Modification of the transcriptional repressor binding site of the NF-YC4 promoter to increase protein content and stress resistance

Abstract

A method for increasing protein content in a eukaryotic cell comprising a NF‑YC4 gene, the method comprising modifying a transcriptional repressor binding site; a method for producing a plant with increased protein content, the method comprising crossing and selecting for increased protein content; a method for increasing resistance to pathogens or pests in a plant cell or plant comprising a NF‑YC4 gene, the method comprising modifying a transcriptional repressor binding site, alone or in combination with expressing QQS in the plant cell or plant; a method for producing a plant with increased resistance to pathogens or pests, the method comprising crossing and selecting for increased resistance to pathogens or pests; a cell, a collection of cells, a tissue, an organ or an organism such as a plant, wherein the NF‑YC4 gene comprises a promoter, the promoter comprising a modified transcriptional repressor binding site such that the transcriptional repressor cannot hinder NF‑YC4 transcription; a hybrid plant; and seeds.

Description

[0001] This application is a divisional application of a patent application with application number 201680022422.6, application date February 17, 2016, and title “Modification of transcription repressor binding sites of NF-YC4 promoter to increase protein content and stress resistance”.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] The work described herein was supported, at least in part, by grants from the National Science Foundation, MCB Grant Nos. 0209789 and 0951170. Accordingly, the U.S. Government has certain rights in this invention. Technical Field

[0004] The present disclosure relates to increasing the protein content of eukaryotic cells, improving plant resistance to stress, such as abiotic (e.g., salt, drought and pollution) or biotic (e.g., pathogens and pests) stress, promoters with modified transcriptional repressor binding sites so that the transcriptional repressor cannot hinder the transcription of the gene NF-YC4, QQS, TALENS, CRISPR / Cas9, tissue culture, hybrid and backcross plants, hybrid plants, regenerable cells and seeds. Background of the Invention

[0005] Protein deficiency is a major health problem in developing countries. Low protein intake causes mental retardation, developmental delays, disease susceptibility, wasting disease and / or death in hundreds of millions of children each year (Forrester et al., PloS one 7:e35907 (2012); Gomes et al., J. Neuroscience Res. 87:3568-3575 (2009)).

[0006] Plants provide more than 60% of human dietary protein (Young et al., Am. J. Clin. Nutr. 59: 1203S-1212S (1994)). Increasing the protein content of staple crops can help alleviate protein deficiency, especially when using animals to produce the same amount of protein requires about 100 times the water and 11 times the energy (Pimentel et al., Am. J. Clin. Nutr. 78: 6605-6635 (2003)) and increasing animal protein content is often accompanied by a decrease in protein quality or yield (Bellaloui et al., Agricultural Sciences 1: 110-118 (2010); Wenefrida et al., J. Agricultural Food Chem. 61: 11702-11710 (2013)).

[0007] Arabidopsis QQS (At3g30720, Qua- Q uine S tarch) lonely gene regulates Arabidopsis protein content. Arabidopsis starch synthase 3 (Atss3) mutants are morphologically similar to wild-type (WT) control lines but have different starch levels (Zhang et al., Plant Physiol. 138: 663-674 (2005)), with more than 5 times the amount of QQS transcripts found in WT (Li et al., Plant J. 58: 485-498 (2009)). QQS overexpression in Arabidopsis increases total protein content and decreases total starch content in leaves, while QQS downregulation has an inverse effect (Li et al., Plant Biotech. J. 13: 177-187 (2015); Li et al. (2009), supra). QQS expression as a transgene increases protein content in other plants, such as soybean (Williams 82 variant; Li et al. (2014), supra; Li et al. (2009), supra).

[0008] QQS expression has been observed to be tightly linked to a variety of developmental, environmental, and genetic perturbations (see, e.g., Arendsee et al., Trends in Plant Sci doi: 10.1016 / j.tplants.2014.07.003 (2014); Li et al. (2009), supra; and Li et al. (2015), supra). However, its role in such perturbations has not been elucidated. For example, PEN3 (Penetration Resistance 3 (Atlg59870, PEN3, ABC-binding cassette transporter gene) confers non-host resistance to fungal and oomycete pathogens. QQS was reported to be the only gene upregulated in pen3 knockout (KO) mutants; however, QQS was upregulated in infected and non-infected mutants (Stein et al., Plant Cell 18(3):731-746 (2006)). As another example, two syntaxins, SYP121 (At3g1 1820, PEN1) and SYP122 (At3g52400), confer resistance to powdery mildew. Knockouts of these genes cause increased susceptibility to these pathogens; QQS was reported to be the only gene upregulated in both (Zhang et al. (2008)). In contrast, PEN3 and EXL1 are upregulated after exposure to some pathogens, and QQS is downregulated in response to some pathogen infections, such as Pseudomonas syringae. syringae) (Kwon et al., Planta 236(3):887-900 (2012); and Thilmony et al., Plant J. 46(1):34-53 (2006)). When Arabidopsis plants were inoculated with Phytopthera infestans, QQS was reported to be first down-regulated at 6 hours post-inoculation and then up-regulated at 12 and 24 hours post-inoculation (Scheel et al., the experiment ID for ArrayExpress is "E-GEOD-5616").

[0009] Therefore, in view of the above, an object of the present disclosure is to identify genes that interact with QQS. In Arabidopsis, QQS interacts with nuclear factor gamma subunit C4 (NF-YC4, At5g63470). Another object is to provide materials and methods for manipulating the identified genes. In an embodiment, manipulating such genes causes an increase in protein content and / or a decrease in carbohydrate content. Another object is to provide materials and methods for improving plant resistance to pathogens or pests. These and other objects and inventive features are apparent from the detailed description provided herein. Summary of the invention

[0010] Provided is a method for increasing protein content in a eukaryotic cell comprising a NF-YC4 gene, the gene comprising a promoter, the promoter comprising a transcriptional repressor binding site. The method comprises modifying the transcriptional repressor binding site so that the transcriptional repressor cannot hinder NF-YC4 transcription. The protein content of the eukaryotic cell increases; therefore, the method may also include selecting for increased protein content. The method may also include producing a cell collection, tissue, organ or organism from a eukaryotic cell. The eukaryotic cell may be part of a cell collection, tissue, organ or organism. The organism may be a plant, such as a crop, such as soybean, rice, corn, etc. The plant may be a monocot or a dicot. The transcriptional repressor binding site can be modified by deletion. The transcriptional repressor binding site may comprise, consist essentially of, or consist of an ERF motif, a RAV 1 motif, or both an ERF motif and a RAV 1 motif. The eukaryotic cell can be a rice cell and (i) lacks two ERF motifs, (ii) lacks a RAV 1 motif, or (iii) lacks a RAV 1 motif and an ERF motif. The eukaryotic cell can be a soybean cell and (i) lacks two RAV 1 motifs or (ii) lacks a RAV 1 motif and an ERF motif. The ERF motif, the RAV 1 motif, or both the ERF motif and the RAV 1 motif can be deleted using TALENS or CRISPR / Cas9.

[0011] Also provided is a method for producing a plant with increased protein content. The method comprises crossing a plant obtained according to the above method with a second plant to produce a progeny plant and selecting a progeny plant with increased protein content. The method can also comprise crossing the selected progeny plant with the second plant to produce a backcross progeny plant, selecting a first backcross progeny plant with increased protein content to produce a selected backcross progeny plant, and repeating the crossing and selection three or more times to produce a backcross progeny plant with increased protein content.

[0012] Also provided is a cell, a cell collection, a tissue, an organ or an organism, wherein the NF-YC4 gene comprises a promoter, and the promoter comprises a modified transcription repressor binding site so that the transcription repressor cannot hinder the transcription of NF-YC4. Compared to the corresponding cell, cell collection, tissue, organ or organism (wherein the promoter included by the NF-YC4 gene comprises an unmodified transcription repressor binding site), the protein content of the cell, cell collection, tissue, organ or organism increases. In an embodiment, the organism can be a plant or a hybrid thereof. Seeds of the above-mentioned plant or its hybrid are also provided. In another embodiment, the organism can be a non-human animal, such as livestock, for example cattle, pigs, chickens, turkeys, sheep and American bison.

[0013] Also provided is a method for increasing resistance to pathogens or pests in a plant cell or plant comprising a NF-YC4 gene, the NF-YC4 gene comprising a promoter, the promoter comprising a modified transcriptional repressor binding site. The method includes modifying the transcriptional repressor binding site of the NF-YC4 gene promoter in a plant cell or plant at risk of infection with a pathogen or pest, so that the transcriptional repressor cannot hinder the transcription of the NF-YC4 gene. Resistance to pathogens or pests in plant cells or plants is increased; therefore, the method can also include selecting for increased resistance to pathogens or pests. The method can also include introducing a polynucleotide comprising a nucleotide sequence encoding a Qua-Quine Starch (QQS) polypeptide into a plant or plant cell and expressing it therein, the polypeptide having an amino acid sequence shown in SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter. The method can also include regenerating a plant or part thereof from a plant cell. The transcriptional repressor binding site can include an ERF motif, a RAV 1 motif, or both an ERF motif and a RAV 1 motif. The plant cell or plant can be a rice cell or a rice plant and (i) lacks two ERF motifs, (ii) lacks a RAV 1 motif, or (iii) lacks a RAV 1 motif and an ERF motif. The plant cell or plant can be a soybean cell or a soybean plant, (i) lacks two RAV 1 motifs or (ii) lacks a RAV 1 motif and an ERF motif. The ERF motif, the RAV 1 motif, or both the ERF motif and the RAV 1 motif can be deleted using TALENS or CRISPR / Cas9. The pathogen can be a bacterium or a virus. The pest can be an aphid. The plant can be a crop such as soybean. The plant can be a dicot.

[0014] Further provided is a method for producing a plant with increased resistance to pathogens or pests. The method comprises crossing the plant obtained according to the above with a second plant to produce a progeny plant and selecting a progeny plant with increased resistance to plant pathogens or pests. The method can also comprise crossing the selected progeny plant with the second plant to produce a backcross progeny plant, selecting a first backcross progeny plant with increased resistance to pathogens or pests to produce a selected backcross progeny plant, and repeating the crossing and selection three or more times to produce a backcross progeny plant with increased resistance to pathogens or pests.

[0015] Further provided is a plant with increased resistance to pathogens or pests. The plant comprises a NF-YC4 gene, the gene comprises a promoter, the promoter comprises a transcriptional repressor binding site. The transcriptional repressor binding site is modified so that the transcriptional repressor cannot hinder NF-YC4 transcription. In one embodiment of the plant, the wild type does not comprise and express QQS, and a polynucleotide comprising a nucleotide sequence encoding a QQS polypeptide is introduced and expressed, the polypeptide having an amino acid sequence as shown in SEQ ID NO: 16. The nucleotide sequence is operably linked to a promoter.

[0016] Seeds of the above plants are also provided, as well as plant hybrids. Seeds of hybrid plants are also provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A This is a diagram of the vector expressing QQS.

[0018] Figure 1B This is a map of the vector expressing NF-YC4 from Arabidopsis thaliana.

[0019] Figure 1C The figure is a vector map for expressing NF-YC4 from soybean.

[0020] Figure 1D This is a map of the vector for expressing NF-YC4 from rice.

[0021] Figure 1E The figure is a vector map for expressing NF-YC4 from maize.

[0022] Figure 2A , 2B , 2C, 2D, 2E and 2F show sequences relevant to the present disclosure as follows:

[0023] SEQ ID NO: 1 shows the promoter region of the rice (Oryza sativa) NF-YC4 gene (Os03g14669), wherein the RAV 1 motif (reverse) is shown in bold, the RAV 1 (reverse) and ERF (forward) motifs are underlined and shown in bold, and the ERF (reverse) motif is shown in bold italics.

[0024] SEQ ID NO:2 shows the promoter region of the rice NF-YC4 gene, wherein the RAV1 (reverse) motif (TGTTG, see bold in SEQ ID NO:1) is deleted, wherein the RAV1 (reverse) and ERF (forward) motifs are underlined and shown in bold, and the ERF motif (reverse) is shown in bold italics.

[0025] SEQ ID NO:3 shows the promoter region of the rice NF-YC4 gene, in which the overlapping sequences of the RAV1 (reverse) motif and the ERF (forward) motif are deleted (TGTTGACT; see the underlined bold in SEQ ID NO:1), wherein the RAV1 motif (reverse) is shown in bold and the ERF motif (reverse) is shown in bold italics.

[0026] SEQ ID NO: 4 shows that the promoter region of rice NF-YC4 gene is, wherein a 111 bp segment is deleted and contains 2 ERF motifs (reverse direction) See the 2 bold italic ERFs and the intervening sequence in SEQ ID NO: 1 ), where the RAV 1 motif (reverse) is in bold, and the RAV 1 (reverse) motif and the ERF (forward) motif are in underlined bold.

[0027] SEQ ID NO:6 shows the promoter region of rice NF-YC4 gene, wherein a 190 bp segment is deleted, containing 2 ERF motifs (reverse), RAV 1 (reverse) and ERF (forward) motifs and the sequence in between See SEQ ID NO: 1, 2 bold italic ERF motifs (reverse), underlined bold RAV1 (reverse) and ERF (forward) motifs, and intervening sequences), where the RAV1 motif (reverse) is shown in bold.

[0028] SEQ ID NO: 8 shows the promoter region of soybean (Glycine max) NF-YC4 gene (Glyma06g17780), wherein the ERF motif (reverse) is shown in bold italics, the RAV1 motif (reverse) is shown in bold, and the RAV1 motif (forward) is shown in underlined bold.

[0029] SEQ ID NO: 9 shows the promoter region of the soybean NF-YC4 gene, wherein the ERF motif (reverse), the RAV1 motif (forward) and the intervening sequence are deleted. See bold italics and underlined bold in SEQ ID NO:8), where the ERF motif (inverse direction) is shown in bold italics and the RAV1 motif (inverse direction) is shown in bold.

[0030] SEQ ID NO: 11 shows the promoter region of the soybean NF-YC4 gene, wherein the ERF motif (reverse), the RAV1 motif (forward) and the intervening sequence are deleted See bold italics and bold in SEQ ID NO: 8, wherein the ERF motif (reverse) is shown in bold italics, the RAV1 motif (reverse) is shown in bold, and the RAV1 motif (forward) is shown in underlined bold.

[0031] SEQ ID NO: 13 shows the promoter region of soybean NF-YC4 gene, wherein two RAV1 motifs and the intervening sequence are deleted See bold in SEQ ID NO:8), wherein the ERF motif (reverse) is shown in bold italics, the RAV1 motif (reverse) is shown in bold, and the RAV1 motif (forward) is shown in underlined bold.

[0032] SEQ ID NO: 15 shows the nucleotide sequence of Arabidopsis thaliana Qua-Quine Starch (QQS) cDNA.

[0033] SEQ ID NO: 16 shows the amino acid sequence of the Arabidopsis QQS protein.

[0034] SEQ ID NO: 17 shows the nucleotide sequence of soybean NF-YC4, between the RAV1-A motif and the W-box motif having the sequence GGTCAGTTTTTGTTAACATTAATTTTTAGGAT.

[0035] SEQ ID NO: 1 8 shows the forward primer GmNF-YC4Fd: 5′-CCTCCCAGGCATGGCAGTCC-3′.

[0036] SEQ ID NO: 19 shows the reverse primer GmNF-YC4Rev: 5'-CCATCAAGGCTCCGCTGG-3'.

[0037] SEQ ID NO: 20 shows the promoter region of the Zea mays NF-YC4 gene, with two RAV1 motifs (forward) shown in bold.

[0038] Figure 3 is a phylogenetic tree of NF-YC genes from evolutionarily distinct eukaryotic species.

[0039] Figure 4AGraph of F3 seed protein (% / g fresh weight, 13% moisture) of soybean elite lines expressing QQS and their respective segregated sister controls. The percent increase in seed protein compared to the respective segregated sister controls is shown on the top of the mutant column. a = segregated sister without QQS gene from QQS-E Williams 82 transformant; b = QQS-E Williams 82 transformant; c = segregated sister control without QQS gene, from IA elite lines or a cross of Williams 82 and QQS-E Williams 82; d = QQS-E mutant, from a cross of IA elite lines and QQS-E Williams 82. Student's t-test was used to compare QQS-E and controls. **P<0.01.

[0040] Figure 4B It is a bar graph of seed oil (% / g fresh weight, 13% moisture) of F3 generation of soybean elite lines expressing QQS and their respective segregated sister control. a = segregated sister without QQS gene from QQS-E Williams 82 transformant; b = QQS-E Williams 82 transformant; c = segregated sister control without QQS gene, from the cross of IA elite line or Williams 82 and QQS-E Williams 82; d = QQS-E mutant, from the cross of IA elite line and QQS-E Williams 82. Student's t-test was used to compare QQS-E and control. *P<0.05.

[0041] **P<0.01.

[0042] Figure 4C Bar graph of F3 seed fiber (% / g fresh weight, 13% moisture) of soybean elite lines expressing QQS compared to their respective segregating sister controls. a = segregating sister without QQS gene from QQS-E Williams 82 transformant; b = QQS-E Williams 82 transformant; c = segregating sister control without QQS gene, from a cross of IA elite lines or Williams 82 and QQS-E Williams 82; d = QQS-E mutant, from a cross of IA elite lines and QQS-E Williams 82. Student's t-test was used to compare QQS-E and controls. *P<0.05. *P<0.01.

[0043] Figure 5ABar graph of leaf protein (% / dry weight) of rice (cv. Kitakke) expressing QQS (QQS-E) and its wild-type sister (Sister). All data show mean ± SE, n = 3. Student's t-test was used to compare QQS-E and control. **P < 0.01.

[0044] Figure 5B Bar graph of seed protein (% / dry weight) of rice (cv. Kitakke) expressing QQS (QQS-E) and its wild-type sister (Sister). All data show mean ± SE, n = 3. Student's t-test was used to compare QQS-E and control. **P < 0.01.

[0045] Figure 6 It is a bar graph of the relative expression of empty vector of capture + bait (BK+AD), empty vector of QQS-capture + bait (BK+QQS), empty vector of AtNF-YC4-bait + capture (AtNF-YC4+AD), and AtNF-YC4-bait + QQS-capture (AtNF-YC4+QQS) plus reporter genes. *P<0.05.**P<0.01.

[0046] Fig. 7A is a bar graph of leaf starch (mg / g fresh weight) of Arabidopsis thaliana overexpressing NF-YC4 (AtNF-YC4-OE) and wild-type Arabidopsis thaliana (WT). All data in the bar graphs show mean ± SE, n = 3. Student's t-test was used to compare starch composition between WT and AtNF-YC4-OE lines. *P < 0.05.

[0047] Figure 7B is a bar graph of leaf protein (mg / g fresh weight) of Arabidopsis thaliana overexpressing NF-YC4 (AtNF-YC4-OE) and wild-type Arabidopsis thaliana (WT). All data in the bar graphs show mean ± SE, n = 3. Student's t-test was used to compare the protein composition of WT and AtNF-YC4-OE lines. **P < 0.01.

[0048] Figure 8 is a graph of LUC (luciferase) activity from tobacco, wherein the transcriptional repressor motif of the soybean NF-YC4 promoter region is deleted (pSoy-LUC DEL1, pSoy-LUC DEL2 and pSoy-LUC DEL3), and the graph is a graph of relative LUC activity compared to the control (pSoy-LUCFull). Data are expressed as mean ± SE, n = 3. Student's t-test was used to compare LUC activity driven by the deleted promoter with that driven by the full-length promoter. *P < 0.05. Error bars indicate standard error.

[0049] Fig. 9Figure 1 is a graph of LUC activity from tobacco, where the transcriptional repressor motif of the rice NF-YC4 promoter region is deleted (OsNF-YC4pro1, Os-NF-YC4pro2, and Os-NF-YC4pro3), and the figure is a graph of relative luciferase (LUC) activity compared to the control (OsNF-YC4proFull). Data are expressed as mean ± SE, n = 3. Student's t-test was used to compare LUC activity driven by the deleted promoter with that driven by the full-length promoter. *P < 0.05. Error bars indicate standard error.

[0050] Fig. 10A Is a graph of the mean number of lesions per 10 Arabidopsis plants (± standard error 120 hours after virus inoculation (hai)) for mutants vs. controls. Student's t-test was used to compare the number of lesions between controls and QQS or NF-YC4 mutants. *P<0.05.**P<0.01.***P<0.001.

[0051] Fig. 10B is the average lesion size of mutants vs. controls (mm 2 ) (± standard error at 120 hai after virus inoculation (n=40)). Student's t-test was used to compare the number of foci between control and QQS or NF-YC4 mutants. ***P<0.001.

[0052] Fig.11 is the number of bacteria (log 10 (CFU / cm 2 )). Error bars indicate standard error. Student's t-test was used to compare bacterial numbers of control and QQS or NF-YC4 mutants. **P<0.01.***P<0.001.

[0053] Fig. 12A is the bacterial count of the soybean strain (CFU*10 4 / cm 2 ). Error bars indicate standard error. Student's t-test was used to compare bacterial numbers of control and QQS or NF-YC4 mutants. **P<0.01. (EV=empty vector)

[0054] Fig. 12B is a graph of relative expression levels of NF-YC4-OE soybean lines. Error bars indicate standard error. **P<0.01. (EV=empty vector)

[0055] Fig.13is a graph of the average number of aphids per plant for soybean genotypes QQS-E 16-6 (QQS expressing line 16-6), QQS-E 32-6 (QQS expressing line 32-6), control, NF-YC4-OE L1 (NF-YC4 overexpressing line 1), and NF-YC4-OE L2 (NF-YC4 overexpressing line 2). Error bars indicate standard error. Student's t-test was used to compare the number of aphids in the control and QQS or NF-YC4-OE mutants. *P<0.05. **P<0.01. (EV=empty vector)

[0056] Fig.14A is a graph of protein content of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein content of NF-YC4-OE mutant and sister control. *P<0.05. **P<0.01.

