponding gene by all finally selected SAMiRNAs.

[0193] The design method of SAMiRNA candidate sequences for CTGF was performed in such a manner that a 2-base sliding window algorithm was applied to NM_001901.2 (2,358 bp, which is a human CTGF mRNA), thereby finally selecting 1,162 SAMiRNA candidate sequences each consisting of 19 nucleotides, and evaluating the degree of inhibition of CTGF thereby.

[0194] Example 2. Synthesis of double-stranded oligo RNA construct

[0195] The double-stranded oligo RNA construct (SAMiRNA) produced in the present invention has a structure according to the following structural formula.

[0196] C 24 -5’s 3’-(hexaethylene glycol-PO 4- )3-hexaethylene glycol

[0197] AS 5′-PO4

[0198] The sense strand of the single SAMiRNA (n=4) double-stranded oligo construct was synthesized in such a manner that three dimethoxytrityl (DMT) hexaethylene glycol aminophosphates, which are monomers of a hydrophilic material, were sequentially bound by the above reaction using 3,4,6-triacetyl-1-hexa(ethylene glycol)-N-acetylgalactosamine-CPG as a support, RNA or DNA synthesis was performed, and then C 24 (C6-S-S-C 18 ) containing a disulfide bond, which is a hydrophobic material, was bound to the 5' end, thereby obtaining the sense strand of the single SAMiRNA (n=4), in which NAG-hexaethylene glycol-(-PO3 - hexaethylene glycol)3 was bound to the 3' end, and C 24 (C6-S-S-C 18) binds to the 5' end.

[0199] After completion of the synthesis, the synthesized single-stranded RNA and oligo(DNA or RNA) / polymer construct were separated from the CPG using 28% (v / v) ammonia in a water bath at 60°C, followed by a deprotection reaction to remove the protective residues. After removing the protective residues, the single-stranded RNA and oligo(DNA or RNA) / polymer construct were treated with N-methylpyrrolidone, triethylamine, and triethylamine trihydrofluoride at a volume ratio of 10:3:4 in an oven at 70°C to remove the 2'-dimethylsilyl group. The single-stranded RNA, oligo(DNA or RNA) / polymer construct, and ligand-bound oligo(DNA or RNA) / polymer construct were separated from the reaction product by high-performance liquid chromatography (HPLC), and their molecular weights were measured using a TOF mass spectrometer (MALDI TOF-MS, SHIMADZU, Japan) to determine whether they matched the nucleotide sequence and oligo / polymer construct to be synthesized. Thereafter, to produce each double-stranded oligo construct, the sense strand and the antisense strand were mixed in equal amounts, added to 1X annealing buffer (30 mM HEPES, 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0), allowed to react in a constant-temperature water bath at 90°C for 3 minutes, and allowed to react again at 37°C, thereby producing the desired SAMiRNA. The annealing of the double-stranded oligo RNA construct thus produced was confirmed by electrophoresis.

[0200] Example 3. High-throughput screening (HTS) of SAMiRNA nanoparticles inducing RNAi targeting human CTGF

[0201] 3.1 Production of SAMiRNA nanoparticles

[0202] The 1,162 kinds of SAMiRNAs targeting the CTGF sequence synthesized in Example 2 were dissolved in 1X Dulbecco's Phosphate Buffered Saline (DPBS) (WELGENE, Korea) and lyophilized in a freeze dryer (LGJ-100F, China) for 5 days. The lyophilized nanoparticle powder was dissolved and homogenized in 1.429 ml of deionized distilled water (Bioneer, Korea), and used in the experiments of the present application.

[0203] 3.2 Intracellular processing of SAMiRNA nanoparticles

[0204] A human-derived breast cancer cell line MDA-MB231 was used to discover SAMiRNAs that inhibit the expression of CTGF, and was cultured in a Gibco DMEM medium (Gibco, USA) containing 10% fetal bovine serum (Hyclone, USA) and 1% penicillin-streptomycin (Hyclone, USA) at 37°C and 5% CO2. TMThe MDA-MB231 cell line was cultured in RPMI 1640 medium (Thermo, USA). Using the same medium as described above, the MDA-MB231 cell line was dispensed in a 96-well plate (Costar, USA) at a density of 2 x 10 4 cells / well, and the next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 was diluted to 200 nM or 600 nM with 1X DPBS and added to the cells. Cell treatment with SAMiRNA was performed a total of 4 times, once every 12 hours, and incubation was performed at 37℃ and 5% CO2.

[0205] 3.3 SAMiRNA screening by analyzing CTGF mRNA expression inhibition efficacy

[0206] Total RNA was extracted from the cell line treated with SAMiRNA in Example 3-2, and synthesized into cDNA, and then the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.

[0207] To analyze the mRNA expression level of the CTGF gene, 300 nM CTGF forward primer, 300 nM CTGF reverse primer, 300 nM CTGF probe, 200 nM RPL13A forward primer, 200 nM RPL13A reverse primer, 300 nM RPL13A probe, 400 nM TBP forward primer, 400 nM TBP reverse primer, and 300 nM TBP probe were added to each well of the Dual-HotStart RT-qPCR kit (Bioneer, Korea), and dried (Table 2). The performance of the prepared kit was determined based on the PCR amplification efficiency (Table 3) by establishing a calibration curve using A549 cell total RNA. RT-qPCR was performed under the reaction conditions of 95℃ for 10 minutes, and then (95℃ for 5 seconds and 58℃ for 15 seconds) x 45 cycles, and the protocol of detecting the fluorescence value in each cycle was followed.

