Application of reagents for detecting 32 gene mutations in the preparation of physical fitness testing products

Abstract

The present invention discloses the use of a reagent for detecting 32 gene mutations in the preparation of a physical fitness test product. The reagent includes primers for amplifying 32 common mutation site regions of physical fitness genes. The reagent can be used to detect 32 mutation sites of physical fitness-related genes at one time, with high sensitivity, strong specificity, and high accuracy. It is also easy to operate, low-cost, and high-throughput, with rapid detection and automatic result interpretation, making it easy to promote and apply. Using the solution of the present invention, a software reporting system can be developed based on GWAS research and databases of the Chinese population. According to the PRS model calculation, the test results can be used to obtain exercise-related risks, which can then assist in formulating more scientific and reasonable personal exercise plans and training intensity.

Description

Technical Field

[0001] The present invention relates to the field of molecular diagnostic technology, and in particular to the use of a reagent for detecting 32 gene mutations in the preparation of physical fitness testing products. Background Art

[0002] Fitness-related gene testing is an innovative genetic testing technology based on a time-of-flight nucleic acid mass spectrometry platform. By collecting oral mucosal samples from the subjects and performing nucleic acid mass spectrometry analysis on the DNA in the samples, it can be determined whether the subjects have sports-related gene mutations, understand personal sports talents, and provide a testing basis for formulating exercise plans and training intensity.

[0003] Sports practice shows that the quality of a person's athletic genetics determines the upper limit of their athletic ability and the degree of their trainability. The most fundamental reason for this is that different individuals have different genetic backgrounds, that is, there are differences in athletic talent.

[0004] 1. Differences in traits are determined by innate genetics. Human biological traits are controlled both by genetics and by the environment. An athlete's response to training stimuli is largely determined by heritability. Traits with high heritability, such as endurance, maximum oxygen uptake, and the ratio of red to white muscle fibers, are difficult to improve through training.

[0005] Second, differences in traits determine athletic ability. Research shows that favorable physical traits are essential for achieving outstanding athletic ability and determine the potential for athletic development. Recent molecular genetic research has repeatedly confirmed that traits related to human athletic ability, such as muscle strength, endurance, balance, coordination, flexibility, aerobic capacity, anaerobic capacity, training response, and the development and progression of fatigue, all have a significant biological basis. Given similar environmental conditions and training methods, individuals can exhibit significant differences in athletic ability, physical fitness, comprehension, and training response. Therefore, favorable physical traits are essential for achieving excellence in certain sports. Genetic testing for physical fitness can provide essential information for athletes to develop exercise plans and training intensity, maximizing training efficiency while maintaining physical fitness, enabling more scientific and rational training plans and achieving better results. Naturally, genetic testing for physical fitness is also suitable for students and those seeking to specialize in a particular sport, providing a comprehensive understanding of their athletic abilities and providing scientific advice when choosing a sport.

[0006] The basic principle of matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) is to disperse the analyte within matrix molecules, forming crystals. When the crystals are irradiated with laser light, the energy absorbed by the matrix molecules accumulates and rapidly generates heat, causing the matrix crystals to sublime, expanding the matrix and analyte into the gas phase. The mass spectra produced by MALDI are mostly singly charged ions, corresponding to the masses of peptides and proteins, and molecular weights are calculated based on the mass / charge ratio. MALDI-generated ions are often detected using a time-of-flight (TOF) detector. The ions are then analyzed based on their mass-to-charge ratio (M / Z), which is proportional to their time of flight, and the molecular weight of the sample molecules is determined. MALDI-TOF mass spectrometry is well-suited for the study of biomacromolecules such as proteins, peptides, polysaccharides, and nucleic acids. Because of its advantages such as wide mass determination range, high sensitivity, fast speed, high accuracy and good tolerance to salt, it has been widely used in the molecular weight and sequence determination of proteins and peptides.

[0007] The present invention's MALDI-TOF mass spectrometry detection of fitness-related gene loci presents difficulties: the design of amplification primers (i.e., multiplex PCR primers) for each detection locus, as well as the design of extension primers, the ratio of each primer during composite amplification, and the optimal concentration of each component in the system all need to be optimized to ultimately achieve intra-site, intra-group, and inter-group balance and stability that meet practical application requirements. Some loci have special sequence structures or high GC content, making it difficult to design primers for multiplex PCR. Summary of the Invention

[0008] In view of this, the purpose of the present invention is to provide a reagent for detecting gene mutations at 32 sites for use in the preparation of physical fitness testing products. By adopting nucleic acid mass spectrometry technology to detect genes related to the tester's athletic talent, 29 genes and a total of 32 mutation sites can be detected at one time, and the test results can be explained from 11 physical fitness-related aspects. The test results can also be used to obtain sports-related risks, which can assist in formulating personal exercise plans and training intensity more scientifically and reasonably.