[0057] Fig. 14B is a graph of oil content of transformed soybean overexpressing NF-YC4 (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare oil content of NF-YC4-OE mutant and sister control. *P<0.05.

[0058] Fig. 14C is a graph of protein + oil content of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein + oil content of NF-YC4-OE mutants and sister control. *P<0.05. **P<0.01.

[0059] Fig.14D is a graph of seed fiber (% / g fresh weight, 13% moisture) of transformed soybean overexpressing NF-YC4 (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare fiber content of NF-YC4-OE mutant and sister control. **P<0.01.

[0060] Fig.14EGraph of seed weight per plant (g / plant) of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare seed weight per plant of NF-YC4-OE mutants and sister control.

[0061] Fig.15A is a graph of grain protein (% dry weight) of transformed maize overexpressing Arabidopsis NF-YC4 (AtNF-YC4-OE) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein content of NF-YC4-OE mutant and sister control. **P<0.01.

[0062] Fig. 15B Is a graph of kernel oil (per dry weight %) of transformed maize overexpressing Arabidopsis NF-YC4 (AtNF-YC4-OE) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare the oil content of NF-YC4-OE mutant and sister control.

[0063] Fig. 15C is a graph of grain starch (% dry weight) of transformed maize overexpressing Arabidopsis NF-YC4 (AtNF-YC4-OE) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare starch content of NF-YC4-OE mutant and sister control. **P<0.01.

[0064] Fig.16A is a graph of grain starch (mg / g dry weight) of transformed rice overexpressing rice NF-YC4 (OsNF-YC4-1-OE) compared to wild type. Error bars indicate standard error. Student's t-test was used to compare grain starch content of NF-YC4-OE mutant and control. **P<0.01.

[0065] Fig. 16B is a graph of seed protein (mg / g dry weight) of transformed rice overexpressing rice NF-YC4 (OsNF-YC4-1-OE) compared to wild type. Error bars indicate standard error. Student's t-test was used to compare seed protein content of NF-YC4-OE mutant and control. **P<0.01. DETAILED DESCRIPTION OF THE INVENTION

[0066] The present disclosure is based at least in part on the discovery of genes that interact with QQS. The gene is a transcriptional regulator called NF-YC4. The gene is conserved between eukaryotic species and exists in different plant species from Arabidopsis to major crop varieties such as soybean, rice and corn. Overexpression of NF-YC4 in Arabidopsis mimics overexpression of QQS; protein content increases and carbohydrate content decreases. Therefore, the present disclosure provides materials and methods for operating genes such as NF-YC, especially NF-YC4 (aliases include but are not limited to MLE2.10, MLE2_10 and nuclear factor Y, subunit C), which interact with QQS (referred to herein as "interacting factor genes"). In embodiments, genetic manipulation causes an increase in protein content and / or a decrease in carbohydrate content and / or an increase in resistance to pathogens or pests. Genetic manipulation may involve mutations such as deletions (or insertions, substitutions, inversions, etc.) of transcriptional repressor binding sites (or more than one site / motif, as long as there is more than one, in which case they can mutate in the same way or in different ways) containing transcriptional repressor binding motifs. A transcriptional repressor binding site can be manipulated, such as by mutation, e.g., deletion of one or more transcriptional repressor binding motifs present therein."Modification," "modify," "modifying," and "modified" may be used herein to describe such manipulations.

[0067] NF-YC is part of the NF-Y transcription factor complex. NF-Y includes three subunits, namely NF-YA, NF-YB and NF-YC. Each of these three subunits includes an evolutionarily conserved region. The conserved region is located at the C-terminus of the NF-YA subunit, the N-terminus of the NF-YC subunit and the center of the NF-YB subunit. The NF-YA and NF-YC subunits have a glutamine-rich region that contains the activation domain function and shows a certain degree of conservation. NF-Y is shown to contain two transcriptional activation domains, one in the NF-YA subunit and the other in the NF-YC subunit. There is a histone fold motif (HFM) of about 65 amino acids in length in the NF-YB and NF-YC subunits. The NF-YB and NF-YC subunits form a tight dimer, which is then associated with the NF-YA subunit. The resulting trimer can bind DNA.

[0068] Plant transcription factors include a superfamily called AP2 / ERF. The AP2 / ERF superfamily is defined by the AP2 / ERF domain, which consists of about 60-70 amino acids and is involved in DNA binding. The superfamily includes three families - the AP2 family, the ERF family and the RAV family. The proteins of the AP2 family contain 2 repeated AP2 / ERF domains, the proteins of the ERF family contain a single AP2 / ERF domain, and the proteins of the RAV family contain a single AP2 / ERF domain and a B3 domain, which is a DNA binding domain that is conserved in other plant-specific transcription factors. Additional information is available from the Plant Transcription Factor Database (Plant TFDB) website.

[0069] The example of the transcription repressor binding motif found in the NF-YC4 promoter region is a motif that binds to RAV1. The RAV1 motif sequence is CAACA. RAV1 binds to a bipartite target as a monomer, which is composed of a motif with CAACA and a motif with CACCTG. These two motifs can be separated by 2-8 nucleotides and can be oriented differently from each other (Kagaya et al., Nucleic Acids Res. 27: 470-478 (1999)). As shown above, RAV1 is a transcription factor containing a single AP2 / ERF and B3 domains. Aliases include but are not limited to At1g13260, EDF4, ethylene response DNA binding factor 4, ethylene response transcription factor RAV1, proteins associated with ABI3 / VP1 1, associated with ABI3 / VP1 1, T6J4_2 and T6J4.2. Additional information can be obtained from the iHOP (information hyperlinked over proteins) website and the Plant TFDB website. RAV1 has the following names: UniProt Q9ZWM9, PDB structure 1WID, NCBI gene 837886, NCBI RefSeq NP_172784, NCBI RefSeq NM_101197, NCBI UniGene 837886, NCBI accession numbers BAA34250 and AAG09554. RAV1 homologs include AT3G25730 (Arabidopsis thaliana), TEM1 (Arabidopsis thaliana), RAV2 (Arabidopsis thaliana), Os01g0693400 (Orzya sativa Japonica Group), and Os05g0549800 (Nipponbare rice). All of the above sequence / structure information is available from UniProt, PDB and NCBI and is expressly incorporated herein by reference.

[0070] Another example of a transcriptional repressor binding motif found in the NF-YC4 promoter region is a motif that binds to ERF (ethylene response factor), more specifically a "W box" motif (as found in the ERF3 gene promoter; referred to herein as an ERF motif). The W box motif sequence is TGACY, where Y = C or T. As shown above, ERF is a transcription factor containing a single AP2 / ERF domain. Additional information can be obtained from the Plant TFDB website. For a discussion of genome-wide analysis of the ERF gene family in Arabidopsis and rice, see Nakano et al., Plant Physiol. 140 (2): 411-432 (2006), which is incorporated herein by reference for its teachings on the above.

[0071] Therefore, in view of the above, the present disclosure provides a method for increasing protein content in a eukaryotic cell containing a NF-YC4 gene. The NF-YC4 gene comprises a promoter, and the promoter comprises a transcriptional repressor binding site. A method for producing a plant with increased protein content is also provided. Further provided is a method for increasing resistance to stress, such as abiotic stress (e.g., salt, drought, pollution) or biotic stress such as pathogens or pests in plant cells or plants, especially plants at risk of infection with pathogens or pests. The plant includes a NF-YC4 gene, which comprises a promoter, and the promoter comprises a transcriptional repressor binding site. A method for producing a plant with increased resistance to pathogens or pests is also provided.

[0072] The above method includes operating or modifying the transcription repressor binding site, so that the transcription repressor cannot hinder NF-YC4 transcription. The transcription repressor binding site can include, essentially consist of, or consist of an ERF motif and / or a RAV 1 motif, one or all of which can be operated or modified, such as missing, for example, using TALENS or CRISPR / Cas9. When operating or modifying 2 or more motifs, they can be operated or modified in the same or different manners. The method does not encompass replacing a complete promoter with another promoter such as a constitutive promoter.

[0073] The NF-YC4 gene can be a eukaryotic NF-YC4 gene, such as an NF-YC4 gene from an animal, an NF-YC4 gene from a fungus, an NF-YC4 gene from an algae, or an NF-YC4 gene from a plant. Examples of NF-YC4 genes include, but are not limited to, those present in Brassica napus (CDS available from GenBank Accession No. KC797143.1), Medicago truncatula (CDS available from GenBank Accession No. JQ918296.1), Arabidopsis thaliana (Gene ID 836466; TAIR AT5G63470 (AT5G63470.1 and AT5G63470.2); The genomic sequence can be obtained from NC_003076.8 (25415701.25417117, supplemented), CDS can be obtained from GenBank accession numbers NM_125742.5 and NM_001037053.1)), soybean (Glyma06g17780 and Glyma04g37291), rice (Os3g14669, Os02g07450 and Os06g45640) and corn (GrmZm2g089812). Another gene was also identified in Chlamydomonas reinhardtii (Cre12.g556400; Cre12.g556400.t1.3). In an embodiment of the method, the NF-YC4 gene coding region is not manipulated or modified. In another embodiment of the method, the NF-YC4 gene coding region is manipulated or modified, such as manipulated or modified (eg, inserted, deleted, substituted, inverted, or truncated at the N or C terminus) to increase the protein content.

[0074] Other NF-YC4 genes (including homologs, orthologs and paralogs) can be identified by methods known in the art. For example, genes can be identified by searching databases for conserved domains with amino acid sequence identity to the NF-YC4 genes identified herein. The degeneracy of the genetic code allows highly variable nucleotide sequences to be translated into proteins with highly similar and even identical amino acid sequences. Programs such as MEGALIGN (DNAStar, Inc., Madison, WI) can be used to compare between two or more sequences according to different methods such as clustal analysis (Higgin et al., Gene 73:237-244 (1988)). Other alignment algorithms and programs include FASTA, BLAST and ENTREZ (NCBI; Altschul et al., J. Mol. Evol. 36:290-300 (1993); Altschul et al., J. Mol. Biol. 215:403-410 (1990)). See also GCG program (U.S. Patent No. 6,262,333) and other alignment techniques, described in Doolittle, Methods in Enzymology 266, "Computer Methods for Macromolecular Sequence Analysis," Academic Press, Inc., San Diego, CA (1996). The Smith-Waterman algorithm allows gaps in sequence alignments, and the algorithm can be performed using the MASPAR computer and MPSRCH software. The GAP program uses the Needleman and Wunsch alignment method and can also be used to align sequences. Additionally or alternatively, transcriptional profiles after overexpression or knockout of 2 or more related transcription factors can be compared. Manual methods can also be used to identify regions with similarities and conserved domains and can involve tertiary structure comparisons. Once identified, this gene can be cloned according to methods known in the art.

[0075] Other NF-YC4 genes can also be identified by hybridization under stringent or highly stringent conditions. Stringency is affected by a variety of factors in hybridization and washing solutions, such as temperature, salt concentration and composition, organic and non-organic additives, solvents, etc. (see, e.g., Sambrook et al., supra; Nucleic Acid Hybridization: A Practical Approach, Hames and Higgins, eds, IRL Press, Washington, DC (1985)). Hybridization assays such as Southern blotting, Northern blotting, solution hybridization, etc. can be used (see, e.g., Sambrook et al., supra).

[0076] With respect to the sequences described herein, the sequence identity percentage ranges from about 55% to 100%. In view of the fact that the NF-YC4 gene is highly conserved in a wide range of eukaryotic organisms, the sequence identity percentage, especially at the amino acid level, ranges from about 60% to 100%, such as about 65% to 100%, about 70% to 100%, about 75% to 100%, about 80% to 100%, about 85% to 100%, about 90% to 100%, or about 95% to 100%, such as about 96%, about 97%, about 98% or about 99%.

[0077] The NF-YC4 region to be manipulated or modified is the promoter region. More specifically, the transcription repressor binding site that binds the transcription repressor is manipulated or modified, such as by mutation, particularly deletion (or insertion, substitution, inversion, etc.) manipulation or modification, to hinder or inhibit the binding of the transcription repressor to the binding site, thereby changing the biochemical composition of eukaryotic organisms such as plants. Specifically, the transcription repressor binding site motif is manipulated or modified. For example, the composition of storage products such as proteins, carbohydrates and lipids can be changed. More specifically, the protein content can be increased and / or the carbohydrate content can be reduced.

[0078] SEQ ID NO: 1 shows the promoter region of rice NF-YC4 gene (Os03g14669) (see Figure 2A ). The RAV1 motif (reverse) is shown in bold, while the RAV1 (reverse) and ERF (forward) motifs are shown in underlined bold, and the ERF motif (reverse) is shown in italic bold.

[0079] SEQ ID NO: 2 shows the promoter region of the rice NF-YC4 gene, in which the RAV1 (reverse) motif (TGTTG, see bold in SEQ ID NO: 1) is deleted. The RAV1 (reverse) and ERF (forward) motifs are underlined and bold, while the ERF motif (reverse) is shown in bold italics.

[0080] SEQ ID NO:3 shows the promoter region of the rice NF-YC4 gene, in which the overlapping sequences of the RAV1 (reverse) motif and the ERF (forward) motif are deleted (TGTTGACT; see the underlined bold in SEQ ID NO:1). The RAV1 motif (reverse) is shown in bold, while the ERF motif (reverse) is shown in bold italics.

[0081] SEQ ID NO:4 shows the promoter region of rice NF-YC4 gene, wherein a 111 bp segment is deleted, containing 2 ERF motifs (inverse direction) See the 2 bold italic ERFs and the intervening sequence in SEQ ID NO:1) (see Figure 2B ). The RAV1 motif (reverse) is shown in bold, and the RAV1 (reverse) and ERF (forward) motifs are shown in underlined bold.

[0082] SEQ ID NO:6 shows the promoter region of the rice NF-YC4 gene, wherein a 190 bp segment is deleted, comprising 2 ERF motifs (reverse), RAV1 (reverse) and ERF (forward) motifs and an intervening sequence See SEQ ID NO: 1 for the 2 bold italic ERF motifs (reverse), the underlined bold RAV1 (reverse) and ERF (forward) motifs, and the intervening sequences) (see Figure 2C ). The RAV1 motif (inverted) is shown in bold.

[0083] In embodiments of the methods involving rice cells or rice plants, (i) both ERF motifs can be deleted, (ii) the RAV1 motif can be deleted, or (iii) the RAV1 motif and the ERF motif can be deleted.

[0084] SEQ ID NO: 8 shows the promoter region of soybean NF-YC4 gene (Glyma06g17780) (see Figure 2C ). The ERF motif (reverse) is in bold italics, the RAV1 motif (reverse) is in bold, and the RAV1 motif (forward) is in underlined bold.

[0085] SEQ ID NO: 9 shows the promoter region of the soybean NF-YC4 gene, wherein the ERF motif (reverse), the RAV1 motif (forward) and the intervening sequence are deleted. See bold italics and underlined bold in SEQ ID NO:8) (see Figure 2D ). The ERF motif (inverted) is shown in bold italics and the RAV1 motif (inverted) is shown in bold.

[0086] SEQ ID NO: 11 shows the promoter region of the soybean NF-YC4 gene, wherein the ERF motif (reverse), the RAV1 motif (forward) and the intervening sequence are deleted See bold italics and bold in SEQ ID NO:8) (see Figure 2D ). The ERF motif (reverse) is in bold italics, the RAV1 motif (reverse) is in bold, and the RAV1 motif (forward) is in underlined bold.

[0087] SEQ ID NO: 13 shows the promoter region of soybean NF-YC4 gene, wherein two RAV1 motifs and the intervening sequence are deleted See bold in SEQ ID NO:8) (see Figure 2E ). The ERF motif (reverse) is in bold italics, the RAV1 motif (reverse) is in bold, and the RAV1 motif (forward) is in underlined bold.

[0088] In embodiments of the methods involving soybean cells or soybean plants, (i) both RAV1 motifs can be deleted, or (ii) a RAV1 motif and an ERF motif can be deleted.

[0089] SEQ ID NO:20 shows the promoter region of the maize NF-YC4 gene. The two RAV1 motifs (forward) are shown in bold. In embodiments of the methods involving maize cells or maize plants, one or both of the RAV1 motifs can be deleted.

[0090] The region can be modified by any suitable method known in the art. For example, site-specific or site-specific mutagenesis, optimized directed evolution, gene site saturation mutagenesis (GSSM), synthetic ligation reassembly (SLR), error-prone PCR, rearrangement, oligonucleotide site-specific mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutation, cassette mutation, cyclic global mutagenesis, exponential global mutagenesis, gene reassembly, SLR recombination, recursive sequence recombination, thiophosphate-modified DNA mutation, uracil-containing template mutation, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction selection mutagenesis, restriction purification mutagenesis, Artificial gene synthesis, global mutagenesis, chimeric nucleic acid polymer generation or other targeted mutation technologies such as genome engineering, using large-range nucleases, transposons, recombinases, chemical DNA incisions and programmable nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), RNA-guided engineered nucleases (RGENs) and bacterial type II clustered, regularly interspaced short palindromic repeats (CRISPR)-Cas (CRISPR-associated) adaptive immune systems. The following genome engineering can be used to perform targeted genetic modification in cultured cells, plants and animals by cutting chromosomal DNA in a site-specific manner (stimulating endogenous DNA repair systems, causing targeted genome modification): ZFN (amino-terminal zinc finger protein (ZFP) and carboxyl-terminal Fok I or other nuclease domains), TALEN (amino-terminal transcription activator-like effector (TALE) and carboxyl-terminal Fok I or other nuclease domains), RGEN and CRISPR-Cas systems. For a review, see Kim et al., Nature Reviews (Genetics) 15:321-334 (May 2014), which is incorporated herein by reference for its teachings on the above. See also references 178-180 cited therein (and incorporated by reference) for the use of engineered nucleases to improve transgenic crops, and references 32 and 168 cited therein (and incorporated by reference) for the use of engineered nucleases to enrich livestock with certain nutrients or to make them disease-resistant.

[0091] The off-target effects of RGEN and other nucleases can be minimized or avoided. For example, it is important to select unique target sites that lack highly homologous sequences elsewhere in the genome. Such sites can be identified by searching, using computer algorithms for TALEN. In addition, web-based programs can be used for TALEN and RGEN, as shown below. It is also important to optimize the expression level of nucleases for RGEN. The use of modified guide RNAs or truncated sgRNAs with 2 extra guanines at the 5' end can reduce off-target mutations. Using recombinant proteins on plasmids to introduce programmable nucleases reduces off-target mutations due to the rapid degradation of recombinant proteins in cells. Finally, DNA nickases ("nickases") that break single strands into DNA can minimize off-target mutations.

[0092] In one embodiment, TALEN is used (see, e.g., U.S. Patent Application Publication No. 2011 / 0201118, which is hereby incorporated by reference in its entirety, particularly pages 50, line 14 to page 58, line 4, page 64, line 2 to page 66, line 29, and Figures 1-3 and 10-16; see also U.S. Patent No. 8,586,363, which is hereby incorporated by reference in its entirety; see also U.S. Patent Application Publication No. 2014 / 335618, which is hereby incorporated by reference in its entirety; see also U.S. Patent Application Publication No. 2014 / 335592, which is hereby incorporated by reference in its entirety; see also U.S. Patent Application No. 2013 / 0122581 and U.S. Patent No. 8,697,853, both of which are hereby incorporated by reference in their entirety; see also U.S. Patent Application Publication No. 2012 / 21 4228 and U.S. Patent No. 8,450,471, both of which are hereby incorporated by reference in their entireties; see also U.S. Patent Application Publication No. 2012 / 178169 and U.S. Patent No. 8,440432, both of which are hereby incorporated by reference in their entireties; see also U.S. Patent Application Publication No. 2012 / 178131 and U.S. Patent No. 8,440,431, both of which are hereby incorporated by reference in their entireties; see also U.S. Patent Application Publication No. 2011 / 0301073 and U.S. Patent No. 8586526, both of which are hereby incorporated by reference in their entireties; U.S. Patent Application Publication No. 2014 / 087426, which is hereby incorporated by reference in its entirety; see also U.S. Patent Application Publication No. 2014 / 0073015 and U.S. Patent No. 8,748,134, both of which are hereby incorporated by reference in their entireties). Because TALEN can be designed to target almost any given DNA sequence, TALEN provides a key advantage over other nuclease types, although it is recommended to select target sequences with thymine at the 5' end, thereby avoiding target sequences with methylated cytosine or replacing the His-Asp RVD repeats that recognize cytosine with Asn-Gly RVD repeats that recognize thymine and thus recognize methylated cytosine. The TAL effector can be any suitable TAL effector. For example, naturally occurring TAL effectors (i.e., wild-type TAL effectors or naturally occurring mutant TAL effectors) or artificial TAL effectors (such as mutant, naturally occurring TAL effectors or synthetic TAL effectors) can be used. An example of a TAL effector is AvrXa7, from Xanthomonas spp. bacteria or Ralstonia spp. bacteria (see, for example, International Patent Application Publication No. WO 2013 / 101877, which is incorporated herein by reference in its entirety). The nuclease cuts both DNA chains and allows modification of the DNA sequence at the cleavage site. The construct size is ~3 kb x 2. The specific length of the target site is about 30 bp to about 40 bp.The target site ideally starts with thymine and ends with adenine. Online resources such as E-TALEN, Genome Engineering Resources, Scoring Algorithms for Predicting TALE(N) Activity, ToolGen TALEN Designer, and ZiFiT Targeter Software can be used to design TALEN; see also Addgene and TALEN Collection Resources. TALEN is available from commercial suppliers such as CellectisBioresearch, Life Technologies, ToolGen, and Transposagen Biopharmaceuticals.