[0208] According to the automated program, the Korea ExiStation HT TM which is an automated device that performs all procedures from total RNA extraction to RT-qPCR, the HT DNA / RNA extraction kit (Bioneer, Korea), and The SAMiRNA-treated 96-well plate (Costar, USA) was subjected to total RNA extraction and one-step RT-qPCR by individually preparing the Dual-HotStart RT-qPCR kit (Bioneer, Korea) containing primers and probes for quantitative analysis of the CTGF gene mRNA.​

[0209] Based on the Ct values of two genes obtained after qPCR array, the relative mRNA expression level (%) of CTGF gene in the experimental group compared to the control group was calculated by relative quantification analysis using the 2(-ΔΔC(T)) method [Livak K.J., Schmittgen T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. Dec; 25(4):402-8].

[0210] [Table 2]

[0211] Sequences of primers and hydrolysis probes used in high-throughput screening (HTS)

[0212] CTGF forward primer CACCAGCATGAAGACATACCG (SEQ ID NO: 33) CTGF reverse primer CGTCAGGGCACTTGAACTC (SEQ ID NO: 34) CTGF probe 5' FAM-CCGACGGCCGATGCTGCACCCCC-3' EBQ (SEQ ID NO: 35) RPL13A forward primer GTGTTTGACGGCATCCCACC (SEQ ID NO: 36) RPL13A reverse primer TAGGCTTCAGACGCACGACC (SEQ ID NO: 37) RPL13A probe 5' TAMRA-AAGCGGATGGTGGTTCCTGCT-3' EBQ (SEQ ID NO: 38) TBP forward primer CACCACAGCTCTTCCACTC (SEQ ID NO: 39) TBP reverse primer ATCCCAGAACTCTCCGAAGC (SEQ ID NO: 40) TBP probe 5' TEXASRED-ACCCTTGCCGGGCACCACTC-3' EBQ (SEQ ID NO: 41)

[0213] [Table 3]

[0214] 3-plex RT-qPCR amplification efficiency

[0215] Name Slope [R 2 ]]> Efficiency CTGF Y = -0.3020X + 7.6316 0.9966 100％ RPL13A Y = -0.2977X + 7.4425 0.9997 98％ TBP Y = -0.2958X + 10.5934 0.9952 99％

[0216] Example 4. Screening of SAMiRNA nanoparticles inducing RNAi targeting human CTGF

[0217] In order to select the high efficient SAMiRNA, lung cancer cell line A549 was treated with the highest efficient sequence having reduced mRNA expression level of CTGF compared to the control group at a final concentration of 200 nM or 600 nM (i.e., 16 sequences having > 60% or more reduction efficiency at a concentration of 500 nM and 1000 nM (for the secondary screening results of a total of 49 types of SAMiRNA-hCTGF)), and the sequence information of the corresponding SAMiRNA is shown in Table 4 below.

[0218] Thereafter, in order to perform an experiment to confirm the IC50value at a low concentration compared to Rxi-109 (sense: 5'-GCACCUUUCUA*G*A-chol-3' (SEQ ID NO: 57) 13mer / AS: 5'-phosphate-U CU AGAAAGG U GC*A*A*A*C*A*U-3' (SEQ ID NO: 58) 19mer / coarse = 2'OME / underline = 2'F / asterisk = phosphothioate / Chol = cholesterol) (WO 2009 / 102427), A549 cells were treated at a low concentration to determine the IC50value. 50The effect of post-reduced expression levels (knockdown) was performed on lung cancer cell line A549 for the third screening at 50 nM, 100 nM, 200 nM, 500 nM and 1000 nM for the eight strongest sequences. Thus, the sequences with SEQ ID NO: 1, 2, 10 and 15 were selected as four SAMiRNAs of the respective sense strand.

[0219] As shown in Figure 1 , finally four SAMiRNAs were selected from 1,162 SAMiRNAs targeting CTGF, which most effectively inhibited the expression of the CTGF gene Figure 2 .

[0220] [Table 4]

[0221] CTGF-specific SAMiRNA candidate sequences selected by 2-base sliding window screening and high-throughput screening (HTS)

[0222]

[0223] The lung cancer cell line A549 was treated with SAMiRNAs having each of the sequences of SEQ ID NO: 1, 2, 10 and 15 as the sense strand selected in Example 3, and the mRNA expression pattern of CTGF in the cell line was analyzed.

