A therapeutic target for diseases caused by TREX1 gene mutation and its application

Abstract

The present invention discloses a therapeutic target for diseases caused by TREX1 gene mutations and its application, specifically the use of an agent that inhibits or prevents cGAS demethylation in the preparation of a drug for treating Aicardi-Goutières syndrome (AGS) caused by TREX1 gene mutations; and also discloses the use of KDM4B as a drug target for inhibiting cGAS activity and / or as a drug target for treating diseases caused by TREX1 gene mutations. The present invention finds that methylation modification significantly inhibits cGAS activity, inhibits the cGAS demethylation process, and significantly reduces cGAS activity and the production of downstream IFN and interferon genes (ISGs). Through screening, the present invention discovered that KDM4B is a demethylase of cGAS. Knockout of KDM4B can significantly inhibit cGAS activity. The KDM4B inhibitor JIB-04 can significantly suppress the immune-enhanced phenotype of mice caused by Trex1 gene knockout, and at the same time reduce the production of ISG genes in peripheral blood mononuclear cells from AGS patients. The above results suggest that KDM4B is a potential target for the treatment of AGS, and KDM4B inhibitors can be used as a potential treatment option for AGS patients.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a therapeutic target for a disease caused by a TREX1 gene mutation and its application. Specifically, the disease is an autoimmune disease, such as Aicardi-Goutières syndrome (AGS). Background Art

[0002] Nucleases play a crucial role in DNA damage repair and genomic stability. Recently, dysfunction of some nucleases has been implicated in the pathogenesis of various autoimmune diseases. TREX1, also known as DNase III, is the major 3'-5' restriction exonuclease in the cytoplasm and is expressed in most tissues and cell types of mammals. The nuclease activity of TREX1 plays a crucial role in maintaining immune tolerance of the innate immune system to self-DNA, thereby preventing the accumulation of free DNA in the cytoplasm, which can lead to overactivation of the innate immune system and the production of autoantibodies. The cGAS-STING pathway is a crucial mechanism for the innate immune system to defend against pathogen invasion and maintain cellular homeostasis. When DNA leaks from the nucleus or from pathogens into the cytoplasm, it activates the cytoplasmic DNA sensor cyclic GMP-AMP synthase (cGAS), unless cleared by the nuclease TREX1, triggering the downstream type I interferon cascade. Mutations in the human TREX1 gene can cause a range of autoimmune diseases, such as Aicardi-Goutières syndrome (AGS).

[0003] Aicardi-Goutières syndrome (AGS) is a rare genetic disorder primarily affecting the nervous system and skin, characterized by acquired microcephaly, basal ganglia calcification, leukodystrophy, cerebral atrophy, and chronic cerebrospinal fluid lymphocytosis and elevated interferon. AGS clinical manifestations are typically accompanied by severe intellectual and motor delays. Most patients experience extreme irritability, intermittent fever, skill loss, slow head growth, spasticity, dystonia, and chilblain-like skin lesions. First described by Aicardi and Goutières in 1984, AGS has been shown to exhibit significant clinical heterogeneity. Some children may have normal cerebrospinal fluid lymphocyte counts even in the early stages of the disease, while a smaller number may exhibit autoimmunity, autoinflammation, abnormal skull base vascular networks, or intracranial large vessel inflammation. AGS also exhibits significant genetic heterogeneity. To date, seven AGS-causing genes have been identified, including mutations in IFIF1, TREX1, SAMHD1, RNASEH2B, RNASEH2C, RNASEH2A, and ADAR1. Based on the age of onset, it can be categorized as either neonatal or late-onset. The neonatal form, often caused by a defect in the TREX1 gene, presents in the newborn or early infant, with symptoms such as irritability, feeding difficulties, neonatal seizures, hepatosplenomegaly, elevated transaminases, thrombocytopenia, and anemia. Late-onset individuals develop normally for a period of time after birth, with the first onset occurring a few months or even after one year of age. The disease presents with a severe subacute encephalopathy characterized by extreme irritability, intermittent aseptic fever, loss of existing behavioral functions, and slow growth in head circumference. After the subacute phase lasts for several months, the disease progresses slowly. Aicardi-Goutières syndrome typically presents with severe intellectual and motor delays. Most patients experience extreme restlessness, intermittent fever, loss of skills, slow head growth, spasticity, and dystonia. Currently, there is no effective treatment.