[0093] Therefore, in an embodiment, the present disclosure provides a method for increasing protein content in a eukaryotic cell containing a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter, and the promoter comprises a transcription repressor binding site. The method includes modifying the transcription repressor binding site of the NF-YC4 gene so that the transcription repressor cannot hinder NF-YC4 transcription. The method includes introducing a first transcription activator-like (TAL) effector endonuclease monomer and a second TAL effector endonuclease monomer into the cell. The monomer can be introduced into the cell by any suitable method, such as transfecting the cell with a nucleic acid encoding the first or second monomer and / or mechanically injecting the protein of the first or second monomer into the cell. When delivered as a protein, a bacterial type III secretion system or electroporation can be used. Each TAL effector endonuclease monomer includes an endonuclease domain, such as a non-specific endonuclease domain, such as a Fok I endonuclease domain, and a TAL effector domain containing multiple TAL effector repeat sequences. A plurality of TAL effector repeat sequences (such as 15 or more DNA binding repeat sequences, such as DNA binding repeat sequences, each including a repeat variable diresidue (RVD), which determines the base pair recognition of the NF-YC4 promoter region and is responsible for recognizing the base pairs of the NF-YC4 promoter region) of the first TAL effector endonuclease monomer are combined to bind to the first specific nucleotide sequence of the NF-YC4 gene promoter region. A plurality of TAL effector repeat sequences (such as 15 or more DNA binding repeat sequences, such as DNA binding repeat sequences, each including RVD, which determines the base pair recognition of the NF-YC4 promoter region and is responsible for recognizing the base pairs of the NF-YC4 promoter region) of the second TAL effector endonuclease monomer are combined to bind to the second specific nucleotide sequence of the NF-YC4 gene promoter region. The first specific nucleotide sequence is different from the second specific nucleotide sequence and is separated by a spacer sequence, such as a spacer sequence of about 12-30 nucleotides in length, for example, 18 nucleotides. The first specific nucleotide sequence and the second specific nucleotide sequence are selected to achieve modification, such as deleting the transcription repressor binding site of the NF-YC4 gene promoter region. The transcription repressor binding site can include an ERF motif or a RAV1 motif; in this regard, two or more ERF motifs, two or more RAV1 motifs, or a combination of ERF and RAV1 motifs can be modified by, for example, deletion. The endonuclease domain of the first TAL effector endonuclease monomer and the endonuclease domain of the second TAL effector endonuclease monomer form a dimer, and when the TAL effector domain of the first TAL effector endonuclease monomer binds to a first specific nucleotide sequence and the TAL effector domain of the second TAL effector endonuclease monomer binds to a second specific nucleotide sequence, the dimer cleaves a target DNA sequence within a cell or its progeny.The method can further comprise providing to the cell a nucleic acid comprising a sequence homologous to at least a portion of the target DNA sequence, such that homologous recombination occurs between the target DNA sequence and the nucleic acid. The protein content of the eukaryotic cell is increased, and thus, the method can further comprise selecting for increased protein content.

[0094] The eukaryotic cell can be part of a cell collection, tissue, organ or organism. When it comes to a cell or cell collection or its progeny, the method can also include producing a genetically modified tissue, organ or organism therefrom. The organism can be a plant, such as a crop such as soybean, rice or corn, a monocot, a dicot, an algae such as a unicellular flagellate, such as a Chlamydomonas species. In embodiments, the organism is soybean, rice or corn. Plants can be hybridized and backcrossed and selected for increased protein content according to methods known in the art and described herein.

[0095] In another embodiment, the present disclosure provides a method for increasing resistance to pathogens or pests in a plant cell containing a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter comprising a transcriptional repressor binding site. The pathogen may be a bacterium, a virus, a fungus or a seed plant and wherein the pest is an insect, a plasmodiophorid, a mite or a nematode, all examples of which are known in the art and described herein. In an embodiment, the pathogen is a bacterium or a virus and the pest is an aphid. The method comprises modifying the transcriptional repressor binding site of the NF-YC4 gene so that the transcriptional repressor cannot hinder the transcription of the NF-YC4 gene. The method comprises introducing into the cell a first transcription activator-like (TAL) effector endonuclease monomer and a second TAL effector endonuclease monomer. The monomer can be introduced into the cell by any suitable method, such as transfecting the cell with a nucleic acid encoding the first or second monomer and / or mechanically injecting the protein of the first or second monomer into the cell. When delivered as a protein, a bacterial type III secretion system or electroporation can be used. Each TAL effector endonuclease monomer includes an endonuclease domain, such as a non-specific endonuclease domain such as a Fok I endonuclease domain, and a TAL effector domain containing multiple TAL effector repeats. The multiple TAL effector repeats of the first TAL effector endonuclease monomer (such as 15 or more DNA binding repeats, such as DNA binding repeats, each including a repeat variable diresidue (RVD), which determines the base pair recognition of the NF-YC4 promoter region and is responsible for recognizing the base pairs of the NF-YC4 promoter region) are combined to bind to the first specific nucleotide sequence of the NF-YC4 gene promoter region. The multiple TAL effector repeats of the second TAL effector endonuclease monomer (such as 15 or more DNA binding repeats, such as DNA binding repeats, each including RVD, which determines the base pair recognition of the NF-YC4 promoter region and is responsible for recognizing the base pairs of the NF-YC4 promoter region) are combined to bind to the second specific nucleotide sequence of the NF-YC4 gene promoter region. The first specific nucleotide sequence is different from the second specific nucleotide sequence and is separated by a spacer sequence, such as a spacer sequence of about 12-30 nucleotides, for example, 18 nucleotides in length. The first specific nucleotide sequence and the second specific nucleotide sequence are selected to achieve modification, such as deletion of a transcriptional repressor binding site in the promoter region of the NF-YC4 gene. The transcriptional repressor binding site can include an ERF motif or a RAV1 motif; in this regard, 2 or more ERF motifs, 2 or more RAV1 motifs, or a combination of ERF and RAV1 motifs can be modified by, for example, deletion.The endonuclease domain of the first TAL effector endonuclease monomer and the endonuclease domain of the second TAL effector endonuclease monomer form a dimer, and when the TAL effector domain of the first TAL effector endonuclease monomer binds to the first specific nucleotide sequence and the TAL effector domain of the second TAL effector endonuclease monomer binds to the second specific nucleotide sequence, the dimer cleaves the target DNA sequence in the cell or its progeny. The method can also include providing a nucleic acid to the plant cell, the sequence contained is homologous to at least a portion of the target DNA sequence, so that homologous recombination occurs between the target DNA sequence and the nucleic acid. Resistance to pathogens or pests in plant cells is increased, and thus, the method can also include selecting for increased resistance to pathogens or pests.

[0096] The method can also include introducing a polynucleotide containing a nucleotide sequence encoding a Qua-Quine Starch (QQS) polypeptide into a plant or plant cell and expressing it therein, wherein the polypeptide has an amino acid sequence as shown in SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter.

[0097] The plant cell can be a part of a collection of cells, a tissue, an organ or an organism. When it comes to cells or collections of cells or their progeny, the method can also include producing a genetically modified tissue, organ or organism therefrom. The plant can be a crop plant such as soybean, rice or corn, a monocot or a dicot. The plants can be hybridized and backcrossed, and selected for increased resistance to pathogens or pests according to methods known in the art and described herein.

[0098] In another embodiment, a CRISPR-Cas system is used. Target-specific crRNA and target-independent trans-activating crRNA (tracrRNA) are complexed with CRISPR-associated protein 9 (Cas9) to form an active DNA endonuclease, i.e., dualRNA-Cas9. The endonuclease cuts a 23-bp target DNA sequence, which is composed of a 20-bp guide sequence in crRNA and a protospacer sequence adjacent motif (PAM; 5'-NGG-3' or 5'-NAG-3'). Any suitable Cas9 can be used, such as Cas9 from Streptococcus pyogenes. Because CRISPR-Cas / RGEN is easy to design and prepare, CRISPR / Cas provides a key advantage over TALEN, although the RGEN target site is limited by the requirements for the PAM sequence, which is recognized by Cas9 (i.e., 5'-X 20 NGG-3' or 5'-X 20 NAG-3', where X 20Corresponding to a 20-bp crRNA sequence), it is recommended that 5' guanine be present in the target sequence or 1 or 2 guanine bases be added to the 5' end of the guide RNA. The construct size is generally about 4.2k (Cas9+0.1kb (sgRNA) from Streptococcus pyogenes). The specific determination length of the target site is generally 22bp (for a total of 23bp length). The target site ideally ends at NGG or NAG (i.e., PAM, as shown above). Online resources such as E-TALEN, genome engineering resources, RGEN tools, and ZiFiT Targeter software can be used; see also Addgene. CRISPR / Cas system components are available from commercial suppliers such as Life Technologies, Sigma-Aldrich, System Biosciences, ToolGen, and Transposagen Biopharmaceuticals.

[0099] Therefore, in another embodiment, the present disclosure provides a method for increasing protein content in a eukaryotic cell containing a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter comprising a transcription repressor binding site. The method includes modifying the transcription repressor binding site of the NF-YC4 gene so that the transcription repressor cannot hinder NF-YC4 transcription. The method includes introducing dualRNA-Cas9, i.e., an active DNA endonuclease, into the cell, which is formed by a complex with CRISPR-associated protein 9 (Cas9) by target-specific crRNA and target-independent trans-activation crRNA (tracrRNA). The endonuclease cuts a 23-bp target DNA sequence (see, e.g., SEQ ID NO: 6 and 7 herein and Example 18), which is composed of a 20-bp guide sequence in crRNA and a protospacer sequence adjacent motif (PAM; 5'-NGG-3' or 5'-NAG-3'). Any suitable Cas9 can be used, such as Cas9 from Streptococcus pyogenes. Embryogenic callus of plants can be transformed by Agrobacterium-mediated gene transfer. Primary transgenic lines can be screened for site-specific DNA changes and identified, and PCR genotyping can be used to identify mutants with deleted sequences. The protein content of eukaryotic cells is increased, and therefore, the method can also include selecting for increased protein content.

[0100] The eukaryotic cell can be part of a cell collection, tissue, organ or organism. When it comes to a cell or cell collection or its progeny, the method can also include producing a genetically modified tissue, organ or organism therefrom. The organism can be a plant, such as a crop such as soybean, rice or corn, a monocot, a dicot, or an algae such as a unicellular flagellate, such as a Chlamydomonas species. In embodiments, the organism is soybean, rice or corn. Plants can be hybridized and backcrossed and selected for increased protein content according to methods known in the art and described herein.

[0101] In another embodiment, the present disclosure provides a method for improving resistance to pathogens or pests in a plant cell containing a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter comprising a transcriptional repressor binding site. The pathogen may be a bacterium, a virus, a fungus or a seed plant and wherein the pest is an insect, a protoplasma, a mite or a nematode, all of which are known in the art and described herein. In an embodiment, the pathogen is a bacterium or a virus, and the pest is an aphid. The method includes modifying the transcriptional repressor binding site of the NF-YC4 gene so that the transcriptional repressor cannot hinder the transcription of the NF-YC4 gene. The method includes introducing dualRNA-Cas9, i.e., an active DNA endonuclease, into a cell, which is formed by a complex of a target-specific crRNA and a target-independent trans-activating crRNA (tracrRNA) with a CRISPR-associated protein 9 (Cas9). The endonuclease cleaves a 23-bp target DNA sequence consisting of a 20-bp guide sequence in the crRNA and a protospacer adjacent motif (PAM; 5'-NGG-3' or 5'-NAG-3'). Any suitable Cas9 can be used, such as Cas9 from Streptococcus pyogenes. Resistance to pathogens or pests in plant cells is increased, and therefore, the method can also include selecting for increased resistance to pathogens or pests.

[0102] The method can also include introducing a polynucleotide containing a nucleotide sequence encoding a Qua-Quine Starch (QQS) polypeptide into plant cells or plants and expressing it therein, wherein the polypeptide has the amino acid sequence shown in SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter.

[0103] The plant cell can be a part of a collection of cells, a tissue, an organ or an organism. When it comes to cells or collections of cells or their progeny, the method can also include producing a genetically modified tissue, organ or organism therefrom. The plant can be a crop plant such as soybean, rice or corn, a monocot or a dicot. The plants can be hybridized and backcrossed, and selected for increased resistance to pathogens or pests according to methods known in the art and described herein.

[0104] Programmable nucleases and / or homologous templates such as targeting vectors or single-stranded oligodeoxynucleotides (ssODN) are delivered to target cells using any suitable method known in the art. For example, such methods include delivery of plasmid DNA, in vitro transcribed mRNA, viral vectors or purified proteins to cultured cells, embryos or complete organisms. Programmable nucleases are often introduced into cell lines by electroporation or liposome transfection of plasmid DNA. In vitro transcribed mRNA is usually microinjected into single-cell embryos. Non-integrating viral vectors such as integrase-deficient lentiviral vectors (IDLV), adenovirus and adeno-associated virus (AAV) can be used in vitro or in vivo, although IDLV may be incompatible with TALEN, due to the presence of highly homologous TALE repeats, which can lead to unwanted recombination events. The use of protein avoids the unnecessary inclusion of foreign DNA, eliminates problems with codon optimization and promoter selection, and is convenient for RGEN because it is not necessary to purify Cas9 from scratch to construct new nucleases.

[0105] Translocation of TAL-cleavage domain fusion proteins across cell membranes can be facilitated by using peptide sequences such as the Antennapedia mutant third helix (Prochiantz, Curr. Opi. Neurobiol. 6:629-634 (1996); Derossi et al., J. Biol. Chem. 269:10444 (1994)), or a signal peptide hydrophobic domain such as the signal peptide K-FGF (Lin et al., J. Biol. Chem. 270:14255-14258 (1995)). Other peptides include the 11-amino acid peptide of the tat protein of HIV, which is a 20-residue peptide sequence corresponding to amino acids 84-103 of the p16 protein (Fahracus et al., Curr. Biol. 6:84 (1996)), the VP22 transport domain from HSV (Elliot et al., Cell 88:223-233 (1997)), and the binary toxin (Arora et al., J. Biol. Chem. 268:3334-3341 (1993); Perelle et al., Infect. Immun. 61:5147-5156 (1993); Stennark et al., J. Cell Biol. 113:1025-1032 (1991); Donnelly et al., PNAS USA 90:3530-3534 (1993); Carbonetti et al., Abstr. Ann. Meet. Am. Soc. Microbiol. 95:295 (1995); Sebo et al., Infect. Immun. 63:3851-3857 (1995); Klimpel et al., PNAS USA 89:10277-10281 (1992); and Novak et al., J. Biol. Chem. 267:17186-17193 (1992). The peptide sequence can be fused to the TAL-cleavage fusion protein. Optionally, a linker such as a peptide linker can be used.

[0106] The method of increasing resistance to pathogens or pests in plant cells or plants at risk of infection with pathogens or pests can also include introducing a polynucleotide containing a nucleotide sequence encoding a Qua-Quine Starch (QQS) polypeptide (SEQ ID NO: 16) into a plant and expressing it therein. The nucleotide sequence is operably linked to a promoter. Therefore, in one embodiment, the method further includes (a) transforming a plant cell with a polynucleotide containing a nucleotide sequence encoding a QQS polypeptide, the polypeptide having an amino acid sequence of SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter, (b) regenerating a transgenic plant from the plant cell, and (c) identifying and selecting a transformed plant from the transgenic plant that shows increased resistance to pathogens or pests compared to an untransformed plant of the same species lacking QQS and grown under similar conditions.

[0107] QQS can be expressed in plants by any suitable means known in the art (see, e.g., U.S. Pat. No. 9,157,091, issued Oct. 13, 2015, which is incorporated herein by reference, and the teachings thereof relate to the same; see, e.g., Examples 1 and 2 and the detailed description therein, portions of which are reproduced in this and the next two paragraphs for ease of reference). For example, QQS can be introduced into plants as a transgene using electroporation, gene guns, Agrobacterium-mediated transformation (as exemplified in Examples 1 and 2 and U.S. Pat. No. 9,157,091), and direct contact with protoplasts. Transformation / transfection (and other techniques for introducing DNA into plants or fungi) and regeneration of monocots and dicots are conventional. The specific method used depends in part on the type of plant or fungus to be transformed / transfected. For example, various procedures are described in Agrobacterium Protocols, 2nd edition, Volumes 1 and 2, Methods in Molecular Biology, compiled by Kan Wang, published by Humana Press, Totowa, New Jersey, which is expressly incorporated herein by reference in its entirety. Such procedures include methods for floral dip transformation and transformation of leaf explants, cotyledon explants, and root explants, as well as specific procedures for transformation of barrel clover, tobacco, barley, corn, rice (indica and japonica), rye, sorghum, wheat, canola, cotton, mustard, sunflower, alfalfa, chickpea, clover, pea, peanut, pigeon pea, red clover, soybean, broad bean, taro, cabbage, cucumber, eggplant, lettuce, tomato, carrot, cassava, potato, sweet potato, yam, Bermuda grass, ryegrass, switchgrass, tall fescue, turfgrass, American elm, cork oak, eucalyptus, Pine, poplar, rubber tree, banana, citrus, coffee, papaya, pineapple, sugar cane, American chestnut, apple, blueberry, grape, strawberry, walnut, carnation, chrysanthemum, orchid, petunia, rose, ginseng, cannabis, poppy and mushroom. Other methods of Agrobacterium-mediated transformation of cereals are described in Shrawat et al., Plant Biotech. J. 4 (6): 575-603 (November 2006), which is expressly incorporated herein by reference in its entirety. Other methods of transforming beans are described in Somers et al., Plant Physiol. 131 (3): 892-899 (March 2003), which is expressly incorporated herein by reference in its entirety. Methods for transforming rice are described in Giri et al., Biotech. Adv. 18(8):653-683 (December 2000) and Hiei et al., Plant Mol. Biol. 35(1-2):205-218 (September 1997), both of which are expressly incorporated herein by reference in their entirety.Vasil et al., Methods Molec. Biol. 111: 349-358 (1999) and Jones et al., Plant Methods 1(1): 5 (September 5, 2005), both of which are expressly incorporated herein by reference in their entirety, describe methods for transforming wheat. The use of direct DNA uptake in barley is described in Lazzeri, Methods Molec. Biol. 49: 95-106 (1996), which is expressly incorporated herein by reference in its entirety. The use of intermittent immersion in a bioreactor system to transform strawberry is described in Hanhineva et al., BMC Biotech. 7: 11 (2007), which is expressly incorporated herein by reference in its entirety. The introduction of transgenes into plastids such as chloroplasts, particularly chloroplasts in tobacco, is described in Daniell et al., Trends Biotech. 23(5): 238-245 (May 2005), which is expressly incorporated herein by reference in its entirety. In this regard, Lutz et al., Plant Physiol. 145(4): 1201-1210 (2007) (expressly incorporated herein by reference in its entirety) provides guidance in selecting vectors for transformation of plastid genomes in higher plants. Somatic embryogenesis of species-specific chloroplast vectors has also been applied to plants such as soybean, carrot and cotton. Other methods for transformation of sugar beet are described in Golovko et al., Tsitol. Genet. 39(3): 30-36 (May-June 2005), which is expressly incorporated herein by reference in its entirety.

[0108] The nucleotide sequence encoding the QQS coding domain sequence (CDS) can be incorporated into a vector or cassette (collectively referred to herein as a vector) for expression in plants. A number of expression vectors suitable for transforming plant cells or establishing transgenic plants have been described (see, e.g., Weissbach et al., Methods for Plant Molecular Biology, Academic Press, New York, NY (1989); and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, Norwell, MA (1990)). Ti plasmids or binary Agrobacterium vectors from Agrobacterium tumefaciens (Bevan, Nucl. Acids Res. 12:8711-8721 (1984)) can be used to transform monocots and dicots. Non-Ti vectors such as viral vectors can be used to transfer DNA into plant cells, tissues, embryos, and plants. Non-Ti vectors can be introduced by using: liposome-mediated transformation, polyethylene glycol (PEG)-mediated transformation, viral transfection, microinjection, vacuum infiltration, electroporation of plant protoplasts, gene guns, silicon carbide whiskers, etc. See, for example, Ammirato et al., Handbook of Plant Cell Culture-Crop Species, MacMillan Pub. Co. (1984); Shimamoto et al., Nature 338: 274-276 (1989); Fromm et al., Bio / Technology 8: 833-839 (1990); and Vasil et al., Biol. Technology 8: 429-434 (1990).