[0224] 4.1 Intracellular treatment of SAMiRNA nanoparticles

[0225] A human-derived lung cancer cell line A549 CCL-185 TM , Manassas, Virginia) was used to discover SAMiRNAs that inhibit the expression of CTGF, and the A549 cell line was cultured in Gibco TM F-12K (Kaighn's) medium (Thermo, USA) containing 10% fetal bovine serum (Hyclone, USA) and 1% penicillin-streptomycin (Hyclone, USA) at 37°C and 5% CO2. Using the same medium as described above, the A549 cell line was dispensed in a 12-well plate (Costar, USA) at a density of 8 x 10 4 cells / well, and the next day, the SAMiRNAs homogenized with deionized distilled water in Example 3.1 were diluted to 50 nM, 100 nM, 200 nM, 500 nM or 1000 nM with 1X DPBS and added to the cells. Cell treatment with SAMiRNAs was performed a total of 4 times, once every 12 hours, and incubation was performed at 37°C and 5% CO2.

[0226] 4.2 SAMiRNA screening by analyzing CTGF mRNA expression inhibition efficacy

[0227] Total RNA was extracted from the cell lines treated with SAMiRNA in Example 4-1, and synthesized into cDNA, and then the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.

[0228] 4-2-1 RNA isolation from SAMiRNA-treated cells and cDNA synthesis

[0229] Total RNA was extracted from the cell lines treated with SAMiRNA in Example 4-1 using an RNA extraction kit (AccuPrep Total Cell RNA Extraction Kit, Bioneer, Korea), and RNA reverse transcriptase (AccuPower RocketScript, Bioneer, Korea) was used to synthesize cDNA from the extracted RNA. RocketScript TM Cycle RT Premix (with oligo(dT)20), Bioneer, Korea) in the following manner. Specifically, 1 μg of the extracted RNA was added to AccuPower RocketScript TM RT Premix (with oligo(dT)20) (Bioneer, Korea) contained in each 0.25 ml Eppendorf tube, and DEPC (diethyl pyrocarbonate)-treated distilled water was added thereto to reach a total volume of 20 μl. In a gene amplification system (MyGenie TM Gradient Thermal Module, Bioneer, Korea), the RNA was hybridized with primers at 37°C for 30 seconds and cDNA was synthesized at 48°C for 4 minutes for two cycles, and then the amplification reaction was terminated by inactivating the enzyme at 95°C for 5 minutes.

[0230] 4-2-2 Relative quantification analysis of human CTGF mRNA

[0231] Using the cDNA synthesized in Example 4-2-1 as a template, the relative mRNA expression level of CTGF compared to the SAMiRNA control sample was analyzed by SYBR green real-time qPCR in the following manner. Specifically, the cDNA synthesized in Example 4-2-1 was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of CTGF, 3 μl of the diluted cDNA, 25 μl GreenStar TM(Republic of Korea), 19 μl distilled water, and 3 μl of CTGF qPCR primer (SEQ ID NOs: 7 and 8 (Table 5), respectively; 10 pmol / μl, Bioneer, Republic of Korea) were added to each well of a 96-well plate to obtain a mixed solution. At the same time, in order to normalize the mRNA expression level of CTGF, GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as a housekeeping (HK) gene was used as a standard gene. Using an Exicycler TM Real-time quantitative thermal cycler (Bioneer, Republic of Korea), the 96-well plate containing the mixed solution was subjected to the following reaction: 15 minutes of reaction at 95°C to activate the enzyme and remove the secondary structure of cDNA, 42 cycles of four processes of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, elongation at 72°C for 30 seconds, and SYBR green scanning, and finally elongation at 72°C for 3 minutes, and then the temperature was maintained at 55°C for 1 minute, and the melting curve was analyzed from 55°C to 95°C.

[0232] After the termination of PCR, the Ct (threshold cycle) value of each target gene was corrected using the GAPDH gene, and then the difference ΔCt of the Ct value was calculated using a control group treated with SAMiRNA (SAMiCONT) (sense: 5'-CUUACGCUGAGUACUUCGA-3' (19-mer) (SEQ ID NO: 59), antisense: 5'-UCGAAGUACUCAGCGUAAG-3' (19-mer) (SEQ ID NO: 60)) which is a control sequence not inducing gene expression inhibition. The relative expression level of the target gene in the cells treated with the CTGF-specific SAMiRNA was quantified using the ΔCt value and Equation 2 (-ΔCtx 100).

[0233] In order to select a highly efficient SAMiRNA, SAMiRNA #10 having a sequence with the highest efficiency of reducing the mRNA expression level of CTGF at a final concentration of 50 nM, 100 nM, 200 nM, 500 nM, or 1000 nM compared to the control group (i.e., the sequence of SEQ ID NO: 10) was finally selected as a sense strand.

[0234] As shown in Figure 3 Among eight SAMiRNAs targeting CTGF, SAMiRNA #10 most effectively inhibiting the expression of the CTGF gene was finally selected, and the IC 50 value of the SAMiRNA was determined by analyzing the mRNA expression pattern of CTGF in the cell line. The sequence information of the corresponding SAMiRNA is shown in Table 6 below.

[0235] Accordingly, it was confirmed that all of the CTGF-specific SAMiRNAs having the sequence of SEQ ID NO: 10 as the sense strand reduced the mRNA expression level of CTGF by 50% or more even at a low concentration of 50 nM, thereby inhibiting the expression of CTGF with a very high efficiency. As Figure 4 indicated in Table 5, for the CTGF-specific SAMiRNA having the sequence of SEQ ID NO: 10 as the sense strand, the IC 50 was determined to be 30.75 nM, indicating that the CTGF gene expression was most effectively inhibited, and also confirmed an excellent inhibitory effect when compared with the Rxi-109 IC 50 .