[0004] AGS caused by TREX1 gene defects often manifests as an autosomal recessive trait. Heterozygous TREX1 mutations resulting in amino acid variants at p.Asp18Asn, p.Asp18His, p.His195Tyr, p.Asp200Asn, or p.Asp200His can lead to more severe skin symptoms. Heterozygous variants at the TREX1 amino acid site p.Asp18Asn exhibit significant clinical heterogeneity and can cause familial pernio-like lupus with or without neurologic symptoms. Children homozygous for the TREX1 amino acid variant p.Arg97His present with typical systemic lupus erythematosus presentation at age three years and develop right hemiparesis at age four years. Imaging studies reveal medium-sized vasculitis and left middle cerebral artery infarction. TREX1 gene defects result in decreased or absent nuclease activity, accumulation of cytoplasmic nucleic acids, which are recognized by cGAS, leading to overactivation of the STING-TBK1-IRF3 signaling pathway and ultimately a significant increase in type I interferon (IFN) levels. Type I IFN can activate the TLR pathway by acting on peripheral blood dendritic cells (pDCs), leading to the production of type I IFN, which exerts a self-reinforcing effect. Type I IFN can also promote the activation of autoreactive CD4+ and CD8+ T cells, the differentiation of autoreactive B cells into plasma cells, and the production of autoantibodies, leading to systemic autoimmune damage. Therefore, targeting the type I IFN signaling pathway and inhibiting type I IFN production may help alleviate the clinical phenotype of AGS. There are no reports of KDM4B inhibitors, a demethylase of cGAS, in the treatment of AGS syndrome caused by TREX1 gene mutations in existing clinical treatment options. Summary of the Invention

[0005] In order to overcome the problems existing in the prior art, the inventors discovered that targeting cGAS activity research can help provide a potential treatment plan for AGS patients with TREX1 gene mutations. Methylation modification significantly inhibits cGAS activity. KDM4B is a demethylase of cGAS, which can remove cGAS methylation and promote the activity of the cGAS-STING signaling pathway. Inhibiting the cGAS demethylation process can significantly reduce cGAS activity and the production of downstream IFN and interferon genes (ISGs). This suggests that targeting cGAS demethylation modification may be a potential intervention target. Further, through screening of demethylases, it was found that KDM4B is a demethylase of cGAS. Knocking out KDM4B can significantly inhibit cGAS activity, and the KDM4B inhibitor JIB-04 can reduce the immune activity of mice, significantly inhibit the immune-enhanced phenotype of mice caused by Trex1 gene knockout, and at the same time reduce the production of ISG genes in peripheral blood mononuclear cells from AGS patients. The above experimental results all suggest that KDM4B is a potential target for the treatment of Aicardi-Goutières syndrome, and KDM4B inhibitors can be used as a potential treatment for patients with Aicardi-Goutières syndrome. This invention provides an important reference for the clinical treatment of Aicardi-Goutières syndrome.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention is to provide the use of an agent for inhibiting or preventing cGAS demethylation in the preparation of a drug for treating a disease caused by TREX1 gene mutation.

[0008] Furthermore, the TREX1 gene variation includes TREX1 gene defect, heterozygous mutation, homozygous mutation, etc., and TREX1 gene defect is more preferred. The TREX1 gene variation can cause cGAS activity disorder.

[0009] Furthermore, the diseases are various diseases and their complications caused by cGAS activity disorder, including but not limited to Aicardi-Goutières syndrome.

[0010] Furthermore, inhibiting or preventing cGAS demethylation significantly reduced cGAS activity and significantly decreased the production of downstream IFN and interferon genes.

[0011] Furthermore, the agent that inhibits or prevents cGAS demethylation includes inhibitors of cGAS demethylase, such as GSK552, Daminozide, GSK-J1 and JIB-04.

[0012] Furthermore, the cGAS demethylase inhibitor includes the KDM4B inhibitor JIB-04; wherein the structural formula of JIB-04 is as follows:

[0013]

[0014] Furthermore, the reagents for inhibiting or preventing cGAS demethylation also include reagents for knocking out cGAS demethylase, specifically, using a CRISPR-Cas9 kit and its auxiliary reagents to knock out KDM4B.