[0109] In addition to the coding sequence, the plant transformation / transfection vector includes one or more 5' and 3' transcriptional regulatory sequences. The transcriptional regulatory sequence can include a promoter, a transcription start site, a transcription stop site, a polyadenylation signal, and a 3' terminator region (e.g., the PI-II terminator region of potato, the octopine synthase 3' terminator region, or the nopaline synthase 3' terminator region). If conventional nuclear processed introns are present, one or more RNA processing signals such as intron splicing sites can also be included. Any suitable promoter can be used. In this regard, the QQS promoter can be used. Alternatively, a non-QQS promoter can be used. For example, the promoter can be constitutive, synthetic (e.g., hybrid), inducible, developmentally regulated, environmentally regulated, hormonally regulated, chemically regulated, cell-specific, or tissue-specific (e.g., seed-specific). Constitutive promoters include the cauliflower mosaic virus (CaMV) 35S promoter, the nopaline synthase promoter, and the octopine synthase promoter. For example, inducible promoters regulated by the environment include promoters induced by light. napin promoter, phaseolin promoter and DC3 promoter are examples of seed-specific promoters, while dru1 promoter, 2A11 promoter and tomato polygalacturonase promoter are examples of fruit-specific promoters, and PTA29, PTA26 and PTA13 are examples of pollen-specific promoters. The pBAN promoter is a seed coat promoter of Arabidopsis thaliana, while p26, p63 and p63tr are early seed promoters from Arabidopsis thaliana (see, e.g., U.S. Patent Application Publication No. 2009 / 0031450). Examples of root-specific promoters are described in U.S. Patent Nos. 5,618,988; 5,837,848; and 5,905,186. Other promoters are induced by auxin, cytokinin, gibberellin, methyl jasmonate, salicylic acid, heat, light, etc.

[0110] The implementation method adopts conventional techniques known in the art and described in the literature and herein. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd and 3rd editions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989 and 2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY (1987); Methods in Enzymology, Academic Press, Inc., San Diego, CA, specifically volume 34 "Chromatin"; Chromatin Structure and Function, 3rd edition, Academic Press, Inc., San Diego, CA (1998); and Methods in Molecular Biology, Humana Press, Totowa, New Jersey, specifically volume 119, "Chromatin Protocols".

[0111] For conventional techniques for introducing DNA constructs into the host plant genome, see, for example, Weissbach & Weissbach, Methods for Plant Molecular Biology,, Chapter VIII, pages 421-463, Academic Press, New York, NY (1988) and Grierson & Corey, Plant Molecular Biology, 2nd edition, Blackie, London, UK (1988). For example, DNA constructs can be introduced directly into plant cell genomic DNA using techniques such as electroporation and microinjection of plant cell protoplasts, or DNA constructs can be introduced directly into plant tissues using particle gun techniques such as DNA particle bombardment (see, for example, Klein et al., Nature 327: 70-73 (1987)). Alternatively, DNA constructs can be combined with appropriate T-DNA flanking regions and introduced into conventional Agrobacterium tumefaciens host vectors. Agrobacterium tumefaciens-mediated transformation techniques include disarming and the use of binary vectors, as described in the literature (see, e.g., Horsch et al., Science 233: 4967-498 (1984) and Fraley et al., PNAS USA 80: 4803 (1983)). When cells are infected with bacteria using binary T DNA vectors (Bevan, Nucleic Acid Research 12: 8711-8721 (1984)) or co-cultivation procedures (Horsch et al., Science 227: 1229-1231 (1985)), the toxic effects of the Agrobacterium tumefaciens host direct the insertion of the construct and adjacent markers into the plant cell DNA. Generally, the Agrobacterium transformation system is used to process dicotyledonous plants (Bevan et al., Ann. Rev. Genet. 16:357-384 (1982); Rogers et al., Methods Enzymol. 118:627-641 (1986)). The Agrobacterium transformation system can also be used to transform monocotyledonous plants (Hernalsteen et al., EMBO J. 3:3039-3041 (1984); Hooykass-Van Slogteren et al., Nature 311:763-764 (1984); Grimsley et al., Nature 325:1677-1679 (1987); Boulton et al., Plant Mol. Biol. 12:31-40 (1989); and Gould et al., Plant Physiol. 95:426-434 (1991)).

[0112] Alternative gene transfer and transformation methods include, but are not limited to, protoplast transformation, naked DNA uptake by calcium-mediated, polyethylene glycol (PEG)-mediated, or electroporation-mediated (Paszkowski et al., EMBO J 3:2717-2722 (1984); Potrykus et al., Molec. gen. Genet. 199:169-177 (1985); Fromm et al., PNAS USA 82:5824-5828 (1985); and Shimamoto, Nature 338:274-276 (1989)) and electroporation of plant tissues (D'Halluin et al., Plant Cell 4:1495-1505 (1992)). Additional methods for plant cell transformation include microinjection, silicon carbide-mediated naked DNA uptake (Kaeppler et al., Plant Cell Reporter 9:415-418 (1990)), and the gene gun (Klein et al. PNAS USA 85:4305-4309 (1988); and Gordon-Kamm et al., Plant Cell 2:603-618 (1990)).

[0113] Transformed cells (or cell collections, calli, tissues, organs or organisms, such as plants) can be identified and isolated by selecting or screening cells for specific characteristics, such as expression of marker genes, increased protein content or increased resistance to pathogens or pests. Such screening and selection methods are well known in the art. In addition, physical and biochemical methods can be used to identify transformants. These include Southern blotting, PCR amplification, Northern blotting, S1 RNase protection, primer extension, RT-PCR, enzymatic assays, protein gel electrophoresis, Western blotting, immunoprecipitation, enzyme-linked immunosorbent assay, in situ hybridization, enzyme staining and immunostaining.

[0114] Transformed cells, such as transformed plant cells, can be cultured to regenerate whole plants that possess the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain plant hormones in tissue culture growth media, typically relying on biocide and / or herbicide markers, which are introduced together with the desired nucleotide sequence (see, e.g., Evans et al., "Protoplasts Isolation and Culture," in Handbook of Plant Cell Culture, pp. 124-176, MacMillan Publishing. Co., New York, NY (1983); Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, FL (1985); and Klee et al., Ann. Rev. Plant Phys. 38: 467-486 (1987)).

[0115] NF-YC4 with manipulated or modified promoters (ideally protein production or increased resistance to pathogens or pests) can be isolated and transferred into another eukaryotic cell, such as another plant, which can be the same species, the same genus but different species, or from a different family or other phylogenetic level. NF-YC4 with manipulated or modified transcriptional repressor binding sites can be introduced into another eukaryotic cell, such as another plant, using standard breeding techniques and backcrossing. For example, plants with manipulated or modified NF-YC4 promoters can be hybridized with plants lacking NF-YC4 with manipulated or modified promoters, and the resulting generations can be hybridized, and plants showing increased protein production or increased resistance to pathogens or pests can be selected. Therefore, when plants with manipulated or modified NF-YC4 promoters are hybridized with plants that do not have NF-YC4 promoters or genes with different manipulated or modified promoters, hybrid seeds can be harvested and planted to obtain hybrid plants or parts thereof. Plants with manipulated or modified promoters of NF-YC4 and suitable for tissue culture can be a source of cells for tissue culture and regeneration of plants using tissue culture methods known in the art. Similar breeding techniques can be used for non-human animals.

[0116] Eukaryotic cells can be a part of a cell collection, tissue, organ or organism. In one embodiment, the organism can be a plant, such as crops, root crops or horticultural crops. Examples of crops include soybean, rice, corn, wheat, millet, barley, alfalfa, tomato, apple, pear, strawberry, orange, watermelon, pepper, carrot, potato, sweet lettuce, yam, lettuce, spinach, sunflower and rapeseed, flowering plants such as petunia, rose and chrysanthemum, conifers and pine trees (such as pine, fir and spruce), plants for phytoremediation (such as plants accumulating heavy metals) and plants for experimental purposes (such as Arabidopsis thaliana). Plants can be monocots or dicots. Examples of monocots include but are not limited to oil palm, sugarcane, banana, Sudan grass, corn, wheat, rye, barley, oats, rice, millet and sorghum. Examples of dicots include but are not limited to safflower, alfalfa, soybean, coffee, amaranth, rapeseed, peanut and sunflower. The orders of dicotyledonous plants include Magnoliales, Illicialales, Cinnamales, Piperales, Aristolochiales, Nymphaeales, Ranunculales, Papaverales, Sarraceniaceae, Kunlanseales, Hamamelisales, Eucomales, Sedumales, Myricariales, Fagusales, Casuarinales, Caryophyllales, Taduncales, Polygonales, Cyanoseales, Pentacarales, Camelliales, Malvaceaes, Urticales, Barringolales, Violales, Willowales, Glechoales, Ericales, Rock Plumales, Dioscoreaales, Primulales, Rosales, Beansales, Sichuan Grassales, Small Two Immortals, Myrtales, Cornusales, Proteales, Santalaceae, Rhapisales, Euonymousales, Euphorbiales, Rhamnosales, Sapindales, Juglans, Geraniales, The genera of dicots include Atropaeolum, Apiaceae, Gentianales, Allium, Lamiales, Plantaginales, Scrophulariaces, Campanulaceae, Rubiaces, Dipsaciales and Asterales. The genera of dicots include Atropaeum, Amaranthus, Arachis, Arachis, Brassica, Carthamus, Coleus, Croton, Cucumis, Citrus, Citrus, Capsicum, Catharanthus, Coconut, Coffea, Cucurbita, Daucus, Dunaliella, California Poppy, Ficus, Fragaria, Galucium, Glycine, Cotton, Helianthus, Rubia, Scoparia, Lactuca, Lactuca, Flax, Litsea, Tomato, Lupin, Manihot, Margherita, Malus, Medicago, Nicotiana, Olea, Guayule, Poppy, Avocado, Phaseolus, Pistacia, Pisa, Pear, Prunus, Radish, Ricinus, Senecio, Stephania, Stephania, Sinapsis, Solanum, Theobroma, Clover, Fenugreek, Vicia, Catharanthus, Vilis, and Vigna. The orders of monocots include Alismatales, Asterales, Alismales, Mycorrhales, Commelinales, Echinopsales, Cordonales, Gramineales, Juncusales, Cyperaceae, Typhaales, Bromeles, Zingiberales, Starlingales, Panamaales, Pandanales, Araceaeales, Liliales, and Orchidales.Monocotyledonous plants include Allium, Andropogon, Aragrostis, Asparagus, Avena, Cynodon, Elaeagnus, Fescue, Fescue Lolium, Heterocallis, Hordeum, Duckweed, Lycopodium, Musa, Oryza, Panicum, Pannesetum, Timothy, Poa, Secale, Sorghum, Triticum, and Zea. Other plants include gymnosperms, such as Pinales, Ginkgoales, Cycadales, and Ephedrales, such as Abies, Cunninghamia, Picea, Pinus, and Pseudotsuga, such as fir and pine. In another embodiment, the organism may be an algae such as a unicellular flagellate, such as a Chlamydomonas species. In another embodiment, the organism may be a non-human animal, such as livestock, for example cattle, pigs, chickens, turkeys, sheep, and bison.

[0117] The pathogen may be a bacterium, a virus or a seed plant. The pest is an insect (such as aphid), Plasmodium, acarid or nematode. In an embodiment, the pathogen is a bacterium or a virus and the pest is aphid.

[0118] The bacterium can be any plant bacterium. Examples include, but are not limited to, Firmicutes, Actinomycetes or Proteobacteria. Proteobacteria can be alphaproteobacteria, betaproteobacteria or gammaproteobacteria. Alphaproteobacteria can be Agrobacterium, Sphingomonas or Candidatus Liberibacter. Betaproteobacteria can be Acidovorax, Burkholderia, Ralstonia or Xylophilus. Gammaproteobacteria can be Enterobacteriaceae, Pseudomonadaceae or Xanthomonadaceae. Enterobacteriaceae can be Brenneria, Dickea, Enterobacter, Erwinia, Ivanella, Pantoea, Pectobacterium, CandidatusPhlomobacter, Samsonia or Serratia. Pseudomonadaceae can be Pseudomonas. Xanthomonadaceae can be Flavobacterium or Xylophilus. The bacterium may be a Corynebacterium, a Brevibacterium, a Rasmus, a Lysella, a Nocardia, a Rhodococcus, a Streptomyces, a Bacillus, a Clostridium, a Spiroplasma, a Candidatus Phytoplasma or a Bacillus. Specific examples of bacteria include, but are not limited to, Clavibacter michiganensis or its subspecies, Curtobacterium flaccumfaciens, Rathayibacter rathayi, Rathayibacter tritici, Rathayibacter toxicus, Leifsonia xyli or its subspecies, Rhodococcus fascians, Sphingomonas suberifaciens, Sphingomonas melonis, Agrobacterium vitis, Agrobacterium tumefaciens, Agrobacterium rubi, Acrobacterium larrymoorei, Acidovorax avenae, avenae), A. avenae citrulli, A. avenae subsp. avenae, A.avenae avenae), Burkholderia cepacia, Burkholderia gladioli, Burkholderia andropogonis, Burkholderia caryophylli, Burkholderia glumae, Burkholderia plantarii, Dickeya dadantii, Dickeya solani, Erwinia amylovora, Ralstonia solanacearum, Ralstonia syzygii, Candidatus Phlomobacter fragariae, Candidatus Liberibacter asiaticus, Pectobacterium carotovorum, Pectobacterium atrosepticum, Pseudomonas syringae, Pseudomonas savastanoi, Pseudomonas marginalis, Pseudomonas viridiflava, Xanthomonas arboricola, Xanthomonas axonopodis, Xanthomonas campestris, Xanthomonas hortorum, Xanthomonas oryzae, Xanthomonas axonopodis, Xanthomonas translucens, Xanthomonas vasicola, or Xylella fastidiosa). According to Mansfield et al. (Mol. Plant Pathol.13:614-629 (2012)), the top bacterial plant pathogens were Pseudomonas syringae pathovars, Ralstonia solanacearum, Agrobacterium tumefaciens, Xanthomonas oryze pv. oryze, Xanthomonas campestris pathovars, Xanthomonas axonopodis pv. manihotis, Erwinia amylovora, Xanthomonas phyllosporin, Dickea dadantii, Phytophthora solani, Pectobacterium carotovora and Pectobacterium nigromatum. .

[0119] The fungus may be a plant fungus. Examples include, but are not limited to, Ascomycetes such as Fusarium spp. (the causative agent of Fusarium wilt), Fusarium graminearum, Fusarium oxysporum, Thielaviopsis spp. (the causative agent of canker, black root rot, and broad bean root rot), Verticillium spp., Magnaporthe grisea (the causative agent of rice blast and gray leaf spot in turfgrass), Magnaporthe oryzae, Sclerotiniasclerotiorum (white mold), and powdery mildews. Other examples include Basidiomycetes such as Ustilago spp., Ustilago maydis, Rhizoctonia spp., Rhizoctonia solani, Phakospora pachyrhizi (the causative agent of soybean rust), Puccinia spp. (the causative agent of severe rust on nearly all cereals and cultivated grasses), and Armillaria spp. (("Armillaria" species; virulent pathogens of trees and production of acceptable mushrooms). According to Dean et al. (Mol. Plant Pathol. 13:414-430 (2012)), the top 10 plant fungal pathogens are Pyricularia grisea, Botrytis cinerea, Puccinia graminearum, Fusarium oxysporum, Blumeria graminearum, and Fusarium oxysporum. graminis), Mycosphaerella graminicola, Colletotrichum spp., Ustilago maydis, and Melampsora lini.According to Kamoun et al. (Mol. Plant Pathol. 16:413-434 (2015)), the top 10 oomycetes are Phytophthora infestans (late blight), Hyaloperonospora arabidopsidis (downy mildew), Phytophthora ramorum (oak and oak death), Phytophthora sojae (root and stem rot), Phytophthora capsici (wilt, blight and others), Plasmopara viticola (downy mildew), Phytophthora cinnamomi (root rot and dieback), Phytophthora parsitica (root and stem rot and others), Pythium ultimum (root and stem rot), Phytophthora ramorum (oak and oak death), Phytophthora ramor ... ultimum) (damping-off and root rot) and Albugo candida (white rust).

[0120] The seed plant can be dodder, mistletoe or striga. Such plants are semi-parasitic or parasitic on other plants.

[0121] The virus can be any plant virus. The virus can be transmitted through sap, by insects, by nematodes, by plasmoviruses, by mites, by seeds or by pollen. Examples include, but are not limited to, members of the following genera: Alfalfa mosaic virus (e.g., Bromoviridae), Alphacryptovirus (e.g., Myloviridae), Baculovirus, Betacryptovirus (e.g., Myloviridae), Bigeminivirus (e.g., Geminiviridae), Brome mosaic virus (e.g., Brome mosaic virus), Barley yellow mosaic virus (e.g., Potyviridae), Hairy virus, Carnation latent virus, Carnation mottle virus (e.g., Tomato bushy dwarf virus), Cauliflower mosaic virus, Closterovirus, Cowpea mosaic virus (e.g., Cowpea mosaic virus), Cucumber mosaic virus (e.g., Bromoviridae) , Cytoplasmic rhabdovirus (such as Rhabdoviridae), Carnation virus, Pea ear mosaic virus, Bean virus (such as Cowpea mosaic virus family), Squash mosaic virus (such as Brome mosaic virus family), Cytoplasmic rhabdovirus (such as Rhabdoviridae), Carnation virus, Pea ear mosaic virus, Bean wilt virus (such as Cowpea mosaic virus family), Fiji virus (such as Reoviridae), Fungus-borne rhabdovirus, Barley virus, Hybrigeminivirus (such as Geminiviridae), Raspberry bushy stunt virus (Idaeovirus), Ilarvirus (such as Bromovirus family), Sweet Potato Virus (Ipomovirus) (such as Potyviridae family), Yellow Disease Virus, Maize Chlorotic Mottle Virus (Machlomovirus), Orange Virus, Maize Rhadovirina Virus, Monogeminivirus (such as Geminiviridae family), Dwarf Virus, Ncroviruses, Nematode-borne Polyhedral Virus (such as Cowpea Mosaic Viridae family), Nuclear Bomb-shaped Virus (such as Rhabdoviridae family), Rice Virus (such as Reoviridae family), Olmivirus, Plant Reovirus (such as Reoviridae family), Potato Virus X, Potato Virus Y (such as Potyviridae family), Ryegrass Mosaic Virus (such as Potyviridae family), Associate Virus (such as Associate Viridae family), Southern Bean Mosaic Virus, Scintillary virus, tobacco mosaic virus, TobRAV1us, tomato bushy stunt virus (e.g., tomato bushy stunt virus family), tomato spotted wilt virus (e.g., Bunyaviridae family), apple chlorotic leaf spot virus, turnip yellow mosaic virus, umbrella plant virus, undefined potato virus Y (e.g., Potatovirus Y family), undefined rhabdovirus (e.g., Rhabdoviridae family), leaf vein varicose virus, stunt virus (e.g., Assemviridae family), and ungrouped viruses. Other examples of viruses include, but are not limited to, citrus tristeza virus, barley yellow dwarf virus, potato leaf roll virus, and tomato bushy stunt virus.According to Scholthof et al. (Mol. Plant Pathol. 12:938-954 (2011)), the top 10 plant viruses are tobacco mosaic virus, tomato spotted wilt virus, tomato yellow leaf curl virus, cucumber mosaic virus, potato virus Y, cauliflower mosaic virus, African cassava mosaic virus, plum pox virus, brome mosaic virus, and potato virus X.

[0122] Examples of sap-borne viruses include, but are not limited to, tobacco mosaic virus, potato virus X, potato virus Y, and cucumber mosaic virus.

[0123] Examples of viruses transmitted by insects include, but are not limited to, Rhabdoviridae, Reoviridae, Potato virus Y, Cucumber mosaic virus, yellow disease virus, Bean golden mosaic virus, Tomato spotted wilt virus, Cowpea mosaic virus, Southern bean mosaic virus, Tomato yellow leaf curl virus, Tomato pseudocurved neck virus, Tomato lesion wilt virus, and lettuce infectious yellows virus. The insects may be aphids, whiteflies, springtails, thrips, or beetles. Aphids can spread Potato virus Y, Cucumber mosaic virus, and yellow disease virus. Whiteflies can spread Bean golden mosaic virus, Tomato yellow leaf curl virus, and lettuce infectious yellows virus. Springtails can spread Rhabdoviridae, Reoviridae, and Tomato pseudocurved neck virus. Thrips can spread Tomato spotted wilt virus and Tomato lesion wilt virus. Beetles can spread Cowpea mosaic virus and Southern bean mosaic virus.

[0124] Nematodes can transmit, for example, nematode-transmitted polyhedral viruses, TobRAV 1us, tobacco ringspot virus, and tobacco rattle virus. According to Jones et al. (Mol. Plant Pathol. 14:946-961 (2013)), the top 10 nematodes are root-knot nematodes (i.e., Meloidogyne spp.), cyst nematodes (i.e., Heterodera spp. and Globodera spp.), root-rot nematodes (i.e., Pratylenchus spp.), boring nematodes (i.e., Radopholus similis), bulbous stem nematodes (i.e., Ditylenchus dipsaci), pine wood nematodes (i.e., Bursaphelenchus xylophilus), reniform nematodes (i.e., Rotylenchulus reniformis), Xiphinema index, Nacobbus spp. aberrans) and rice stem nematode (Aphelenchoides besseyi).

[0125] Plasmoviruses can transmit, for example, Beet Necrotic Yellow Vein Virus, Barley Yellow Mosaic Virus, Fungus-borne Rhabdovirus, Peanut Cluster Virus, Pomovirus, Barley Yellow Mosaic Virus, and Beet Necrotic Yellow Vein Virus.

[0126] Mites can transmit ryegrass mosaic virus, wheat mosaic virus and wheat streak mosaic virus.