[0236] [Table 5]

[0237] Primer sequence information for qPCR

[0238] Primer Sequence SEQ ID NO: hGAPDH-F GGTGAAGGTCGGAGTCAACG 42 hGAPDH-R ACCATGTAGTTGAGGTCAATGAAGG 43 hCTGF-F CACCAGCATGAAGACATACCG 44 hCTGF-R CGTCAGGGCACTTGAACTC 45

[0239] (F represents a forward primer, and R represents a reverse primer)

[0240] [Table 6]

[0241] SAMiRNA sequences effective in suppressing CTGF expression

[0242] SEQ ID NO: Code name Position Sense strand sequence 10 SAMi-CTGF #1330 1330-1348 TGATTTCAGTAGCACAAGT

[0243] Example 5. Comparative analysis of inhibition of human CTGF expression by DNA / RNA hybrid and RNA / RNA hybrid SAMiRNAs comprising the selected sequence of SEQ ID NO: 10 as the sense strand

[0244] A lung cancer cell line A549 was treated with a double-stranded oligo DNA / RNA hybrid and RNA / RNA hybrid CTGF-specific SAMiRNA comprising the sequence of SEQ ID NO: 10 having been selected in Example 4 as the sense strand, and the relative mRNA expression level (%) of CTGF in the cell line was analyzed.

[0245] 5.1 Intracellular treatment of SAMiRNA nanoparticles

[0246] A human-derived lung cancer cell line A549 was used to find SAMiRNAs that inhibit the expression of CTGF, and the A549 cell line was cultured in Gibco F-12K (Kaighn's) medium (Thermo, USA) containing 10% fetal bovine serum (Hyclone, USA) and 1% penicillin-streptomycin (Hyclone, USA) at 37°C and 5% CO2. TM The A549 cell line was cultured in Gibco F-12K (Kaighn's) medium (Thermo, USA) containing 10% fetal bovine serum (Hyclone, USA) and 1% penicillin-streptomycin (Hyclone, USA) at 37°C and 5% CO2.4 The density of one cell per well was dispensed in a 12-well plate (Costar, USA), and the next day, the SAMiRNA homogenized with deionized distilled water in Example 3.1 was diluted to 200 nM or 600 nM with IX DPBS and added to the cells. Cell treatment with SAMiRNA was performed a total of 4 times, once every 12 hours, and incubation was performed at 37°C and 5% CO2.

[0247] 5.2 SAMiRNA screening by analyzing the inhibitory efficacy of human CTGF mRNA expression

[0248] Total RNA was extracted from the cell lines treated with SAMiRNA in Example 5-1, and synthesized into cDNA, and then the relative mRNA expression level of the CTGF gene was quantified using real-time PCR.

[0249] 5-2-1 RNA isolation and cDNA synthesis from SAMiRNA-treated cells

[0250] Total RNA was extracted from the cell lines treated with SAMiRNA in Example 5-1 using an RNA extraction kit (AccuPrep Total Cell RNA Extraction Kit, Bioneer, Korea), and RNA reverse transcriptase (RocketScript, Bioneer, Korea) was used to synthesize the extracted RNA into cDNA in the following manner. Specifically, 1 μg of the extracted RNA was added to RocketScript TM oligo(dT)20, Bioneer, Korea) and DEPC (diethylpyrocarbonate)-treated distilled water was added thereto to reach a total volume of 20 μl. In a gene amplification system (MyGenie RocketScript TM (Bioneer, Korea), and DEPC (diethylpyrocarbonate)-treated distilled water was added thereto to reach a total volume of 20 μl. In a gene amplification system (MyGenie TM Gradient Thermal Module, Bioneer, Korea), the RNA was hybridized with the primers at 37°C for 30 seconds and cDNA was synthesized at 48°C for 4 minutes for two cycles, and then the amplification reaction was terminated by inactivating the enzyme at 95°C for 5 minutes.

[0251] 5-2-2 Relative quantification analysis of human CTGF mRNA

[0252] Using the cDNA synthesized in Example 5-2-1 as a template, the relative mRNA expression level of CTGF compared to the SAMiRNA control sample was analyzed by SYBR green real-time qPCR in the following manner. Specifically, the cDNA synthesized in Example 5-2-1 was diluted 5 times with distilled water, and in order to analyze the mRNA expression level of CTGF, 3 μl of the diluted cDNA, 25 μl (Republic of Korea), 19 μl distilled water, and 3 μl of CTGF qPCR primers (SEQ ID NOs: 44 and 45 (Table 5), respectively; 10 pmol / μl, Bioneer, Republic of Korea) were added to each well of a 96-well plate to obtain a mixed solution. At the same time, in order to normalize the mRNA expression level of CTGF, GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as a housekeeping (HK) gene was used as a standard gene. The 96-well plate containing the mixed solution was subjected to the following reaction using an Exicycler TM quantitative thermal cycler (Bioneer, Republic of Korea), 42 cycles of four processes including denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, elongation at 72°C for 30 seconds, and SYBR green scanning, and finally elongation at 72°C for 3 minutes, and then, the temperature was maintained at 55°C for 1 minute, and a melting curve was analyzed from 55°C to 95°C.