[0015] Furthermore, the agent for inhibiting or preventing cGAS demethylation may further include a pharmaceutically acceptable adjuvant.

[0016] A second aspect of the present invention is to provide the use of KDM4B as a drug target for inhibiting cGAS activity and / or as a drug target for treating diseases caused by TREX1 gene mutations.

[0017] Furthermore, in the above application, the disease includes diseases caused by disordered cGAS activity, including Aicardi-Goutières syndrome.

[0018] Furthermore, in the above application, knockout of KDM4B blocks cGAS demethylation. Specifically, the above knockout of KDM4B can significantly inhibit cGAS activity, inhibit cGAS-STING signaling pathway activity and type I interferon expression.

[0019] Furthermore, in the above application, a KDM4B inhibitor is used to target KDM4B. Specifically, the application of the above KDM4B inhibitor can inhibit cGAS activity, suppress the expression of downstream ISGs genes, significantly inhibit the immune enhancement phenotype of mice caused by Trex1 gene knockout, and reduce the production of ISG genes in peripheral blood mononuclear cells from patients with Aicardi-Goutières syndrome (effectively inhibiting the expression level of ISGs in peripheral blood mononuclear cells of AGS patients).

[0020] Furthermore, the KDM4B inhibitor is JIB-04. In a specific embodiment, the inhibitor JIB-04 is intraperitoneally injected into 3-week-old Trex1 knockout mice at a daily injection concentration of 20 mg / kg.

[0021] Furthermore, in the validation experiment for the application of KDM4B as a target, in a specific embodiment, the detection of inhibition of KDM4B to suppress cGAS activity: a KDM4B gene knockout cell line is selected as a control, and the HT-DNA stimulation method is selected to detect the downstream cGAS-STING signaling pathway activity and type I interferon production; and / or, in a specific embodiment, the detection of KDM4B inhibitor inhibition of cGAS activity: a cGAS gene knockout cell line is selected as a control, and the HT-DNA and cGAMP stimulation methods are selected; and / or, in a specific embodiment, the in vivo therapeutic effect of KDM4B inhibitor is selected: Trex1 gene knockout mice are selected to simulate the AGS disease model.

[0022] Furthermore, in the above specific embodiments, the KDM4B gene knockout cell line and the cGAS gene knockout cell line are both obtained using CRISPR-Cas9 gene knockout technology.

[0023] Furthermore, in the above specific embodiment, the sgRNA sequences used in the construction of the KDM4B gene knockout cell line are as follows: sgRNA1: AAGCCCGCATGGTAACCATA (SEQ ID NO.1), sgRNA2: CTGGATCGACTATGGCAAAG (SEQ ID NO.2), sgRNA3: GAATGCGGGACCATCATTGA (SEQ ID NO.3), sgRNA4: TGTGGAAGACCACGTTTGCC (SEQ ID NO.4).

[0024] Furthermore, in the above specific embodiment, the sgRNA sequence used in the construction of the cGAS gene knockout cell line is as follows: sgRNA5: TCTCGTACCCAAGAATGCAA (SEQ ID NO. 14).

[0025] Furthermore, the above specific embodiment also involves other JMJD2 family gene knockout cell lines, specifically: KDM4A gene knockout cell line, KDM4C gene knockout cell line, KDM4D gene knockout cell line; wherein, the sgRNA sequences used in the construction of the KDM4A gene knockout cell line are shown in SEQ ID NO.5 to SEQ ID NO.7; the sgRNA sequences used in the construction of the KDM4C gene knockout cell line are shown in SEQ ID NO.8 to SEQ ID NO.10; the sgRNA sequences used in the construction of the KDM4D gene knockout cell line are shown in SEQ ID NO.11 to SEQ ID NO.13.

