Methods for quantitative genetic analysis of cell-free DNA

Abstract

The present invention provides a method for performing genetic analysis in an individual, which reveals the genetic sequence and chromosome copy number of a targeted and specific genomic locus in a single analysis. The present invention also provides a method for sensitively and specifically detecting target gene sequences and gene expression profiles.

Description

[0001] This application is a divisional application of Chinese patent application with application number 201480081729.4.

[0002] Statement regarding sequence listing

[0003] A sequence listing associated with this application is provided in text format in lieu of a paper copy and is incorporated into this specification by reference. The name of the text file containing the sequence listing is CLFK_002_00US_ST25.txt. The text file is 117KB, created on August 22, 2014, and submitted electronically via EFS-Web. background Technical Field

[0004] The present invention generally relates to compositions and methods for quantitative genetic analysis of cell-free DNA (cfDNA). In particular, the present invention relates to improved target sequence capture compositions and methods for genetic characterization and analysis of cfDNA.

[0005] Related technical description

[0006] It is becoming increasingly clear that most, if not all, of the most common human cancers are diseases of the human genome. The emerging condition is the accumulation of somatic mutations during an individual's lifetime, some of which increase the probability that the cells they harbor can develop into a tumor (Vogelstein et al., Science 339(6127): 1546-1558 (2013)). With only the wrong combination of accumulated mutational events, precancerous growths lose the restraints that constrain uncontrolled proliferation, and the resulting mass of cells becomes cancer. Clusters of mutations that are necessary and sufficient to cause cancer are often collectively referred to as "driver mutations." One of the themes that has emerged from recent and thorough molecular analyses is that cancer, once thought to be a single, tissue-specific disease, is in fact a group of related diseases, each with a unique molecular pathology. The Human Genome Project laid the foundation for genome-wide analyses of cancer.

[0007] For example, the introduction of next-generation sequencing technology (2004 to present) has accelerated the pace of discovery of causative genomic factors that underlie the diagnosis of NSCLC, thereby clearly demonstrating that NSCLC is a true family of related diseases, each of which may be responsive to different targeted therapies.

[0008] This technology lacks reliable and powerful molecular analysis methods for genetic disease analysis. Traditionally, molecular diagnostics has been composed of antibody-based detection (immunohistochemistry), in situ hybridization with DNA probes (fluorescence in situ hybridization) and hybridization or PCR-based detection of query specific nucleotide sequences. Until recently, DNA sequencing as a molecular diagnostic tool was generally limited to the coding exons of one or two genes. Although DNA sequencing has been used for the diagnosis and treatment of solid cancers, one of the most significant shortcomings of these methods is that they need to directly enter the tumor tissue. This material is usually difficult to obtain from the initial biopsy used to diagnose the disease, and it is actually impossible to obtain with multiple repetitions over time. Similarly, it is impossible to perform a biopsy in patients with inaccessible tumors, and it is not practical in individuals with metastatic diseases.

[0009] As a result, the enormous potential of molecular diagnostics for genetic diseases, fetal testing, paternity testing, predicting response to drug therapy, diagnosing or monitoring medical conditions, Mendelian disorders, genetic mosaicism, pathogen screening, microbiome analysis, and organ transplant monitoring has not been realized. To date, existing molecular diagnostic methods lack efficient solutions for cloning and amplifying single DNA molecules, as well as solutions for efficient targeted sequencing to specific genomic loci with sufficient sensitivity to distinguish true-positive test results from false-positive signals that arise during sample processing. SUMMARY OF THE INVENTION

[0010] The present invention generally relates to compositions and methods that provide improved compositions and methods for genetic analysis of cfDNA.

[0011] In various embodiments, a method for genetic analysis of cell-free DNA (cfDNA) is provided, comprising: treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce cfDNA library clones; determining the number of genome equivalents in the cfDNA clone library; and performing quantitative genetic analysis of one or more target genetic loci in the cfDNA library clones.

[0012] In specific embodiments, the method further comprises isolating cfDNA from a biological sample from the subject.

[0013] In another embodiment, the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0014] In a certain embodiment, the one or more adaptors comprise a plurality of adaptor species.

[0015] In specific embodiments, the one or more adaptors each comprise a primer binding site for amplifying the cfDNA library.

[0016] In another embodiment, the one or more adaptors each comprise one or more unique read codes.

[0017] In another embodiment, one or more adaptors each comprise one or more sample codes for multiplexing of samples.

[0018] In another embodiment, the one or more adaptors each comprise one or more sequences for DNA sequencing.

[0019] In specific embodiments, qPCR is performed on the cfDNA clone library, and the qPCR measurements are compared to standards of known genome equivalents to determine the genome equivalent of the cfDNA clone library.

[0020] In another specific embodiment, qPCR is performed using a primer that binds to an Alu sequence and a primer that binds to a sequence in an adaptor.

[0021] In a certain embodiment, quantitative genetic analysis is performed on multiple genetic loci in cfDNA library clones.

[0022] In another embodiment, quantitative genetic analysis is performed on multiple genetic loci in multiple cfDNA clone libraries.

[0023] In another embodiment, quantitative genetic analysis comprises hybridizing one or more capture probes to the target genetic locus to form a capture probe-cfDNA clonal complex.

[0024] In specific embodiments, quantitative genetic analysis comprises isolating capture probe-cfDNA clonal complexes.

[0025] In a certain embodiment, the quantitative genetic analysis comprises amplifying the cfDNA clone sequences in the isolated hybridized capture probe-cfDNA clone complexes.

[0026] In another embodiment, the quantitative genetic analysis comprises DNA sequencing to generate a plurality of sequencing reads.

[0027] In another embodiment, the quantitative genetic analysis comprises bioinformatics analysis of multiple sequencing reads.

[0028] In specific embodiments, bioinformatics analysis is used: to quantify the number of genomic equivalents analyzed in the cfDNA clone library; to detect genetic variants in the target genetic locus; to detect mutations within the target genetic locus; to detect genetic fusions within the target genetic locus; and to measure copy number fluctuations within the target genetic locus.

[0029] In another embodiment, the subject does not suffer from a genetic disease.

[0030] In a certain embodiment, the subject has not been diagnosed with a genetic disease.

[0031] In another embodiment, the subject has been diagnosed with a genetic disease.

[0032] In another embodiment, quantitative genetic analysis is used to identify or detect one or more genetic lesions that cause or are associated with a genetic disease.

[0033] In a certain embodiment, the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change, or a gene fusion.

[0034] In specific embodiments, the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0035] In a specific embodiment, the 3' coding region of the ALK gene is fused to the EML4 gene.

[0036] In another embodiment, the genetic disease is cancer.

[0037] In another embodiment, the subject is pregnant.

[0038] In another embodiment, quantitative genetic analysis is used to identify or detect one or more genetic variants or genetic lesions at one or more target genetic loci in fetal cfDNA.

[0039] In specific embodiments, the subject is a transplant recipient.

[0040] In another embodiment, quantitative genetic analysis is used to identify or detect donor cfDNA in a subject.

[0041] In various embodiments, a method for predicting, diagnosing, or monitoring a genetic disease in a subject is provided, comprising: isolating or obtaining cfDNA from a biological sample of the subject; treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce a cfDNA clone library; determining the number of genomic equivalents in the cfDNA clone library; and performing quantitative genetic analysis on one or more target genetic loci associated with the genetic disease in the cfDNA clone library, wherein identifying or detecting one or more genetic lesions in the one or more target genetic loci predicts the genetic disease, diagnoses the genetic disease, or monitors the progression of the genetic disease.

[0042] In another embodiment, the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0043] In a certain embodiment, the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change, or a gene fusion.

[0044] In specific embodiments, the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0045] In another embodiment, the 3' coding region of the ALK gene is fused to the EML4 gene.

[0046] In specific embodiments, the genetic disease is cancer.

[0047] In various embodiments, a companion diagnostic for a genetic disease is provided, which comprises: isolating or obtaining cfDNA from a biological sample of a subject; treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce a cfDNA clone library; determining the number of genomic equivalents in the cfDNA clone library; and performing quantitative genetic analysis on one or more biomarkers associated with the genetic disease in the cfDNA clone library, wherein detection or non-detection of at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disease.

[0048] In a specific embodiment, the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0049] In another embodiment, the biomarker is a genetic lesion.

[0050] In specific embodiments, the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change, or a gene fusion.

[0051] In another embodiment, the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0052] In another embodiment, the 3' coding region of the ALK gene is fused to the EML4 gene.

[0053] In one embodiment, the genetic disease is cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 Shown is the expected relative observed variant frequency as a function of pooling dilution in the absence of unique read filtering. In the absence of unique read filtering, random base changes with measurable non-zero frequencies occurred at these four selected positions; therefore, indicating a lack of sensitivity in detecting specific single nucleotide variants (SNVs).

[0055] Figure 2 Shows the Figure 1 The left panel shows unique read filtering of data generated from Figure 1 Figure 1 shows data for the BRAF I326T SNV without unique read filtering. The right panel shows that unique read filtering using the same data increases analytical sensitivity and allows for the differentiation of true signal from error-prone noise.

[0056] Figure 3 Capture probe performance as a function of length and wash temperature is shown. The y-axis shows the total number of reads associated with each capture probe. The bars in the bar graph are divided into two categories, where open bars correspond to on-target reads that align with the intended capture probe target and solid bars show off-target reads that are associated with the capture probe but map to unintended regions of the genome. Overall, 40-mer and 60-mer capture probes perform essentially the same at washes of 44°C and 47°C. At washes of 50°C, the 40-mer capture probe behaves erratically. These data validate the use of 40-mer capture probes at wash temperatures ranging from about 44°C to about 47°C.

[0057] Figure 4Schematic diagram of targeted and directed sequencing of intron 19 of the ALK gene is shown. A) In the "wild-type" reference sequence, the antisense-oriented ALK capture probe identifies sequences from intron 19. B) In the case of pathogenic fusion genes, some ALK capture probes will identify junctional sequences associated with the gene fusion event.

[0058] Figure 5 A schematic diagram of high-density capture probe placement for complete sequencing of a target region is shown. Each capture probe captures a set of sequences that provide cumulative coverage at each base position. Here, coverage is represented by a line, and the amplitude of the line represents the depth of coverage from a specific capture probe. Overlapping coverage from adjacent capture probes provides complete sequencing of the target region in two possible directions. In addition, the head-to-head placement of opposite strand capture probes ensures that all capture probe binding sites are sequenced.

[0059] Figure 6 Representative examples of size distribution of fragmented DNA used in library construction are shown.

[0060] Figure 7 The performance of a high-density 40-mer capture probe in a representative experiment is shown. The y-axis shows the total number of reads, which are divided into on-target reads, off-target reads, and unmappable reads. The x-axis lists each of the 105 capture probes used for sequence capture in this experiment.

[0061] Figure 8 Representative examples showing cumulative coverage of target regions using high density 40-mer capture probes. Shown here is cumulative coverage of TP53 coding exons.

[0062] Fig.9A A representative example of the size distribution of a cell-free DNA (cfDNA) library is shown. The dominant band is consistent with a pool of 170 ± 10 bp fragments ligated to a 90 bp adapter. Fig. 9B Published gel images of cfDNA and representative cfDNA libraries generated using the methods disclosed and / or contemplated herein are shown. The qualitative "ladder" appearance is conserved among the libraries, but the libraries are transformed to higher quality by the addition of 90 bp adapter sequences. Fig. 9C Representative examples of genomic, plasma-derived cfDNA libraries from ovarian cancer patients (OvC) and "healthy donors" (HD) are shown.

[0063] Fig.10 Unique read counts across 8 cfDNA libraries from four plasma samples are shown. Fragmentation prior to library construction with this sample 23407 increased library yield more than two-fold.

[0064] Fig.11Representative read coverage of cfDNA across the TP53 gene region is shown. 24 131bp reads captured by the "TP53_NM_000546_chr17:7579351:region_3:280nt:41:80:r" capture probe (SEQ ID NO: 201) were randomly selected and aligned using the BLAST algorithm in the UCSC genome browser. 21 reads mapped to the target region, and they did so in overlapping coverage mode. The probes used to capture these reads are marked with arrows.

[0065] Fig.12 An overview of targeted DNA sequencing of the TP53 gene coding region from a cfDNA genomic library is shown. Coverage (horizontal axis) extends across all 10 coding regions and includes intronic regions involved in mRNA splicing. Sequencing depth (vertical axis) reaches a maximum of 4851 and is the same across all coding exons.

[0066] Fig.13 A graph showing unique read counts relative to qPCR estimated genome equivalents in ACA2-based analysis. qPCR measurements are shown on the X-axis and the read counts relative to them are shown on the Y-axis. Perfect agreement between these measurements is shown as a diagonal line. There is very poor (if any) correlation between measurements, especially at lower genome inputs. These data show that ACA2-based qPCR analysis has long underestimated library complexity and is insufficient to measure genome equivalents.

[0067] Fig.14 A schematic diagram of the core elements of the qPCR genome equivalent measurement analysis that couples a genomic repeat-specific primer (e.g., Alu) and a long adapter-specific primer is shown. (A) Standard library amplification is performed using a single 25nt primer (primer 1) named ACA2. (B) The longer 58nt version of the ACA2 primer (primer 2) does not amplify the genomic library due to stem-loop suppression. (C) Forward and reverse primers for the common human Alu repeat element (primer 3 and primer 4) are used to identify 1000 loci and conveniently amplify genomic DNA. (D) A separate single Alu primer (forward or reverse) (primer 3 or primer 4) coupled to a long ACA2 primer (primer 2) does not amplify genomic DNA. (E) The same primer pair as in (D) conveniently amplifies a genomic cfDNA library clone containing an Alu sequence.

[0068] Figure 15 shows proof-of-concept data for genome-equivalent Alu plus adapter-based qPCR analysis. (A) 10 pg of a standard genomic library was amplified with various PCR primers. The x-axis shows the PCR primers used for amplification, and the Y-axis (logarithmic scale) shows the PCR signal measured in fg / μL. As expected, the standard ACA2 primers produced a strong signal. The ACA2 long primers failed to produce a signal due to PCR inhibition. Both Alu primer pairs produced a signal of 1% of the ACA2 amount, indicating that 1% of the clones had an amplifiable Alu sequence. Any combination of Alu primers with the long ACA2 primers also produced a strong signal. (B) Validation against 10 pg genomic DNA (four samples on the left) or 10 pg library DNA (four clones on the right). The Alu primer pair amplifies comparable signals from either genomic DNA or genomic libraries. In contrast, primer pairs consisting of an Alu primer and a long ACA2 primer amplify genomic DNA very little (L+A1F) or not at all (L+A1R). These same primer pairs show library amplification that slightly exceeds the signal from the Alu primer pair.