[0127] Seeds can transmit, for example, barley virus, bean common mosaic virus, and barley streak mosaic virus.

[0128] Once the foreign DNA is stably incorporated into the transgenic plant and confirmed to be operable, it can be introduced into other plants by sexual hybridization. Therefore, plants with increased protein content or increased resistance to pathogens or pests are also provided. The method includes hybridizing the plant obtained above with a second plant to produce offspring plants and selecting offspring plants with increased protein content or increased resistance to pathogens or pests. The method can also include hybridizing the selected offspring plant with the second plant to produce backcross offspring plants, selecting the first backcross offspring plant with increased protein content or increased resistance to pathogens or pests to produce selected backcross offspring plants, repeating 3 or more times of hybridization and selection to produce backcross offspring plants with increased protein content or increased resistance to pathogens or pests. Similar processes can be used or suitable for use in algae and non-human animals, and the algae are nutritious, asexual and sexually propagated.

[0129] Also provided is a cell, cell collection, tissue, organ or organism, wherein the NF-YC4 gene comprises a promoter, the promoter comprises a transcriptional repressor binding site that has been manipulated or modified so that the transcriptional repressor cannot hinder NF-YC4 transcription. Compared to a corresponding cell, cell collection, tissue, organ or organism (wherein the promoter included by the NF-YC4 gene comprises a transcriptional repressor binding site that has not been manipulated or modified), the protein content of the cell, cell collection, tissue, organ or organism is increased. In an embodiment, the organism can be a plant or algae such as a unicellular flagellate. In another embodiment, the organism can be a non-human animal, such as livestock, for example cattle, pigs, chickens, turkeys, sheep and American bison.

[0130] Seeds of the above plants are also provided, as are hybrids of the above organisms, such as hybrid plants. Seeds of hybrid plants are also provided, as well as corresponding structures produced from algae nutrition, asexual and sexual reproduction, and non-human animal fertilized eggs. Other offspring, clones, cell lines, and cells are also provided. Example

[0131] The following examples serve to illustrate the present disclosure. The examples are not intended to limit the scope of the claimed invention.

[0132] Example 1

[0133] This example describes the preparation of 35S::QQS and 35S::AtNF-YC4 fusion constructs and transformation.

[0134] 35S::QQS and 35S::AtNF-YC4 fusion constructs were prepared by cloning the amplified full-length coding sequence into the binary vector pB2GW7, as described above (Li et al. (2015), supra). Briefly, the QQS coding domain sequence (CDS) or the NF-YC4 CDS from Arabidopsis thaliana (AtNF-YC4) was inserted into the vector pB2GW7 (see Figures 1a and 1b, which are vector maps), which contains the Bar gene (phosphinothricin acetyltransferase gene) under the control of Pnos (nos promoter) and Tnos (nos terminator) of the nopaline synthase from Nicotiana tabacum. The CDS on this vector is controlled by p35S (cauliflower mosaic virus (CaMV) 35S promoter) and terminated by T35S (CaMV 35S). Only the region between LB and RB is introduced into plants to produce transgenic plants.

[0135] The constructs were introduced into Agrobacterium tumefaciens strain GV3101 for transformation in Arabidopsis thaliana Columbia type (Col-0), into Agrobacterium tumefaciens strain EHA101 for transformation in soybean (soybean) cultivar William 82 (Li et al. (2015), supra), rice (orchid) cultivar Kitakke, and maize (corn) line B104.

[0136] Transformants expressing QQS (QQS-E) were identified based on BAR selection followed by polymerase chain reaction (PCR) analysis for the presence of the QQS gene as described above (Li et al. (2015), supra).

[0137] Soybean QQS-E Williams 82 was used as a pollen donor to cross with Iowa soybean elite lines (IA1022, IA2079, IA2102, IA2053 and IA3022) in field trials (Williams 82 was used as a control). The F1 generation was grown in pots under the greenhouse, 3 plants / pot, with an environmental control of 16 hours light and 8 hours dark, 27 / 20°C. The F2 generation was planted in the field in Ames, IA. QQS-E mutants were identified based on the following: BAR selection followed by PCR analysis for the presence of the QQS gene. Isolated wild-type (WT) plants that are not herbicide tolerant and do not express QQS were used as sister plant controls.

[0138] Rice plants were grown in a growth chamber with a controlled environment of 16 hours light and 8 hours dark, 28 / 25° C. T3 generation plants were analyzed. Similarly, plants were tested by herbicide and PCR analysis to identify transformants and WT sister controls.

[0139] Corn plants were grown in the field in Ames, IA. Plants were backcrossed to B104. Similarly, plants were tested by herbicide and PCR analysis to identify transformants and WT sister controls.

[0140] Arabidopsis thaliana was transformed, grown and harvested as described above. See Li et al. (2009), supra.

[0141] Example 2

[0142] This example describes the analysis of plant composition.

[0143] Leaf composition (starch staining and quantification and protein) was determined in Arabidopsis in seedling shoots 20 days after planting (DAP) in a growth chamber, and in rice in the inverted leaves (next to the flag leaf) of the primary branch of plants from 30 DAP. Three (for starch) or five (for protein) plants were replicated each time, and three replicates from each independent T2 line (Arabidopsis) and T3 line (rice) were analyzed. Leaves were harvested at the end of the light phase. Seeds of Arabidopsis, rice, and soybean were harvested from individual plants. For leaf and seed protein quantification, plant material was baked at 71°C. Dried leaf / seed tissue (0.07 g) was used for each assay. Total protein content was measured. Total nitrogen was determined using LECO CHN-2000 ((LECO, St. Joseph, MI) and converted to protein content (Li et al. (2015), supra).

[0144] The entire aerial part of Arabidopsis was stained with I2 / KI, and the middle part of the first branch leaf (next to the flag leaf) of rice was collected and cut into small pieces (about 1-1.5 cm).

[0145] Soybean and corn seeds (protein, oil and fiber for soybean; protein, oil and starch for corn) were analyzed by near infrared spectroscopy (NIRS) using a Bruins Grain Analyzer S / N 106110 (Munich, Germany). Approximately 60 g of seeds / plant were tested with 3 biological replicates per line.

[0146] Example 3

[0147] This example describes a yeast two-hybrid assay.

[0148] Matchmaker System 3 (Clontech, Mountain View, CA) was used to identify QQS interacting proteins using an Arabidopsis thaliana (Columbia type) cDNA library constructed from 3-day-old etiolated seedlings (Arabidopsis.org / servlets / TairObject?type=library&id=23). For the reciprocal yeast two-hybrid assay, QQS and AtNF-YC4 were cloned into pGBKT7 (bait vector) and pGADT7 (trap vector), respectively.

[0149] Example 4

[0150] This example describes a bimolecular fluorescence complementation (BiFC) assay.

[0151] QQS and AtNF-YC4 were fused in-frame to the nYFP N-terminus (yellow fluorescent protein (YFP) N-terminus) and cYFP (YFP C-terminus), respectively. Agrobacterium strain GV3101 transformed with QQS-nYFP and AtNF-YC4-cYFP constructs was co-infiltrated into tobacco. The reconstructed YFP signal was observed under a Zeiss Axioplan II fluorescence microscope 48 hours after infiltration.

[0152] Example 5

[0153] This example describes the purification of HIS-MBP-tagged recombinant NF-Y.

[0154] Escherichia coli (E. coli) transformants containing the AtNF-YC4 gene (or other NF-Y genes or gene fragments) were grown in 0.6 L Luria-Bertani (LB) medium at 37°C until OD 6000.90, then isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.075mM. After incubation at 12°C for 20 hours, the induced cells were harvested by centrifugation at 5,000xg for 5 minutes. HIS-MBP-tagged (i.e., 6x histidine maltose binding protein-tag) proteins were purified by Ni Sepharose 6 Fast Flow (GE Healthcare Life Sciences, Pittsburgh, PA) affinity chromatography at 4°C native conditions. The cell pellet was resuspended in 15ml binding buffer (50mM NaH2PO4, pH 8.0, 500mM NaCl and 30mM imidazole). The cells were lysed by intermittent ultrasonic treatment. After centrifugation at 10,000xg for 20 minutes, the resin was added to the clarified lysate. After shaking at 4°C for 30 minutes, the lysate-resin mixture was loaded into the column. The resin was washed with washing buffer (50 mM NaH2PO4, pH 8.0, 500 mM NaCl and 60 mM imidazole). The bound protein was eluted from the column with elution buffer (50 mM NaH2PO4, pH 8.0, 500 mM NaCl and 250 mM imidazole). The eluted protein was dialyzed twice with PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.3). The protein concentration was detected by BCA protein assay kit (Thermo Scientific, St. Louis, MO), and bovine serum albumin (BSA) was used as a standard.

[0155] Example 6

[0156] This example describes the expression and purification of GST-tagged QQS.

[0157] The E. coli transformants expressing the QQS gene were grown in 1.2 L of Luria-Bertani (LB) medium at 37°C until the OD 6000.90, then isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.075 mM. After incubation at 2°C for 20 hours, the induced cells were harvested by centrifugation at 5,000 x g for 5 minutes. Purification of GST-tagged (i.e., glutathione-S-transferase-tagged) QQS was purified using glutathione Sepharose 4B (GE Healthcare Life Sciences) affinity chromatography at 4°C native conditions. The cell pellet was resuspended in 15 ml PBS buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4, pH 7.3), and the cells were lysed by intermittent sonication. After centrifugation at 10,000 x g for 20 minutes, the resin was added to the clarified lysate. After shaking at 4°C for 30 minutes, the lysate-resin mixture was loaded into the column. The resin was washed with PBS. The bound protein was eluted from the column with elution buffer (50 mM Tris-HCl, 10 mM reduced glutathione, 5 mM DTT, pH 8.0). The eluted protein was dialyzed twice with PBS buffer. The protein concentration was determined by BCA protein assay kit (Thermo Scientific), and BSA was used as a standard.

[0158] Example 7

[0159] This example describes a pull-down experiment.

[0160] Purified His-MBP-tagged protein (5 μg) was mixed with bead-immobilized GST-QQS fusion protein (10 μg) in 1 ml PBS buffer containing 1% NP-40, 1 mM DTT and 0.5 μg / μl BSA. The mixture was incubated at 4°C for 2 hours. GST protein immobilized on beads was used for incubation with His-MBP-tagged protein as a negative control. The beads were recovered by centrifugation, washed 6 times with 1 ml PBS buffer and resuspended in 50 μl SDS-sample buffer. 15 μl of the resulting sample was analyzed as follows: SDS-PAGE on a 12% gel, followed by immunoprecipitation and analysis with antiserum against MBP.

[0161] Example 8

[0162] This example describes the statistical design and analysis.

[0163] Plants were grown, collected and analyzed in a randomized complete block design or a completely randomized design. Qualitative and quantitative analysis was performed with a minimum of 3 bioassays from each independent transgenic line and each control. For compositional analysis, plant samples were assigned random numbers and provided to the analysis equipment for determination in random order without genotype identification.

[0164] Data are expressed as mean ± SE. Two independent samples were compared using Student's t-test (two-tailed), assuming equal variance (n=3). P<0.05 was considered significant (*); P<0.01 was considered extremely significant (**).

[0165] Example 9

[0166] This embodiment describes the inference of phylogeny.

[0167] The sequence was selected as a potential NF-Y gene, and the PF00808.18 PFam domain (histone fold-like domain) was searched (hmmsearch) using HMMER 3.0 (Finn et al., Nucleic Acids Res. 39:W29-37 (2011)) against protein sequences of soybean, rice, Arabidopsis, Chlamydomonas reinhardtii, corn, Homo sapiens, Mus musculus, Danio rerio, Saccharomyces cerevisiae, and Dictyostelium discoideum. The tree was built using the PhyML package (Guindon et al., Systematic Biology 52:696-704 (2003)) (using parameters '-ae-f m') and visualized in Archaeopteryx (sites.google.com / site / cmzmasek / home / software / archaeopteryx). See Figures 2a-c and Figure 3 , Figure 2a-c shows the NF-YC4 sequence, Figure 3 is the phylogenetic tree of NF-YC4 genes from different evolved species.

[0168] Example 10

[0169] This example demonstrates that the QQS transgene affects both protein content and carbohydrate content in elite soybean lines with different seed protein content; therefore, the QQS effect is not limited to soybean line Williams 82.

[0170] The QQS transgene was introduced into elite soybean lines differing in seed protein content by crossing with Williams 82 soybean expressing QQS (QQS-E) as a pollen donor. Self-pollinated F2 and F3 progeny of these crosses containing the QQS transgene were similar to each segregating sister line in terms of morphology, development, seed size, seed shape, seed weight, and seed yield per plant. Seed composition (F3 generation) was analyzed by near infrared spectroscopy (NIRS).

[0171] QQS expression increased seed protein content in each elite line, regardless of the initial protein level in the line ( Figure 4A ). The seed protein content is shown in Figure 4A , This is a bar graph of F3 seed protein (% / g fresh weight, 13% moisture) of soybean elite lines expressing QQS compared to their respective segregating sister controls. The percent increase in seed protein compared to each segregating sister control is shown on the top of the mutant column. a = segregating sister line without QQS gene from QQS-E Williams 82 transformant; b = QQS-E Williams 82 transformant; c = segregating sister control without QQS gene, from a cross of IA elite lines or Williams 82 and QQS-E Williams 82; d = QQS-E mutant, from a cross of IA elite lines and QQS-E Williams 82. Student's t-test was used to compare QQS-E and controls. **P<0.01. Specifically, QQS expression increased seed protein content by 9% in the low protein line IA1022, 6-7% in the medium protein lines IA2079 and IA2102, and 7-11% in the high protein lines IA2053 and IA3022 compared to each segregating sister line.

[0172] Figure 4B Bar graph of F3 seed oil (% / g fresh weight, 13% moisture) of soybean lines expressing QQS compared to their respective segregating sister controls. a = segregating sister without QQS gene from QQS-E Williams 82 transformants; b = QQS-E Williams 82 transformants; c = segregating sister control without QQS gene from IA elite lines or crosses of Williams 82 and QQS-E Williams 82; d = QQS-E mutant from crosses of IA elite lines or Williams 82 and QQS-E Williams 82. Student's t-test was used to compare QQS-E and controls. *P<0.05. **P<0.01.

[0173] Figure 4CBar graph of F3 seed fiber (% / g fresh weight, 13% moisture) of soybean elite lines expressing QQS compared to their respective segregating sister controls. a = segregating sister without QQS gene from QQS-E Williams 82 transformant; b = QQS-E Williams 82 transformant; c = segregating sister control without QQS gene, from a cross between IA elite lines or Williams 82 and QQS-E Williams 82; d = QQS-E mutant, from a cross between IA elite lines or Williams 82 and QQS-E Williams 82. Student's t-test was used to compare QQS-E and controls. *P<0.05. *P<0.01.

[0174] Embodiment 11

[0175] This example demonstrates in rice and corn that the QQS transgene affects protein content.

[0176] The QQS transgene was introduced into rice (cv. Kitakke; see Figure 1A , which is the vector map). Rice plants were grown in growth chambers in a randomized complete block design. Leaves and mature T4 seeds from T3 plants of three independent transformation events were analyzed in triplicate. Independent transgenic lines of rice plants expressing the QQS gene (QQS-E) and their seeds were visually and developmentally similar to their respective wild-type (WT) sister controls. However, QQS gene expression in the three independent transgenic lines reduced starch content and increased leaf protein content in leaves expressing the QQS gene (QQS-E) and its wild-type sister (sister) (see Figure 5A , This is a bar graph of leaf protein (% / dry weight) of rice (cv. Kitakke) expressing QQS (QQS-E) and its wild-type sister (Sister); all data are shown as mean ± SE, n = 3. Student's t-test was used to compare QQS-E and control. **P < 0.01). The average protein increase in mature rice seeds across the three transgenic lines was 20% (see Figure 5B , This is a bar graph of seed protein (% / dry weight) of rice (cv. Kitakke) expressing QQS (QQS-E) and its wild-type sister (Sister); all data show mean ± SE, n = 3. Student's t-test was used to compare QQS-E and control. **P < 0.01.).

[0177] The QQS transgene was also introduced into field-grown corn. Kernel protein (% / dry weight) in corn expressing QQS increased from about 10% to about 20% compared to sister controls (see Li et al., PNAS USA 112(47): 14734-14739 (2015), which is incorporated herein by reference).

[0178] Example 12

[0179] This example describes a yeast two-hybrid screen of a cDNA library from Arabidopsis seedlings using QQS as bait to identify genes that interact with QQS.

[0180] Yeast two-hybrid screening using QQS as bait against a cDNA library of Arabidopsis seedlings identified Arabidopsis nuclear factor YC4 (AtNF-YC4) as a gene that interacts with QQS. Reciprocal yeast two-hybrid assays were consistent with QQS and AtNF-YC4 interacting; AtNF-YC4 on bait had an autosignal, and the signal for QQS-capture + AtNF-YC4-bait was higher than that for AtNF-YC4-bait. The interaction between QQS and AtNF-YC4 was further confirmed by yeast two-hybrid pairwise interaction studies ( Figure 6 ). Figure 6 It is a bar graph of the relative expression of empty vector of capture + bait (BK+AD), empty vector of QQS-capture + bait (BK+QQS), AtNF-YC4-bait + empty vector of capture (AtNF-YC4+AD), and AtNF-YC4-bait + QQS-capture (AtNF-YC4+QQS) plus reporter gene. *P<0.05. **P<0.01. Statistical analysis indicated that AtNF-YC4-bait + QQS-capture expression was higher than AtNF-YC4-bait (*P<0.05). The bimolecular fluorescence complementation assay of tobacco leaves indicated that QQS and AtNF-YC4 interacted with the cytosol and nucleus; in the absence of QQS and AtNF-YC4 interaction, no YFP signal was detected.

[0181] Embodiment 13

[0182] This example describes a glutathione-S-transferase (GST) pull-down experiment using purified recombinant AtNF-YC4-GST fusion protein to identify the region of AtNF-YC4 required for QQS binding.

[0183] Proteins containing different AtNF-YC4 regions (i.e., full length, amino acids 1-72, amino acids 73-162, amino acids 163-250, amino acids 1-162, and amino acids 73-250) fused to GST were expressed. The fusion proteins were used for pull-down experiments. Analysis showed that QQS binds to amino acids in the amino acid 73-amino acid 162 region of AtNF-YC4. This region corresponds to the location of the histone fold-like domain. Bimolecular fluorescence complementation experiments in tobacco leaves indicated that QQS and NF-YC4 interact with the cytosol and the nucleus. The interaction located in the nucleus was used as a positive control. GST pull-down experiments also showed the interaction of QQS with soybean and rice NF-YC4 homologs.

[0184] Embodiment 14

[0185] This example describes a GST pull-down experiment using purified recombinant Arabidopsis nuclear factor YB7 (AtNF-YB7)-GST fusion protein to identify whether QQS generally binds to histone fold-like domain proteins.

[0186] AtNF-YB7 contains a histone fold-like domain and is predicted to complex with AtNF-YC4 (Hackenberg et al., Mol. Plant 5:876-888 (2012)). However, AtNF-YB7 did not bind QQS in a GST pull-down assay, suggesting that QQS binds to proteins with histone fold-like domains, which have certain unique features.

[0187] Embodiment 15

[0188] This example describes the in vivo co-expression of QQS and AtNF-YC4 in tobacco leaves.

[0189] QQS and AtNF-YC4 are co-expressed in tobacco leaves in vivo. The QQS-NF-YC4 complex is detected in the cytosol and the nucleus. These data (see Figures 1a and 1b for vector diagrams) indicate that QQS (Li et al. (2009), supra) and NF-YC (Kahle et al., Molec. Cell. Biol. 25: 5339-5354 (2005)), which are mainly in the cytosol, bind in the cytosol and move into the nucleus, similar to the model in which NF-YB in the cytosol binds NF-YC and the NF-YB-NF-YC complex moves into the nucleus.

[0190] Example 16

[0191] This example describes the interaction of QQS with rice and soybean proteins that have amino acid sequences similar to AtNF-YC4 amino acids 73-162.

[0192] Rice and soybean proteins with amino acid sequences similar to amino acids 73-162 of AtNF-YC4 were selected by phylogenetic analysis of all NF-Y histone fold-like domains in protein-coding genes from the genomes of 10 different eukaryotic species ( Figure 3 ) is a phylogenetic tree of NF-YC genes from evolutionarily distinct eukaryotic species, showing analysis of rice, soybean, and Arabidopsis. Physical interactions of QQS with soybean (Glyma06g17780 and Glyma04g37291) and rice (Os3g14669, Os2g07450, and Os6g45640) homologs were detected by GST pull-down experiments. QQS interacted with all homologs. These findings are consistent with QQS expression conferring a high protein phenotype to soybean and rice via NF-YC4 interaction.

[0193] Embodiment 17

[0194] This example describes overexpression of AtNF-YC4 and OsNF-YC4 in Arabidopsis thaliana.

[0195] The AtNF-YC4 (At = Arabidopsis) transgene was overexpressed in Arabidopsis. 20-day-old T2 seedlings from three independent transformation events were analyzed. AtNF-YC4 overexpression reduced the starch content of leaves by approximately 16% (see Fig. 7A , This is a bar graph of leaf starch (mg / g fresh weight) in Arabidopsis overexpressing NF-YC4 (AtNF-YC4-OE) and wild-type Arabidopsis (WT); all data in the bar graphs show mean ± SE, n = 3; Student's t-test was used to compare starch composition between WT and AtNF-YC4-OE lines; *P < 0.05.) and increased the protein content of leaves by about 17% (see Figure 7B , This is a bar graph of leaf protein (mg / g fresh weight) of Arabidopsis thaliana overexpressing NF-YC4 (AtNF-YC4-OE) and wild-type Arabidopsis thaliana (WT); all data in the bar graphs show mean ± SE, n = 3; Student's t-test was used to compare the protein composition of WT and AtNF-YC4-OE lines. **P < 0.01.).