[0026] Compared with the prior art, the present invention adopts the above technical solution to achieve the following beneficial effects:

[0027] The present invention provides the KDM4B inhibitor JIB-04 as a treatment for AGS disease, especially for Aicardi-Goutières syndrome caused by Trex1 gene mutation. The function of TREX1 protein is to degrade double-stranded DNA (dsDNA) released by cells due to self-mismatching. If TREX1 protein cannot unwind dsDNA in time, it will lead to the activation of the cGAS-STING-IFN signaling pathway induced by self-DNA, thereby leading to enhanced immunity of the body and ultimately inducing autoimmune diseases. The present invention discovered that KDM4B can target and remove cGAS methylation modification, promote cGAS activity, and then promote the activity of the STING-TBK1-IFN signaling pathway. In addition, knocking out KDM4B or targeting the KDM4B inhibitor JIB-04 can specifically inhibit cGAS activity, further inhibiting IFN production, which helps to improve the mouse phenotype of the AGS disease model simulated by Trex1 gene knockout mice. It also inhibits the production of interferon genes in vitro by monocytes derived from AGS patients. This study, in which mice were intraperitoneally injected with the KDM4B inhibitor JIB-04 (20 mg / kg) for eight consecutive days, significantly reduced interferon gene production in their hearts. This potential treatment for AGS syndrome caused by TREX1 gene mutations has promising development prospects and provides an important reference for clinical diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0029] Figure 1 This is a schematic diagram of the results of detecting cGAS-STING signaling pathway activity and cGAS methylation modification in cells after knocking out KDM4A, KDM4B, KDM4C, and KDM4D in one embodiment of the present invention;

[0030] Figure 2 This is a schematic diagram of the results of detecting cGAS-STING signaling pathway activity and IFN production in cells after KDM4B knockout in one embodiment of the present invention;

[0031] Figure 3 This is a schematic diagram of the results of detecting cGAS-STING signaling pathway activity and IFN production in cGAS gene knockout cells in the control group after treatment with the KDM4B inhibitor JIB-04 in one embodiment of the present invention;

[0032] Figure 4 Schematic diagram of the results of the specificity of the KDM4B inhibitor JIB-04 and different inhibitors of the JMJD2 family on the activity of the cGAS-STING signaling pathway in one embodiment of the present invention;

[0033] Figure 5 This is a schematic diagram showing the results of detecting cGAS-STING signaling pathway activity and ISGs production in BMDM of normal mice and Trex1 knockout mice treated with the KDM4B inhibitor JIB-04 in one embodiment of the present invention;

[0034] Figure 6 This is a schematic diagram showing the results of detecting ISGs production in heart tissue after intraperitoneal injection of the KDM4B inhibitor JIB-04 into mice in one embodiment of the present invention;

[0035] Figure 7 This is a schematic diagram of the results of detecting ISGs generated by treating AGS patient-derived monocytes with the KDM4B inhibitor JIB-04 in one embodiment of the present invention. DETAILED DESCRIPTION

[0036] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. It is obvious that the described embodiments are only some of the embodiments of the present invention, and are not all of the embodiments. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally measured in accordance with national standards. The experimental materials in the following examples, for which the sources are not specified, are all commercially available raw materials. The equipment used in each step of the following examples is conventional equipment. If there are no corresponding national standards, the steps are carried out in accordance with general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise specified, all parts are by weight, and all percentages are by mass percentages. Unless otherwise defined or specified, all professional and scientific terms used in the present invention have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention.

[0037] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but they are not intended to limit the present invention.

[0038] In the following examples, JIB-04 (S7281) was purchased from Selleck.

[0039] Example 1 - Inhibition of KDM4B suppresses cGAS activity

[0040] In this example, JMJD2 family gene knockout cell lines were used as controls to perform HT-DNA stimulation and detect the inhibition of KDM4B in inhibiting cGAS activity. The specific steps are as follows:

[0041] (1) JMJD2 family gene knockout cell lines were obtained using CRISPR-Cas9 gene knockout technology; B16F10 cell line was used to construct KDM4A, KDM4B, KDM4C, and KDM4D gene knockout cell lines. The specific steps for constructing the gene knockout cell lines are as follows:

[0042] JMJD2 family gene knockout cell lines were generated using CRISPR-Cas9 gene knockout technology. Using the B16F10 cell line, Cas9 stably expressing cell lines were constructed through blastin resistance screening. sgRNAs targeting the four genes KDM4A, KDM4B, KDM4C, and KDM4D were designed. The sgRNA sequences are shown in the table below. The sgRNAs were constructed into a puromycin-resistant lentiviral vector, and cell lines with knockout of the corresponding genes were constructed based on the Cas9 stably expressing cell lines.