[0069] Fig.16 A direct comparison of the ACA2 primer qPCR analysis with the Alu-ACA2 long primer qPCR analysis is shown. The Alu ACA2 long primer qPCR analysis shows an 8-fold increase in detectable genome equivalents, which is more consistent with the unique read counts from the sequencing data.

[0070] Fig.17 Representative examples of adapter structures and functions that provide highly sensitive, quantitative genetic analysis that accurately measures the genome equivalents analyzed are shown. (A) The fine structure of the adapter ligation strand. Details related to each numbered element are provided in Example 4. (B) The duplex formed between the 45nt ligation strand and the 12nt partner oligonucleotide strand generates a blunt-ended ligation substrate that is compatible with end-repaired cfDNA fragments (solid bars). (C) After ligation, a complementary sequence to the ligation strand is generated by a DNA polymerase-mediated fill-in reaction.

[0071] Fig.18 Representative examples of size distribution of two DNA samples (NA06994 & NCI-H2228) processed to simulate cfDNA are shown.

[0072] Fig.19 A representative example of the sensitivity of detection of the TP53 point mutation Q331* in tumor sample DNA (H2228) mixed with normal genomic DNA (N) is shown. The most sensitive detection corresponds to 1000 copies of the normal gene for TP53. mutant copies.

[0073] Fig. 20 It is shown that the junction sequence of the EML4-ALK fusion gene contained in the cell line NCI-H2228 can be accurately determined using the compositions and methods disclosed herein.

[0074] Fig.21 Figure 4 shows the detection of the EML4-ALK fusion gene in tumor sample DNA (H2228) mixed with normal genomic DNA (N). Since the fusion is present as a heterozygote in the NCI-H2228 cell line, the most sensitive detection corresponds to the ALK gene. A gene fusion occurs in one normal chromosome copy (50 genome equivalents).

[0075] Fig. 22 Shown is the detection of MYCN gene amplification in a mixture of the cell line NCI-H69 (H69) diluted into normal human DNA (N). The threshold of two normal diploid copies is shown as a red dashed line.

[0076] Fig.23 Shown are DNA mutations detected in the TP53 gene in patients with three different cancers. A typical gene model is shown at the top of the figure. The peaks represent DNA sequence coverage (X-axis) and depth (Y-axis). For all samples analyzed, the sequencing depth was >4000 genome equivalents. An expanded view of exon 7 below the gene model, showing where all detected mutations were located. The frequency of mutant detection in cfDNA (plasma), tumor tissue, and normal adjacent tissue is shown, if available (NA - not available). OVA1 and OVA2 are patients with ovarian cancer; CRC406 and CRC407 are patients with colorectal cancer. No mutations in TP53 were found in any of the OVA1 samples.

[0077] Fig.24 DNA sequencing of a larger panel of 13 genes (boxed) is shown. Sequencing identified KRAS mutations in cfDNA and tumors from ovarian cancer patient OVA1.

[0078] Fig.25 DNA sequencing of a larger panel of 12 genes is shown. The sequencing identified ERBB2 gene amplification in the plasma of colorectal cancer patient CRC407. DETAILED DESCRIPTION OF THE INVENTION

[0079] A. Overview

[0080] The present invention relates in part to compositions and methods for quantitative genetic analysis of the genetic state of an individual using cell-free DNA (cfDNA). As used herein, the term "genetic state" refers to a sequence of one or more target genomic sequences in a genome for a non-pathogenic normal sequence or a sequence for a genetic condition or disease that is pathogenic. In one embodiment, analyzing genetic state refers to identifying, quantifying or monitoring genetic variants in a target genetic locus, wherein the variant has changed relative to a reference sequence (e.g., a normal sequence or a mutant sequence). The inventors have provided solutions to the molecular diagnosis problems of genetic conditions or diseases, which involve a lack of sensitivity for distinguishing true positives from false positives, invalid cloning and amplification of single DNA molecules, and invalid targeted sequencing of specific genomic loci. Solutions related to this article include compositions and methods for reliable and stable quantitative genetic analysis, with sensitivity sufficient to distinguish true positive test results from false positive signals occurring during sample processing.

[0081] Next-generation sequencing technologies offer the opportunity to add broad genomic investigations to molecular diagnostics in a variety of conditions including cancer, fetal diagnosis, paternity testing, pathogen screening, and organ transplant monitoring. In the context of genetic disease, next-generation sequencing information is used in clinical settings to identify mutations within genes that may alter gene function, to identify gains or losses of genetic material within cells, and to identify genomic rearrangements that are not found in normal, healthy cells. The results of these broad diagnostic investigations are often used to guide patient treatment.

[0082] However, the need to directly access the affected tissue to obtain a sample outweighs the potential benefits of DNA sequencing in diagnosing and treating an individual's genetic status or genetic condition or disease. Such material is often difficult to obtain from an initial biopsy used to diagnose a disease, and is virtually impossible to obtain with multiple repetitions over time. Similarly, in cancer patients, biopsies are not possible in patients with inaccessible tumors, and are not practical in individuals with metastatic disease. In contrast, the inventor's method derives from the fact that all tissues need access to the vasculature to survive, and therefore these clumps deposit DNA into body fluids. One major reservoir in body fluids where the DNA of diseased cells is found is the plasma of human blood.

[0083] In contrast to detection methods that rely on shallow whole-genome sequence coverage, the molecular diagnostics for individual genetic status, genetic diseases, Mendelian disorders, genetic mosaicism, fetal testing, paternity testing, predicting responses to drug treatments, diagnosing or monitoring medical conditions, pathogen screening, microbiome analysis, and organ transplant monitoring involved herein utilize the availability of cfDNA to provide deep sequence coverage of selected target genes. In addition, the cfDNA-based cancer diagnostics involved herein have the ability to detect a variety of genetic changes, including somatic sequence variations that change protein function, large-scale chromosomal rearrangements that produce mosaic gene fusions, and copy number variations including gene copy reduction or increase. Using the compositions and methods involved herein, these changes are detectable and quantifiable in the face of significant dilution or mixing of normal sequences within cfDNA contributed by normal conversion processes occurring within healthy tissues. The compositions and methods involved herein also successfully address the major challenges associated with detecting rare genetic changes that cause disease; namely, cfDNA is highly fragmented, cfDNA levels vary significantly between individuals, and the degree of mixing of diseased sequences relative to normal sequences is highly variable in patients, even within individuals with the same molecular disease and stage.

[0084] In various embodiments, the compositions and methods for genetic analysis include detecting DNA portions in biological fluid samples and fecal samples. The methods involved herein use cfDNA that can be obtained from various biological sources to provide a novel comprehensive framework address molecular genetic analysis. The purified cfDNA clones are introduced into the labeled cfDNA sequences, which provide information for downstream analysis and enable the amplification of the resulting clone library. Hybridization capture with target-specific oligonucleotides is used to retrieve specific sequences for subsequent analysis. Independent measurements of the number of genomes present in the library are applied to each sample, and these analyses provide a means of estimating the sensitivity of the analysis. The analysis involved herein provides a reliable, repeatable and robust method for analyzing, detecting, diagnosing or monitoring genetic states, conditions or diseases.

[0085] Unless otherwise indicated, the practice of the specific embodiments of the present invention will employ conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology and cell biology within the skill of the art, many of which are described below for illustrative purposes. Such techniques are fully explained in the literature. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Transcription and Translation (B. Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984) and Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998).

[0086] B. Definition

[0087] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or detection of the present invention, preferred embodiments of compositions, methods and materials are described herein. For purposes of the present invention, the following terms are defined as follows.

[0088] The articles "a / an" and "the" are used herein to refer to one or more than one (ie, at least one) of the grammatical object of the article. As an example, "an element" means one element or more than one element.

[0089] The use of alternatives (eg, "or") should be understood to mean one, two, or any combination of the alternatives.

[0090] The term "and / or" should be understood to mean one or both of these alternatives.

[0091] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% relative to a reference quantity, reference level, reference value, reference number, reference frequency, reference percentage, reference dimension, reference size, reference amount, reference weight or reference length. In one embodiment, the term "about" or "approximately" refers to a range of about ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2% or ±1% of a reference quantity, reference level, reference value, reference number, reference frequency, reference percentage, reference dimension, reference size, reference amount, reference weight or reference length.

[0092] Throughout the specification, unless the context requires otherwise, the words "comprise / comprises / comprising" will be understood to mean the inclusion of stated steps or elements or groups of steps or elements but not the exclusion of any other steps or elements, or groups of steps or elements. In specific embodiments, the terms "comprises", "having", "containing" and "including" are used synonymously.

[0093] “Consisting of is meant to include and be limited to whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0094] "Consisting essentially of" means including any elements listed after the phrase and is limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of" means that the listed elements are required or mandatory, but no other elements are optional and may or may not be present depending on whether they affect the activity or action of the listed elements.

[0095] References throughout the specification to "an embodiment," "an embodiment," "a specific embodiment," "a related embodiment," "an embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that the specific features, structures, or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. Therefore, the aforementioned phrases appearing in various places throughout the specification do not necessarily all refer to the same embodiment. Furthermore, the specific features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0096] As used herein, the term "isolated" refers to material that is substantially or essentially free from components that normally accompany it in its native state. In specific embodiments, the terms "obtained" or "derived" are used synonymously with isolated.

[0097] As used herein, the term "DNA" refers to deoxyribonucleic acid. In various embodiments, the term DNA refers to genomic DNA, recombinant DNA, synthetic DNA, or cDNA. In one embodiment, DNA refers to genomic DNA or cDNA. In a specific embodiment, the DNA comprises a "target region". The DNA libraries referred to herein include genomic DNA libraries and cDNA libraries constructed from RNA (e.g., RNA expression libraries). In various embodiments, the DNA library comprises one or more additional DNA sequences and / or tags.

[0098] "Target genetic locus" or "DNA target region" refers to a region of interest within a DNA sequence. In various embodiments, targeted genetic analysis is performed on a target genetic locus. In specific embodiments, a DNA target region is a region of a gene associated with a specific genetic state, genetic condition, genetic disease, fetal testing, genetic mosaicism, paternity testing, predicting a response to drug therapy, diagnosing or monitoring a medical condition, microbiome analysis, pathogen screening, or organ transplant monitoring.

[0099] As used herein, the terms "circulating DNA," "circulating cell-free DNA," and "cell-free DNA" are often used interchangeably and refer to DNA that is extracellular DNA, DNA that has been extruded from cells, or DNA that has been released from necrotic or apoptotic cells.

[0100] As used herein, "subject," "individual," or "patient" includes any animal that exhibits symptoms of a condition that can be detected or identified using the compositions described herein. Suitable subjects include laboratory animals (such as mice, rats, rabbits, or guinea pigs), farm animals (such as horses, cattle, sheep, pigs), and livestock or pets (such as cats or dogs). In specific embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human primate, and in preferred embodiments, the subject is a human.

[0101] C. Genetic Analysis Methods of Cell-Free DNA

[0102] In various embodiments, methods for genetic analysis of cfDNA are provided.

[0103] In a specific embodiment, a genetic analysis method for cfDNA comprises generating and amplifying a cfDNA library, determining the number of genomic equivalents in the cfDNA library, and performing quantitative genetic analysis of one or more genomic target loci.

[0104] The genetic analysis method for cfDNA includes: treating cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA, and ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce cfDNA library clones; determining the number of genome equivalents in the cfDNA library clones; and performing quantitative genetic analysis on one or more target genetic loci in the cfDNA library clones.

[0105] 1. Generation of cfDNA Library

[0106] In a specific embodiment, the genetic analysis method contemplated herein includes generating a cfDNA library, comprising treating the cfDNA with one or more end-repair enzymes to generate end-repaired cfDNA, and ligating one or more adapters to each end of the end-repaired cfDNA to generate a cfDNA library.

[0107] (a) Cell-free DNA (cfDNA)

[0108] The methods and compositions involved herein are designed to use cell-free DNA (cfDNA) as an analyte to effectively analyze, detect, diagnose and / or monitor genetic status, genetic conditions, genetic diseases, genetic mosaicism, fetal diagnosis, paternity testing, microbiome analysis, pathogen screening and organ transplant monitoring. The size distribution range of cfDNA is about 150bp to about 180bp fragments. Fragmentation may be the result of endonuclease activity and / or exonuclease activity, and poses a huge challenge to the accurate, reliable and stable analysis of cfDNA. Another challenge in analyzing cfDNA is its short half-life in the bloodstream, on the order of about 15 minutes. Without wishing to be bound by any specific theory, the present invention relates in part to the analysis of cfDNA, similar to "liquid biopsy", and is a real-time snapshot of current biological processes.

[0109] Furthermore, because cfDNA is not present within cells and can be obtained from many suitable sources, including but not limited to biological fluids and stool samples, it is not subject to existing limitations that plague next-generation sequencing analysis, such as direct access to the tissue being analyzed.

[0110] In specific embodiments, illustrative examples of biological fluids as suitable sources from which to isolate cfDNA include, but are not limited to, amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, intraocular fluid, urine, saliva, mucus, and sweat.

[0111] In specific embodiments, the biological fluid is blood or plasma.

[0112] In certain embodiments, commercially available kits and other methods known to those skilled in the art can be used to isolate cfDNA directly from a patient's biological fluid or from a previously obtained and optionally stabilized biological sample, for example by freezing and / or adding an enzyme chelator (including but not limited to EDTA, EGTA, or other chelators specific for divalent cations).

[0113] (b) Generation of end-repaired cfDNA

[0114] In a specific embodiment, generating a cfDNA library includes end repair of separated cfDNA. The fragmented cfDNA is treated with an end repair enzyme to produce end repaired cfDNA with a blunt end, a 5' overhang or a 3' overhang. In some embodiments, the end repair enzyme can produce, for example. In some embodiments, the end repaired cfDNA contains a blunt end. In some embodiments, the end repaired cfDNA is processed to contain a blunt end. In some embodiments, the flat end of the end repaired cfDNA is further modified to contain a single base pair overhang. In some embodiments, the end repaired cfDNA containing a blunt end can be further processed to contain an adenine (A) / thymine (T) overhang. In some embodiments, the end repaired cfDNA containing a blunt end can be further processed to contain an adenine (A) / thymine (T) overhang as a single base pair overhang. In some embodiments, the end repaired cfDNA has a non-templated 3' overhang. In some embodiments, the end repaired cfDNA is processed to contain a 3' overhang. In some embodiments, the end-repaired cfDNA is treated with terminal transferase (TdT) to contain a 3' overhang. In some embodiments, a G tail can be added by TdT. In some embodiments, the end-repaired cfDNA is treated to contain an overhanging end by partial digestion using any known restriction enzyme (e.g., with Sau3A enzyme, etc.).