[0009] In order to achieve the above object, the present invention provides the following technical solutions:

[0010] The invention relates to a reagent for detecting 32 gene mutations in the preparation of a physical fitness test product, wherein the 32 sites are rs12722, rs10887741, rs1815739, rs2253206, rs11549465, rs1042713, rs3764352, rs12612420, rs6265, rs2073711, rs1800795, rs363050, rs800562, rs699, rs1842129, rs12143842, rs2016520, rs4665058, rs679620, rs1799945, rs363039, rs4783307, rs2267668, rs4994, rs591058, rs1799722, rs8097348, rs1800012, rs8192678, rs4948418, rs1208, and rs17602729.

[0011] In a preferred embodiment of the present invention, the reagent is an amplification primer for 32 detection sites, and the amplification primers are shown as SEQ ID NO.1 to SEQ ID NO.64.

[0012] In a preferred embodiment of the present invention, the reagent further comprises a single-base extension primer for the detection site.

[0013] In a preferred embodiment of the present invention, the single-base extension primers are shown as SEQ ID NO. 65 to SEQ ID NO. 96.

[0014] In a preferred embodiment of the present invention, the concentration of each sequence of the amplification primer is 0.3 to 3 μM; the concentration of each sequence of the extension primer is 3 to 30 μM.

[0015] In a preferred embodiment of the present invention, the kit further comprises a reaction reagent for digesting excess dNTPs and primers in the amplification system, a desalting reagent, and a detection chip.

[0016] In a preferred embodiment of the present invention, the reaction reagent is SAP enzyme and SAP reaction mixture; and the desalting reagent is cation exchange resin powder.

[0017] In a preferred embodiment of the present invention, the detection chip is a silicon-based chip comprising 384 detection spots of pre-dotted matrices.

[0018] In a preferred embodiment of the present invention, the reagent further comprises a PCR amplification buffer, Mg 2+ , dATP, dCTP, dTTP, dUTP, dGTP, Taq enzyme and UNG enzyme.

[0019] In a preferred embodiment of the present invention, the detection product uses a time-of-flight mass spectrometry detection system to perform mass spectrometry detection.

[0020] The beneficial effects of the present invention are:

[0021] (1) The present invention provides a primer combination and mutation detection kit for detecting fitness-related gene loci. The optimized system and reagents have high sensitivity and strong specificity, and can detect human gDNA nucleic acid samples as low as 0.2 ng. The accompanying integrated detection platform is simple and fast to operate, easy to analyze results, with high throughput, low cost, and high accuracy. It has better performance than existing related products based on QPCR or NGS methodologies, and its practicality is also very outstanding.

[0022] (2) The present invention refers to the globally shared SNP database NCBI dbSNP (https: / / www.ncbi.nlm.nih.gov / snp / ), the OMIM database (http: / / www.omim.org / ), the international 1000 Genomes SNP database (https: / / www.ncbi.nlm.nih.gov / variation / tools / 1000genomes / ) and relevant domestic guidelines in China, and selects 32 mutation sites related to physical fitness genes. After multiple screening and optimization of amplification primers and single-base extension primer combinations, 32 sites can be detected in one well; after multiple optimization and improvement of pretreatment reagents, multiple components can be premixed, which greatly simplifies the difficulty of system preparation and subsequent testing for operators in clinical applications, significantly improves the stability and repeatability of micro-system preparation and detection, is easy to operate, and effectively reduces the threshold for use and difficulty of getting started; the integrated instrument automatically detects and analyzes the results, and the result analysis and release are simple, objective, and not prone to errors; the entire process completes 384 sample tests within 6-7 hours, with high detection throughput and easy large-scale promotion and application.

[0023] (3) The present invention adopts a nucleic acid mass spectrometry analysis system based on MALDI-TOF MS technology, which is a high-precision DNA qualitative analysis platform. This technology platform is currently the only mass spectrometry technology platform in the world that can accurately detect nucleic acids. It perfectly integrates the high sensitivity of PCR technology, the high throughput of chip technology, the high precision of mass spectrometry technology and the powerful function of computer intelligent analysis, providing the market with a fully automatic solution with significant cost advantages, simple workflow and high throughput. The accuracy is ≥99.7%, and the desalting, spotting and detection are integrated into one system. The degree of automation is high, the operation is simple and fast, and the result interpretation is simple; 384 samples can be tested at a time, with high sample throughput, and a single sample can also be tested at a time, with flexible detection throughput and on-demand testing; the site throughput is medium to high, and a single well can detect up to 40 sites, which can reduce the use of precious samples, with costs as low as tens of yuan, saving screening costs and reducing national medical expenses. It is suitable for comprehensive promotion in different economic levels across the country, and is more suitable for large-sample scientific research purposes of related genes. DETAILED DESCRIPTION

[0024] The present invention will be further described below with reference to specific examples so that those skilled in the art can better understand the present invention and implement it, but the examples are not intended to limit the present invention.