[0253] After the termination of PCR, the Ct (threshold cycle) value of each target gene was corrected using the GAPDH gene, and then the difference Δ of the calculated value was calculated using a control group treated with SAMiRNA (SAMiCONT) (a control sequence that does not induce gene expression inhibition). The relative expression level of the target gene in the cells treated with the CTGF-specific SAMiRNA was quantified using the Δ value and Equation 2 (-Δ x 100).

[0254] In order to select a highly efficient SAMiRNA from double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids, a SAMiRNA that is a DNA / RNA hybrid having the highest efficiency in reducing the mRNA expression level of CTGF at a final concentration of 200 nM or 600 nM compared to the control group (i.e., the DNA sequence of SEQ ID NO: 10) was finally selected as the sense strand.

[0255] As Figure 5 indicated in the above

[0256] Example 6. Screening of SAMiRNA nanoparticles inducing RNAi targeting rat CTGF

[0257] In siRNA therapeutic agents, it is difficult to find optimal sequences that can be generally applied to different strains. Here, the US FDA guidelines are provided to verify pharmacological efficacy due to inhibition of expression of the corresponding gene and toxicity due to inhibition of expression of the corresponding gene (presented by Robert T. Dorsam Ph.D. Pharmacology / Toxicology Reviewer of FDA / CDER) by designing siRNA sequences (alternative sequences; mouse gene-specific siRNAs) specific to animal models for analyzing therapeutic effects (confirmed by in vivo efficacy tests).

[0258] SAMiRNA-based sequences were found using a siRNA design program based on a conventional algorithm (Turbo-si-designer owned by the applicant). A total of 94 candidate siRNA sequences were generated from the complete transcript sequence of the rat CTGF gene (NM_022266.2), and the corresponding SAMiRNAs were synthesized, and then the rat hepatocarcinoma-derived H4-II-E cell line was treated with the SAMiRNAs at 500 nM under cell culture conditions containing 10% FBS, and thus the initial screening of in vitro expression inhibition was performed using the primers shown in Table 8 below. Figure 6 ).

[0259] To select a highly efficient SAMiRNA, a secondary screening was performed at 200 nM and 500 nM for the sequence having the highest efficiency of reducing the mRNA expression level of rat CTGF at a final concentration of 500 nM compared to the control group (i.e., 12 sequences having a reduction efficiency of > 60% or more) in the H4-II-E cell line, which is a rat hepatocarcinoma cell line, among the total of 94 types of SAMiRNA-rat CTGF. Thus, three sequences having SEQ ID NOs: 46, 47, and 48 were selected as SAMiRNAs of the corresponding sense strands.

[0260] As shown in Figure 6 , three SAMiRNAs most effectively inhibiting the expression of the rat CTGF gene were finally selected from among the 94 SAMiRNAs targeting rat CTGF Figure 8 , and the sequence information of the corresponding SAMiRNAs is shown in Table 9 below.

[0261] To select a highly efficient SAMiRNA, SAMiRNA-rat CTGF #46 having a sequence having the highest efficiency of reducing the mRNA expression level of rat CTGF at a final concentration of 25 nM, 50 nM, 100 nM, 200 nM, 400 nM, or 800 nM compared to the control group (i.e., the sequence of SEQ ID NO: 46) as a sense strand was finally selected.

[0262] AsFigure 8 As shown in Table 2, for the rat CTGF-specific SAMiRNA having the sequence of SEQ ID NO: 46 as the sense strand, the IC50was determined to be 122.9 nM, indicating that it most effectively inhibited the expression of the rat CTGF gene. 50 As shown in Table 2, for the rat CTGF-specific SAMiRNA having the sequence of SEQ ID NO: 46 as the sense strand, the IC50was determined to be 122.9 nM, indicating that it most effectively inhibited the expression of the rat CTGF gene.

[0263] In addition, as shown in Table 2, among the double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids comprising the selected rat CTGF-specific SAMiRNAs, the DNA / RNA hybrid SAMiRNA #46 was finally selected as the most effective in inhibiting the expression of the rat CTGF gene. Figure 9 In addition, as shown in Table 2, among the double-stranded oligo DNA / RNA hybrids and RNA / RNA hybrids comprising the selected rat CTGF-specific SAMiRNAs, the DNA / RNA hybrid SAMiRNA #46 was finally selected as the most effective in inhibiting the expression of the rat CTGF gene.