[0115] (c) Ligation of adapter molecules to end-repaired cfDNA

[0116] In a specific embodiment, generating a cfDNA library includes connecting one or more adapters to each end of the end-repaired cfDNA. The present invention relates in part to an adapter module designed to accommodate a large number of genome equivalents in a cfDNA library. The adapter module is configured to measure the number of genome equivalents present in the cfDNA library, and by extension, the sensitivity of the sequencing analysis used to identify sequence mutations.

[0117] As used herein, the term "adapter module" refers to a polynucleotide comprising at least five elements: (i) a first element comprising a PCR primer binding site for single primer library amplification; (ii) a second element comprising a read code of 5 nucleotides for uniquely identifying each sequencing read; (iii) a third element comprising a sample code of 3 nucleotides to identify different samples and enable sample multiplexing in a sequencing run; (iv) a fourth element comprising a 12-nucleotide anchor sequence that enables calibration of the correct base call in the sequencing read and serves as an anchor point for hybridization with a partner oligonucleotide; and (v) a fifth element comprising the two 3' terminal nucleotides ( Fig.17and Tables 12-16). The adapter module is hybridized with a partner oligonucleotide complementary to element 4 to form an adapter suitable for ligation to the end of cfDNA (optionally end-repaired blunt-ended cfDNA).

[0118] In a specific embodiment, the adapter module comprises one or more PCR primer sequences that are effective for connecting to the substrate, one or more read codes, one or more sample codes, one or more anchor sequences, and two or more 3' nucleotides. In other embodiments, the adapter module further comprises one or more sequencing primer binding sites.

[0119] In a specific embodiment, the adapter module comprises a first element comprising one or more PCR primer binding sequences for single primer amplification of a cfDNA library. In one embodiment, the PCR primer binding sequence is: about 12 to about 40 nucleotides, about 18 to about 40 nucleotides, about 20 to about 35 nucleotides, or about 20 to about 30 nucleotides. In another embodiment, the PCR primer binding sequence is: about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21 nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides or more.

[0120] In one embodiment, the PCR primer binding sequence is about 25 nucleotides.

[0121] In a specific embodiment, the adapter module includes a second element comprising one or more read coding sequences. As used herein, the term "read coding" refers to a polynucleotide used to identify a unique sequencing read. In one embodiment, the read coding is a random sequence of nucleotides. In one embodiment, the read coding is about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides or more nucleotides.

[0122] As a non-limiting example, a 5 nucleotide code consists of 256 possible unique sequences, where each code selected differs by 2 nucleotides from every other code in the set. This feature distinguishes unique and different reads from reads that appear unique due to sequencing errors in the coding region. In specific embodiments, codes that have been empirically determined to interfere with adaptor function due to specific sequence combinations can be excluded from use, for example, 7 of the 256 codes have an overrepresentation of G nucleotides and are excluded.

[0123] In other embodiments, each read encoding of 5, 6, 7, 8, 9, 10 or more nucleotides may differ from every other read encoding by 2, 3, 4, or 5 nucleotides.

[0124] In one embodiment, a read is encoded by about 5 nucleotides and differs from every other read by 2 nucleotides.

[0125] In a specific embodiment, the adapter module includes a third element comprising one or more sample encoding sequences. As used herein, the term "sample code" refers to a polynucleotide used to identify a sample. Sample codes are also useful in setting up multiplex sequencing reactions because each sample code is unique to that sample and can therefore be used to identify reads from a specific sample in a multiplex sequencing reaction.

[0126] In one embodiment, the sample encodes a sequence comprising about 1, about 2, about 3, about 4, or about 5 nucleotides or more. In another embodiment, each sample of 2, 3, 4, 5 or more nucleotides may differ from each other sample encoding 2, 3, 4, or 5 nucleotides.

[0127] In one embodiment, the sample code is about three nucleotides and differs from every other sample code used in other samples by 2 nucleotides.

[0128] In specific embodiments, the adapter module comprises a fourth element comprising one or more anchor sequences. As used herein, "anchor sequence" refers to a nucleotide sequence of at least 8 nucleotides, at least 10 nucleotides, at least 12 nucleotides, at least 14 nucleotides, or at least 16 nucleotides that hybridizes to a partner oligonucleotide and which comprises the following three properties: (1) each anchor sequence is part of a family of four anchor sequences that collectively represent each of the four possible DNA bases at each position within the stretch; this feature (balanced base representation) is used in specific embodiments to correct for correct base calls in sequencing reads; (2) each anchor sequence consists of only two of the four possible bases, and these are specifically selected to be either an equal number of A+C or an equal number of G+T; an anchor sequence formed of only two bases reduces the likelihood that the anchor sequence will participate in the formation of secondary structures that interfere with correct adapter function; and (3) because each anchor sequence consists of an equal number of A+C or G+T, each anchor sequence shares approximately the same melting temperature and duplex stability with each other anchor sequence in a set of four.

[0129] In a specific embodiment, the adapter module comprises a fifth element consisting of the two 3' terminal nucleotides of element 4. The two bases at the 3' end of each anchor were selected based on empirical determinations that showed that these two nucleotides are effective substrates for ligation to cfDNA. In a specific embodiment, element 5 comprises a sequence of dinucleotides selected from the following: AA, CC, TT, and GG. In a specific embodiment, element 5 does not comprise the dinucleotide combinations CG or TG, as the inventors have determined that these combinations are not effective ligation substrates.

[0130] In a specific embodiment, the connecting step includes connecting an adapter module to the end-repaired cfDNA to produce a "tagged" cfDNA library. In some embodiments, a single adapter module is used. In some embodiments, two, three, four, or five adapter modules are used. In some embodiments, an adapter module of the same sequence is connected to each end of the fragmented end-repaired DNA.

[0131] In one embodiment, a plurality of adaptor species are ligated to the end-repaired cfDNA library. Each of the plurality of adaptors may comprise one or more primer binding sites for amplifying the cfDNA library, one or more read encoding sequences, one or more sequences for multiplex analysis of samples, and one or more sequences for DNA sequencing.

[0132] The connection of one or more adapters involved in this article can be performed by methods known to those of ordinary skill in the art. In a specific embodiment, one or more adapters involved in this article are connected to the cfDNA of the end repair comprising a flat end. In certain embodiments, one or more adapters involved in this article are connected to the cfDNA of the end repair comprising complementary ends suitable for the connection method adopted. In certain embodiments, one or more adapters involved in this article are connected to the cfDNA of the end repair comprising a 3' overhang.

[0133] 2. Amplification of cfDNA Library

[0134] In a specific embodiment, the genetic analysis method involved herein includes amplifying a cfDNA library to produce a cfDNA clone library or a library of cfDNA clones. Each molecule of the cfDNA library includes an adapter connected to each end of the end-repaired cfDNA, and each adapter includes one or more PCR primer binding sites. In one embodiment, different adapters are connected to different ends of the end-repaired cfDNA.

[0135] In a preferred embodiment, the same adapter is attached to both ends of the cfDNA. The same adapter is attached to both ends of the end-repaired cfDNA, allowing PCR amplification with a single primer sequence. In a specific embodiment, standard PCR techniques will be used to drive amplification with a single primer sequence to amplify a portion of the adapter-attached cfDNA library. In one embodiment, the single primer sequence is about 25 nucleotides, optionally with an expected Tm of ≥55°C under standard ionic strength conditions.

[0136] In a specific embodiment, the picograms of the initial cfDNA library are amplified into micrograms of cfDNA clones, meaning a 10,000-fold amplification. The amount of amplified product can be measured (e.g., quantified on a Qubit 2.0 or Nanodrop instrument) using methods known in the art.

[0137] 3. Determine the number of genome equivalents

[0138] In various embodiments, the method for genetic analysis of cfDNA includes determining the number of genome equivalents in a cfDNA clone library. As used herein, the term "genome equivalent" refers to the number of genome copies in each library. The important challenge encountered by the compositions and methods involved herein is to achieve sufficient analytical sensitivity to detect and analyze rare genetic mutations or differences in genetic sequences. In order to determine the analytical sensitivity value based on a sample-by-sample basis, the number of different and distinguished sequences present in each sample is measured by measuring the number of genome equivalents present in the sequencing library. In order to establish sensitivity, the number of genome equivalents of each sample library must be measured.

[0139] The number of genome equivalents can be determined by qPCR analysis or by using bioinformatics-based counts after sequencing. qPCR measurements of genome equivalents are used as a QC step for cfDNA libraries during the processing of clinical samples. It establishes expectations for analytical sensitivity prior to sequence analysis and allows samples to be excluded from analysis if their corresponding cfDNA clone library lacks the required genome equivalent depth. Finally, bioinformatics-based counts of genome equivalents are also used to identify the genome equivalents of each given cfDNA clone library—and therefore analytical sensitivity and false-negative estimates.

[0140] Empirical qPCR analysis and statistical counting analysis should be well correlated. In cases where sequencing fails to reveal sequence depth in cfDNA clone libraries, reprocessing of cfDNA clone libraries and / or additional sequencing may be necessary.

[0141] In one embodiment, the genome equivalents in the cfDNA clone library are determined using quantitative PCR (qPCR) analysis. In a specific embodiment, a standard library of known concentrations is used to construct a standard curve, and the measured values ​​from the qPCR analysis are fitted to produce a standard curve, and the value of the genome equivalent is derived from the fitting. Unexpectedly, the inventors have found that qPCR "repeat-based" analysis, which includes a primer (e.g., a repeat sequence) that specifically hybridizes to a common sequence in the genome and another primer that binds to a primer binding site in an adapter, has measured an 8-fold increase in genome equivalents compared to a method using only adapter-specific primers (present at both ends of the cfDNA clone). By providing a more consistent library and library performance and a better alignment between qPCR estimates of genome equivalents and label equivalents of bioinformatic counts in sequencing runs.

[0142] Illustrative examples of repeats suitable for the repeat-based genomic equivalent analysis contemplated herein include, but are not limited to, short interspersed nuclear elements (SINEs) (e.g., Alu repeats), long interspersed nuclear elements (LINEs) (e.g., LINE1, LINE2, LINE3), microsatellite repeat elements (e.g., short tandem repeats (STRs), simple sequence repeats (SSRs)), and mammalian-range interspersed repeats (MIRs).

[0143] In one embodiment, the repeats are Alu repeats.

[0144] 4. Quantitative Genetic Analysis

[0145] In various embodiments, the genetic analysis method for cfDNA includes quantitative genetic analysis of one or more target genetic loci of cfDNA library clones. Quantitative genetic analysis includes one or more or all of the following steps: capturing cfDNA clones containing target genetic loci; amplifying the captured target genetic loci; sequencing the amplified captured target genetic loci; and bioinformatics analysis of the resulting sequence reads.

[0146] (a) Capturing target genetic loci

[0147] The present invention relates in part to designing capture probe modules to maintain the efficiency and reliability of larger probes, but to minimize the generation of non-informative sequences in cfDNA clone libraries. "Capture probe module" refers to a polynucleotide comprising a capture probe sequence and a tail sequence. In a specific embodiment, the capture probe module sequence or a portion thereof is used as a primer binding site for one or more sequencing primers.

[0148] In a specific embodiment, the capture probe module includes a capture probe. As used herein, a "capture probe" refers to a region that can hybridize with a specific DNA target region. Because the average size of cfDNA is about 150 to about 170 bp and is highly fragmented, the compositions and methods involved herein include using high-density and relatively short capture probes to explore the target DNA target region.

[0149] Of particular concern with the use of high density capture probes is that capture probes are typically designed using specific "sequence rules". For example, regions of redundant sequence or regions exhibiting extreme base composition deviations are typically excluded when designing capture probes. However, the inventors have discovered that the lack of flexibility in capture probe design rules does not substantially affect probe performance. In contrast, capture probes that are strictly selected through positional constraints provide on-target sequence information, exhibit minimal capture of off-target and unmappable reads, and produce uniform, useful on-target reads with only a few exceptions. In addition, the high redundancy near the probe spacing can fully compensate for the occasional poorly performing capture probe.

[0150] In a specific embodiment, the target region is targeted by multiple capture probes, wherein any two or more capture probes are designed to bind to a target region within 10 nucleotides of each other, within 15 nucleotides of each other, within 20 nucleotides of each other, within 25 nucleotides of each other, within 30 nucleotides of each other, within 35 nucleotides of each other, within 40 nucleotides of each other, within 45 nucleotides of each other, or within 50 nucleotides of each other or more, and all intermediate nucleotide lengths.

[0151] In one embodiment, the capture probe is about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, or about 45 nucleotides.

[0152] In one embodiment, the capture probe is about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 100 nucleotides. In another embodiment, the capture probe is about 100 nucleotides to about 500 nucleotides, about 200 nucleotides to about 500 nucleotides, about 300 nucleotides to about 500 nucleotides, or about 400 nucleotides to about 500 nucleotides, or any intermediate ranges thereof.

[0153] In specific embodiments, the capture probe is not 60 nucleotides.

[0154] In another embodiment, the capture probe is substantially smaller than 60 nucleotides, but hybridizes comparable, identical, or better than a 60 nucleotide capture probe targeted to the same DNA target region.

[0155] In a certain embodiment, the capture probe is 40 nucleotides.

[0156] In certain embodiments, the capture probe module includes a tail sequence. As used herein, the term "tail sequence" refers to a polynucleotide at the 5' end of the capture probe module, which in specific embodiments can be used as a primer binding site. In specific embodiments, the sequencing primer binds to the primer binding site in the tail region.

[0157] In specific embodiments, the tail sequence is about 5 to about 100 nucleotides, about 10 to about 100 nucleotides, about 5 to about 75 nucleotides, about 5 to about 50 nucleotides, about 5 to about 25 nucleotides, or about 5 to about 20 nucleotides. In certain embodiments, the third region is about 10 to about 50 nucleotides, about 15 to about 40 nucleotides, about 20 to about 30 nucleotides, or about 20 nucleotides, or any intermediate number of nucleotides.

[0158] In specific embodiments, the tail sequence is about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides.

[0159] In various embodiments, the capture probe module comprises a specific member of a binding pair to enable separation and / or purification of one or more capture fragments of a labeled and / or amplified cfDNA library hybridized with the capture probe. In specific embodiments, the capture probe module is conjugated to biotin or another suitable hapten (e.g., dinitrophenol, digoxin).