[0025] Example 1: Screening for fitness-related gene detection sites

[0026] With reference to the globally shared SNP database NCBI dbSNP (https: / / www.ncbi.nlm.nih.gov / snp / ), OMIM database (http: / / www.omim.org / ), the international 1000 Genomes SNP database (https: / / www.ncbi.nlm.nih.gov / variation / tools / 1000genomes / ) and relevant Chinese guidelines, 29 genes related to physical fitness genes were selected, with a total of 32 mutation sites. The specific detection sites are as follows: rs12722, rs10887741, rs1815739, rs2253206, rs11549465, rs1042713, rs3764352, rs12612420, rs6265, rs2073711, rs1800795, rs363050, rs800562, rs699, rs1842129, rs12143842, rs2016520, rs4665058, rs679620, rs1799945, rs363039, rs4783307, rs2267668, rs4994, rs591058, rs1799722, rs8097348, rs1800012, rs8192678, rs4948418, rs1208, rs17602729, and then designed upstream and downstream amplification primers for the detection sites, which were synthesized by Shanghai Biolige Biotechnology Co., Ltd. The sequences are shown in Table 1 below:

[0027] Table 1. Amplification primers

[0028]

[0029]

[0030] At the same time, single base extension primers were designed, as shown in Table 2:

[0031] Table 2. Single base extension primers

[0032] Detection site Single-base extension primer (Ext P) rs12722 ctctgtccacaccca (SEQ ID NO.65) rs10887741 cattcacgtgcaggg (SEQ ID NO.66) rs1815739 atggcacctcgctctc (SEQ ID NO.67) rs2253206 tcacccattcctcctac (SEQ ID NO.68) rs11549465 ccttcgatcagttgtca (SEQ ID NO.69) rs1042713 atttgctggcacccaat (SEQ ID NO.70) rs3764352 atactgaagagtcaacca (SEQ ID NO.71) rs12612420 ttttacttccctcccgatc (SEQ ID NO.72) rs6265 tccaacagctcttctatca (SEQ ID NO.73) rs2073711 gaaccagacaggcttacct (SEQ ID NO.74) rs1800795 aatgtgacgtcctttagcat (SEQ ID NO.75) rs363050 tgagcacctgtgaatgagtg (SEQ ID NO.76) rs800562 cccgacttcacaaaggaaatgtg (SEQ ID NO.77) rs699 ctggactggctgctccctga (SEQ ID NO.78) rs1842129 aacagactcattacacatttat (SEQ ID NO.79) rs12143842 gggccagggtcacatcccagtt (SEQ ID NO.80) rs2016520 ggtgaagatggacctctacagg (SEQ ID NO.81) rs4665058 agctcttaaaaacaaaatagctt (SEQ ID NO.82) rs679620 tctctagaaaactactacgacctc (SEQ ID NO.83) rs1799945 gaacagctgttcgtgttctatgat (SEQ ID NO.84) rs363039 cgaggaggacaagacag (SEQ ID NO.85) rs4783307 agtctccatttaactgtcacctaaa (SEQ ID NO.86) rs2267668 agttggagctgtcggtaaaatatct (SEQ ID NO.87) rs4994 ccctctggtctggagtctcggagtcc (SEQ ID NO.88) rs591058 tttaaaaaataagtaactattgttctc (SEQ ID NO.89) rs1799722 cttcaagggctgggta (SEQ ID NO.90) rs8097348 ccgatggttgggaggagta (SEQ ID NO.91) rs1800012 gaagtccagccctcatcccgccc (SEQ ID NO.92) rs8192678 ccactgtccctcagttcac(SEQ ID NO.93) rs4948418 gctggcatgacagggaa(SEQ ID NO.94) rs1208 cctaggttgaagaagtgctga(SEQ ID NO.95) rs17602729 ggacagcaaaagtaatgcaatactcac(SEQ ID NO.96)

[0033] Example 2: Optimization and Improvement of Pretreatment Reagents for Fitness-Related Gene Detection and Analysis (1) Optimization of UNG Enzyme Concentration

[0034] Prepare the PCR reaction mixture according to the table below and divide it into four groups, adding 0.5, 0.25, 0.125, and 0.05 μl / person of UNG enzyme to each group, respectively. Wild-type and mutant samples were diluted to 50 ng / μl, 20 ng / μl, 10 ng / μl, 5 ng / μl, 1 ng / μl, and 0.5 ng / μl, respectively, and 1 μl / person of each was added to the reaction system. PCR reactions were performed using 0.5 ng / μl of whole blood genomic DNA as a template according to the PCR reaction system and protocol in Tables 3 and 4. After the PCR reaction, the PCR products were digested with SAP according to the SAP system and protocol in Tables 5 and 6. The digested products were then extended according to the extension system and protocol in Tables 7 and 8. After the extension reaction, 18.5 μL of ultrapure water was added to the extension products, mixed thoroughly, and transferred to a 384-well plate for mass spectrometry detection using a DP-TOF time-of-flight mass spectrometer.