[0196] These data suggest that QQS acts in conjunction with AtNF-YC4 to alter the partitioning of nitrogen and carbon. It is believed that QQS binds to NF-YC4, the resulting complex moves to the nucleus and alters transcription of genes that are repressed and activated by the NF-YC4-associated NF-Y complex. These expression changes cause an increase in protein content and a decrease in starch content.

[0197] The OsNF-YC4 (Os = rice; Os3g14669) transgene was also overexpressed in Arabidopsis. The NF-YC4 CDS from rice was inserted into the vector pB2GW7, which contains the Bar gene (phosphinothricin acetyltransferase gene) under the control of Pnos (nos promoter) and Tnos (nos terminator) of the nopaline synthase from tobacco. OsNF-YC4 on this vector is controlled by p35S (cauliflower mosaic virus (CaMV) 35S promoter) and terminated by T35S (CaMV 35S). Only the region between LB and RB was introduced into Arabidopsis plants to generate transgenic Arabidopsis OsNF-YC4-OE plants (see Figure 1D , this is the vector map). OsNF-YC4 overexpression reduced the starch content of leaves by 16% compared to wild-type Arabidopsis. Protein content was analyzed.

[0198] Embodiment 18

[0199] This example describes the targeted removal of an identified repressor motif in the promoter region of the NF-YC4 gene.

[0200] RAV1 binding motifs, particularly RAV1-A, were identified in the NF-YC4 gene promoter region. The RAV1-A motif has the sequence CAACA (for discussion of RAV1, see, e.g., Kagaya et al., Nucleic Acids Res. 27:470-478 (1999)). A "W box" motif was also identified in the NF-YC4 gene promoter region (for discussion of W boxes in the ERF3 gene promoter region, see, e.g., Nishiuchi et al., J. Biol. Chem. 279:55355-55361 (2004)). The W box motif has the sequence TGACY, where Y=C or T. Such motifs were identified in the Plant Cis-Acting Regulatory DNA Elements (PLACE) database: 1999 (Nucleic Acids Res. 27(1):297-300(1999)); such motifs were identified using SIGNAL SCAN (Prestridge, CABIOS 7:203-206(1991); available at www.dna.affrc.go.jp / PLACE / signalscan.html). Motifs were also discovered using Plantcare (bioinformatics.psb.ugent.be / webtools / plantcare / html). Suppressor motifs were deleted from the promoter region of the soybean and rice NF-YC4 genes. For soybean, the region between the RAV1-A motif and the W box motif was specifically deleted (i.e., nucleotides 360-391, having the sequence GGTCAGTTTTTGTTAACATTAATTTTTAGGAT [SEQ ID NO: 17]; see Figure 2E ). For rice, the RAV1-A motif (i.e., nucleotides 250-254, having the sequence CAACA) was specifically deleted. Constructs with mutant promoters and constructs with full-length promoters were fused to luciferase as a reporter gene, respectively. Each construct on the binary vector was transformed into Agrobacterium GV3101 and then into Nicotiana benthamiana (Leuzinger et al., Vis. Exp. 77 (2013)). The recommended developmental stage and Agrobacterium growth and infiltration concentrations for Nicotiana benthamiana were used. Recombinant luciferase protein was transiently expressed. Luciferase expression was quantified in tobacco leaves infiltrated with Agrobacterium. Each construct was included in at least 3 replicates in 3 plants. Removal of the repressor motif from the soybean NF-YC4 gene caused an increase in luciferase expression in 2 / 3 replicates. Similarly, removal of the repressor motif from the rice NF-YC4 gene caused an increase in luciferase expression in 2 / 3 replicates. Overall, total luciferase expression increased in all three replicates for both the NF-YC4 gene from soybean and the NF-YC4 gene from rice.

[0201] In separate experiments, three separate mutations in the OsNF-YC4 promoter region were generated to remove the transcriptional repressor motif. In the "pro1" mutation, the "RAV1" motif 1164 bp upstream was deleted (see SEQ ID NO: 2 and Figure 2A ). In the "pro2" mutation, the "RAV1" motif at 982 bp upstream and the "Class II ERF" motif at 979 bp upstream were deleted (see SEQ ID NO: 3 and Figure 2B The RAV1 motif and the intervening sequence are missing in the "pro3" mutation (see SEQ ID NO: 4 and Figure 2B The control "proFull" contains the full-length promoter region, i.e., 1,448 bp upstream of the start codon (see SEQ ID NO: 1 and Figure 2A ). The promoter region was fused to the luciferase coding region and transformed into Agrobacterium and then into tobacco as described above. The results are shown in Fig. 9 .

[0202] Fig. 9 Figure 1 is a graph of LUC activity from tobacco, where the transcriptional repressor motif of the rice NF-YC4 promoter region is deleted (OsNF-YC4pro1, Os-NF-YC4pro2, and Os-NF-YC4pro3), and the figure is a graph of relative luciferase (LUC) activity compared to the control (OsNF-YC4proFull). Data are expressed as mean ± SE, n = 3. Student's t-test was used to compare LUC activity driven by the deleted promoter with that driven by the full-length promoter. *P < 0.05. Error bars indicate standard error.

[0203] As shown, when the transcription repressor motif in the promoter region was removed, NF-YC4 expression was upregulated. Deletion of two ERF motifs produced a greater effect than deletion of one RAV1 motif or the combined deletion of one RAV1 motif and one ERF motif.

[0204] In another experiment, three separate mutations in the GmNF-YC4 promoter region were generated to remove the transcriptional repressor motif. In the "pro1" mutation, the ERF motif (reverse), the RAV1 motif (forward), and the intervening sequence (see SEQ ID NOs: 9 and Figure 2D ). In the "pro2" mutation, the ERF motif (inverted), the RAV1 motif (inverted) and the intervening sequence are missing (see SEQ ID NO: 11 and Figure 2D ), while the "pro3" mutation lacks two RAV1 motifs and the intervening sequence (see SEQ ID NO: 13 and Figure 2EThe control "proFull" contains the full-length promoter region, i.e., 1,448 bp upstream of the start codon (see SEQ ID NO: 8 and Figure 2C The promoter region was fused to the luciferase coding region and transformed into Agrobacterium and then into tobacco as described above. The results are shown in Figure 8 .

[0205] Figure 8 Figure 1 is a graph of LUC (luciferase) activity from tobacco in which the transcription repressor motif of the soybean NF-YC4 promoter region was deleted (pSoy-LUC DEL1, pSoy-LUC DEL2 and pSoy-LUC DEL3), and the figure is a graph of relative LUC activity compared to the control (pSoy-LUCFull). Data are expressed as mean ± SE, n = 3. Student's t-test was used to compare LUC activity driven by the deleted promoter with that driven by the full-length promoter. *P < 0.05. Error bars indicate standard error. As shown, NF-YC4 expression is upregulated when the transcription repressor motif of the promoter region is removed. The effect of deleting 2 RAV1 motifs is greater than the combined deletion of 1 RAV1 motif and 1 ERF motif.

[0206] In another experiment, rice T0 plants (Kitaake) were transformed with CRISPR / Cas9 constructs that targeted mutations introduced into the promoter region of OsNF-YC4. Multiple steps for targeted gene editing in rice were included using gRNA / Cas9 technology. The target sequence of OsNF-YC4 was selected (see SEQ ID NO: 6 and 7), a plasmid expressing luciferase (i.e., Cas9 and gRNA) was designed and constructed, embryonic callus was transformed by Agrobacterium-mediated gene transfer, primary transgenic lines were screened and identified for site-specific DNA changes, and PCR genotyping was used to identify mutants with deleted sequences. More than 19 mutant plants (T0) with heterozygous mutations were identified. T0 plants were self-pollinated to obtain offspring with homozygous mutations and isolate T-DNA. T1 seeds were harvested. Mutants with homozygous mutations and no T-DNA insertion were selected.

[0207] Embodiment 19

[0208] This example describes screening of the NF-YC4 gene promoter region to identify regions that may contain binding sites for transcriptional repressors.

[0209] Kitakke leaf genomic DNA was used as a PCR template to generate a mutant OsNF-YC4 promoter construct. The NF-YC4 gene promoter region (1 kb region upstream of the start codon) was mutated by sequentially deleting 100 bp segments, starting from the -1000 bp position (upstream of the start codon). A mutant NF-YC4 promoter was constructed by double-joint PCR, which deleted 100-bp in the middle of the promoter (i.e., -900 bp to -100 bp position) (Yu et al., Fungal Genet. Biol. 41: 973-981 (2004)).

[0210] The construct with the mutant promoter and the construct with the full-length promoter were fused to the luciferase as a reporter gene. Each construct on the binary vector was transformed into Agrobacterium GV3101 and then into Nicotiana benthamiana (Leuzinger et al. (2013), supra). The recommended developmental stage and Agrobacterium growth and infiltration concentrations for Nicotiana benthamiana were used. The recombinant luciferase protein was transiently expressed. Luciferase expression was quantified in tobacco leaves infiltrated with Agrobacterium to identify which deletion caused the expression to increase compared to the full-length promoter. It is recommended that the promoter with increased expression contain a transcriptional repressor binding site. At least 3 replicates in 3 plants were included for each construct.

[0211] Embodiment 20

[0212] This example describes the effects of QQS over- and under-expression on the expression of genes involved in plant defense.

[0213] Total RNA was extracted from the collected leaf samples using TRIzol (Life Technologies, Carlsbad, CA). RNA was further purified using the QIAGEN RNeasy Mini Kit (QIAGEN, Valencia, CA) and treated with DNAse I (Life Technologies, Carlsbad, CA) to remove DNA contamination.

[0214] 200-bp short insert library was constructed. Transcriptome sequencing was performed by Illumina HiSeq2000 system with V3 reagent (91 air end sequencing). Low quality reads were filtered as follows: reads with connectors were removed, reads with more than 5% unknown nucleotides, and reads with a quality of ≤10 for more than 20% of bases. The purified reads were aligned with the reference Arabidopsis genome in Phytozome version 8.0 (phytozome.net) using TopHat. The mapped reads were counted by htseq-count (huber.embl.de / users / anders / HTSeq / doc / count.html).

[0215] Analysis of RNA-Seq data from QQS RNAi (down-regulated QQS), QQS OE (over-expressed QQS) and wild-type Col-0 Arabidopsis plants showed that marker genes related to plant defense had perturbed transcript levels relative to wild-type Arabidopsis, as shown in Table 1 .

[0216] Table 1.

[0217]

[0218]

[0219] The patterns can be divided into three groups. The first group includes a gene, WRKY47, whose expression is reduced in both mutants, which is highly activated by bacterial infection and is involved in inducing basal defense (Truman et al., Plant J. 46 (1): 14-33 (2006)). The second group includes four genes whose expression is increased in both mutants. These four genes are JMT, MYC2, PAP1 and RAB2-6. JMT is a key metabolic enzyme in jasmonic acid (JA)-regulated plant responses (Seo et al., PNAS USA 98 (8): 4788-4793 (2001)), MYC2 is a JA-responsive transcription factor that regulates the antagonism between jasmonic acid and ethylene (ET) signaling (Chico et al., Plant Cell 26 (5): 1967-1980 (2014); Song et al., Plant Cell 26 (1): 263-279 (2014); and Zhang et al., Plant Cell 26(3):1105-1117(2014)), PAP1 is a JA-responsive transcription factor that activates anthocyanin biosynthesis and is dependent on JA to activate Col1 (Shan et al., J. Exp. Bot. 60(13):3849-3860(2009)), and RAB2-6 is an ET-responsive transcription factor that stimulates callose deposition in plants (Ali et al., BMC Plant Biol. 13:47(2013)). The third group includes three genes whose expression is reduced in mutants with downregulated QQS and increased in mutants with overexpressed QQS. The three genes are WRKY38, NPR1 regulatory protein, and PR1 pathogenesis-associated protein 1. WRKY38 is a negative regulator of NPR-dependent basal defense that regulates SA-induced immunity (Caillaud et al., PLoS Biol. 11(12):e1001732 (2013); Kim et al., Plant Cell 20(9):2357-2371 (2008); Pre et al., Plant Physiol. 147(3):1347-1357 (2008); and Seo et al. (2001), supra).

[0220] Embodiment 21

[0221] This example demonstrates that viral infection is reduced in transgenic Arabidopsis plants overexpressing NF-YC4 or QQS.

[0222] Turnip mosaic virus carrying green fluorescent protein (TuMV-GFP) inoculation assays were performed as described above (Yang et al., Molecular Plant-Microbe Interactions 20(4):358-370 (2007)) with some minor modifications. Frozen TuMV-GFP-infected turnip (first 7) ​​leaves were ground in 20 mM sodium phosphate buffer (pH 7.2, 1:6 wt / vol) and filtered through Miracloth (Calbiochem, San Diego, CA) to obtain the inoculum. The inoculum titer was adjusted to produce well-separated GFP loci.

[0223] Arabidopsis plants were grown at 22°C under 10 h of light for 7 weeks to allow large rosette leaves to develop. Rosette leaves were dusted with silicon carbide and rubbed with a cotton swab applicator to inoculate TuMV-GFP. 120 hours after inoculation (hai), the GFP loci on the inoculated rosette leaves were counted under UV irradiation ((100-W Blak-Ray long-wave UV lamp; UVP, Upland, CA). Each line had 3 biological replicates of 10 randomly selected plants. The average number of lesions for 10 plants of each line was calculated, and the significance of the difference in the number of lesions between lines was determined using the Student's t-test (P<0.01 or 0.05).

[0224] For each genotype, 40 single GFP lesions were randomly selected and photographed using a Zeiss AxioCam MRc5 digital camera on a Zeiss Stemi SV11 fluorescent dissecting microscope (Hewezi et al., Plant Cell 20 (11): 3080-3093 (2008)). The digital files were then processed with Zeiss AxioVision software. Each photographed GFP lesion was processed with ImageJ measurement tools (NIH) and calibrated for correct scaling from the Stemi SV11 initial image. The total area of ​​the GFP lesion was calculated as square millimeters. The individual measurements of the GFP lesions of each strain were used to calculate the average lesion size of each strain measured. The significance of the size differences between strains was determined using a student's t test (P < 0.01 or 0.05).

[0225] TuMV-GFP was inoculated on Arabidopsis plants with different QQS and NF-YC4 genetic backgrounds. GFP foci were counted (numbers indicate the ability of TuMV to initiate the infection process) and the size of GFP foci was measured 5 days after inoculation (size indicates the ability of TuMV to propagate in the plant). Arabidopsis Col-0 lines with altered expression of QQS and altered expression of the QQS interactor NF-YC4 were used for all infection experiments. The lines used were Col-0 (few trichomes, control for transformants) for AtQQS RNAi (QQS-downregulation), AtQQS OE (QQS-overexpression) and AtNF-YC4 OE (NF-YC4-overexpression), and Col-0 (trichomes, control for T-DNA knockout (KO) mutants) for AtQQS KO and AtNF-YC4 KO.

[0226] like Fig. 10A (A) (Plots of mutants vs. controls for the mean number of lesions per 10 Arabidopsis plants (± standard error 120 h after virus inoculation (hai)); Student's t test was used to compare the number of lesions between controls and QQS or NF-YC4 mutants; *P < 0.05. **P < 0.01. ***P < 0.001.) and 10B (Plots of mutants vs. controls for the mean lesion size (mm 2 )(± standard error at 120 hai after virus inoculation (n=40); Student's t-test was used to compare the number of foci between control and QQS or NF-YC4 mutants. ***P<0.001.), AtNF-YC4 OE plants had a significantly reduced number of GFP foci, about 88% less than the control. In contrast, AtNF-YC4 KO plants had a slightly increased number of foci, about 16.5% more than the control; although small, Student's t-test indicated that the difference was significant. Similarly, AtQQS OE plants had 21.7% fewer foci than control plants, while AtQQS RNAi plants had 12.2% more foci than control plants, and AtQQS KO plants had 45.9% more foci than controls. These results show that overexpression of AtQQS or AtNF-YC4 impairs viral infection initiation, while silencing or knocking out AtQQS or AtNF-YC4 promotes viral infection initiation. YC4 overexpression almost blocks viral infection.

[0227] The changes in lesion number showed a similar trend. The lesions in AtNF-YC4 KO, AtQQS KO, ​​and AtQQS-silenced plants were 27.8%, 52.5%, and 51.9% larger than those in the control, respectively, while the lesions in AtNF-YC4 OE and AtQQS OE plants were 51% and 32% smaller than those in the control, respectively.

[0228] These results show that overexpression of AtNF-YC4 or AtQQS impairs virus reproduction, while silencing or knocking out AtNF-YC4 or AtQQS promotes virus reproduction. The experiments indicate that QQS and its interactor NF-YC4 reduce infection initiation in plants and reduce virus reproduction. Therefore, they are positive regulators of plant immune responses, as their respective overexpression increases plant resistance to viruses.

[0229] Embodiment 22

[0230] This example demonstrates that bacterial growth is reduced in transgenic Arabidopsis plants overexpressing NF-YC4 or QQS.

[0231] Arabidopsis plants were grown at 22°C for 4-5 weeks under 10 h light and 14 h dark. Pseudomonas syringae was washed and resuspended in inoculation buffer (10 mM MgCl2, 0.05% Silwet L-77). Plants were sprayed with the bacterial inoculum and the bacterial level was adjusted to 10 8 Colony forming units (CFU) / mL (Katagiri et al., The Arabidopsisthaliana–Pseudomonas syringae Interaction. The Arabidopsis Book / American Society of Plant Biologists, 1, e0039. http: / / doi.org / 10.1199 / tab.0039 (2002)). The bacterial level of the plant was determined as follows: leaf discs (0.5 cm inner diameter) were cut with a cork borer and homogenized completely in 500 μl of inoculation buffer. The resulting suspension containing bacteria was diluted and inoculated on KB plates with appropriate antibiotics.

[0232] Plant bacterial growth of Pst DC3000 and ΔCEL strains was tested in the same set of Arabidopsis plants listed in Example 21. Pst DC3000 is a bacterial pathogen that robustly infects Arabidopsis plants, while ΔCEL is an avirulent strain that grows slowly in plants, which is a mutant Pst DC3000 strain with mutations in multiple effector genes. Pst DC3000 grew about 1,000 times in 4 days, while ΔCEL grew about 10 times. Pst DC3000 growth was greatly impaired in plants overexpressing AtNF-YC4 or AtQQS, with a reduction of 88% and 63%, respectively. In contrast, in AtQQS or AtNF-YC4 RNAi and KO lines, Pst DC3000 growth increased by about 30%. The increase in Pst DC3000 growth was quite significant in AtQQS RNAi plants, while AtQQS or AtNF-YC4 KO lines were not significant at the p=0.05 level.

[0233] On the other hand, it is clear that the growth of ΔCEL in AtQQS or AtNF-YC4 RNAi and KO lines is greatly improved by about 2.6 times. The growth changes of ΔCEL are not similarly significant in AtQQS or AtNF-YC4 overexpressing plants. Overall, the data on the growth changes of the two bacterial strains in Arabidopsis plants with different genetic backgrounds show that overexpression of AtNF-YC4 or AtQQS can improve the plant immune response, making the bacterial pathogens of robust infection less toxic and growing slowly, while silencing or knocking out AtNF-YC4 or AtQQS weakens the plant immune response, making the growth of avirulent bacterial pathogens better. Therefore, these data show that AtNF-YC4 and AtQQS are positive regulators of the plant immune response.

[0234] The results are summarized in Fig.11 . Fig.11 is the number of bacteria (log 10 (CFU / cm 2 The initial inoculum was uniformly adjusted to 10 8 CFU / mL. Error bars indicate standard error. Student's t-test was used to compare bacterial numbers between control and QQS or NF-YC4 mutants. **P<0.01.***P<0.001.

[0235] Embodiment 23

[0236] This example demonstrates that bacterial growth is reduced in transgenic soybean plants overexpressing NF-YC4 or expressing QQS.

[0237] The NF-YC4 CDS from soybean (GmNF-YC4) was inserted into the vector pB2GW7, which contains the Bar gene (phosphinothricin acetyltransferase gene) under the control of the Pnos (nos promoter) and Tnos (nos terminator) of the nopaline synthase from tobacco (see Figure 1C , which is a vector map). GmNF-YC4 on this vector is controlled by p35S (cauliflower mosaic virus (CaMV) 35S promoter) and terminated by T35S (CaMV 35S). Only the region between LB and RB is introduced into plants to generate transgenic plants.

[0238] Generate expression of AtQQS (AtQQS; see Examples 1 and Figure 1AStable transgenic soybean lines expressing the vector map of QQS-OE-pB2GW7) or overexpressing GmNF-YC4 (Glyma06g17780; GmNF-YC4 OE) were prepared and grown in a growth chamber at 22°C under 14 hours of light and 10 hours of darkness. Soybean mutant plants of QQS E, GmNF-YC4-OE and empty vector controls were selected by PCR screening of leaf DNA. The first three leaves on 23-day-old soybeans were used for inoculation. Freshly cultured Pseudomonas savastanoi pv. glycinea Race 4 (PsgR4) were suspended in inoculation buffer (see Example 22) to a final concentration of about 10 7 CFU / mL. The leaflets of each trifoliate leaf were wounded by needle before 5 μL of inoculum was placed on each wound (10 / leaflet). The bacterial levels of the plants were determined 10 days after inoculation as described above.