[0160] In various embodiments, the capture probe module hybridizes to the labeled and optionally amplified cfDNA library to form a complex. In some embodiments, the multifunctional capture probe module hybridizes substantially to a specific genomic target region in the cfDNA library.

[0161] Hybridization or hybridization conditions may include any reaction conditions in which two nucleotide sequences form a stable complex, for example, a labeled cfDNA library and a capture probe module form a stable labeled cfDNA library-capture probe module complex. Such reaction conditions are well known in the art, and those skilled in the art will appreciate that such conditions may be appropriately modified (e.g., lowering the annealing temperature with a shorter length of capture probe), and are within the scope of the present invention. Substantial hybridization may occur when the second region of the capture probe complex exhibits 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 85%, 80%, 75% or 70% sequence identity, homology or complementarity with the region of the labeled cfDNA library.

[0162] In specific embodiments, the capture probe is about 40 nucleotides and has an optimal annealing temperature of about 44°C to about 47°C.

[0163] In certain embodiments, the methods contemplated herein include separating the labeled cfDNA library-capture probe module complex. In specific embodiments, methods for separating DNA complexes are well known to those skilled in the art, and any method deemed suitable by those skilled in the art may be used together with the methods of the present invention (Ausubel et al., Current Protocols in Molecular Biology, 2007-2012). In specific embodiments, biotin-streptavidin separation techniques are used to separate the complexes.

[0164] In specific embodiments, it involves removing single-stranded 3'-ends from the isolated labeled cfDNA library-capture probe module complex. In certain embodiments, the method comprises enzymatically treating the isolated labeled DNA library-multifunctional capture probe module complex with a 3'-5' exonuclease to remove the single-stranded 3' end.

[0165] In certain other embodiments, the method comprises performing 5'-3' DNA polymerase extension of the multifunctional capture probe using the isolated labeled DNA library fragments as template.

[0166] In certain other embodiments, the methods include generating hybridized capture probe-isolated labeled cfDNA target molecules by the coordinated action of 5' FLAP endonuclease, DNA polymerization, and nick sealing by DNA ligase.

[0167] A variety of enzymes can be used to enzymatically treat the separated labeled cfDNA library-multifunctional capture probe module complex with a 3'-5' exonuclease. Exemplary examples of suitable enzymes that exhibit 3'-5' exonuclease activity that can be used in specific embodiments include, but are not limited to: T4 or exonucleases I, III, V (see also, Shevelev IV, Hübscher U., 3'5' exonucleases, "Nat Rev Mol Cell Biol. 3 (5): 364-76 (2002)). In specific embodiments, the enzyme having 3'-5' exonuclease activity is T4 polymerase. In specific embodiments, enzymes that exhibit 3'-5' exonuclease activity and are capable of extending primer templates can be used, including, for example, T4 or exonucleases I, III, V. (supra).

[0168] In some embodiments, the methods involved herein include sequencing and / or PCR of the complex treated with 3'-5' exonuclease enzymes discussed above and elsewhere herein. In a specific embodiment, the tail of the capture probe molecule is replicated to produce a hybrid nucleic acid molecule. In one embodiment, the hybrid nucleic acid molecule produced comprises a target region capable of hybridizing with the capture probe module and a complementary sequence to the tail sequence of the capture probe module.

[0169] In a specific embodiment, the genetic analysis includes: a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of cfDNA library clones to form one or more capture probe module-cfDNA library clone complexes; b) separating one or more capture probe module-cfDNA library clone complexes from a); c) treating one or more separated capture probe module-cfDNA library clone complexes from step b) with an enzyme; d) performing PCR on the enzyme-treated complexes from c), wherein the tail of the capture probe molecule is replicated to produce an amplified hybrid nucleic acid molecule, wherein the amplified hybrid nucleic acid molecule comprises a target sequence in the target genetic locus that is capable of hybridizing to a complementary sequence of the capture probe and the capture probe module tail sequence; and e) performing quantitative genetic analysis on the amplified hybrid nucleic acid molecules from d).

[0170] In a specific embodiment, a method for determining the copy number of a specific target genetic locus is provided, which includes: a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of cfDNA library clones to form one or more capture probe module-cfDNA library clone complexes; b) separating one or more capture probe module-cDNA library clone complexes from a); c) treating one or more separated capture probe module-cfDNA library clone complexes from step b) with an enzyme; d) performing PCR on the enzyme-treated complexes from c), wherein the tail of the capture probe molecule is replicated to produce an amplified hybrid nucleic acid molecule, wherein the amplified hybrid nucleic acid molecule comprises a target sequence in the target genetic locus that is capable of hybridizing to a complementary sequence of the capture probe and the capture probe module tail sequence; e) performing PCR amplification on the hybrid nucleic acid molecules amplified in d); and f) quantifying the PCR reaction in e), wherein the quantification allows determination of the copy number of a specific target region.

[0171] In one embodiment, the enzymatic treatment of step c) includes: using an enzyme with 3'-5' exonuclease activity to perform 3'-5' exonuclease enzymatic treatment on one or more capture probe module-cfDNA library clone complexes from b) to remove single-stranded 3' ends; generating one or more hybridized capture probe module-cfDNA library clone molecules through the synergistic action of 5'FLAP endonuclease, DNA polymerization and nick closure by DNA ligase; or using the cfDNA clone isolated in the complex as a template to perform 5'-3' DNA polymerase extension of the capture probe.

[0172] In one embodiment, the enzyme treatment of step c) comprises: performing 5'-3' DNA polymerase extension of the capture probe using the cfDNA clone isolated in the complex as a template.

[0173] In specific embodiments, any standard PCR reaction conditions well known to those skilled in the art can be used to carry out PCR. In certain embodiments, the PCR reaction in e) uses two kinds of PCR primers. In one embodiment, the PCR reaction in e) uses the first PCR primer that is hybridized with the repetition inside the target genetic locus. In specific embodiments, the PCR reaction in e) uses the second PCR primer that hybridizes with the hybrid nucleic acid molecule at the target genetic locus / tail junction. In certain embodiments, the PCR reaction in e) uses the first PCR primer that hybridizes with the target genetic locus and the second PCR primer that hybridizes with the hybrid nucleic acid molecule of amplification at the target genetic locus / tail junction. In specific embodiments, the second primer hybridizes with the target genetic locus / tail junction so that at least one or more nucleotides of the primer hybridize with the target genetic locus, and at least one or more nucleotides of the primer hybridize with the tail sequence.

[0174] In certain embodiments, the amplified hybrid nucleic acid molecules obtained from step e) are sequenced, and the sequence levels are aligned, i.e. aligned to each other, but not aligned to a reference sequence. In a specific embodiment, steps a) to e) are repeated one or more times with one or more capture probe modules. The capture probe modules can be identical or different, and are designed to target the cfDNA chain of the target genetic locus. In some embodiments, when the capture probes are different, they are hybridized at overlapping or adjacent target sequences in the target genetic locus in the cfDNA clone library of the label. In one embodiment, a high-density capture probe strategy is used, wherein multiple capture probes are hybridized with the target genetic locus, and wherein each of the multiple capture probes is hybridized with the target genetic locus inside any other capture probe of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200bp (the target genetic locus in the cfDNA clone library of the label is hybridized with any other capture probe), including all distances in between.

[0175] In some embodiments, the method can be performed using two capture probe modules for each target genetic locus, one of which hybridizes to the "Watson" strand (non-coding strand or template strand) upstream of the target region and the other hybridizes to the "Crick" strand (coding strand or non-template strand) downstream of the target region.

[0176] In specific embodiments, the methods involved herein can also be performed multiple times with any number of capture probe modules, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more capture probe modules per target genetic locus, hybridized with Watson strands or Crick strands in any combination and in any quantity. In some embodiments, the sequences obtained can be compared to each other to identify any difference in a plurality of differences.

[0177] In certain embodiments, one or more capture probe modules are used to interrogate multiple target genetic loci, e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 10000, 50000, 100000, 500000 or more, in a single reaction.

[0178] (b) Sequencing

[0179] In a specific embodiment, quantitative genetic analysis includes sequencing a plurality of hybrid nucleic acid molecules (as described elsewhere herein, as described above) to generate sufficient sequencing depth to obtain a plurality of unique sequencing reads. A unique read is defined as a single common read from a "family" of reads described below, and the read "family" all shares the same read code and sequence start point inside cfDNA. By grouping into families, each capture probe generates a set of unique reads extracted by a computer from the total reads. The unique reads of a given sample are then calculated as the average of all unique reads observed on a probe-by-probe basis. The case where there is an obvious copy number change is excluded from the data set used to calculate the average. Unique reads are important because each unique read must come from a unique cfDNA clone. Each unique read represents the input and analysis of the haploid equivalent of genomic DNA. The sum of unique reads is the sum of the haploid genomes analyzed. In turn, the number of genomes analyzed determines the sensitivity of the sequencing analysis. As a non-limiting example, if the average unique read number is 100 genome equivalents, the specific analysis has a sensitivity of being able to detect one mutation read or 1% in 100. Any observation less than this value is unreasonable.

[0180] In specific embodiments, quantitative genetic analysis involves multiplex sequencing of hybridized nucleic acid molecules derived from multiple samples.

[0181] In various embodiments, the quantitative genetic analysis comprises obtaining one or more or more labeled DNA library clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a target genetic locus and the second DNA sequence comprises a capture probe sequence; performing a paired end sequencing reaction on the one or more clones and obtaining one or more sequencing reads, or performing a sequencing reaction on the one or more clones and obtaining a single long sequencing read of greater than about 100, 200, 300, 400, 500 or more nucleotides, wherein the read is sufficient to identify the first DNA sequence and the second DNA sequence; and sorting or clustering the sequencing reads of the one or more clones according to the probe sequences of the sequencing reads.

[0182] (c) Bioinformatics analysis

[0183] In various embodiments, quantitative genetic analysis also includes bioinformatics analysis of sequencing reads. Bioinformatics analysis excludes any purely psychological analysis performed without a composition or method for sequencing. In certain embodiments, bioinformatics analysis includes, but is not limited to, sequence alignment, genome equivalent analysis, single nucleotide variation (SNV) analysis, gene copy number variation (CNV) analysis, and detection of genetic damage. In specific embodiments, bioinformatics analysis can be used to quantify the number of genome equivalents analyzed in a cfDNA clone library; for detecting the genetic state of a target genetic locus; for detecting genetic damage in a target genetic locus; and for measuring copy number fluctuations within a target genetic locus.

[0184] Sequence alignment can be performed between sequence reading and one or more human reference DNA sequences. In specific embodiments, sequencing alignment can be used to detect genetic damage in the target genetic locus, including but not limited to detecting nucleotide conversion or transversion, nucleotide insertion or deletion, genome rearrangement, copy number variation or gene fusion. Detection of genetic damage as a pathogenic indication or prognostic indication can be used for diagnosis, prognosis, treatment and / or monitoring of specific genetic conditions or diseases.

[0185] Also disclosed herein are methods for performing sequence alignment analysis without the need for alignment with a reference sequence, referred to herein as horizontal sequence analysis. Such analysis may be performed on any sequence produced by the methods disclosed herein or any other method. In a specific embodiment, the sequence analysis comprises performing a sequence alignment on the reads obtained by the methods disclosed herein.

[0186] In one embodiment, after sequencing, the genome equivalents in the cfDNA clone library are determined using bioinformatics-based counting. Each sequencing read is associated with a specific capture probe, and the read set assigned to each capture probe is parsed into groups. Within a group, the group of individual reads shares the same read encoding and the same DNA sequence start position inside the genome sequence. These individual reads are grouped into "families", and a single consensus representative of the family is transferred to a "unique read". All individual reads constituting the family are derived from a single connection event, and therefore they are "siblings" of the amplification source to each other. Each unique read is considered to be a unique connection event, and the sum of the unique reads is considered to be equal to the number of genome equivalents analyzed.

[0187] As the number of unique clones approaches the total number of possible sequence combinations, probability dictates that the same coding and start site combination will be created by independent events and that these independent events will not be appropriately grouped in a single family. The net result will be an underestimate of the number of genome equivalents analyzed, and rare mutant reads may be discarded as sequencing errors because they overlap with wild-type reads with the same identifier.

[0188] In a specific embodiment, in order to provide accurate analysis of the cfDNA clone library, the number of genome equivalents analyzed is about 1 / 10, about 1 / 12, about 1 / 14, about 1 / 16, about 1 / 18, about 1 / 20, about 1 / 25 or less of the number of possible unique clones. It should be understood that the above procedures are merely exemplary and not limiting.

[0189] In some embodiments, it may be desirable to increase the number of genome equivalents to be analyzed. To expand the depth of genome equivalents, at least two solutions are involved. The first solution is to use more than one adapter set per sample. By combining adapters, the total number of possible clones can be expanded exponentially, and therefore the comfortable limit of genome input can be expanded. The second solution is to expand the read encoding by 1, 2, 3, 4, or 5 or more bases. The number of possible read encodings that differ from every other read encoding by at least 2 bases is expanded to 4. (n-1) , where n is the number of bases within the read. Thus, in a non-limiting example, if the read is 5 nucleotides, then 4 (5-1) =256; therefore, including additional bases causes each additional base to expand the available repertoire by a factor of four.

[0190] In one embodiment, quantitative genetic analysis includes bioinformatic analysis of sequencing reads to identify rare single nucleotide variations (SNVs).

[0191] Next generation sequencing has an inherent error rate of about 0.02-0.02%, meaning that anywhere from 1 / 200 to 1 / 500 base calls are incorrect. In order to detect variants and other mutations that occur at frequencies below this frequency (e.g., at a frequency of 1 per 1000 sequences), it is necessary to call a molecular annotation strategy. As a non-limiting example, 5000 unique molecules are analyzed using target sequence capture technology, and a collection of 5000 unique reads will be generated at a sufficient sequencing depth of >50,000 reads, where each unique read belongs to a "family" of reads that all have the same read encoding. SNVs that occur within a family are candidates for rare variants. When the same variant is observed in more than one family, it becomes a very strong candidate for a rare variant present in the starting sample. In contrast, variants that occur occasionally within a family may be sequencing errors, and variants that occur in one and only one family are rare or are the result of base changes that occur in vitro (e.g., DNA base oxidation or PCR-introduction errors).

[0192] In one embodiment, the method of detecting SNVs comprises introducing 10 times more genome input (genomes or genome equivalents) as the desired target sensitivity of the analysis. In a non-limiting example, if the desired sensitivity is 2% (2 in 100), the experimental target is an input of 2000 genomes.

[0193] In specific embodiments, bioinformatic analysis of sequencing data is used to detect or identify SNVs associated with genetic status, condition or disease, genetic mosaicism, fetal testing, paternity testing, predicting response to drug treatment, diagnosing or monitoring medical conditions, microbiome analysis, pathogen screening, and monitoring organ transplantation.