[0035] Table 3. PCR reaction system

[0036] Components Volume [μl] / person <![CDATA[ddH2O]]> 0.675 PCR buffer 0.5 <![CDATA[MgCl2]]> 0.4 dNTP 0.075 dUTP 0.025 PCR amplification enzyme 0.2 PCR Primer Mix 1 UNG 0.5 / 0.25 / 0.125 / 0.05 Other types of samples 1 0.5ng / μl whole blood genomic DNA 1

[0037] Table 4. PCR reaction program

[0038]

[0039] Table 5. SAP reaction system and procedure

[0040]

[0041]

[0042] Table 6. SAP reaction procedure

[0043]

[0044] Table 7, Extension System

[0045] Components Volume [μl] / person <![CDATA[ddH2O]]> 0.62 Extended buffer 0.2 ddNTP 0.2 Extension primer 0.94 elongase 0.04

[0046] Table 8. Extension procedures

[0047]

[0048] The results of different UNG enzyme concentrations are shown in Table 9.

[0049] Table 9. UNG enzyme concentration optimization experimental results

[0050]

[0051]

[0052] Note: √ indicates that the sample interferes with the normal reading of genomic DNA, and × indicates that the sample does not interfere with the normal reading of genomic DNA; + indicates that all sites of genomic DNA can be read normally, and - indicates that there are sites in genomic DNA that cannot be read.

[0053] The results showed that the addition of 0.25 μL / person and 0.5 μL / person UNG enzyme incubation may affect the normal detection of genomic DNA, and the addition of 0.05 μL / person UNG enzyme could not eliminate 10 4 Contamination of samples with a concentration of 10 copies / μL or higher. Using 0.125 μL / sample of UNG enzyme provides good decontamination capabilities without affecting the normal amplification of template DNA. Therefore, 0.125 μL / sample is the appropriate amount of UNG enzyme added for this reaction system.

[0054] (2) Optimization of dUTP dosage

[0055] According to the appropriate addition amount of UNG enzyme obtained in 9, 0.125 μL, the appropriate addition amount of dUTP in the system was optimized so that the UNG-dUTP could reduce exogenous contamination with the greatest efficiency and would not affect the sensitivity of the nucleic acid mass spectrometry detection method.

[0056] Sample: Whole blood sample provided by Hangzhou Dian Medical Testing Center Co., Ltd. After nucleic acid extraction, the concentration was diluted to 40 ng / μl.

[0057] method: Prepare the PCR reaction solution according to the system in Table 10 and divide it into 3 groups. Add 0.01, 0.025, and 0.05 μl / person of dUTP to each group respectively. Take the negative sample mother solution and the positive sample mother solution and dilute them to 10 2 1 μl of each sample (100 copies / μl) and 40 ng / μl of nucleic acid sample DNA were added to the reaction system. Three replicates were performed for each dUTP concentration. PCR reactions were then performed according to the protocol in Table 4. After the PCR reaction, the PCR products were digested with SAP using the SAP system and protocol in Tables 5 and 6. The digested products were then extended using the extension system and protocol in Tables 7 and 8. After the extension reaction, 18.5 μL of ultrapure water was added to the extended products, mixed thoroughly, and transferred to a 384-well plate for mass spectrometry detection using a DP-TOF time-of-flight mass spectrometer.

[0058] Table 10. PCR reaction system and procedure

[0059] Components Volume [μl] / person <![CDATA[ddH2O]]> 0.675 PCR buffer 0.5 <![CDATA[MgCl2]]> 0.4 dNTP 0.075 dUTP 0.01 / 0.025 / 0.05 PCR amplification enzyme 0.2 PCR Primer Mix 1 UNG enzyme 0.125

[0060] The test results are shown in Table 11.

[0061] Table 11. dUTP dosage optimization experiment results

[0062]

[0063] Note: + indicates that all sites can be detected and read normally, - indicates that some sites cannot be detected or read normally

[0064] The results showed that when the dUTP dosage was 0.01 μl / person, the exogenous interference samples added could not be completely removed from the normal detection samples, affecting the reading of the correct sample results; when the dUTP dosage was 0.05 μl / person, the amplification of some sites in the sample to be tested was affected, and there was a risk of not being able to obtain completely correct results for all sites. Therefore, the appropriate dUTP dosage for this study was 0.025 μl / person.

[0065] Example 3: Preparation of a kit for detecting and analyzing physical fitness-related genes

[0066] (1) Nucleic acid sample pretreatment reagents for time-of-flight mass spectrometry detection system, the main components are shown in Table 12:

[0067] Table 12. Components of the Fitness-Related Gene Detection and Analysis Kit

[0068]

[0069]

[0070] (2) Amplification reaction primer premix: a mixture of the nucleotide sequences shown in SEQ ID NOs. 1 to 64 in Example 1, with each primer concentration being 0.3 to 3 μM;

[0071] (3) Single base extension reaction primer premix: a mixture of the nucleotide sequences shown in SEQ ID NOs. 65 to 96 in Example 1, with each primer concentration ranging from 3 to 30 μM;

[0072] (4) Desalination resin: including cation exchange resin powder for removing salt ions from the elongation reaction solution;

[0073] (5) Detection chip: A silicon-based chip containing 384 detection points with pre-dotted matrices.