[0239] Psg causes bacterial blight on soybean, which is considered a great threat to soybean production. PsgR4 is one of the most virulent strains because it can infect almost all commercial soybean cultivars. Using soybean lines carrying an empty vector as a control, PsgR4 grew much slower in soybean GmNF-YC4 OE lines and soybean AtQQS-E lines, with a reduction of 62.4% and 55.3%, respectively. PsgR4 attenuated bacterial growth in soybean lines overexpressing GmNF-YC4 or expressing AtQQS, indicating that GmNF-YC4 and AtQQS also enhance soybean immune responses, which is consistent with the above data that NF-YC4 and QQS are positive regulators of plant immune responses.

[0240] The results are summarized in Fig. 12A . Fig. 12A The number of bacteria (CFU*10 4 / cm 2 ) for soybean lines. The initial inoculum was uniformly adjusted to 10 7 CFU / mL. Error bars indicate standard error. Student's t-test was used to compare bacterial numbers of control and QQS or NF-YC4 mutants. **P<0.01. (EV=empty vector).

[0241] To confirm that GmNF-YC4 was overexpressed in transgenic soybean lines, the expression level of GmNF-YC4 was determined by quantitative real-time PCR. Approximately 100 mg of soybean leaves were used for RNA isolation using the RNeasy Plant Mini Kit (Qiagen) according to the manufacturer's instructions. 2 μg of RNA and III First Strand Kit (Invitrogen) was used for cDNA synthesis. Quantitative real-time PCR (qRT-PCR) was performed using cDNA and gene-specific primers (GmNF-YC4Fd: 5'-CCTCCCAGGCATGGCAGTCC-3' [SEQ ID NO: 18] and GmNF-YC4Rev: 5'-CCATCAAGGCTCCGCTGG-3' [SEQ ID NO: 19]). Each cDNA was amplified by quantitative PCR using iQ TM Green Supermix (Bio-Rad) and iCycler real-time PCR system (Bio-Rad). GmACTIN expression was used to normalize the expression values ​​of each sample, and the relative expression values ​​were compared with the mock samples using the comparative Ct method (2 -ΔΔCt )Sure.

[0242] GmACTIN (Glyma 15g050200) was used as a reference gene (Liu et al., Mol. Plant Microbe Interact. 27(8):824-834 (2014)). The expression level of GmNF-YC4 in the GmNF-YC4 OE line was 4.47 times higher than that in the soybean control line.

[0243] The results are summarized in Fig. 12B . Fig. 12B is a graph of NF-YC4-OE soybean lines in terms of relative expression levels. Error bars indicate standard error. **P<0.01. (EV=empty vector).

[0244] Embodiment 24

[0245] This example demonstrates aphid reduction in transgenic soybean plants overexpressing NF-YC4 or expressing QQS.

[0246] Transgenic soybean plants were generated as described in Example 23. Soybean seeds were planted at 25°C with a photoperiod of 16 hours light and 8 hours dark. Plants were infested with pests 18 days after planting. Seven days after infestation, the average number of aphids per plant was determined. The results are shown in Fig.13 .

[0247] Fig.13The average number of aphids per plant is shown for soybean genotypes QQS-E 16-6 (QQS expressing line 16-6), QQS-E 32-6 (QQS expressing line 32-6), control, NF-YC4-OE L1 (NF-YC4 overexpressing line 1), and NF-YC4-OE L2 (NF-YC4 overexpressing line 2). Error bars indicate standard error. Student's t-test was used to compare the number of aphids in the control and QQS or NF-YC4-OE mutants. *P<0.05. **P<0.01. (EV=empty vector) As shown, the average number of aphids per plant was reduced by about 20% to about 30% in soybean plants expressing QQS or overexpressing NF-YC4 compared to the control.

[0248] Embodiment 25

[0249] This example demonstrates that protein or protein+oil content is increased in seeds of transgenic soybean plants overexpressing NF-YC4.

[0250] Transgenic soybean plants (Williams 82) overexpressing NF-YC4 were generated as described in Example 23 and grown in the field. T2 seeds were analyzed by NIRS as described in Example 2. Data are shown in Figures 14A-14E .

[0251] Fig.14A Graph of protein content of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein content of NF-YC4-OE mutants and sister control. *P<0.05. **P<0.01. As shown, protein in soybean plants overexpressing NF-YC4 increased by about 6% to about 12% compared to controls.

[0252] Fig. 14B Graph of oil content of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare oil content of NF-YC4-OE mutants and sister control. *P<0.05. As shown, oil in soybean plants overexpressing NF-YC4 was similar or reduced to controls.

[0253] Fig. 14CGraph of protein + oil content of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein + oil content of NF-YC4-OE mutants and sister control. *P<0.05. **P<0.01. As shown, protein + oil content in soybean plants overexpressing NF-YC4 was increased by about 5% to about 7% compared to controls.

[0254] Fig.14D Graph of seed fiber (% / g fresh weight, 13% moisture) of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister plant controls. Error bars indicate standard error. Student's t-test was used to compare fiber content of NF-YC4-OE mutants and sister plant controls. **P<0.01. As shown, seed fiber in soybean plants overexpressing NF-YC4 was reduced by about 3.4% to about 5.6% compared to controls.

[0255] Fig.14E Is a graph of seed weight per plant (g / plant) of transformed soybean (NF-YC4-OE) transformation events (1, 2, 3, and 4; each number indicates a different transformation event) overexpressing NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare seed weight per plant of NF-YC4-OE mutants and sister control. As shown, seed weight per plant in soybean plants overexpressing NF-YC4 was similar to the control.

[0256] Embodiment 26

[0257] This example demonstrates that protein content is increased in seeds of transgenic corn plants overexpressing NF-YC4.

[0258] Transgenic maize plants overexpressing NF-YC4 were generated and grown in the field. The construct from Example 1 was introduced into maize by Agrobacterium-mediated transformation. Backcross 2 (BC2; B104 background backcross B104) seeds were analyzed by NIRS as described in Example 2. Data are shown in Figures 15A-15C .

[0259] Fig.15A is a graph of grain protein (% per dry weight) of transformed maize overexpressing Arabidopsis NF-YC4 (AtNF-YC4-OE) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare protein content of NF-YC4-OE mutant and sister control. **P<0.01. As shown, grain protein increased by approximately 17% compared to control.

[0260] Fig. 15B Is a graph of kernel oil (per dry weight %) of transformed maize (AtNF-YC4-OE) overexpressing Arabidopsis NF-YC4 compared to sister control. Error bars indicate standard error. Student's t-test was used to compare the oil content of NF-YC4-OE mutant and sister control. As shown, kernel oil was similar to control.

[0261] Fig. 15C is a graph of kernel starch (per dry weight %) of transformed maize overexpressing Arabidopsis NF-YC4 (AtNF-YC4-OE) compared to sister control. Error bars indicate standard error. Student's t-test was used to compare starch content of NF-YC4-OE mutant and sister control. **P<0.01. As shown, kernel starch was reduced by approximately 2.2% compared to control.

[0262] Embodiment 27

[0263] This example demonstrates that protein content is increased in seeds of transgenic rice plants overexpressing NF-YC4.

[0264] Transgenic rice plants overexpressing NF-YC4 were generated and grown in the field. The construct from Example 17 (pB2GW7-OsNF-YC4) was introduced into rice by Agrobacterium-mediated transformation. Data are shown in Fig.16A and 16B .

[0265] Fig.16A is a graph of grain starch (mg / g dry weight) of transformed rice overexpressing rice NF-YC4 (OsNF-YC4-1-OE) compared to wild type. Error bars indicate standard error. Student's t-test was used to compare grain starch content of NF-YC4-OE mutant and control. **P<0.01. As shown, grain starch was reduced by about 6%.

[0266] Fig. 16B is a graph of seed protein (mg / g dry weight) of transformed rice overexpressing rice NF-YC4 (OsNF-YC4-1-OE) compared to wild type. Error bars indicate standard error. Student's t-test was used to compare seed protein content of NF-YC4-OE mutant and control. **P<0.01. As shown, seed protein increased by about 37%.

[0267] All patents, patent application publications, journal articles, textbooks, and other publications mentioned in this specification are indicative of the levels of those skilled in the art to which the present disclosure relates. All of these publications are incorporated herein by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0268] The invention illustratively described herein can be appropriately implemented without any elements or limitations, which are not specifically disclosed herein. Thus, for example, any of the terms "comprising", "consisting essentially of", and "consisting of" in each example herein can be replaced by any of the other two terms. Likewise, the singular forms "a", "an", and "the" include plural forms unless the context clearly indicates otherwise. Thus, for example, reference to "the method" includes one or more types of methods and / or steps, which are described herein and / or apparent to one of ordinary skill in the art by reading this disclosure.

[0269] The terms and expressions employed are used as terms of description, not limitation. In this regard, certain terms are defined under "Definitions" and are otherwise defined, described, or discussed elsewhere in the "Detailed Description", and all such definitions, descriptions, and discussions are intended to be attributed to these terms. The use of such terms and expressions is not intended to exclude equivalents of any features shown and described, or portions thereof. In addition, when a subheading such as "Definitions" is used in the "Detailed Description", such use is for ease of reference only and is not intended to limit any disclosure made in a certain section to only that section; on the contrary, any disclosure made under a certain subheading is intended to constitute disclosure under each subheading.