[0194] In various embodiments, a method for copy number determination analysis is provided, comprising obtaining one or more or more clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a target genetic locus, and the second DNA sequence comprises a capture probe sequence. In a related embodiment, a paired end sequencing reaction is performed on one or more clones, and one or more sequencing reads are obtained. In another embodiment, a sequencing reaction is performed on one or more clones, wherein a single long sequencing read greater than about 100 nucleotides is obtained, wherein the reading is sufficient to identify the first DNA sequence and the second DNA sequence. The sequencing reads of one or more clones can be sorted or clustered according to the probe sequence of the sequencing read.

[0195] Copy number analysis includes, but is not limited to, analysis that examines the number of copies of a specific gene or mutation that occurs in a given genomic DNA sample, and may also include quantitative determination of the number of copies of a given gene or sequence differences in a given sample. In specific embodiments, copy number analysis is used to detect or identify gene amplifications associated with genetic status, condition or disease, fetal testing, genetic mosaicism, paternity testing, predicting response to drug therapy, diagnosing or monitoring medical conditions, microbiome analysis, pathogen screening, and monitoring organ transplantation.

[0196] In a specific embodiment, bioinformatics analysis of sequencing data is used to detect or identify one or more sequences or genetic damage in the target locus, including but not limited to: detecting nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy number changes, or gene fusions. Detection of genetic damage as a pathogenic or prognostic indicator can be used to diagnose, prognose, treat, and / or monitor specific genetic conditions or diseases. In one embodiment, genetic damage is associated with genetic status, condition or disease, fetal testing, genetic mosaicism, paternity testing, predicting response to drug therapy, diagnosing or monitoring medical conditions, microbiome analysis, pathogen screening, and monitoring organ transplantation.

[0197] D. Clinical Applications of Quantitative Genetic Analysis

[0198] In various embodiments, the invention relates to methods of detecting, identifying, prognosing, diagnosing or monitoring a condition or disease in a subject.

[0199] In a specific embodiment, a method for detecting, identifying, predicting, diagnosing or monitoring a genetic state, condition or disease in a subject comprises: performing quantitative genetic analysis on one or more target genetic loci in a cfDNA clone library to detect or identify changes in the sequence of the one or more target genetic loci.

[0200] In one embodiment, a method for detecting, identifying, predicting, diagnosing or monitoring a genetic state, condition or disease comprises: isolating or obtaining cfDNA from a biological sample of a subject; treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce a cfDNA clone library; determining the number of genomic equivalents in the cfDNA clone library; and performing quantitative genetic analysis on one or more target genetic loci in the cfDNA clone library to detect or identify sequence changes at the one or more target genetic loci.

[0201] In a specific embodiment, a method for detecting, identifying, predicting, diagnosing or monitoring a genetic state, or a genetic condition or disease comprises: isolating or obtaining cfDNA from a biological sample of a subject; treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce a cfDNA clone library; determining the number of genomic equivalents in the cfDNA clone library; and performing quantitative genetic analysis on one or more target genetic loci in the cfDNA clone library to detect or identify nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy number changes or gene fusions in the sequence at the one or more target genetic loci, wherein the genetic state, or genetic condition or disease is selected from: a genetic disease, genetic mosaicism, fetal testing, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome analysis, pathogen screening and organ transplant monitoring.

[0202] Exemplary genetic diseases that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to, cancer, Alzheimer's disease (APOE1), Charcot-Marie-Tooth disease, Leber hereditary optic neuropathy (LHON), Angelman syndrome (UBE3A, ubiquitin protein ligase E3A), Prader-Willi syndrome (region in chromosome 15), beta-thalassemia (HBB, beta-globin), Gaucher disease (type I) (GBA, glucocerebrosidase), cystic fibrosis (CFTR epithelial chloride channel), sickle cell disease (HBB, beta-globin), Tay–Sachs disease (HEXA, hexosaminidase A), phenylketonuria (PAH, phenylalanine hydrolase) , familial hypercholesterolemia (LDLR, low-density lipoprotein receptor), adult polycystic kidney disease (PKD1, polycystin), Huntington's disease (HDD, huntingtin), neurofibromatosis type I (NF1, NF1 tumor suppressor gene), myotonic dystrophy (DM, myotonia), tuberous sclerosis (TSC1, tuberin), achondroplasia (FGFR3, fibroblast growth factor receptor), fragile X syndrome (FMR1, RNA-binding protein), Duchenne muscular dystrophy (DMD, dystrophin), hemophilia A (F8C, blood coagulation factor VIII), Lesch-Nyhan syndrome (HPRT1, hypoxanthine guanine ribosyltransferase 1), and adrenoleukodystrophy (ABCD1).

[0203] Illustrative examples of cancers that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to: B cell cancer (e.g., multiple myeloma), melanoma, breast cancer, lung cancer (e.g., non-small cell lung cancer or NSCLC), bronchial cancer, colorectal cancer, prostate cancer, pancreatic cancer, gastric cancer, ovarian cancer, bladder cancer, brain cancer or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine cancer or endometrial cancer, oral cancer or pharyngeal cancer, liver cancer, kidney cancer, testicular cancer, bile duct cancer, small intestine cancer or appendix cancer, salivary gland cancer Cancer, thyroid cancer, adrenal cancer, osteosarcoma, chondrosarcoma, cancer of hematological tissues, adenocarcinoma, inflammatory myofibroblastic tumor, gastrointestinal stromal tumor (GIST), colon cancer, multiple myeloma (MM), myelodysplastic syndrome (MDS), myeloproliferative disorders (MPD), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), polycythemia vera, Hodgkin lymphoma, non-Hodgkin lymphoma (NH L), soft tissue sarcoma, fibrosarcoma, myxosarcoma, liposarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing sarcoma, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, bladder cancer, epithelial carcinoma, glioma, astrocytoma, neuroblastoma Tubulocytoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, follicular lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, hepatocellular carcinoma, thyroid cancer, gastric cancer, head and neck cancer, small cell carcinoma, essential thrombocythemia, unexplained myeloid metaplasia, hypereosinophilic syndrome, systemic mastocytosis, common eosinophilic syndrome, chronic eosinophilic leukemia, neuroendocrine carcinoma, carcinoid tumor, etc.

[0204] In one embodiment, the genetic lesions are lesions annotated in the COSMIC database (lesion and sequence data can be downloaded from cancer.sanger.ac.uk / cosmic / census) or lesions annotated in The Cancer Genome Atlas (lesion and sequence data can be downloaded from tcga-data.nci.nih.gov / tcga / tcgaDownload.jsp).

[0205] Illustrative examples of genes with one or more genetic lesions associated with cancer that can be detected, identified, predicted, diagnosed, or monitored using the compositions and methods contemplated herein include, but are not limited to: ABCB1, ABCC2, ABCC4, ABCG2, ABL1, ABL2, AKT1, AKT2, AKT3, ALDH4A1, ALK, APC, AR, ARAF, ARFRP1, ARID1A, ATM, ATR, AURKA, AURKB, BCL2, BCL2A1, BCL2L1, BCL2L2, BCL6, BRAF, BRCA1, BRCA2, Clorf144, CARD11, CBL, CCND1, CCND2 , CCND3, CCNE1, CDH1, CDH2, CDH20, CDH5, CDK4, CDK6, CDK8, CDKN2A, CDKN2B, CDKN2C, CEBPA, CHEK1, CHEK2, CRKL, CRLF2, CTNNB1, CYP1B1, CYP2C19, CYP 2C8, CYP2D6, CYP3A4, CYP3A5, DNMT3A, DOT1L, DPYD, EGFR, EPHA3, EPHA5, EPHA6, EPHA7, EPHB1, EPHB4, EPHB6, EPHX1, ERBB2, ERBB3, ERBB4, ERCC2, ERG, E SR1, ESR2, ETV1, ETV4, ETV5, ETV6, EWSR1, EZH2, FANCA, FBXW7, FCGR3A, FGFR1, FGFR2, FGFR3, FGFR4, FLT1, FLT3, FLT4, FOXP4, GATA1, GNA11, GNAQ, GNA S, GPR124, GSTP1, GUCY1A2, HOXA3, HRAS, HSP90AA1, IDH1, IDH2, IGF1R, IGF2R, IKBKE, IKZF1, INHBA, IRS2, ITPA, JAK1, JAK2, JAK3, JUN, KDR, KIT, KRAS, LRP1B, LRP2, LTK, MAN1B1, MAP2K1, MAP2K2, MAP2K4, MCL1, MDM2, MDM4, MEN1, MET, MITF, MLH1, MLL, MPL, MRE11A, MSH2, MSH6, MTHFR, MTOR, MUTYH, MYC, MY CL1, MYCN, NF1, NF2, NKX2-1, NOTCH1, NPM1, NQO1, NRAS, NRP2, NTRK1, NTRK3, PAK3, PAX5, PDGFRA, PDGFRB, PIK3CA, PIK3R1, PKHD1, PLCG1, PRKDC, PTCH1,PTEN, PTPN11, PTPRD, RAF1, RARA, RB1, RET, RICTOR, RPTOR, RUNX1, SLC19A1, SLC22A2, SLCO1B3, SMAD2, SMAD3, SMAD4, SMARCA4, SMARCB1, SMO, SOD2 , SOX10, SOX2, SRC, STK11, SULT1A1, TBX22, TET2, TGFBR2, TMPRSS2, TNFRSF14, TOP1, TP53, TPMT, TSC1, TSC2, TYMS, UGT1A1, UMPS, USP9X, VHL and WT1. ,

[0206] In specific embodiments, the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number variation, or a gene fusion.

[0207] In one embodiment, the genetic lesion is a gene fusion that fuses the 3' coding region of the ALK gene to another gene.

[0208] In one embodiment, the genetic lesion is a genetic fusion fusing the 3' coding region of the ALK gene to the EML4 gene.

[0209] Illustrative examples of conditions suitable for fetal testing that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to: Down syndrome (trisomy 21), Edwards syndrome (trisomy 18), Patau syndrome (trisomy 13), Klinefelter syndrome (XXY), trisomy X, XYY syndrome, trisomy 8, trisomy 16, Turner syndrome (XO), Robertsonian translocation, DiGeorge syndrome and Wolf-Hirschhorn syndrome.

[0210] Illustrative examples of alleles suitable for paternity testing that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to, 16 or more of the following genes: D20S1082, D6S474, D12ATA63, D22S1045, D10S1248, D1S1677, D11S4463, D4S2364, D9S1122, D2S1 776, D10S1425, D3S3053, D5S2500, D1S1627, D3S4529, D2S441, D17S974, D6S1017, D4S2408, D9S2157, Amelogenin, D17S1301, D1GATA113, D18S853, D20S482, and D14S1434.

[0211] Illustrative examples of genes suitable for predicting a response to a drug treatment that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to, one or more of the following genes: ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), ACE (angiotensin I converting enzyme), ADH1A (alcohol dehydrogenase 1A (class I), alpha polypeptide), ADH1B (alcohol dehydrogenase IB (class I), beta polypeptide), ADH1C (alcohol dehydrogenase 1C (class I), gamma polypeptide), ADRB1 (adrenaline, beta-1-receptor), ADRB2 (adrenaline, beta-2-receptor, surface), AHR (aryl hydrocarbon receptor), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), ALOX5 (arachidonic acid 5-lipoxygenase), BRCA1 (breast cancer 1, early onset), COMT (catechol-O-methyltransferase), CYP2A6 (cytochrome P450, family 2, subfamily A, polypeptide 6), CYP2B6 (cytochrome P450, family 2, subfamily A, polypeptide 6), CYP2C9 (cytochrome P450, family 2, subfamily C, polypeptide 9), CYP2C19 (cytochrome P450, family 2, subfamily C, polypeptide 19), CYP2D6 (cytochrome P450, family 2, subfamily D, polypeptide 6), CYP2J2 (cytochrome P450, family 2, subfamily J, polypeptide 2), CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4), CYP P3A5 (cytochrome P450, family 3, subfamily A, polypeptide 5), DPYD (dihydropyrimidine dehydrogenase), DRD2 (dopamine receptor D2), F5 (coagulation factor V), GSTP1 (glutathione S-transferase pi), HMGCR (3-hydroxy-3-methylglutaryl coenzyme A reductase), KCNH2 (potassium voltage-gated channel, subfamily H (Eag-related), member 2), KCNJ11 (potassium inward rectifier channel, subfamily J, member 11), MTHFR (5,10-methylenetetrahydrofolate reductase (NADPH)), NQO1 (NAD(P)H dehydrogenase, quinone 1), P2RY1 (purinergic receptor P2Y, G-protein coupled, 1), P2RY12 (purinergic receptor P2Y, G-protein coupled, 12), PTGIS (prostaglandin I2 (prostacyclin) synthase), SCN5A (sodium channel, voltage-gated, V-type, alpha (long QT syndrome 3)), SLC19A1 (solute carrier family 19 (folate transporter), member 1 ), SLCO1B1 (solute carrier organic anion transporter family, member 1B1), SULT1A1 (sulfotransferase family, cytosolic, 1A, phenol preference, member 1), TPMT (thiopurine S-methyltransferase), TYMS (thymidylate synthase), UGT1A1 (UDP glucuronosyltransferase 1 family, polypeptide A1), VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor), VKORC1 (vitamin K epoxide reductase complex, subunit 1). ,

[0212] Illustrative examples of medical conditions that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include, but are not limited to, stroke, transient ischemic attack, traumatic brain injury, heart disease, myocardial infarction, angina, atherosclerosis and hypertension.

[0213] Illustrative examples of pathogens that can be screened using the compositions and methods contemplated herein include, but are not limited to, bacteria, fungi, and viruses.

[0214] Illustrative examples of bacterial species that can be screened using the compositions and methods contemplated herein include, but are not limited to, Mycobacterium, Pneumococcus, Escherichia, Campylobacter, Corynebacterium, Clostridium, Streptococcus, Staphylococcus, Pseudomonas, Shigella, Treponema, or Salmonella.

[0215] Illustrative examples of fungal species that can be screened using the compositions and methods contemplated herein include, but are not limited to, Aspergillus, Blastomyces, Candida, Coccicioides spp., Cryptococcus, Dermatophytes, Trichophyton, Trichophyton, Microsporum, Fusarium, Histoplasma, Mucoromycotinaspp., Pneumocystis, Sporothrix, Exserophilum spp., or Cladosporium.