[0043]

[0044]

[0045] During the construction of the above cell lines, two KDM4B gene knockout cell lines were obtained by screening for resistance to viral infection.

[0046] (2) HT-DNA stimulation of cells: The selected cell lines were plated in 24-well plates. When the cell lines grew to a cell density of 30%-50%, 0.5 μg HT-DNA was transfected into each well. The stimulation time of the western blot samples was as follows: Figure 1 and Figure 2 As shown, samples for ISGs detection were collected 6 hours after HT-DNA stimulation.

[0047] The above test results are as follows Figure 1 and Figure 2 As shown. Figure 1 It can be seen that after HT-DNA stimulation, compared with the control group and KDM4A, KDM4C, and KDM4D gene knockout groups, KDM4B specific knockout significantly inhibited the activity of the cGAS-STING signaling pathway and enhanced cGAS methylation modification.

[0048] Depend on Figure 2 It can be seen that the experimental results of the two KDM4B gene knockout cell lines are the same. After HT-DNA stimulation of the cells, Figure 2As shown in part A of Figure 3, KDM4B gene knockout inhibits the activity of the cGAS-STING signaling pathway and enhances cGAS methylation modification; Figure 2 As shown in part B, KDM4B knockout significantly inhibited IFN expression.

[0049] Example 2 - KDM4B inhibitor JIB-04 inhibits cGAS activity

[0050] In this example, a cGAS gene knockout cell line was selected as a control to detect the inhibitory effect of the KDM4B inhibitor JIB-04 on cGAS activity and its specificity. The specific steps are as follows:

[0051] (1) The effect of KDM4B inhibitor JIB-04 on the activity of cGAS-STING signaling pathway and IFN expression;

[0052] Method for constructing a cGAS knockout cell line: The cGAS knockout cell line was generated using CRISPR-Cas9 gene knockout technology. Using the B16F10 cell line, a single sgRNA (sgRNA) with the specific sequence TCTCGTACCCAAGAATGCAA (SEQ ID NO. 14) was selected and constructed into the GFP-458 vector. The plasmid was then transfected into the target cells. GFP-expressing cells were then plated into 96-well plates using flow cytometry, with one cell per well. Once the cells reached monoclonal size, the cGAS knockout efficiency was assessed by western blot to obtain the cGAS knockout cell line. Cells were treated with 20 μM JIB-04 for 12 hours, followed by HT-DNA stimulation.

[0053] HT-DNA stimulated cells: The selected cell lines were plated in 24-well plates. When the cell lines grew to a cell density of 30%-50%, 0.5 μg HT-DNA was transfected into each well. The stimulation time of western blot samples was as follows: Figure 3 As shown, samples for ISGs detection were collected 6 hours after HT-DNA stimulation.

[0054] Stimulate cells with cGAMP: Plate the selected cell lines in 24-well plates. When the cell lines grow to a cell density of 30%-50%, transfect each well with 30 μg / ml cGAMP by perforating the cell membrane. Figure 3 At the indicated time, cell pellets were collected for detection.

[0055] The above test results are as follows Figure 3 As shown, after HT-DNA and cGAMP stimulation, the cells Figure 3 As shown in part A of FIG, the KDM4B inhibitor JIB-04 inhibits the activity of the cGAS-STING signaling pathway; Figure 3As shown in part B, the KDM4B inhibitor JIB-04 significantly inhibited IFN expression.

[0056] (2) The KDM4B inhibitor JIB-04 specifically inhibits the activity of the cGAS-STING signaling pathway;

[0057] In this example, different demethylase inhibitors were selected to treat B16F10 cells. The specific experimental steps are as follows:

[0058] Treatment conditions for different demethylase inhibitors: GSK-552, final concentration 1 μM; Daminozide, final concentration 2 μM; JIB-04, final concentration 20 μM; GSK-J1, final concentration 20 μM. Cells were treated for 12 hours before HT-DNA stimulation.