[0270] It is recognized that multiple modifications are feasible within the scope of the invention claimed. Therefore, it should be understood that although the present invention is specifically disclosed in the context of preferred embodiments and optional features, those skilled in the art may rely on modifications and variations of the concepts disclosed herein. Such modifications and variations are considered to be within the scope of the invention claimed herein. Sequence Listing <110> Iowa State University Research Foundation <120> Modification of the transcriptional repressor binding site of the NF-YC4 promoter to increase protein content and stress resistance <130> ISURF 1401-2 PCT <150> 62 / 117,924 <151> 2015-02-18 <150> 62 / 244,131 <151> 2015-10-20 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 1447 <212> DNA <213> Oryza sativa <400> 1 gcaagaaccc cagttgagag tggagatggc cattttgttc aggcactagg cagtgggtag 60 gacggtgagg agtgtgtcct gcactcctgc ttcccctgac gatcgatccc catgcgtgcc 120 gaagcatctg atacttttgc tgtgctgttc tttaatttac cctgatactt ttggatatct 180 gaagcagtag agctcgttca ctcaaacagg ctagcctgtt ttgctttctg gtaagaactt 240 aattaactag ttgagatcga catgcatgga tgcgtgaatc tattgttgca ttttttctaa 300 tggatagtta gatttgttcc agcttttttt ttgtcaattc tgttacattt gcagtgtctt 360 caacttctgc atcattcttc tctattcttc ttcactttc tttcttgaac tagaaaagca 420 aaccagagtt ctttttcccc ctcttctaca taaacgaaaa cagcttgttg actggctccc 480 tagagcttt tgtaagttga tcatcgaagt agctagttct cttcacttat cagtcatcac 540 tgttctatgt tctatctgca ttttccttga ttttgtactt ttcctgaacg aaaggacaat 600 ccttagccat cataatgcta tgatcgactt attctgaagt catccggcct cgatcctctt 660 ttgtttcggt gagatctgta atggtttagg aaaattatgg atctctgaaa aataagaaac 720 atctagtagt atatgaaatt aagaaatgtc ggaccacgtc aaatcctact ggtatcatat 780 accagataac taacttttg aatggaacca aacacgagat tgtgaatata tagcagtaag 840 aaatacaacc ccgaagggta aaggagaaaa aggaaaagca gtttagtgta cgagctgtag 900 gagtagcttt gctcctgcca aggcccagat ccttgcctct tccttcattt ctgcgaggag 960 accaggcact gaggtctcat tgtgatcgaa gattctcctg tttctctcct tccagatctc 1020 ctttgggaac accctgtgtg tttgcaagcg cttagcttca ttttcatgca tgatatgatc 1080 tctggataga agataagtag cccccacaca tgcacttcgc cacctatagc cagcctcgag 1140 ttctcatctg tttgatccgt cgcacatgtg gagcaacgaa gctctagagt acgtctccta 1200 atctctactt acttttgcag tttgcacaca tattgagaaa tgcttatcaa tccttcgatc 1260 tctcacagac aatacctaca agcgtcgttt acactttgca tgtatagcta gccattgtta 1320 catacgtgga gcatgtagcg atcattcgtt cctagcacgt aaattaatcg ccgtaattttt 1380 gcccatgcag acacagcaca cacagctaca aatcgactgt aattaaggta cgtatatata 1440 ggtgaca 1447 <210> 2 <211> 1441 <212> DNA <213> Oryza sativa <400> 2 gcaagaaccc cagttgagag tggagatggc cattttgttc aggcactagg cagtgggtag 60 gacggtgagg agtgtgtcct gcactcctgc ttcccctgac gatcgatccc catgcgtgcc 120 gaagcatctg atacttttgc tgtgctgttc tttaatttac cctgatactt ttggatatct 180 gaagcagtag agctcgttca ctcaaacagg ctagcctgtt ttgctttctg gtaagaactt 240 aattaactag ttgagatcga catgcatgga tgcgtgaatc tatatttttt ctaatggata 300 gttagatttg ttccagcttt ttttttgtca attctgttac atttgcagtg tcttcaactt 360 ctgcatcatt cttctctatt cttccttcac tttctttctt gaactagaaa agcaaaccag 420 agttcttttt cccctcttc tacataaacg aaaacagctt gttgactggc tccctagagc 480 tttttgtaag ttgatcatcg aagtagctag ttctcttcac tttcagtca tcactgttct 540 atgttctatc tgcattttcc ttgatttgt acttttcctg aacgaaagga caatccttag 600 ccatcataat gctatgatcg acttattctg aagtcatccg gcctcgatcc tcttttgttt 660 cggtgagatc tgtaatggtt taggaaaatt atggatctct gaaaaataag aaacatctag 720 tagtatga attaagaaa tgtcggacca cgtcaaatcc tactggtatc atataccaga 780 taactaactt tttgaatgga accaaacacg agattgtgaa tatatagcag taagaaatac 840 aaccccgaag ggtaaaggag aaaaaggaaa agcagtttag tgtacgagct gtaggagtag 900 ctttgctcct gccaaggccc agatccttgc ctcttccttc atttctgcga ggagaccagg 960 cactgaggtc tcattgtgat cgaagattct cctgtttctc tccttccaga tctcctttgg 1020 gaacaccctg tgtgtttgca agcgcttagc ttcattttca tgcatgatat gatctctgga 1080 tagaagataa gtagcccca cacatgcact tcgccaccta tagccagcct cgagttctca 1140 tctgtttgat ccgtcgcaca tgtggagcaa cgaagctcta gagtacgtct cctaatctct 1200 acttacttt gcagtttgca cacatattga gaaatgctta tcaatccttc gatctctcac 1260 agacaatacc tacaagcgtc gtttacactt tgcatgtata gctagccatt gttacatacg 1320 tggagcatgt agcgatcatt cgttcctagc acgtaaatta atcgccgtaa ttttgcccat 1380 gcagacacag cacacacagc tacaaatcga ctgtaattaa ggtacgtata tataggtgac 1440 at 1441 <210> 3 <211> 1439 <212> DNA <213> Oryza sativa <400> 3 gcaagaaccc cagttgagag tggagatggc cattttgttc aggcactagg cagtgggtag 60 gacggtgagg agtgtgtcct gcactcctgc ttcccctgac gatcgatccc catgcgtgcc 120 gaagcatctg atacttttgc tgtgctgttc tttaatttac cctgatactt ttggatatct 180 gaagcagtag agctcgttca ctcaaacagg ctagcctgtt ttgctttctg gtaagaactt 240 aattaactag ttgagatcga catgcatgga tgcgtgaatc tattgttgca ttttttctaa 300 tggatagtta gatttgttcc agcttttttt ttgtcaattc tgttacattt gcagtgtctt 360 caacttctgc atcattcttc tctattcttc ttcactttc tttcttgaac tagaaaagca 420 aaccagagtt ctttttcccc ctcttctaca taaacgaaaa cagctggctc ctagagactt 480 tttgtaagtt gatcatcgaa gtagctagtt ctcttcactt atcagtcatc actgttctat 540 gttctatctg cattttcctt gattttgtac ttttcctgaa cgaaaggaca atccttagcc 600 atcataatgc tatgatcgac ttattctgaa gtcatccggc ctcgatcctc ttttgtttcg 660 gtgagatctg taatggttta ggaaaattat ggatctctga aaaataagaa acatctagta 720 gtatatgaaa ttaagaaatg tcggaccacg tcaaatccta ctggtatcat ataccagata 780 actaactttt tgaatggaac caaacacgag attgtgaata tatagcagta agaaatacaa 840 ccccgaaggg taaaggagaa aaaggaaaag cagtttagtg tacgagctgt aggagtagct 900 ttgctcctgc caaggcccag atccttgcct cttccttcat ttctgcgagg agaccaggca 960 ctgaggtctc attgtgatcg aagattctcc tgtttctctc cttccagatc tcctttggga 1020 acaccctgtg tgtttgcaag cgcttagctt cattttcatg catgatatga tctctggata 1080 gaagataagt agcccccaca catgcacttc gccacctata gccagcctcg agttctcatc 1140 tgtttgatcc gtcgcacatg tggagcaacg aagctctaga gtacgtctcc taatctctac 1200 ttactttgc agtttgcaca catattgaga aatgcttatc aatccttcga tctctcacag 1260 acaataccta caagcgtcgt ttacactttg catgtatagc tagccattgt tacatacgtg 1320 gagcatgtag cgatcattcg ttcctagcac gtaaattaat cgccgtaatt ttgcccatgc 1380 agacacagca cacacagcta caaatcgact gtaattaagg tacgtatata taggtgaca 1439 <210> 4 <211> 1336 <212> DNA <213> Oryza sativa <400> 4 gcaagaaccc cagttgagag tggagatggc cattttgttc aggcactagg cagtgggtag 60 gacggtgagg agtgtgtcct gcactcctgc ttcccctgac gatcgatccc catgcgtgcc 120 gaagcatctg atacttttgc tgtgctgttc tttaatttac cctgatactt ttggatatct 180 gaagcagtag agctcgttca ctcaaacagg ctagcctgtt ttgctttctg gtaagaactt 240 aattaactag ttgagatcga catgcatgga tgcgtgaatc tattgttgca ttttttctaa 300 tggatagtta gatttgttcc agcttttttt ttgtcaattc tgttacattt gcagtgtctt 360 caacttctgc atcattcttc tctattcttc ttcactttc tttcttgaac tagaaaagca 420 aaccagagtt ctttttcccc ctcttctaca taaacgaaaa cagcttgttg actggctccc 480 taggcttt tgtaagttga tcatcgaagt agctagttct cttcacttat ctccggcctc 540 gatcctcttt tgttcggtg agatctgtaa tggtttagga aaattatgga tctctgaaaa 600 ataagaaaca tctagtagta tatgaaatta agaaatgtcg gaccacgtca aatcctactg 660 gtatcatata ccagataact aactttttga atggaaccaa acacgagatt gtgaatatat 720 agcagtaaga aatacaaccc cgaagggtaa aggagaaaaa ggaaaagcag tttagtgtac 780 gagctgtagg agtagctttg ctcctgccaa ggcccagatc cttgcctctt cttcatttc 840 tgcgaggaga ccaggcactg aggtctcatt gtgatcgaag attctcctgt ttctctcctt 900 ccagatctcc tttgggaaca ccctgtgtgt ttgcaagcgc ttagcttcat tttcatgcat 960 gatatgatct ctggatagaa gataagtagc ccccacacat gcacttcgcc acctatagcc 1020 agcctcgagt tctcatctgt ttgatccgtc gcacatgtgg agcaacgaag ctctagagta 1080 cgtctcctaa tctctactta cttttgcagt ttgcacacat attgagaaat gcttatcaat 1140 ccttcgatct ctcacagaca atacctacaa gcgtcgttta cactttgcat gtatagctag 1200 cattgttac atacgtggag catgtagcga tcattcgttc ctagcacgta aattaatcgc 1260 cgtaatttg cccatgcaga cacagcacac acagctacaa atcgactgta attaaggtac 1320 established gtgaca 1336 <210> 5 <211> 111 <212> DNA <213> Oryza sativa <400> 5 agtcatcact gttctatgtt ctatctgcat tttccttgat tttgtacttt tcctgaacga 60 aaggacaatc cttagccatc ataatgctat gatcgactta ttctgaagtc a 111 <210> 6 <211> 1257 <212> DNA <213> Oryza sativa <400> 6 gcaagaaccc cagttgagag tggagatggc cattttgttc aggcactagg cagtgggtag 60 gacggtgagg agtgtgtcct gcactcctgc ttcccctgac gatcgatccc catgcgtgcc 120 gaagcatctg atacttttgc tgtgctgttc tttaatttac cctgatactt ttggatatct 180 gaagcagtag agctcgttca ctcaaacagg ctagcctgtt ttgctttctg gtaagaactt 240 aattaactag ttgagatcga catgcatgga tgcgtgaatc tattgttgca ttttttctaa 300 tggatagtta gatttgttcc agcttttttt ttgtcaattc tgttacattt gcagtgtctt 360 caacttctgc atcattcttc tctattcttc ttcactttc tttcttgaac tagaaaagca 420 aaccagagtt ctttttcccc ctcttctaca tatccggcct cgatcctctt ttgtttcggt 480 gagatctgta atggtttagg aaaattatgg atctctgaaa aataagaaac atctagtagt 540 atatgaaatt aagaaatgtc ggaccacgtc aaatcctact ggtatcatat accagataac 600 taactttttg aatggaacca aacacgagat tgtgaatata tagcagtaag aaatacaacc 660 ccgaagggta aaggagaaaa aggaaaagca gtttagtgta cgagctgtag gagtagcttt 720 gctcctgcca aggcccagat ccttgcctct tccttcattt ctgcgaggag accaggcact 780 gaggtctcat tgtgatcgaa gattctcctg tttctctcct tccagatctc ctttgggaac 840 accctgtgtg tttgcaagcg cttagcttca tttcatgca tgatatgatc tctggataga 900 agataagtag cccccacaca tgcacttcgc cacctatagc cagcctcgag ttctcatctg 960 tttgatccgt cgcacatgtg gagcaacgaa gctctagagt acgtctccta atctctactt 1020 acttttgcag tttgcacaca tattgagaaa tgcttatcaa tccttcgatc tctcacagac 1080 aatacctaca agcgtcgttt acactttgca tgtatagcta gccattgtta catacgtgga 1140 gcatgtagcg atcattcgtt cctagcacgt aaattaatcg ccgtaatttt gcccatgcag 1200 acacagcaca cacagctaca aatcgactgt aattaaggta cgtatatata ggtgaca 1257 <210> 7 <211> 190 <212> DNA <213> Oryza sativa <400> 7 aacgaaaaca gcttgttgac tggctcccta gagctttttg taagttgatc atcgaagtag 60 ctagttctct tcacttatca gtcatcactg ttctatgttc tatctgcatt ttccttgatt 120 ttgtactttt cctgaacgaa aggacaatcc ttagccatca taatgctatg atcgacttat 180 tctgaagtca 190 <210> 8 <211> 1176 <212> DNA <213> Glycine max <400> 8 taatataata taagaatttg taattatata acctaaaaa ggtgcatacc aaatgaatag 60 tttatttca aagcaagat aaattttata cacaaagtg acaaatgtg gacttgaaaa 120 tcacatgcta gagcaagca aggttcagat gaagccaat ggctagaacg taaatgctgc 180 aaaaatcaat tatattgaa tctcacggggc attgacaa agagaatgga cccatcaatg 240 gggcattgac atggatggat ggacaccct catagtcaca tgccacaca gagtaacgct 300 aaaaaaatg tattaacaa aactatagga tcatgctttc ttaatttaaaacataggtg 360 gtcagtttt gttaacatta atttttagga ttttgttg aagacaata tggaaggttt 420 ataataattt atgtgcatta ctcaatgtaa tccttaaaat gaaataact aaactttttt 480 tttttggata gttaacaac tacgaagcta aatgaataat taatcaata ttaatttga 540 ttaaaataa gattataat atccctaata tgtgaacaa actttgttgg taatgtaaaa 600 aaatttaaaaaaacagat taaattacgt atttaataat ttaagattaa tgttgtttaa 660 tttgattttt taaatattta tctttcttt gatttgatt ctttagttca cttaagatta 720 tgatcgttaa tattctaaa agtaaatgt catcaatctt gattgattg aagattaaa 780 ttaaaaaaaaaaaaaaatgaaaatacatttt aaaaaaaaag atgaaaaaaaaa 840 atgtgtcatt taaccaaaa aaaaaggaa aaaaaggaac taccctcc 900 cctcaaaaaa gaaaagaaaaaaaaagga acttacctt gttgttccg ttgaattga 960 aaaaacaaac cctaactta ggtcctagg cactgtcgg atatgttatt 1020 gtttagttta ccttatccca ccacatacat agtttttt ttctttaatt tcccaatcaa ttccatccat cgggtcttta ctctcttacc caacccacac acacctttc tctctctc 1140 tttccctgat catcaaatc agaaaaaatt ggggga 1176 <210> 9 <211> 1159 <212> DNA <213> Glycine max <400> 9 taatataata taagaatttg taattatata acctaaaaa ggtgcatacc aaatgaatag 60 tttatttca aagcaagat aaattttata cacaaagtg acaaatgtg gacttgaaaa 120 tcacatgcta gagcaagca aggttcagat gaagccaat ggctagaacg taaatgctgc 180 aaaaatcaat tatattgaa tctcacggggc attgacaa agagaatgga cccatcaatg 240 gggcattgac atggatggat ggacaccct catgagtaac gctaaaacaa atgtattac 300 aaaaactata ggatcatgct ttcttaattt aaaaacatag gtggtcagtt ttgttaaca 360 ttaattttta ggattattg tgagacaa atatggaagg ttttaata tttgtgca 420 ttactcaatg taatccttaa atgaaaata actaacttt ttttttgg atagttaaac 480 actacgaag ctaaatgaat aattaatca attaattt tgattaaaa tagattaat 540 atatcccta atattgtgaa caactttgt tggtaatgta aaaaaatta aaagaaaacaa 600 gatttaatta cgtatttaat aatttagat taatgttgtt taatttgat ttttaaatat 660 ttatctttct tttgaatttg attctttg tcacttaaga ttatgatcgt taatattct 720 aaagattaaa tgtcatcaat cttgaattga ttgaaagatt aaaagatta aaagatta 780 agataatga tgaaaataca tttaaaaaat aagatgaaac aaatgtgtc atttaccaa 840 aaaaaaaagg aaaaaaat taaaaaaagg aacttaccct tccctcaa aaaaaaga 900 aaaaaaaaaa ggaacttacc cttggttgtt ccgttgaat tgaaaaaaaaccctaaac 960 ttaccttaac ctaggtccta gggcactggt cggatatgtt attgttgt ttaccttatc 1020 ccaccacata catagtttt tttttttta atttcccaat cattccatc catcgggtct 1080 tactctctt acccaaccca cacacactct ttctctct ctctttccct gatcatcaa 1140 atcagaaaaa attggggga 1159 <210> 10 <211> 17 <212> DNA <213> Glycine max <400> 10 agtcacatgc 17 <210> 11 <211> 1135 <212> DNA <213> Glycine max <400> 11 taatataata taagaatttg taattatata acctaaaaa ggtgcatacc aaatgaatag 60 tttatttca aagcaagat aaattttata cacaaagtg acaaatgtg gacttgaaaa 120 tcacatgcta gagcaagca aggttcagat gaagccaat ggctagaacg taaatgctgc 180 aaaaatcaat tatattgaa tctcacggggc attgacaa agagaatgga cccatcaatg 240 gggcattgac atggatggat ggacaccct catagtcaca tgccacaca gagtaacgct 300 aaaaaaatg tattacaaa aactatagga tcatgctttc ttaatttaaaacataggta 360 agacaatat ggaggttta taataattta tgtgcattac tcaatgtaat ccttaaaatg 420 aaaataacta aacttttttt ttttggatag ttaaacaact acgaagctaa atgaataatt 480 aaatcaat taatttgat taaaaatag attaata tccctaat tgtgaacaaa 540 ctttgttggt aatgtaaaa aaattaaag aaacaagatt aattacgta tttaatatt 600 taagattaat gttgtttaat ttgattttt aaatatttat ctttctttg aatttgattc 660 tttagttcac ttaagattat gatcgttaat aattctaaaa gataaatgtc atcaatcttg 720 Aadgattga agattaat daaaaaaaaaaaaatgattga aadgattga attackattatta 780 aaaaaataga tgaaaaaaaa tgtgtcattt aaaaaaaaaaaaaaaatttaaa 840 aaaaggaact taccctcccc ctcaaaaag aaaaaaaaaaaaggaa cttacccttg 900 gttgttccgt tgaaattgaa aaaacaacc ctaacttac cttaacctag gtcctagggc 960 actggtcgga tatgttattg tttagtttac cttatcccac cacatacata gtttttttt 1020 tcttaaattt cccaatcat tccatccatc gggtctttac tctcttacc acccacaca 1080 cactctttct ctctctct tccctgatc atcaaatca gaaaaaattg gggga 1135 <210> 12 <211> 41 <212> DNA <213> Glycine max <400> 12 gtcagtttt tgttaacatt aatttttagg attatttgtt g 41 <210> 13 <211> 1105 <212> DNA <213> Glycine Max <400> 13 taatataata taagaatttg taattatata acctaaaaa ggtgcatacc aaatgaatag 60 tttatttca aagcaagat aaattttata cacaaagtg acaaatgtg gacttgaaaa 120 tcacatgcta gagcaagca aggttcagat gaagccaat ggctagaacg taaatgctgc 180 aaaaatcaat tatattgaa tctcacggggc attgacaa agagaatgga cccatcaatg 240 gggcattgac atggatggat ggacaccct catagtcaca tgccacaca gagtaacgct 300 aaaaaaatg tattaacaa aactatagga tcatgctttc ttaatttaaaacataggtg 360 gtcagtttt gttaacatta atttttagga ttttgttg aagacaata tggaaggttt 420 ataataattt atgtgcatta ctcaatgtaa tccttaaaat gaaataact aaactttttt 480 tttttggata gttaacaac tacgaagcta aatgaataat taatcaata ttaatttga 540 ttaaaaata gatttaataat acccctaata tgtgaacaa actttttaat ttgatttttt 600 aaatatttat ctttctttg aatttgattc tttagttcac ttaagattat gatcgttaat 660 aattctaaa gataatgtc atcaatcttg attgattga aagattaat taataaaaa 720 gattagat aatgatgaa atacattatta aaaataga tgaaaaaaa tgtgtcattt 780 aaaaaaaaaaaaaaaaaaaaaaaaggaact taccctcccc ctcaaaaaag 840 aaaaaaaa aaaaaaggaa cttacccttg gttgttccgt tgaaattgaa aaaaaaacc 900 ctaaacttac cttaacctag gtcctaggggc actgtcgga tatgttattg tttagtttac 960 cttatcccac cacatacata gtttttttt tcttaaattt cccaatcaat tccatccatc 1020 gggtctttac tctcttaccc aacccacaca cactctttct ctctctct ttccctgatc 1080 atcaaaatca gaaaaaattg gggga 1105 <210> 14 <211> 71 <212> DNA <213> Glycine max <400> 14 tgttggtaat gtaaaaaaaa ttaaaagaaa caagattaaa ttacgtattt aataatttaa 60 gattaatgtt g 71 <210> 15 <211> 586 <212> DNA <213> Arabidopsis thaliana <400> 15 ctcagaagaa gcctcctttc gatctgtcag ccattgaaga aacctccttt cgatctgtca 60 gccattgaag atcagaagaa acaagactca cacggtcagc cattgaagaa gcctcctctc 120 attacctctc atcaaacatc tagatctgta cccaaacctt atcccttttt ccttatttct 180 cgctttgtct attcttaatc tgattaatac ttgttgttgt tccaggttat agaagatctg 240 ggttgtgtta tatgcttcat tttctccaca gcgaccagtt ggtgtttggt tcttagattc 300 atgaagacca atagagagca ggaaatttac gttgaaagaa gcttcaaacc aaacaattca 360 acaattcaga atttgatgga cattgaaagg ttcattttgc ctcacacttc tacatcaggt 420 gtcgcaaggc tcaaaatgag ggtcatatca tgggtcgggc ttcagttcta caactactga 480 tattgggcct tatcacaaat tagttatagg gccattgtat ccaatattta atatctctgt 540 aaacttgttt aatggttatt ttgttctaat gcccattaca actaga 586 <210> 16 <211> 59 <212> PRT <213> Arabidopsis thaliana <400> 16 Met Lys Thr Asn Arg Glu Gln Glu Ile Tyr Val Glu Arg Ser Phe Lys 1 5 10 15 Pro Asn Asn Ser Thr Ile Gln Asn Leu Met Asp Ile Glu Arg Phe Ile 20 25 30 Leu Pro His Thr Ser Thr Ser Gly Val Ala Arg Leu Lys Met Arg Val 35 40 45 Ile Ser Trp Val Gly Leu Gln Phe Tyr Asn Tyr 50 55 <210> 17 <211> 32 <212> DNA <213> Glycine max <400> 17 ggtcagtttt tgttaacatt aatttttagg at 32 <210> 18 <211> 20 <212> DNA <213> Artificial <220> <223> Synthetic <400> 18 cctcccaggc atggcagtcc 20 <210> 19 <211> 18 <212> DNA <213> Artificial <220> <223> Synthetic <400> 19 ccatcaaggc tccgctgg 18 <210> 20 <211> 1034 <212> DNA <213> Zea mays <400> 20 agggccctgc agcggcggca gctggcgggga gagaggcttg ggactgggcc gcccggcgc 60 gaggaataaa ctcactcctg tcttcatacg tatccatagc cggcaggcgg cagtacctgt 120 atgtggtttt agctatacgc gacctcagtt cgggcgcaag gttagtcttc gatttaagca 180 tagatttat tttatcttct tggctccacc aaataacact aaaaaatcg cttggcttc 240 tatgggttca aattaagcac tggatcgtac cattttcttg ttcatttata cttgtcatc 300 caatccacac cgattaattt ctcacggtca acaacgcatg aagttttcat ttctgggaag 360 aagcatgtat tttttatc tccgactcga tctagtggtg agaggaggaa gatgaatagt 420 gcatgcatat gatatctaga gaggcaccag atctagtggc tccatgttct gttcgcgggc 480 taagaaaaaa cataacaag caggcgcctg aaaaatagct agtccctaac tttttagacc 540 aatctgtag tttatttga cgatattggt atgaaaagt ctctcaagaa caatacat 600 atgcagcatg catgtgcatg gtataattat aattattag cagagtttag atagtaggc 660 cccacgtct gcgctccgcc acctacagcg agcctccctt tcctaccctcc ctgattcgtt 720 tgcacttgct gagagctca cagaatttgg tcaccgattt caatcgcag ctactaattc 780 tcaccacatt gaaattttcg atttgaaca gtacaatttc tgaagagaaa ttgtacgtct 840 gaaacggttg catgtgtact atgactgct agccattccc tgcatacgtg ggacacgctc 900 agatcattca ttcgcagcac gtacgtaacc ttaatattct actatacatc catgcagcta 960 aaccccgac caggcgagaa gaagcatcga tagtgtgacg agctaaccca ccaccacca 1020 cgtaatccaa atcc 1034

Claims

1. A method for increasing protein content in a plant cell comprising a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter, and the promoter comprises a transcription repressor binding site, wherein the method comprises modifying the transcription repressor binding site so that the transcription repressor cannot hinder the transcription of the NF-YC4 gene, thereby increasing the protein content in the plant cell.

2. The method of claim 1, further comprising generating a plant cell collection, a plant tissue, a plant organ or a plant from the plant cell.

3. The method of claim 1, wherein the plant cell is a collection of plant cells, a plant tissue, a plant organ, or a part of a plant.

4. A method for producing a plant with increased protein content, the method comprising crossing an organism with a second plant to produce offspring plants and selecting offspring plants with increased protein content, thereby producing a plant with increased protein content, wherein the organism is a plant obtained according to the method of claim 2 or 3.

5. A method for producing a plant cell, a collection of plant cells, a plant tissue, a plant organ or a plant, comprising modifying a transcription repressor binding site in the promoter of a NF-YC4 gene therein so that the transcription repressor cannot hinder NF-YC4 transcription, wherein the plant cell, plant cell collection, plant tissue, plant organ or plant has an increased protein content compared to a corresponding plant cell, plant cell collection, plant tissue, plant organ or plant, in which the NF-YC4 gene comprises a promoter comprising an unmodified transcription repressor binding site.

6. The method of claim 5, wherein the plant is a hybrid plant.

7. The method of claim 5, further comprising obtaining seeds from the plant or the hybrid as defined in claim 6.

8. A method for improving resistance to pathogens or pests in a plant cell or plant comprising a NF-YC4 gene, wherein the NF-YC4 gene comprises a promoter, and the promoter comprises a transcription repressor binding site, the method comprising modifying the transcription repressor binding site in the promoter of the NF-YC4 gene in a plant cell or plant at risk of infection with a pathogen or pest so that the transcription repressor cannot hinder the transcription of the NF-YC4 gene, thereby improving resistance to pathogens or pests in the plant cell or plant.

9. The method of claim 8, further comprising regenerating a plant from the plant cell.

10. The method of claim 8, wherein the method further comprises introducing a polynucleotide comprising a nucleotide sequence encoding a Qua-Quine Starch (QQS) polypeptide into the plant cell or plant and expressing it therein, wherein the polypeptide has the amino acid sequence shown in SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter.

11. The method of claim 10, further comprising regenerating a plant from the plant cell.

12. The method of claim 8 or 10, wherein the pathogen is a bacterium or a virus and wherein the pest is an aphid.

13. The method of claim 8 or 10, wherein the plant is soybean.

14. A method for producing a plant with increased resistance to pathogens or pests, the method comprising crossing a plant obtained according to the method of claim 8, 9, 10 or 11 with a second plant to produce offspring plants and selecting offspring plants with increased resistance to pathogens or pests, thereby producing a plant with increased resistance to pathogens or pests.

15. A method for producing a plant, comprising modifying a transcription repressor binding site in a promoter of a NF-YC4 gene therein so that the transcription repressor cannot hinder the transcription of the NF-YC4 gene, wherein the resistance to pathogens or pests in the plant is increased.

16. The method of claim 15, wherein the wild type of the plant does not contain and express QQS, and a polynucleotide comprising a nucleotide sequence encoding a QQS polypeptide is introduced into the plant and expressed therein, the polypeptide having the amino acid sequence shown in SEQ ID NO: 16, wherein the nucleotide sequence is operably linked to a promoter.

17. A method for producing seeds, comprising obtaining seeds from a plant obtained according to the method of claim 15 or 16.

18. A method of producing a hybrid comprising crossing a plant obtained according to the method of claim 15 or 16 with a second plant.

19. A method of producing seeds, comprising obtaining seeds from a hybrid plant obtained according to the method of claim 18.

20. A method for increasing the protein content in a plant or a part thereof, comprising overexpressing a NF-YC4 gene in said plant or a part thereof, wherein at least the protein content in said plant or a part thereof is higher than the protein content in a corresponding wild-type plant or a corresponding wild-type part thereof not overexpressing the NF-YC4 gene.

21. The method of claim 20, wherein the NF-YC4 gene is a transgene.

22. The method of claim 20, wherein the NF-YC4 gene is selected from Arabidosisthaliana, Oryza sativa or Glycine max genes.

23. The method of claim 21, wherein the NF-YC4 gene is under the control of a cauliflower mosaic virus promoter, wherein the cauliflower mosaic virus promoter is a p35S promoter.

24. The method of claim 23, wherein the NF-YC4 gene is in a vector.

25. The method of claim 20, comprising i) transforming a plant with a vector comprising the NF-YC4 gene, and ii) overexpressing the NF-YC4 gene.

26. The method of claim 25, wherein the NF-YC4 gene is introduced into the plant by Agrobacterium-mediated transformation.

27. The method of claim 25, wherein the protein content is increased in leaves or seeds of the plant.

28. The method of claim 25, wherein the NF-YC4 gene is a transgene.

29. The method of claim 25, wherein the NF-YC4 gene is selected from Arabidopsis, rice or soybean genes.

30. The method of claim 28, wherein the NF-YC4 gene is under the control of a cauliflower mosaic virus promoter, wherein the cauliflower mosaic virus promoter is a p35S promoter.

31. A method for producing a plant with increased protein content, the method comprising crossing an organism with a second plant to produce offspring plants and selecting offspring plants with increased protein content, thereby producing a plant with increased protein content, wherein the organism is a plant obtained according to the method of claim 20.

32. A method for improving the resistance of a plant cell or plant to a pathogen or pest, comprising overexpressing a NF-YC4 gene in a plant cell or plant at risk of being infected by the pathogen or pest, wherein the resistance of the plant cell or plant to the pathogen or pest is improved.

33. The method of claim 32, wherein the plant is rice, soybean or corn.

34. A method for producing a plant with increased resistance to pathogens or pests, the method comprising crossing a plant obtained according to the method of claim 32 with a second plant to produce offspring plants and selecting offspring plants with increased resistance to pathogens or pests, thereby producing a plant with increased resistance to pathogens or pests.

35. The method of claim 1, 8, 10 or 20, wherein the plant is a crop plant.

36. The method of claim 35, wherein the crop plant is soybean, rice or corn.

37. The method of claim 1, 8, 10 or 20, wherein the plant is a monocot.

38. The method of claim 1, 8, 10 or 20, wherein the plant is a dicot.

39. The method of claim 1, wherein the transcription repressor binding site is modified by deletion.

40. The method of claim 1, 2, 3, 8, 10, or 39, wherein the transcription repressor binding site comprises an ERF motif, a RAV 1 motif, or both an ERF motif and a RAV 1 motif.

41. The method of claim 40, wherein the plant cell is a rice cell and (i) lacks two ERF motifs, (ii) lacks a RAV 1 motif, or (iii) lacks a RAV 1 motif and an ERF motif.

42. The method of claim 40, wherein the plant cell is a soybean cell and (i) lacks two RAV1 motifs or (ii) lacks a RAV1 motif and an ERF motif.

43. The method of claim 40, wherein the ERF motif, the RAV1 motif, or both the ERF motif and the RAV1 motif are deleted using TALENS.

44. The method of claim 40, wherein the ERF motif, the RAV1 motif, or both the ERF motif and the RAV1 motif are deleted using CRISPR / Cas9.

Images