[0216] Illustrative examples of viruses that can be screened using the compositions and methods contemplated herein include, but are not limited to: influenza A (e.g., H1N1, H1N2, H3N2, and H5N1 (avian influenza)), influenza B, influenza C, hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, rotavirus, any of the Norwalk virus group, enteroadenovirus, parvovirus, dengue virus, monkeypox, monosense virus, Lyssavirus (e.g., rabies virus, rags rhabdovirus, mokla virus, duwenhage virus, European bat virus 1 & 2, and Australian bat virus), short fever virus, Vesicular viruses, vesicular stomatitis virus (VSV), herpes viruses (such as herpes simplex virus types 1 and 2, varicella zoster, cytomegalovirus, Epstein-Barr virus (EBV), human herpesvirus (HHV), human herpesvirus types 6 and 8), Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), foamy virus, Freund's murine leukemia virus, mouse stem cell virus (MSCV), and Rous sarcoma virus ( RSV), HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2), visna-maedi virus (VMV), caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), and simian immunodeficiency virus (SIV), papillomaviruses, murine gammaherpesviruses, arenaviruses (such as Argentine hemorrhagic fever virus, Bolivian hemorrhagic fever virus, Sabia-related hemorrhagic fever virus, Venezuelan hemorrhagic fever virus, Lassa fever virus, Machupo virus), lymphocytic choriomeningitis virus (LCMV), Bunyaviridae (e.g., Crimean-Congo hemorrhagic fever virus, Hantavirus, virus causing hemorrhagic fever with renal syndrome, Rift Valley fever virus), Filoviridae (filoviruses) including Ebola and Marburg hemorrhagic fevers, Flaviviridae and Paramyxoviridae (e.g., Hendra and Nipah viruses) including Kyoto Forest disease virus, Omsk hemorrhagic fever virus, tick-borne encephalitis viruses, variola major and minor (smallpox), alphaviruses (e.g., Venezuelan equine encephalitis virus, Eastern equine encephalitis virus, Western equine encephalitis virus), SARS-related coronavirus (SARS-CoV), West Nile virus, and any encephalitis virus.

[0217] Illustrative examples of genes suitable for monitoring organ transplantation in a transplant recipient that can be detected, identified, predicted, diagnosed, or monitored using the compositions and methods contemplated herein include, but are not limited to, one or more of the following genes: HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DP, and HLA-DQ.

[0218] In specific embodiments, bioinformatics analysis is used to quantify the number of genomic equivalents analyzed in a cfDNA clone library; detect genetic variants in a target genetic locus; detect mutations within a target genetic locus; detect genetic fusions within a target genetic locus; or measure copy number fluctuations within a target genetic locus.

[0219] E. Companion Diagnostics

[0220] In various embodiments, a companion diagnostic for a genetic disease is provided, comprising: isolating or obtaining cfDNA from a biological sample of a subject; treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; ligating one or more adapters to each end of the end-repaired cfDNA to produce a cfDNA library; amplifying the cfDNA library to produce a cfDNA clone library; determining the number of genomic equivalents in the cfDNA clone library; and performing quantitative genetic analysis of one or more biomarkers associated with the genetic disease in the cfDNA clone library, wherein detection or failure to detect at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disease.

[0221] As used herein, the term "companion diagnostic" refers to a diagnostic test associated with a specific anti-cancer therapy. In a specific embodiment, the diagnostic method comprises detecting genetic damage in a biomarker associated with a biological sample, thereby allowing rapid identification of patients who should be treated with an anti-cancer therapy.

[0222] Anticancer treatments include, but are not limited to: surgery, radiation, chemotherapy, anticancer drugs, and immunomodulators.

[0223] Illustrative examples of anticancer drugs include, but are not limited to, alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN TM); alkyl sulfonates, such as busulfan, improsulfan and piposulfan; aziridines, such as benzodopa, carboquinone, metodepa and uredepa; ethyleneimines and methylmelamines including hexamethylmelamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trihydroxymethylmelamine; nitrogen mustards, such as chlorambucil, naphthyl nitrogen mustard, chlorphosphamide, estramustine, ifosfamide, dichloromethyl diethylamine, oxychloride nitrogen mustard, melphalan, nebiquinone, phenylmustard, phenylmustard, trofosamide, uracil nitrogen mustard; nitrosoureas, such as urea mustard, chlorozotocin, fotemustine, cyclohexylnitrosourea, pyrimidine nitrosourea, remoxazole Stins; antibiotics, such as aclarubicin, dactinomycin, anthramycin, azaserine, bleomycin, actinomycin C, calicheamicin, carabicin, carminomycin, carmomycin, chromomycin, dactinomycin, daunorubicin, detoxibicin, 6-diazo-5-oxo-L-norleucine, doxorubicin and its pegylated preparations, epirubicin, esorubicin, demethoxydaunorubicin, mexiromycin, mitomycin, mycophenolic acid, nogamycin, oliveromycins, peplomycin, porfiromycin, puromycin, triferon-doxorubicin, rhodorubicin, streptozotocin, streptozotocin, tuberculocidin , ubenimex, netastatin, doxycycline; antimetabolites, such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs, such as dimethoate, methotrexate, pteropterin, trimetrexate; purine analogs, such as fludarabine, 6-mercaptopurine, thioguanine, thioguanine; pyrimidine analogs, such as cyclocytidine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens, such as caprotestosterone, drostanolone propionate, cyclothiostanolol, melastane, testolactone; antiadrenal drugs, such as aminoglutethimide, mitotane, trilostane (tri lostane; folic acid supplements such as folinic acid; aceglucuronide; aldophosphamide glycoside; aminolevulinic acid; amacrine; bestrabucil; bisantrene; edatrexate; defosfamide; colcemid; diazocone; elformithine; elliptonium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoxantrone; mopidarol; nitracrine; pentostatin; methamine mustard; pirarubicin; podophyllic acid; 2-ethylhydrazide; methylprocarbazine; razoxane; sizofiran; helical germanium; tricosporic acid; triazoquinone; 2,2',2"-trichlorotriethylamine; ethyl carbamate; vindesine; dacarbazine; mannitol mustard; dibromomannitol; dibromodulanol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, such as paclitaxel ( Bristol-Myers Squibb Oncology, Princeton, NJ) and docetaxel ( Rhne-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs, such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; mitoxantrone hydrochloride (novantrone); teniposide; aminopterin; xeloda; ibandronate; CPT-11; topoisomerase inhibitor RFS2000; difluoromethylornithine (DMFO); retinoic acid derivatives, such as targretin TM (Bexarotene), Panretin TM (Alitretinoin); ONTAK TM (denileukin-toxin conjugate); esperamicin; capecitabine; and any pharmaceutically acceptable salts, acids or derivatives thereof. The definition also includes antihormonal agents used to modulate or inhibit hormonal effects on cancer, such as antiestrogens, including, for example, tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, troxifene, keoxifene, LY117018, onapristone and toremifene (Fareston); and antiandrogens, such as flutamide, nilutamide, bicalutamide, leuprolide and goserelin; and any pharmaceutically acceptable salts, acids or derivatives thereof.

[0224] Illustrative examples of immunomodulators include, but are not limited to, cyclosporin, tacrolimus, treperolimus, pimecrolimus, sirolimus, everolimus, rafilimus, laquinimod, and imiquimod, and analogs, derivatives, salts, ions, and complexes thereof.

[0225] All publications, patent applications, and issued patents cited in this specification are herein incorporated by reference as if each individual publication, patent application, or issued patent was specifically and individually indicated to be incorporated by reference.

[0226] Although the foregoing invention has been described in considerable detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art, based on the teachings of the present invention, that certain changes and modifications may be made without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not limitation. One of ordinary skill in the art will readily recognize that various non-critical parameters may be changed or modified to produce substantially similar results.

[0227] This application also relates to the following implementation schemes:

[0228] Embodiment 1. A method for genetic analysis of cell-free DNA (cfDNA), comprising:

[0229] (a) treating cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA;

[0230] (b) ligating one or more adaptors to each end of the end-repaired cfDNA to generate a cfDNA library;

[0231] (c) amplifying the cfDNA library to generate cfDNA library clones;

[0232] (d) determining the number of genome equivalents in the cfDNA clone library;

[0233] (e) performing quantitative genetic analysis on one or more target genetic loci in the cfDNA library clones.

[0234] Embodiment 2. A method as described in Embodiment 1, which also includes isolating cfDNA from a biological sample of the subject.

[0235] Embodiment 3. A method as described in embodiment 1 or 2, wherein the cfDNA is isolated from a biological sample, and the biological sample is selected from: amniotic fluid, blood, plasma, serum, semen, lymph fluid, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0236] Embodiment 4. A method as described in any of Embodiments 1-3, wherein the one or more linkers comprise multiple linker species.

[0237] Embodiment 5. A method as described in any of Embodiments 1-4, wherein the one or more adaptors each comprise a primer binding site for amplifying the cfDNA library.

[0238] Embodiment 6. A method as described in any of Embodiments 1-5, wherein the one or more linkers each comprise one or more unique read codes.

[0239] Embodiment 7. A method as described in any of Embodiments 1-6, wherein the one or more adapters each comprise one or more sample codes for multiplex analysis of samples.

[0240] Embodiment 8. A method as described in any of Embodiments 1-6, wherein the one or more adaptors each comprise one or more sequences for DNA sequencing.

[0241] Embodiment 9. A method as described in any of Embodiments 1-8, wherein the cfDNA clone library is subjected to qPCR, and the qPCR measurement results are compared with standards of known genome equivalents to determine the genome equivalent of the cfDNA clone library.

[0242] Embodiment 10. A method as described in embodiment 9, wherein the qPCR is performed using a primer that binds to an Alu sequence and a primer that binds to a sequence in an adaptor.

[0243] Embodiment 11. A method as described in any of Embodiments 1-10, wherein the quantitative genetic analysis is performed on multiple genetic loci in the cfDNA library clones.

[0244] Embodiment 12. A method as described in any of Embodiments 1-11, wherein the quantitative genetic analysis is performed on multiple genetic loci in multiple cfDNA clone libraries.

[0245] Embodiment 13. A method as described in any of Embodiments 1-12, wherein the quantitative genetic analysis comprises hybridizing one or more capture probes to the target genetic locus to form a capture probe-cfDNA clonal complex.

[0246] Embodiment 14. A method as described in Embodiment 13, wherein the quantitative genetic analysis includes isolating the capture probe-cfDNA clonal complex.

[0247] Embodiment 15. A method as described in Embodiment 14, wherein the quantitative genetic analysis includes amplifying the cfDNA clone sequence in the isolated hybridized capture probe-cfDNA clone complex.

[0248] Embodiment 16. A method as described in any of embodiments 1-15, wherein the quantitative genetic analysis comprises DNA sequencing to generate multiple sequencing reads.

[0249] Embodiment 17. A method as described in Embodiment 16, which also includes bioinformatics analysis of the multiple sequencing reads.

[0250] Embodiment 18. The method of any one of embodiments 1-17, wherein bioinformatics analysis is used:

[0251] (a) to quantify the number of genome equivalents analyzed in the cfDNA clone library;

[0252] (b) to detect genetic variants in a target genetic locus;

[0253] (c) to detect mutations within a target genetic locus;

[0254] (d) to detect genetic fusions within a target genetic locus; and

[0255] (e) To measure copy number fluctuations within a target genetic locus.

[0256] Embodiment 19. The method of any one of embodiments 2-18, wherein the subject does not suffer from a genetic disease.

[0257] Embodiment 20. The method of any one of embodiments 2-18, wherein the subject has not been diagnosed with a genetic disease.

[0258] Embodiment 21. The method of any one of embodiments 2-18, wherein the subject has been diagnosed with a genetic disease.

[0259] Embodiment 22. A method as described in embodiment 21, wherein the quantitative genetic analysis is used to identify or detect one or more genetic lesions that cause or are associated with the genetic disease.

[0260] Embodiment 23. A method as described in embodiment 22, wherein the genetic damage comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change, or a gene fusion.

[0261] Embodiment 24. The method of embodiment 22, wherein the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0262] Embodiment 25. The method of embodiment 24, wherein the 3' coding region of the ALK gene is fused to the EML4 gene.

[0263] Embodiment 26. A method as described in any of Embodiments 22-25, wherein the genetic disease is cancer.

[0264] Embodiment 27. The method of any one of Embodiments 2-18, wherein the subject is pregnant.

[0265] Embodiment 28. A method as described in Embodiment 27, wherein the quantitative genetic analysis is used to identify or detect one or more genetic variants or genetic damage at one or more target genetic loci in fetal cfDNA.

[0266] Embodiment 29. The method of any one of Embodiments 2-18, wherein the subject is a transplant recipient.

[0267] Embodiment 30. A method as described in Embodiment 27, wherein the quantitative genetic analysis is used to identify or detect donor cfDNA in the subject.

[0268] Embodiment 31. A method for predicting, diagnosing or monitoring a genetic disease in a subject, comprising:

[0269] (a) isolating or obtaining cfDNA from a biological sample of a subject;

[0270] (b) treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA;

[0271] (c) ligating one or more adaptors to each end of the end-repaired cfDNA to generate a cfDNA library;

[0272] (d) amplifying the cfDNA library to generate a cfDNA clone library;

[0273] (e) determining the number of genome equivalents in the cfDNA clone library; and

[0274] (f) performing a quantitative genetic analysis on one or more target genetic loci associated with the genetic disease in the cfDNA clone library, wherein identification or detection of one or more genetic lesions in the one or more target genetic loci predicts the genetic disease, diagnoses the genetic disease, or monitors the progression of the genetic disease.

[0275] Embodiment 32. A method as described in Embodiment 29, wherein the cfDNA is isolated from a biological sample, and the biological sample is selected from: amniotic fluid, blood, plasma, serum, semen, lymph fluid, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0276] Embodiment 33. A method as described in embodiment 29, wherein the genetic damage comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change or a gene fusion.

[0277] Embodiment 34. The method of embodiment 31, wherein the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0278] Embodiment 35. The method of embodiment 32, wherein the 3' coding region of the ALK gene is fused to the EML4 gene.

[0279] Embodiment 36. A method as described in any of Embodiments 29-32, wherein the genetic disease is cancer.

[0280] Embodiment 37. A companion diagnostic method for a genetic disease, comprising:

[0281] (a) isolating or obtaining cfDNA from a biological sample of a subject;

[0282] (b) treating the cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA;

[0283] (c) ligating one or more adaptors to each end of the end-repaired cfDNA to generate a cfDNA library;

[0284] (d) amplifying the cfDNA library to generate a cfDNA clone library;

[0285] (e) determining the number of genome equivalents in the cfDNA clone library; and

[0286] (f) performing a quantitative genetic analysis of one or more biomarkers associated with the genetic disease in the cfDNA clone library, wherein detection or non-detection of at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disease.