[0264] [Table 8]

[0265] (F stands for forward primer, and R stands for reverse primer)

[0266] Primer Sequence Rat-GAPDH-F AACATCATCCCTGCATCCAC (SEQ ID NO: 49) Rat-GAPDH-R CGGATACATTGGGGGTAGGA (SEQ ID NO: 50) Rat-CTGF-F CAAGGGTCTCTTCTGCGAC (SEQ ID NO: 51) Rat-CTGF-R ATTTGCAACTGCTTTGGAAGG (SEQ ID NO: 52)

[0267] [Table 9]

[0268] SEQ ID NO: Code name Position Sense strand sequence 46 SAMi-rCTGF #46 195-213 GACACTGGTTTCGAGACAG 47 SAMi-rCTGF #47 182-200 CCTGTCAATCTCAGACACT 48 SAMi-rCTGF #48 984-1002 CATCCGGACGCCTAAAATT

[0269] Example 7. Verification of the efficacy of SAMiRNA-rat CTGF by intradermal administration in a wound-induced keloid animal model

[0270] The efficacy of SAMi-rCTGF on wounds induced with an 8 mm biopsy punch (Biopsy Punch, BP-80F, Kai, Japan) was analyzed. For the experiment, 7-week-old rats (SD rats, Nara Biotech, Gyeonggi-do, Korea) were purchased and allowed to acclimate for 1 week. An 8 mm biopsy punch was used to create wounds on the back skin of the rats. Two days before wound induction and on the day of wound induction, the rats were administered 1200 μg / site of each of saline (PBS) for the negative control group, SAMiRNA-rCTGF #46 DNA / RNA (D / R) for the experimental group, and SAMiRNA-rCTGF #46 RNA / RNA (R / R) for another experimental group, a total of two times. The rats were sacrificed on the 3rd day after wound induction.

[0271] 7-1. Analysis of gene expression of SAMiRNA in a wound-induced keloid animal model

[0272] Rat skin tissue treated with SAMiRNA was obtained and initially homogenized using a mortar and pestle and liquid nitrogen. The homogenized tissue was then placed in lysis buffer of an RNA extraction kit (AccuPrep Total RNA Extraction Kit, Bioneer, Korea) and homogenized a second time using a homogenizer. Subsequently, total RNA was extracted according to the manufacturer's protocol. RNA reverse transcriptase (RNA) was used... RocketScript TM RT Premix (with oligo(dT)20), Bioneer, Korea) synthesized cDNA from extracted RNA in the following manner.

[0273] [Table 10]

[0274] RT parameters

[0275] Step Temperature Time 1 37℃ 30 sec 2 48℃ 4 min 3 55℃ 30 sec 4 De-staging 1 12 cycles 5 95℃ 5 min

[0276] Using synthesized cDNA as a template, the relative expression level of total mRNA in each group was analyzed by SYBR Green real-time qPCR as follows. Specifically, the synthesized cDNA was diluted 10-fold with distilled water, and to analyze the mRNA expression level of CTGF, 10 μl of diluted cDNA and 25 μl of... GreenStar TM (Korea), 20 μl of distilled water, and 5 μl of CTGF qPCR primers (3 pmol / μl each, Table 11) were added to each well of a 96-well plate to obtain a mixed solution. Simultaneously, to normalize the mRNA expression levels of CTGF, fibronectin, and Col3α1, RPL13A, as a housekeeping (HK) gene, was used as a standard gene. After qPCR termination, the Ct (threshold cycle) value of each target gene was corrected using the RPL13A gene to determine the ΔCt value of the target gene, and then its ΔΔCt value compared to the control group was calculated. The relative expression levels of CTGF, fibronectin, and Col3α1 genes were quantified using the ΔΔCt value and Equation 2 (-ΔΔCt x 100).

[0277] [Table 11]

[0278] (F represents a forward primer, and R represents a reverse primer)

[0279] Primer Sequence Rat Rpl13a F AGGGGCAGGTTCTAGTATTG (SEQ ID NO: 53) Rat Rpl13a R GCGTACAACCACCACCTTTC (SEQ ID NO: 54) Rat Ctgf F AGGAGTGGGTGTGTGATGAG (SEQ ID NO: 55) Rat Ctgf R TTGGCTCGCATCATAGTTGG (SEQ ID NO: 56)

[0280] [Table 12]

[0281] qPCR parameters

[0282]

[0283] Accordingly, it was confirmed that CTGF expression was significantly reduced in the group treated with 1200 μg SAMiRNA-rCTGF (D / R) compared to the group treated with saline, and also statistically significantly reduced in the group treated with 1200 μg SAMiRNA-rCTGF (D / R) compared to the group treated with 1200 μg SAMiRNA-rCTGF (R / R) in the wound-induced rats.

[0284] As shown in Figure 10 It was concluded that the double-stranded oligo DNA / RNA hybrid most effectively inhibited CTGF gene expression compared to the RNA / RNA hybrid in the hybrid containing the selected rCTGF-specific SAMiRNA.

[0285] Although specific embodiments of the present application have been disclosed in detail herein, it will be apparent to those skilled in the art that the description is merely exemplary in nature and that the scope of the application is not limited to the preferred embodiments described herein. Thus, the scope of the present application should be defined by the appended claims and equivalents thereof.

[0286] Utility

[0287] According to the present application, the double-stranded oligonucleotide construct comprising the CTGF-specific double-stranded oligonucleotide and the pharmaceutical composition containing the same as an active ingredient can inhibit the expression of CTGF with high efficiency without side effects, and is very effective in preventing and treating diseases caused by excessive fibrosis and respiratory diseases.