[0074] Example 4: Method for detecting mutation sites in physical fitness genes of clinical samples

[0075] 1. Preparation of human gDNA nucleic acid template:

[0076] a) Specimen collection: Whole blood specimens are routinely collected by collecting 5 ml of venous blood into EDTA anticoagulant tubes. Blood can be extracted immediately after collection or stored at 4°C for later use.

[0077] b) Extraction of genomic DNA from whole blood: Refer to the instructions for extraction of the CWE2100 Blood DNA Kit V4 (Cat. CW2555S). After extraction, the absorbance of the DNA should be between 1.7 and 2.0. Then, dilute the sample to 15 ng / μL for the next PCR reaction.

[0078] 2. Detection of fitness gene mutation sites using a set of optimized amplification primers and a set of optimized single-base extension primers, specifically including the following steps:

[0079] (1) PCR reagent preparation (reagent preparation area):

[0080] Remove the PCR reaction mix and PCR enzyme mix from the kit, thaw each at room temperature, shake well, and centrifuge at 2000 rpm for 10 seconds. Calculate the number of reaction reagents needed.

[0081] The preparation of each test reaction system is shown in Table 13:

[0082] Table 13. Reaction system

[0083] Reagents PCR reaction mixture PCR enzyme mix PCR amplification primer premix Dosage 1.67μL 0.33μL 1 μL

[0084] Calculate the amount of each reagent to be used, mix thoroughly, and dispense 3 μL into PCR reaction tubes or 384-well PCR plates, and transfer to the sample processing area.

[0085] (2) Sample loading (sample processing area):

[0086] Add 2 μL of sample DNA solution respectively, cover the reaction tube or 384-well PCR plate tightly, and transfer to the detection area.

[0087] (3) PCR amplification (nucleic acid amplification region):

[0088] Place the reaction tubes in a certain order on the PCR instrument and perform PCR amplification according to the program in Table 14:

[0089] Table 14. PCR amplification program

[0090]

[0091] *Note: The PCR product will not be used for the next experimental step and can be stored at 4°C overnight.

[0092] (4) SAP reagent preparation (reagent preparation area):

[0093] Take out the SAP reaction mixture and SAP enzyme mixture from the kit, melt them separately at room temperature, shake and mix them evenly, centrifuge at 2000 rpm for 10 seconds, and calculate the number of reaction reagents needed.

[0094] The preparation of each test reaction system is shown in Table 15:

[0095] Table 15. SAP reaction system

[0096] Reagents SAP reaction mixture SAP enzyme mixture Dosage 1.70 μL 0.30μL

[0097] (5) Sample addition (nucleic acid amplification area):

[0098] Add 2 μL of the above SAP reaction solution to each PCR product from step 3. Tightly cap the reaction tubes or 384-well PCR plate. Place the reaction tubes in a specific order on the PCR instrument and perform SAP digestion according to the program in Table 16:

[0099] Table 16. SAP digestion reaction program

[0100]

[0101] *Note: The SAP product should be immediately processed to the next step. It is not recommended to store it at 4°C overnight.

[0102] (6) Extension reagent preparation (reagent preparation area):

[0103] Remove the extension reaction mix and extension enzyme mix from the kit, thaw at room temperature, shake and mix thoroughly, and centrifuge at 2000 rpm for 10 seconds. Calculate the number of reaction reagents needed.

[0104] The preparation of each test reaction system is shown in Table 17:

[0105] Table 17. Extension reaction system

[0106] Reagents Extension reaction mixture Elongase cocktail Single base extension primer premix Dosage 0.72μL 0.34μL 0.94μL

[0107] (7) Sample addition (nucleic acid amplification area):

[0108] Add 2 μL of the above extension reaction solution to each of the 6 SAP products in a certain order, and cover the reaction tubes or 384-well PCR plates tightly.

[0109] Place the reaction tubes in a certain order on the PCR instrument and perform extension amplification according to the program in Table 18:

[0110] Table 18, Extension Reaction Procedure

[0111]

[0112] *Note: The extension product can be stored at 4°C overnight without further experimental operation.

[0113] (8) Mass spectrometry detection using a DP-TOF time-of-flight mass spectrometry detection system (amplification analysis area):

[0114] Perform standard operations according to the DP-TOF nucleic acid mass spectrometer operating instructions, select the chip and well number corresponding to the required test sample, and the instrument automatically desalts the sample extension product, spots and detects the chip, and automatically analyzes the results.

[0115] (9) Import the result file analyzed by the mass spectrometer into the sample result reporting system and publish the sample result report.