[0287] Embodiment 38. A method as described in embodiment 35, wherein the cfDNA is isolated from a biological sample, and the biological sample is selected from: amniotic fluid, blood, plasma, serum, semen, lymph fluid, cerebrospinal fluid, intraocular fluid, urine, saliva, feces, mucus and sweat.

[0288] Embodiment 39. The method of embodiment 35, wherein the biomarker is genetic damage.

[0289] Embodiment 40. A method as described in embodiment 37, wherein the genetic damage comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a copy number change, or a gene fusion.

[0290] Embodiment 41. The method of Embodiment 37, wherein the genetic lesion comprises a genomic rearrangement that fuses the 3' coding region of the ALK gene to another gene.

[0291] Embodiment 42. The method of embodiment 39, wherein the 3' coding region of the ALK gene is fused to the EML4 gene.

[0292] Embodiment 43. A method as described in any of Embodiments 35-40, wherein the genetic disease is cancer. Example

[0293] Example 1

[0294] Accurately detect rare mutations using target capture technology

[0295] Purpose

[0296] The goal of this experiment was to provide a direct proof-of-principle demonstration of the detection of rare variants using target capture technology.

[0297] background

[0298] Target capture technology provides quantitative, sequence-based genetic analysis of nucleic acids and can be used to perform combined mutation and copy number analysis of drug metabolism genes. The inventors used target capture technology and subsequence genetic analysis to detect rare sequence variants.

[0299] Genomic DNA input plays a central role in rare variant detection, but quantification and control of genomic input places limits on the estimated sensitivity of rare variant analysis. The inventors used genomic qPCR analysis to estimate genomic input.

[0300] One experimental goal for rare variant analysis is to introduce 10-fold more genomic input as the target sensitivity of the analysis. In other words, to measure a variant with 1% sensitivity (1 / 100), the experimental goal is to input 1000 genomes. Downstream of sequencing, bioinformatics analysis reveals the number of unique reads, and this is of the quality required as an orthogonal and more direct measure of genomic input.

[0301] Summarize

[0302] A cell line with known SNVs (ZR75-30) was mixed with a germline DNA sample (NA12878) ranging from 1 to 1 to 1000 dilution series. Target regions corresponding to known sequence differences were retrieved and sequenced using target sequence capture technology. Sequence variants occurring at a frequency of less than 1 per 1000 sequences were detected.

[0303] method

[0304] Capture probe

[0305] The table below shows the set of 62 capture probes used in this experiment.

[0306] Table 1. 60-base probe sequences used in the hybrid proof-of-concept study

[0307]

[0308]

[0309]

[0310] Capture probe modules from a stock plate were pooled, combined with partner oligo #138 (SEQ ID NO:63) (GTGAAAACCAGGATCAACTCCCGTGCCAGTCACAT / 3BioTEG / ), and diluted to a final working concentration of 1 nM.

[0311] Genomic samples

[0312] Commercially purchased genomic DNA from germline sample NA12878 and cell line ZR75-30 was fragmented to a target fragment size of 500 bp at a concentration of 10-20 ng / μl on a Covaris ultrasonic instrument. DNA was purified using DNA purification beads at a concentration of 1:1 and end repair was performed using the New England Biolabs (NEB) Quick blunt kit at a final concentration of 15-30 ng / μL. Germline and cell line DNA were mixed at a ratio of 1:1, 10:1, 100:1 and 1000:1, respectively. Libraries were constructed, purified and quantified. Sample encoding, library quantification and input for library construction are shown in Table 2.

[0313] Table 2. Adapters used as input and genomic analysis of libraries

[0314] mix Adaptor code Genome / μl #Expected genome μL entering PCR 1:1 NNNNNNNNCATGGCCGCAGG(SEQ ID NO:64) 55 200 4 10:1 NNNNNNNNATCTTAGTGGCA(SEQ ID NO:65) 66 200 3 100:1 NNNNNNNNCGGAACTCGGAG(SEQ ID NO:66) 64 1000 16 1000:1 NNNNNNNNGACTCCGATCCC(SEQ ID NO:67) 77 10000 130

[0315] The genomic libraries were combined, denatured, combined with probes, hybridized and washed. The washed capture probe-labeled genomic library complex was amplified with forward and reverse full-length primers, purified and screened for fragments of 225-600 bp in size on a Pippin-prep instrument. Finally, the captured material was sequenced using a 150-V3 Illumina sequencing kit.

[0316] result

[0317] Paired capture probes targeting BRAF (in both loci), MYCN, and CDH1 were used to analyze SNVs in these loci. The results are shown in Table 3.

[0318] Table 3. Bioinformatics summary

[0319]

[0320]

[0321] Column 3 shows the total number of unique read counts, which in turn provides a definition of the sensitivity of the analysis. The estimated and measured genomic inputs are well within the range of each other. The light shaded boxes highlight SNVs where the cell line sequence differs from the germline sequence. In the absence of unique read filtering (shown in the right portion of the table), random base changes occur at these four selected positions with measurable non-zero frequencies. Figure 1 By requiring variation within unique read families, true signal can be sorted from error-prone noise. Figure 2 .

[0322] Example 2

[0323] Effective in highly fragmented G New probe design for comprehensive sequencing of target DNA regions

[0324] Purpose

[0325] The goal of these experiments was to develop an analytical system to reliably and reproducibly interrogate circulating DNA.

[0326] background

[0327] Analysis of circulating DNA from body fluids represents an exciting but unrealized opportunity in molecular diagnostics. Genomic DNA is highly intact. Literature suggests that the average size of circulating DNA is about 150 bp, which correlates well with the size of DNA wrapped around a single nucleosome histone complex.

[0328] Summarize

[0329] The technical parameters of the target sequence capture technology involved in this article are designed to accommodate highly fragmented DNA and maintain the ability to generate comprehensive sequence coverage of the targeted DNA. The capture probe density is increased and the length of the capture probe sequence is reduced from 60 nucleotides to 40 nucleotides to minimize the generation of non-informative sequences in the clone library. The human genome is scattered with repetitive sequences and drastic changes in base composition, therefore, it is not allowed to achieve higher capture probe density and the suitability of shorter capture probes, but empirical verification of new analysis is required.

[0330] Conditions were established in which shorter 40mer capture probe sequences demonstrated reliable and robust assay performance. In the first set of experiments, the assay was used to interrogate two large regions—the coding region of the tumor suppressor gene TP53 and the long, contiguous intron 19 of the ALK oncogene, both of which are central to cancer diagnostics. In the second set of experiments, several high-density paired capture probes with shorter 40-nucleotide capture probe sequences were used to interrogate known SNVs located in the NCI-H69 cell line.

[0331] The new high density of shorter capture probes was successfully used to interrogate short fragmented DNA, and the results showed that the assay design is well suited for sequencing circulating DNA found in the plasma fraction of blood.

[0332] Methods - Modified 40mer capture probe

[0333] The capture probe sequences used to empirically validate the performance of the 40mer capture probes are shown in Table 4.

[0334]

[0335]

[0336]

[0337]

[0338]

[0339] The performance of 40mer capture probe is compared with that of 60mer capture probe. By removing 20 nucleotides from the 5' end of 60mer capture probe, 40mer capture probe is designed from 60mer capture probe. Although the 3' end of two capture probe groups is identical with respect to the sequence copied from the captured genomic clone, the probe sequence signal (reading 2 of paired end reading) is different between 60mer and 40mer probe groups. This design is useful because it allows multiplex analysis of capture probe during sequencing, and analyzes its performance subsequently during the bioinformatics overlap analysis in downstream.

[0340] Genomic samples

[0341] A pool of 12 genomic DNA samples (selected from the Coriell human panel of 112 human genomic DNA) was used as target DNA. The 12 samples were divided into four groups of four samples each, as detailed in Table 5.

[0342]

[0343] Hybridization, washing and sequencing

[0344] Six different hybridization conditions were used for hybridization of 60mer probes and 40mer probes to genomic target DNA:

[0345] 1) Wash the 60mer probe at 50°C.

[0346] 2) Wash the 40mer probe at 50°C.

[0347] 3) Wash the 60mer probe at 47°C.

[0348] 4) Wash the 40mer probe at 47°C.

[0349] 5) Wash the 60mer probe at 44°C.

[0350] 6) Wash the 40mer probe at 44°C.

[0351] For each experiment, the capture probe oligonucleotide was combined with the partner oligonucleotide; the final concentration of the dual capture probes was 1 nM for each capture probe.

[0352] In a total volume of 40 μl, each hybridization reaction has genomic library. Each sample was heated to 98°C for 2 minutes and then cooled on ice. 20 μl of capture probe and 90 μl of hybridization buffer were added, and the hybridization mixture was incubated at 80°C and reduced by 1°C every 48 minutes until 50°C for 24 hours. The complex was bound to 20 μl of streptavidin beads in a total volume of 1 mL of TEzero buffer + 0.05% Tween20 (TT). The beads were washed 3 times, each time with 200 μl of TT for 5 minutes, and washed in wash buffer at 45°C for 5 minutes. The beads were then washed with TEzero and each reaction was resuspended in 20 μl of TEzero. The complex was then PCR amplified using a full-length forward primer (ACA2_FLFP; SEQ ID NO: 152; AATGATACGGCGACCACCGAGATCTACACGTCATGCAGGACCAGAGAATTCGAATACA) and a full-length reverse primer (CAC3_FLRP; SEQ ID NO: 153; CAAGCAGAAGACGGCATACGAGATGTGACTGGCACGGGAGTTGATCCTGGTTTTCAC).

[0353] After amplification and purification, the resulting product masses were measured, and equal masses were pooled for sequencing.

[0354] Results - Modified 40mer Primer

[0355] exist Figure 3 The capture probe performance as a function of length and washing temperature is shown in the graph. In general, the 40mer capture probe and the 60mer capture probe perform at 44°C and 47°C washes. At 50°C washes, the 40mer capture probe exhibits scattered behavior. These data empirically confirm that when using these reagents, 40mer capture probes and wash temperatures ranging from 44°C to 47°C are used.

[0356] Methods - High Density 40mer

[0357] Typically, sequence capture probes are designed using specific "rules". For example, regions of lengthy sequence or regions that exhibit extreme base composition bias are typically avoided. A key implication of the requirement for high probe density and close spacing of probes along the target region is that there is little or no freedom to move the probes around in order to accommodate any such probe design rules. In this study, probes were designed solely based on their positions relative to each other, without regard to the probe binding sequence; therefore, use of this high-density approach requires empirical validation that hybridization and processing methods will accommodate such a probe set.

[0358] The human ALK gene encodes a protein kinase that is important in early development, but normal ALK gene expression is essentially undetectable in normal adults. Oncogenic ALK fusions occur when intron 19 of ALK undergoes unconventional recombination that fuses the kinase-encoding portion of ALK to the 5' end of another gene. This gene fusion often causes ectopic expression of the ALK kinase, which in turn is important in driving the inappropriate cell proliferation observed in lung tumors. In lung cancer, this "other gene" is often EML4, but other fusion partners have also been detected. In order to generate an assay that can detect any possible ALK gene fusion event, 40 nucleotide probes were designed that were placed in intron 19 of ALK at 80 nucleotide intervals. These probes were oriented so that they were antisense relative to the gene ( Figure 4 ). This means that their 3' end extends and copies the region of the gene to which the hybridization site is 5'. When a fusion gene is present, the probe extension comes from the probe located near the fusion junction replication junction sequence. The DNA sequence obtained from these ligated clones has the fusion partner sequence at its 5' end and the fusion junction sequence and ALK intron 19 sequence at its 3' end ( Figure 4 B).

[0359] Another important diagnostic target in cancer is the TP53 gene. It encodes a tumor suppressor and is often inactivated by mutations in cancer. Mutations that can inactivate gene function are scattered throughout the gene, so for deterministic sequence-based analysis of TP53 inactivating mutations, the entire coding region and untranslated region (UTR) of the gene must be resolved. Because circulating DNA fragments are short, high-density probes are used to query all target regions of the TP53 gene. Unlike ALK, the probes for TP53 are placed in two possible orientations ( Figure 5 ). At high probe density, the cumulative coverage from multiple probes provides uniform deep sequencing coverage of the target region.

[0360] The set of 105 probes used in this study is shown in Table 6. In addition to probes targeting the fusion susceptibility region of ALK and the coding region of TP53, probes covering known SNVs in cell line DNA were also included.

[0361] Table 6

[0362]

[0363]

[0364]

[0365]

[0366]

[0367] Genomic samples

[0368] Three samples of genomic DNA were analyzed:

[0369] 1) Germline sample NA 06994—normal human sample obtained from the Coriell library;

[0370] 2) Cancer cell line NCI-H69—a cell line known to have mutations in TP53, amplification of the MYCN locus, and SNVs in ALDH4A1, BRCA1, BRCA2, CDKN2A, DPYD, EPHX1, MYC, RB1, and TNFRSF14 included in the target probe set;

[0371] 3) Cancer cell line ZR-75-1, which was reported to have the EML4-ALK fusion gene (Lin et al., Mol. Cancer Res. 7(9): 1466, 2009).

[0372] DNA sequencing libraries are typically constructed from sheared DNA fragments. Acoustic disruption is used to generate DNA fragments ranging in size from 200 to >500 bp. Enzymatic cleavage of the acoustically fragmented DNA is performed in an attempt to mimic circulating DNA, which is thought to consist of nucleosomes. Fragment composition. In short, 20-40ng / μl of DNA was sonicated under 200bp conditions to produce wide fragments (broad smear) ranging in size from 150bp to 400bp. The DNA was further fragmented by adding 0.01 and 0.02μl of DNAse enzyme (New England Biolabs recombinant bovine DNAse) to 50μl aliquots of DNA in DNAse buffer (10mM Tris pH8.0, 2.5mM MnCl2, 0.5mM CaCl2). The DNAse reaction was incubated at 37°C for 10 minutes and terminated by adding 0.5M EDTA to a final concentration of 25mM. First, 0.9 volumes of beads were added to 1 volume of DNA, and DNA with an average size of 150bp was purified by "double-sided" bead selection. The beads that bound to the larger fragments that were not needed were discarded, and another 1.6 volumes of beads were added to the supernatant. The bound material was then purified and quantified. In Figure 6 An agarose gel of the resulting highly fragmented short DNA used for library construction is shown in .