[0059] HT-DNA stimulated cells: The selected cell lines were plated in 24-well plates. When the cell lines grew to a cell density of 30%-50%, 0.5 μg HT-DNA was transfected into each well. The stimulation time of western blot samples was as follows: Figure 4 As shown, samples for ISGs detection were collected 6 hours after HT-DNA stimulation.

[0060] The above test results are as follows Figure 4 As shown, after HT-DNA stimulation of cells, the KDM4B inhibitor JIB-04 specifically inhibited the activity of the cGAS-STING signaling pathway compared with other demethylases.

[0061] Example 3 - The therapeutic effect of KDM4B inhibitor JIB-04 in mice

[0062] In this example, Trex1 knockout mice were used to simulate the AGS disease model to verify the in vivo therapeutic effect of the KDM4B inhibitor JIB-04. The specific steps are as follows:

[0063] (1) Construction of Trex1 gene knockout mice: obtained using CRISPR-Cas9 gene knockout technology (purchased from Shanghai Model Organisms).

[0064] (2) Mouse BMDMs were treated with the KDM4B inhibitor JIB-04 (20 μM JIB-04 treatment for 12 hours followed by HT-DNA stimulation) to detect the activity of the cGAS-STING signaling pathway and the production of ISGs.

[0065] The BMDM used in this example were derived from the bone marrow tissue of 4-week-old wild-type and Trex1 knockout mice and were stimulated after 7 days of in vitro culture. Figure 5 Part A and Part B are shown.

[0066] Mouse bone marrow tissue was obtained by sacrificing the mouse by cervical dislocation and soaking it in alcohol. On a sterile operating table, the mouse tibia was removed and the bones and muscles were removed. A 1ml sterile syringe was used to draw up 1ml of PBS solution per syringe and gently inserted into the bone marrow cavity. The marrow cavity was flushed to obtain the bone marrow, and this was repeated 2-3 times. The solution was filtered through a 400-mesh filter and centrifuged at 1200 rpm / min for 5 minutes. The supernatant was discarded, and 1ml of red blood cell lysis buffer (ACK) was added. The solution was allowed to stand for 1 minute, and then 9ml of PBS was added to terminate the process. The solution was centrifuged at 1200 rpm / min for 5 minutes. The supernatant was discarded, and the bone marrow cells were washed twice with PBS. 1×10 6 cells / ml, and then 20 ng / ml of cytokine MC-SF was added to culture bone marrow cells for 7 days.

[0067] The above results indicate that the KDM4B inhibitor JIB-04 inhibits the cGAS-STING signaling pathway activity and ISGs expression in BMDM derived from Trex1 gene knockout mice, but has little effect on BMDM from wild-type mice.

[0068] (3) Mice were intraperitoneally injected with the KDM4B inhibitor JIB-04, and the expression of ISGs in heart tissue and the activity of the cGAS-STING signaling pathway in spleen were detected;

[0069] Three-week-old Trex1 knockout mice were intraperitoneally injected with 20 mg / kg JIB-04 daily. Eight days later, the mice were killed by cervical dislocation, and their heart tissue and spleen cells were isolated. The expression of ISGs in heart tissue and the activity of the cGAS-STING signaling pathway in spleen cells were measured. Figure 6 shown.

[0070] The above results found that compared with wild-type mice, after treatment with the inhibitor JIB-04, the expression of interferon genes in the mouse heart was significantly decreased, and the activity of the cGAS-STING signaling pathway in the mouse spleen was decreased, which indicates that the KDM4B inhibitor JIB-04 inhibits type I interferon signaling activity and inhibits the expression of interferon signals in mice.

[0071] Example 4 - KDM4B inhibitor JIB-04 inhibits interferon gene production in peripheral blood monocytes from AGS patients

[0072] In this example, exon sequencing technology was used to find that the TREX1 Cys154Met and Tyr232Ser gene mutations were found in peripheral blood samples of AGS patients (clinical test samples, such as Figure 7 Human peripheral blood mononuclear cells were obtained by peripheral blood mononuclear cell separation technology, and the cells were treated with 20 μM JIB-04 for 12 hours. The expression of interferon gene was detected. The experimental results are shown in FIG. Figure 7As shown in Part B.