[0116] Example 5: Accuracy test of physical fitness gene loci using the kit of the present invention

[0117] (1) Blood samples were randomly collected from 10 patients undergoing clinical examinations, and gDNA was extracted from the whole blood and its concentration was measured;

[0118] (2) Performing fitness gene loci detection on 10 samples of unknown results according to Example 3;

[0119] (3) The accuracy of the kit of the present invention in detecting fitness gene loci was verified by using the gold standard Sanger sequencing method. The verification primer pairs for the regions where each mutation site is located were synthesized and amplified by Shanghai Bio-Tech Co., Ltd. The verification PCR reaction system is shown in Table 19:

[0120] Table 19. PCR reaction system

[0121]

[0122] The reaction mixture was mixed and centrifuged at 8000 g for PCR verification. The procedure was as shown in Table 20:

[0123] Table 20. PCR reaction program

[0124]

[0125] After PCR amplification of each sample, the amplified fragments were confirmed by 2% agarose gel electrophoresis and sent to a sequencing company (Hangzhou Shangya Biotechnology Co., Ltd.) for sequencing verification. The results were compared with the mass spectrometry results. For example, the comparison results are shown in Table 21:

[0126] Table 21. Comparison of mass spectrometry results

[0127]

[0128]

[0129] Conclusion: The results of Sanger sequencing were completely consistent with those of nucleic acid mass spectrometry.

[0130] Advantages of this method: All 32 sites can be detected in one well reaction, while the sequencing method requires 32 well reactions, and the workload and cost are much higher than this method.

[0131] Example 6: Testing the sensitivity of fitness gene loci using the kit of the present invention

[0132] In this example, three DNA samples were selected and serially diluted. The starting DNA loading amounts were 10 ng, 5 ng, 2.5 ng, 1 ng, 0.5 ng, 0.2 ng, and 0.1 ng, respectively. Subsequent PCR, digestion, extension, and on-machine testing were performed. The statistical results of the three samples are shown in Tables 22 to 24:

[0133] Table 22. Sensitivity test results of sample 1

[0134]

[0135]

[0136] Table 23. Sensitivity test results of sample 2

[0137]

[0138]

[0139] Table 24. Sensitivity test results of sample 3

[0140]

[0141] The results showed that all loci in the three samples were correctly detected with a sample load as low as 0.2 ng, while some loci were not detected with a sample load of 0.1 ng. This indicates that the kit can detect all 32 loci simultaneously with as little as 0.2 ng of genomic DNA, demonstrating its high sensitivity and suitability for research on complex or rare samples.

[0142] Example 7: Generating a physical fitness report using the kit of the present invention to detect physical fitness gene loci

[0143] The detection site of the present invention was used for detection, and the detection results are shown in Table 25.

[0144]

[0145] Based on the Chinese population GWAS research and database, and calculated using the PRS model, we obtained physical fitness data from the test results and generated a physical fitness report, which included the following items:

[0146]

[0147] The test results were compared with traditional physical fitness tests and were consistent, thus indicating that the detection site of the present invention can be used for physical fitness prediction.