[0288] Free text of sequence listing

[0289] Additional electronic file. SEQUENCE LISTING <110> PEARL GENETICS CO., LTD. <120> CTGF gene-specific double-stranded oligonucleotide and composition comprising the same for preventing and treating fibrotic diseases and respiratory-related diseases <130> PF-B2791 <140> PCT / KR2020 / 014948 <141> 2020-10-29 <150> 10-2019-0151673 <151> 2019-11-22 <160> 60 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 1 atgtacagtt atctaagtt 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 2 tgtacagtta tctaagtta 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 3 gtacagttat ctaagttaa 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 4 atggaaattc tgctcagat 19 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 5 tggaaattct gctcagata 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 6 ggaaattctg ctcagatag 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 7 atttcagtag cacaagtta 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 8 tttcagtagc acaagttat 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 9 ttcagtagca caagttatt 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 10 tgatttcagt agcacaagt 19 <210> 11 <211 > 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 11 gatttcagta gcacaagtt 19 <210> 12 <211 > 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 12 taaaaatgat ttcagtagc 19 <210> 13 <211 > 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidates (sense) <400> 13 aaaaatgatt tcagtagca 19 <210> 14 <211 > 19 <212> DNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 14 aaaatgattt cagtagcac 19 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 15 tcagtagcac aagttattt 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CTGF specific SAMiRNA candidate (sense) <400> 16 cagtagcaca agttattta 19 <210> 17 <211> 19 <212> RNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CTGF specific SAMiRNA candidate (antisense) <400> 17 aacuuagaua acuguacau 19 <210> 18 <211> 19 <212> RNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CTGF specific SAMiRNA candidate (antisense) <400> 18 uaacuuagau aacuguaca 19 <210> 19 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 19 uuaacuuaga uaacuguac 19 <210> 20 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 20 aucugagcag aauuuccau 19 <210> 21 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 21 uaucugagca gaauuucca 19 <210> 22 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 22 cuaucugagc agaauuucc 19 <210> 23 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA candidates specific for CTGF (antisense) <400> 23 uaacuugugc uacugaaau 19 <210> 24 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA candidates specific for CTGF (antisense) <400> 24 auaacuugug cuacugaaa 19 <210> 25 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA candidates specific for CTGF (antisense) <400> 25 aauaacuugu gcuacugaa 19 <210> 26 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA candidates specific for CTGF (antisense) <400> 26 acuugugcua cugaaauca 19 <210> 27 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA candidates specific for CTGF (antisense) <400> 27 aacuugugcu acugaaauc 19 <210> 28 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 28 gcuacugaaa ucauuuuua 19 <210> 29 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 29 ugcuacugaa aucauuuuu 19 <210> 30 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 30 gugcuacuga aaucauuuu 19 <210> 31 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF-specific SAMiRNA candidate (antisense) <400> 31 aaauaacuug ugcuacuga 19 <210> 32 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CTGF specific SAMiRNA candidates (antisense) <400> 32 uaaauaacuu gugcuacug 19 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 33 caccagcatg aagacatacc g 21 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 34 cgtcagggca cttgaactc 19 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 35 ccgacggccg atgctgcacc ccc 23 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 36 gtgtttgacg gcatcccacc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 37 taggcttcag acgcacgacc 20 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 38 aagcggatgg tggttcctgc t 21 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 39 caccacagct cttccactc 19 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 40 atcccagaac tctccgaagc 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 41 acccttgccg ggcaccactc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 42 ggtgaaggtc ggagtcaacg 20 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 43 accatgtagt tgaggtcaat gaagg 25 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 44 caccagcatg aagacatacc g 21 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 45 cgtcagggca cttgaactc 19 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SAMi-rCTGF Sense <400> 46 gacactggtt tcgagacag 19 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SAMi-rCTGF Sense <400> 47 cctgtcaatc tcagacact 19 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SAMi-rCTGF Sense <400> 48 catccggacg cctaaaatt 19 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 49 aacatcatcc ctgcatccac 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 50 cggatacatt gggggtagga 20 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 51 caagggtctc ttctgcgac 19 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 52 atttgcaact gctttggaag g 21 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 53 aggggcaggt tctagtattg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 54 gcgtacaacc accacctttc 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 55 aggagtgggt gtgtgatgag 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 56 ttggctcgca tcatagttgg 20 <210> 57 <211> 13 <212> RNA <213> Artificial Sequence <220> <223> Rxi-109 Sense <400> 57 gcaccuuucu aga 13 <210> 58 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Rxi-109 Antisense <400> 58 ucuagaaagg ugcaaacau 19 <210> 59 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA (SAMiCONT) Sense <400> 59 cuuacgcuga guacuucga 19 <210> 60 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> SAMiRNA (SAMiCONT) antisense <400> 60 ucgaaguacu cagcguaag 19

Claims

1. A CTGF-specific double-stranded oligonucleotide construct having a structure of Structural Formula (3) or Structural Formula (4): Structural Formula (3) Structural Formula (4) in Structural Formula (3) and Structural Formula (4), A is a hydrophilic material selected from any one of the group consisting of polyethylene glycol, polyvinylpyrrolidone, polyoxazoline, or a hydrophilic material having a structure of Structural Formula (5) or Structural Formula (6): Structural Formula (5) Structural Formula (6) in Structural Formula (5) and Structural Formula (6), A' is a hydrophilic material monomer, J is a linker that links m number of hydrophilic material monomers to each other or links m number of hydrophilic material monomers and an oligonucleotide to each other, m is an integer of 1 to 15, and n is an integer of 1 to 10, wherein the sense strand is DNA, and the antisense strand is RNA.