[0073] Method for isolating peripheral blood mononuclear cells: Take fresh anticoagulated whole blood and dilute it with PBS; add an appropriate amount of separation solution to a centrifuge tube and spread the diluted blood evenly on the surface of the separation solution, taking care to keep a clear interface between the two liquid surfaces; centrifuge at room temperature and 500g for 30 minutes; after centrifugation, obvious stratification will appear, and the middle white film layer is the mononuclear cell layer. Pipette the cells in the white film layer into a clean 15mL centrifuge tube; wash the cells in the white film layer with 10mL PBS and centrifuge at 250g for 10 minutes; discard the supernatant and re-select the cells for later use.

[0074] The above results show that after treatment with the inhibitor JIB-04, the production of interferon in peripheral blood monocytes of AGS patients was significantly reduced, which indicates that JIB-04 inhibits the production of interferon genes in peripheral blood monocytes from AGS patients.

[0075] As can be seen from the above examples, the present invention provides the KDM4B inhibitor JIB-04 as a potential treatment for AGS patients, providing an important reference for clinical diagnosis and treatment. However, the present invention is not limited to the aforementioned detailed features and the enumerated disease types caused by cGAS dysregulation. Those skilled in the art will appreciate that any improvements to the present invention, including the addition of detection capabilities for disease types caused by cGAS dysregulation, fall within the scope of protection and disclosure of the present invention.

[0076] The above description is only a preferred embodiment of the present invention and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the description and illustrations of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Shanghai Tenth People's Hospital <120> A therapeutic target for diseases caused by TREX1 gene mutation and its application <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA / RNA <213> sgRNA1-KDM4B (Artificial Sequence) <400> 1 aagcccgcat ggtaaccata 20 <210> 2 <211> 20 <212> DNA / RNA <213> sgRNA2 - KDM4B (Artificial Sequence) <400> 2 ctggatcgac tatggcaaag 20 <210> 3 <211> 20 <212> DNA / RNA <213> sgRNA3 - KDM4B (Artificial Sequence) <400> 3 gaatgcggga ccatcattga 20 <210> 4 <211> 20 <212> DNA / RNA <213> sgRNA4 - KDM4B (Artificial Sequence) <400> 4 tgtggaagac cacgtttgcc 20 <210> 5 <211> 19 <212> DNA / RNA <213> sgRNA1 - KDM4A (Artificial Sequence) <400> 5 agcgggatca ccattgagg 19 <210> 6 <211> 19 <212> DNA / RNA <213> sgRNA2 - KDM4A (Artificial Sequence) <400> 6 cagctgaccc ccgaggagg 19 <210> 7 <211> 19 <212> DNA / RNA <213> sgRNA3 - KDM4A (Artificial Sequence) <400> 7 tgtctggaaa taccccagg 19 <210> 8 <211> 19 <212> DNA / RNA <213> sgRNA1 - KDM4C (Artificial Sequence) <400> 8 aagctgggcc ctcctgcgg 19 <210> 9 <211> 19 <212> DNA / RNA <213> sgRNA2 - KDM4C (Artificial Sequence) <400> 9 gtctctgcaa tttgagggg 19 <210> 10 <211> 19 <212> DNA / RNA <213> sgRNA3 - KDM4C (Artificial Sequence) <400> 10 agacagaata cctttacag 19 <210> 11 <211> 19 <212> DNA / RNA <213> sgRNA1 - KDM4D (Artificial Sequence) <400> 11 tttccctatg gctaccacg 19 <210> 12 <211> 19 <212> DNA / RNA <213> sgRNA2 - KDM4D (Artificial Sequence) <400> 12 attcaagacc tattggaac 19 <210> 13 <211> 19 <212> DNA / RNA <213> sgRNA3 - KDM4D (Artificial Sequence) <400> 13 aatgtggcat agtgattga 19 <210> 14 <211> 20 <212> DNA / RNA <213> sgRNA - cGAS (Artificial Sequence) <400> 14 tctcgtaccc aagaatgcaa 20

Claims

1. Use of a KDM4B inhibitor in the preparation of a medicament for inhibiting Aicardi-Goutières syndrome, characterized in that: The KDM4B inhibitor is JIB-04.

Images