[0148] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims. Sequence Listing <110> Chinese People's Liberation Army General Hospital <120> Application of reagents for detecting 32 gene mutations in the preparation of physical fitness testing products <160> 96 <170> SIPOSequenceListing 1.0 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <400> 1 acgttggatg cctggagctg aatcacatga cc 32 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <400> 2 acgttggatg caacccctgagacctattca cg 32 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 acgttggatg cgaaacagag ttcaatggtc 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 acgttggatg ttccacaaca attatgcagg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 acgttggatg catacgtctg gcagatcttc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <400> 6 acgttggatg cacgatcagt tcaaggcaac 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <400> 7 acgttggatg ttttttctgt cacccattcc 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <400> 8 acgttggatg ctgcacaatt acatggacac 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 acgttggatg cttccagtta cgttccttcg 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <400> 10 acgttggatg ttgaggactt gcgctttcag 30 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <400> 11 acgttggatg gaacggcagc gccttcttg 29 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <400> 12 acgttggatg atgagagaca tgacgatgcc 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <400> 13 acgttggatg cggcccatta acctttttag 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 acgttggatg gtttgtgtgg aagagctgac 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <400> 15 acgttggatg gtccctttgt aatcccatcc 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <400> 16 acgttggatg agtggttacc tggcagaatg 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <400> 17 acgttggatg cttcattggg ccgaactttc 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <400> 18 acgttggatg gcttgacatc attggctgac 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <400> 19 acgttggatg actgcatagt tatgcccacc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <400> 20 acgttggatg tgtgaagtcc aaggttgccc 30 <210> twenty one <211> 30 <212> DNA <213> Artificial Sequence <400> twenty one acgttggatg gattgtgcaa tgtgacgtcc 30 <210> twenty two <211> 30 <212> DNA <213> Artificial Sequence <400> twenty two acgttggatg agcctcaatg acgacctaag 30 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <400> twenty three acgttggatg tcagggatca tccctgttac 30 <210> twenty four <211> 30 <212> DNA <213> Artificial Sequence <400> twenty four acgttggatg tcagggatca tccctgttac 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 acgttggatg catctcccct accttatttc 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <400> 26 acgttggatg tccattagag gctaacacac 30 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <400> 27 acgttggatg taccttggaa gtggacgtag 30 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <400> 28 acgttggatg ctgtgacagg atggaagact 30 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <400> 29 acgttggatg atgtcccttg cagaacagac 30 <210> 30 <211> 30 <212> DNA <213> Artificial Sequence <400> 30 acgttggatg gttgggtacg taaaaacatc 30 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <400> 31 acgttggatg ctgaattagc acccagggtc 30 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <400> 32 acgttggatg agctagagg gccttcaaca 30 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <400> 33 acgttggatg agctagagg gccttcaaca 30 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <400> 34 acgttggatg atcctcttcc ttgtcactgc 30 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <400> 35 acgttggatg gttaggtatt tatacgctc 29 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <400> 36 acgttggatg ttagactttcccagactaag 30 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <400> 37 acgttggatg gagtgaccta aaaactatac 30 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <400> 38 acgttggatgccactgtcctttctcctaac 30 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <400> 39 acgttggatg gtttgaagct ttgggctacg 30 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <400> 40 acgttggatg tggaaaccca tggagttcgg 30 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <400> 41 acgttggatg agaaaggccc ctgtaggttc 30 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <400> 42 acgttggatg tccctaagta gaggagcaga 30 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <400> 43 acgttggatg cctccccagg tactgttaag 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <400> 44 acgttggatg aggcccaatt cttggatccg 30 <210> 45 <211> 30 <212> DNA <213> Artificial Sequence <400> 45 acgttggatg gattgagttt gagctgtcgg 30 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <400> 46 acgttggatg agaccttgtg gaaggatcag 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <400> 47 acgttggatg agaccttgtg gaaggatcag 30 <210> 48 <211> 29 <212> DNA <213> Artificial Sequence <400> 48 acgttggatg caacctgctg gtcatcgtg 29 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <400> 49 acgttggatg cacagcagac ctgtgtaatg 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <400> 50 acgttggatg caatttcatg agcagcaacg 30 <210> 51 <211> 30 <212> DNA <213> Artificial Sequence <400> 51 acgttggatg aacagctcat ctttcaaggg 30 <210> 52 <211> 29 <212> DNA <213> Artificial Sequence <400> 52 acgttggatg agtgcagagc tcagctgga 29 <210> 53 <211> 29 <212> DNA <213> Artificial Sequence <400> 53 acgttggatg ctttgtgatg tcttttctc 29 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <400> 54 acgttggatg caatgctaatttaggagagg 30 <210> 55 <211> 30 <212> DNA <213> Artificial Sequence <400> 55 acgttggatg ggcttgcgtg gtagagacag 30 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <400> 56 acgttggatg aatcagccgc tcccattctc 30 <210> 57 <211> 30 <212> DNA <213> Artificial Sequence <400> 57 acgttggatg aacgagagcg catcctttgg 30 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <400> 58 acgttggatg aagcaggtct ctccttgcag 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <400> 59 acgttggatg aaggaagcta agatgggctc 30 <210> 60 <211> 30 <212> DNA <213> Artificial Sequence <400> 60 acgttggatg gacccagtcc tttatgtagc 30 <210> 61 <211> 30 <212> DNA <213> Artificial Sequence <400> 61 acgttggatg tctcactgag gaagaggttg 30 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <400> 62 acgttggatg tttgggcacg agatttctcc 30 <210> 63 <211> 35 <212> DNA <213> Artificial Sequence <400> 63 acgttggatg atactctgac aaatggcagc aaaag 35 <210> 64 <211> 33 <212> DNA <213> Artificial Sequence <400> 64 acgttggatg tacatgtgtc taccccaaag cag 33 <210> 65 <211> 15 <212> DNA <213> Artificial Sequence <400> 65 ctctgtccac accca 15 <210> 66 <211> 15 <212> DNA <213> Artificial Sequence <400> 66 cattcacgtg caggg 15 <210> 67 <211> 16 <212> DNA <213> Artificial Sequence <400> 67 atggcacctc gctctc 16 <210> 68 <211> 17 <212> DNA <213> Artificial Sequence <400> 68 tcacccattc ctcctac 17 <210> 69 <211> 17 <212> DNA <213> Artificial Sequence <400> 69 ccttcgatca gttgtca 17 <210> 70 <211> 17 <212> DNA <213> Artificial Sequence <400> 70 atttgctggc acccaat 17 <210> 71 <211> 18 <212> DNA <213> Artificial Sequence <400> 71 atactgaaga gtcaacca 18 <210> 72 <211> 19 <212> DNA <213> Artificial Sequence <400> 72 ttttacttcc ctcccgatc 19 <210> 73 <211> 19 <212> DNA <213> Artificial Sequence <400> 73 tccaacagct cttctatca 19 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <400> 74 gaaccagaca ggcttacct 19 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <400> 75 aatgtgacgt cctttagcat 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <400> 76 tgagcacctg tgaatgagtg 20 <210> 77 <211> twenty three <212> DNA <213> Artificial Sequence <400> 77 cccgacttca caaaggaaat gtg 23 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <400> 78 ctggactggc tgctccctga 20 <210> 79 <211> twenty two <212> DNA <213> Artificial Sequence <400> 79 aacagactca ttacacattt at 22 <210> 80 <211> twenty two <212> DNA <213> Artificial Sequence <400> 80 gggccagggt cacatcccag tt 22 <210> 81 <211> twenty two <212> DNA <213> Artificial Sequence <400> 81 ggtgaagatg gacctctaca gg 22 <210> 82 <211> twenty three <212> DNA <213> Artificial Sequence <400> 82 agctcttaaa aacaaaatag ctt 23 <210> 83 <211> twenty four <212> DNA <213> Artificial Sequence <400> 83 tctctagaaa actactacga cctc 24 <210> 84 <211> twenty four <212> DNA <213> Artificial Sequence <400> 84 gaacagctgt tcgtgttcta tgat 24 <210> 85 <211> 17 <212> DNA <213> Artificial Sequence <400> 85 cgaggaggac aagacag 17 <210> 86 <211> 25 <212> DNA <213> Artificial Sequence <400> 86 agtctccatt taactgtcac ctaaa 25 <210> 87 <211> 25 <212> DNA <213> Artificial Sequence <400> 87 agttggagct gtcggtaaaa tatct 25 <210> 88 <211> 26 <212> DNA <213> Artificial Sequence <400> 88 ccctctggtc tggagtctcg gagtcc 26 <210> 89 <211> 27 <212> DNA <213> Artificial Sequence <400> 89 tttaaaaaat aagtaactat tgttctc 27 <210> 90 <211> 16 <212> DNA <213> Artificial Sequence <400> 90 cttcaagggc tgggta 16 <210> 91 <211> 19 <212> DNA <213> Artificial Sequence <400> 91 ccgatggttg ggaggagta 19 <210> 92 <211> twenty three <212> DNA <213> Artificial Sequence <400> 92 gaagtccagc cctcatcccg ccc 23 <210> 93 <211> 19 <212> DNA <213> Artificial Sequence <400> 93 ccactgtccc tcagttcac 19 <210> 94 <211> 17 <212> DNA <213> Artificial Sequence <400> 94 gctggcatga cagggaa 17 <210> 95 <211> twenty one <212> DNA <213> Artificial Sequence <400> 95 cctaggttga agaagtgctg a 21 <210> 96 <211> 27 <212> DNA <213> Artificial Sequence <400> 96 ggacagcaaa agtaatgcaa tactcac 27