2. The CTGF-specific double-stranded oligonucleotide construct according to claim 1, having a structure of Structural Formula (7) or Structural Formula (8): Structural Formula (7) Structural Formula (8) ， 4. The CTGF-specific double-stranded oligonucleotide construct according to claim 1, wherein the hydrophilic material has a molecular weight of 200 to 10,000. ， 5. The CTGF-specific double-stranded oligonucleotide construct according to claim 1, wherein the hydrophobic material has a molecular weight of 250 to 1,000.

6. The CTGF-specific double-stranded oligonucleotide construct according to claim 5, wherein the hydrophobic material is any one selected from the group consisting of a steroid derivative, a glyceride derivative, and a phospholipid. (A m -J n 7. The CTGF-specific double-stranded oligonucleotide construct according to claim 6, wherein the steroid derivative is tocopherol or cholesterol. (J-A' m ) n 8. The CTGF-specific double-stranded oligonucleotide construct according to claim 7, wherein the tocopherol is tocotrienol, or wherein the cholesterol comprises any one selected from the group consisting of cholestanol, cholic acid, cholesteryl formate, cholestanol formate, and cholinesterase. The hydrophilic material monomer A' is any one compound selected from the following compound (1) and compound (3), and the J is selected from the group consisting of -PO3 - -, -SO3- and -CO2- : Compound (1), wherein G is CH2, O, S or NH; Compound (3), B is a hydrophobic material selected from the group consisting of a lipid, a polypropylene glycol, C 12 to C 50 an unsaturated or saturated hydrocarbon, a fatty acid, and a lipopolyamine, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, S and AS are respectively a sense strand and an antisense strand of the double-stranded oligonucleotide, the sequence of the sense strand is SEQ ID NO: 10 and the sequence of the antisense strand is a sequence complementary to the sequence of SEQ ID NO: 10, 9. The CTGF-specific double-stranded oligonucleotide construct according to claim 6, wherein the glyceride derivative is any one selected from the group consisting of glycerol ether, monoglyceride, diglyceride, and triglyceride; or wherein the phospholipid is diacylphosphatidylcholine.

10. The CTGF-specific double-stranded oligonucleotide construct according to claim 1, wherein the covalent bond represented by X and Y is a non-degradable bond or a degradable bond.

11. The CTGF-specific double-stranded oligonucleotide construct according to claim 10, wherein the non-degradable bond is an amide bond or a phosphate ester bond. (A m -J n -X-R-Y-B 12. The CTGF-specific double-stranded oligonucleotide construct according to claim 10, wherein the degradable bond is a biodegradable bond. (J-A' m ) n -X-R-Y-B.

3. The CTGF specific double stranded oligonucleotide construct of claim 1, wherein A is hexaethylene glycol-(-PO3 - )3 and B is C 24 (C6-S-S-C 18 ).

13. The CTGF-specific double-stranded oligonucleotide construct according to claim 12, wherein the biodegradable bond is any one selected from the group consisting of a disulfide bond, an acid-degradable bond, and an enzyme-degradable bond. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ 14. The CTGF-specific double-stranded oligonucleotide construct of claim 13, wherein the acid-degradable linkage is an acid anhydride linkage; or wherein the enzyme-degradable linkage is an ester linkage.

15. A nanoparticle comprising the double-stranded oligonucleotide construct of claim 1.

16. The nanoparticle of claim 15, wherein the nanoparticle is configured such that the double-stranded oligonucleotide construct comprising a plurality of double-stranded oligonucleotides is mixed.

17. A pharmaceutical composition for preventing or treating fibrosis or a respiratory disease, the pharmaceutical composition comprising the nanoparticle of claim 15 as an active ingredient.

18. The pharmaceutical composition of claim 17, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive pulmonary disease, asthma, acute and chronic bronchitis, allergic rhinitis, expectorant cough, bronchitis, bronchiolitis, laryngitis, tonsillitis, and laryngotracheitis.

19. The pharmaceutical composition of claim 17, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis, liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.

20. A lyophilized formulation comprising the pharmaceutical composition of claim 17.

21. A pharmaceutical composition for preventing or treating fibrosis or a respiratory disease, the pharmaceutical composition comprising the double-stranded oligonucleotide construct of claim 1 as an active ingredient.

22. The pharmaceutical composition of claim 21, wherein the respiratory disease is any one selected from the group consisting of chronic obstructive pulmonary disease, asthma, acute and chronic bronchitis, allergic rhinitis, expectorant cough, bronchitis, bronchiolitis, laryngitis, tonsillitis, and laryngotracheitis.

23. The pharmaceutical composition of claim 21, wherein the fibrosis is any one selected from the group consisting of idiopathic pulmonary fibrosis, liver fibrosis, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, keloid, pulmonary fibrosis, cardiac fibrosis, and radiation-induced fibrosis.

24. A lyophilized formulation comprising the pharmaceutical composition of claim 21.

Images