Claims

1. Use of a reagent for detecting 32 gene mutations in the preparation of a physical fitness test product, characterized by: The 32 loci are rs12722, rs10887741, rs1815739, rs2253206, rs11549465, rs1042713, rs3764352, rs12612420, rs6265, rs2073711, rs1800795, rs363050, rs800562, rs699, rs1842129, rs1214 3842, rs2016520, rs4665058, rs679620, rs1799945, rs363039, rs4783307, rs2267668, rs4994, rs591058, rs1799722, rs8097348, rs1800012, rs8192678, rs4948418, rs1208, and rs17602729; The reagents include amplification primers for 32 detection sites and single-base extension primers, and the amplification primers are shown in SEQ ID NO.1 to SEQ ID NO.64; The single-base extension primers are shown in SEQ ID NO.65 to SEQ ID NO.

96.

2. Use of the reagent for detecting 32 gene mutations according to claim 1 in preparing a physical fitness test product, characterized in that: The concentration of each sequence of the amplification primer is 0.3-3 μM; the concentration of each sequence of the extension primer is 3-30 μM.

3. Use of the reagent for detecting 32 gene mutations according to claim 1 or 2 in the preparation of a physical fitness test product, characterized in that: The reagents also include a reaction reagent for digesting excess dNTPs and primers in the amplification system, a desalting reagent, and a detection chip.

4. Use of the reagent for detecting 32 gene mutations according to claim 3 in the preparation of a physical fitness test product, characterized in that: The reaction reagents are SAP enzyme and SAP reaction mixture; and the desalting reagent is cation exchange resin powder.

5. Use of the reagent for detecting 32 gene mutations according to claim 3 in the preparation of a physical fitness test product, characterized in that: The detection chip is a silicon-based chip comprising 384 detection points of pre-dotted matrices.

6. Use of the reagent for detecting 32 gene mutations according to claim 1 in preparing a physical fitness test product, characterized in that: The reagents also include PCR amplification buffer, Mg 2+ , dATP, dCTP, dTTP, dUTP, dGTP, Taq enzyme and UNG enzyme.

7. Use of the reagent for detecting 32 gene mutations according to claim 1 in preparing a physical fitness test product, characterized in that: The detection product adopts a time-of-flight mass spectrometry detection system to perform mass spectrometry detection.

Images