[0373] The fragmented DNA was end-repaired using a QuickBeunt kit format NEB and mixed in the ratios shown in Table 7. Ten nanograms of the mixed DNA was then ligated to adapters having the sequences shown in Table 7. For mixtures 9 and 15, two ligation reactions were performed, 10 ng each, and then combined. For mixture 16, four reactions were performed. Also shown in Table 7 is an estimate of the genomic input for each library using qPCR analysis.

[0374] Table 7. Samples and mixing ratios

[0375]

[0376]

[0377] Targeted Sequencing

[0378] 1 microgram of each of the 16 DNA libraries shown in Table 7 was pooled and adjusted to a final volume of 160 μL. Eight identical 20 μL aliquots were denatured at 98°C, cooled on ice, and 20 μL of probe (Table 6) and 50 μL of CF hyb buffer were added at 1 nM / probe. The samples were annealed from 80°C to 50°C for 24 hours, washed and amplified. After amplification of the resulting captured and processed fragments, the PippinPrep TM The size of the final sequencing library was selected using the Illumina MiSeq instrument. Libraries were sequenced on an Illumina MiSeq using a 150-read V3 kit.

[0379] result

[0380] The capture probe performance of high density capture probes selected based on their position in the target sequence is monitored. The performance of each capture probe is graphically displayed as Figure 7 These data indicate that:

[0381] 1) All capture probes strictly selected by positional constraints provide on-target sequence information;

[0382] 2) Most capture probes exhibited very little off-target and unmappable read capture; and

[0383] 3) The yield of useful on-target reads is essentially uniform.

[0384] Capture probes that capture a high proportion of off-target and unmappable reads were further analyzed. These capture probes are usually located in regions of low sequence complexity / high sequence redundancy. However, here, such capture probes have no significant adverse effect on sequencing depth, because the high level of probe redundancy (high density of probes) means that all regions are covered by reads from a few probes. The net effect is excellent coverage uniformity. See, e.g. Figure 8 , probe coverage of the TP53 gene using a 40mer capture probe.

[0385] in conclusion

[0386] Together, these data demonstrate that capture probe length can be reduced from 60 to 40 nucleotides with little or no discernible loss in probe performance (once capture wash temperature is adjusted). They also demonstrate that probe design can follow positional constraints and sequence context or composition can generally be ignored. Even if the approach produces occasional poorly performing probes, high redundancy at close proximity to the probe spacing fully compensates for individual probe deficiencies.

[0387] Example 3

[0388] Genetic analysis of circulating DNA

[0389] Purpose

[0390] The purpose of this example is to benchmark genetic analysis of cfDNA using an efficient cloning procedure and a target retrieval system for cfDNA.

[0391] background

[0392] While there is great enthusiasm in the scientific and healthcare communities regarding “liquid biopsies”—the analysis of circulating DNA (cfDNA) for markers associated with underlying disease states—there is very little actual information available about this potential analyte.

[0393] Summarize

[0394] Plasma samples collected from healthy donors and individuals with ovarian or colon cancer were used for genetic analysis of circulating DNA. The amount and overall characteristics of circulating cfDNA can vary widely between individuals. Surprisingly, the inventors found that cfDNA was easy to clone, and its efficiency was not significantly different from that of highly purified and fragmented genomic DNA; the fragment size was very consistent, with an average clone insert size of 170 ± 10 bp (in 7 / 8 samples); and the genomic representation from such samples was uniform and comparable to experiments performed using purified gDNA. It was further determined that by counting unique reads, the depth of representation in each library provided an estimate of the minor allele frequency of tumor markers present in cfDNA of sick patients. This study established that the construction and target retrieval system involved in this article can be effectively applied to quantitative genetic analysis of cfDNA.

[0395] method

[0396] DNA purification

[0397] Eight plasma samples were purchased from Proteogenex, Inc., Culver City, CA (Table 8). Circulating DNA was extracted from the samples (on two separate occasions) using a circulating nucleic acid purification kit from Qiagen. The samples were passed through a DNA microcolumn using centrifugation. The sample IDs and yields of DNA are shown in Table 8.

[0398] Table 8. Plasma samples and cfDNA yield

[0399]

[0400] Library construction

[0401] Purified DNA from 4 mL of plasma was collected in 100 μl of elution buffer. For four samples collected from patients with colon cancer (CRC), the DNA was split in half and a 50 μl aliquot from each patient was sonicated to 200 bp. A 50 μl aliquot of unprocessed cfDNA from each patient and a 50 μl of fragmented cfDNA (from the entire sample from each patient) were end-repaired (per sample) by adding:

[0402] 6 μl 10X Rapid Buffer (New England Biolabs (NEB))

[0403] 0.6 μl 10 mM dNTPs

[0404] 2.4 μl Rapid Inactivation Enzyme Mix

[0405] 1.2 μl PreCR enzyme mix.

[0406] Incubate samples at 20°C for 30 minutes and at 70°C for 10 minutes. Ligation with adapters (Table 2) by combination:

[0407] 60 μl end-repaired cfDNA

[0408] 12 μl adapter duplex (10 μM)

[0409] 10 μl 10X Ligase Buffer (NEB)

[0410] 15 μl 50% PEG 8000

[0411] 3 μl HC T4 DNA ligase

[0412] Table 9. Samples and codes used for four CRC plasma samples

[0413] Progenex ID sample# Preprocessing Adaptor 23149 1 none NNNNNTTTTGTGTGTGTGTG(SEQ ID NO:275) 23407 2 none NNNNNACTACACACACACAC(SEQ ID NO:276) 23406 3 none NNNNNCTCGTGTGTGTGTGT(SEQ ID NO:277) 23185 4 none NNNNNGAACACACACACACA(SEQ ID NO:278) 23149 5 Fragmentation NNNNNCATGTGTGTGTGTGT(SEQ ID NO:279) 23407 6 Fragmentation NNNNNGTGCACACACACACA(SEQ ID NO:280) 23406 7 Fragmentation NNNNNATAACACACACACAC(SEQ ID NO:281) 23185 8 Fragmentation NNNNNTACTGTGTGTGTGTG(SEQ ID NO:282)

[0414] The reaction was incubated at 22°C for 1 hour and at 65°C for 10 minutes. The ligation products were purified by adding 100 μl beads, washing and eluting in 40 μl TEzero. All 40 μl ligation products were amplified by PCR with primer ACA2 (SEQ ID NO: 283) and the samples were combined at the same mass for targeted capture.

[0415] Target capture and sequencing

[0416] Four non-fragmented and four fragmented colon plasma samples ( Fig. 9C ), hybridized with our high-density, 40-nucleotide probe set targeting TP53, ALK, etc. The capture complexes were processed as described in Example 2.

[0417] result

[0418] Library appearance

[0419] Pseudo-color photograph of a 2% agarose gel loaded with 50 ng of each library. Fig.9A As shown. The average fragment size is in a tight range of 260 ± 20 bp. These data suggest that the clonable portion of cfDNA exists primarily as nucleosomal fragments. In addition, the size of the cfDNA library has the same basic surface appearance as cfDNA in renal dialysis patients (Atamaniuk et al., Clinical Chemistry 52(3): pp.523-26 (2006)), except that the cfDNA library is transformed to higher quality ( Fig. 9B). In contrast, cfDNA libraries are very different from sonicated gDNA libraries, which appear as broad fragments.

[0420] Four additional sets of cfDNA libraries were constructed from two plasma samples from ovarian cancer patients and two plasma samples from healthy volunteers. In a total volume of 50 μl, 38 μl aliquots of cfDNA were end-repaired. The ligation reagents included 40 μl of end-repaired fragments, 16 μl of adapters (10 μM), 8 μl of 10X ligase buffer, 16 μl of 50% PEG, and 4 μl of HCT4 DNA ligase in a total volume of 80 μl. The ligation reactions were incubated at 20°C for 1 hour and at 65°C for 10 minutes. For purification, 20 μl of TEzero and 150 μl of beads were added. The purified ligation products were resuspended in 40 μl, all of which were used for subsequent 200 μl library amplification by PCR. The resulting amplified library is as shown Fig. 9C shown.

[0421] Sequencing data analysis

[0422] In each of the eight libraries, the observed average unique read counts ranged from unique reads to >3000 unique reads, defining to sensitivity range. Fig.10 Rare mutation reads may be observed more than once, meaning that the minimum sensitivity is less than the above calculation. In a preferred embodiment, unique reads provide a statistically reasonable lower limit on the frequency of observation.

[0423] cfDNA cloning efficiency

[0424] Sample 23407 was used as a benchmark. 10 ng / mL of cfDNA was recovered from the plasma sample, and 20 ng of isolated cfDNA was used in each of the two library construction efforts. The unique read counts indicated that we obtained 10 ng / mL of cfDNA from non-fragmented DNA ( Fig.10 An average of 700 unique reads (genome equivalents) were recovered from the library ("23407" in Figure 1). Considering that each genome contains 0.003 ng of gDNA, 2.1 ng of input DNA was recovered in this library (10% cloning efficiency).

[0425] Fragmentation prior to library construction with this sample increased library yield more than two-fold ( Fig.1023407 fragments" in the ). This suggests that a large amount of the DNA present in the 23407 sample is high molecular weight DNA that needs to be fragmented in order to be clonable. Therefore, the library cloning efficiency is likely much greater than 10%, and is likely in the 20% range of the input cfDNA. This cloning efficiency is comparable to highly purified genomic DNA and suggests that the cfDNA is unlikely to be modified in any way that would be detrimental to downstream cloning efforts.

[0426] Library coverage

[0427] The cfDNA library resembles a set of discrete bands with random coverage of the target region. Fig.11 A random sampling of sequence data is shown. Using BLAT, the sequences that were not fragmented prior to cloning (see Fig.10 ) and a random set of reads from sample 23407 captured by the TP53 probe "chr17:7579351:region_3:280nt:41:80:r" (SEQ ID NO:201) were aligned. Given the way the samples were prepared, these are likely a reflection of cfDNA fragments overall, as the left-hand portion of these reads (read start sites) are randomly distributed over the target region. This random distribution indicates random destruction of genomic DNA, and it suggests that, despite the banded appearance of the cfDNA library, the sequencing output is a random coverage of the target region. Random distribution is important for effective genetic analysis using the techniques described herein.

[0428] Fig.12 A higher-resolution overview of TP53 coding region sequencing for a typical cfDNA library is provided. The elements of targeted sequencing—coverage of all target regions and uniform depth at each sequenced base—are apparent. At this depth of >4000 unique reads per base, and the requirement that at least two plausible candidate base changes must be encountered, it can be estimated that the mutation detection sensitivity for this particular library is approximately 1 mutation in 2000 sequences, or 0.05%. This level of sensitivity represents a striking and unexpected technical achievement.

[0429] in conclusion

[0430] From plasma clones with efficiencies comparable to highly purified gDNA isolated from cell lines (gold standard), cfDNA is isolated and cloned. The cfDNA library is similar to DNA fragments + adapters of circulating nucleosome size, and the ends have sufficiently random properties, which enables effective genetic analysis. In addition, the highly consistent size characteristics of the plasma cfDNA library allow the design of capture strategies and the following probe sequences to cover the target reliably to the greatest extent, 120bp (=160-40) from the end of the probe.

[0431] Example 4

[0432] Measuring genome equivalents in circulating DNA libraries

[0433] Purpose and Background

[0434] One of the major challenges in the analysis of circulating cell-free DNA is achieving adequate analytical sensitivity. If adequate sensitivity is not achieved, analysis of cfDNA libraries is perplexing: if a sample is sequenced and no mutational events are detected, this result can be interpreted to mean that no mutations are present, or that significant events were missed because the sampling depth was too small. The sensitivity of an assay is defined in statistical terms as the false negative rate. In the context of sequencing circulating cell-free DNA, a significant obstacle is the detection of rare sequences that are mixed into a large excess of reference sequences.

[0435] One way to determine analytical sensitivity is to measure the occurrence of a mutant sequence in a set of samples where the mutant sequence is gradually diluted into a non-mutant reference sequence. The dilution at which the mutant sequence is no longer detected defines the analytical sensitivity. This approach is appropriate if the identity of the mutant sequence and the degree of dilution are known. Unfortunately, clinical samples do not usually provide any parameters. Often the identity of the mutant sequence is unknown and the degree of dilution varies from sample to sample. In this case, analytical sensitivity is established on a sample-by-sample basis.

[0436] In order to assign sensitivity values ​​on a sample-by-sample basis, the number of different and distinct sequences present in each sample is measured by measuring the number of genome equivalents present in the sequencing library. As a non-limiting example, if a known DNA sequencing library contains 3 ng (3000 pg) of human genomic DNA, and each human genome has a mass of 3 pg, the library has a genome equivalent of 3000 ÷ 3 = 1000 DNAs. If a mutant DNA sequence must be detected twice to be statistically significant, the best possible sensitivity estimate for the detection of this particular library is 2 mutant sequences ÷ a total of 1000 sequences = 0.002 = 0.2%. In order to establish sensitivity, the number of genome equivalents of each sample library must be measured.

[0437] Summarize

[0438] Two methods are used to measure genome equivalents. The first method is based on quantitative PCR (qPCR). A genomic library is constructed using the connection of an adapter to a genomic fragment and a pair of PCR primers (one specific for a common genomic sequence (e.g., Alu I repeats) and the other specific for the adapter). The abundance of the connected adapter: fragment sequences of these cfDNA libraries is measured. A standard curve is constructed using a standard library of known concentration, and the measured values ​​are fitted to the resulting standard curve, and the value of the genome equivalent is derived from the fit.

[0439] The second method to measure genome equivalents uses bioinformatic counting performed after sequencing. Each unique sequence in the library is identified by its random sequence tag and the starting nucleotide of the genome sequence. In addition, each unique sequence must be derived from an independent genome. Therefore, the sum of the unique sequences present in the sequence data establishes an accurate quantitative measure of the number of genome equivalents present in the sample.

[0440] Methods and Results

[0441] Development of qPCR assays

[0442] The first version of the qPCR-based genome equivalent analysis used ACA2 primers (Table 10), but this analysis consistently underreported the number of genome equivalents present in the cfDNA library ( Fig.13 ).

[0443] Table 10. PCR primers used to develop genome-equivalent qPCR assays

[0444]

[0445] An improved version of the analysis is based on endogenous repeats (e.g., Alu repeats) that are found at very high frequencies throughout the human genome. By coupling Alu-specific primers with adapter-specific primers, the frequency of adapter-to-genomic fragment connections is reliably measured. A standard curve using libraries of known genome equivalents is generated, and the number of genome equivalents in a clone library is measured by fitting to the curve.

[0446] The PCR primers used to develop the Alu+ adapter-based qPCR analysis are shown in Table 10. PCR primers for Alu amplification were designed from the common human Alu sequence (Batzer & Deininger, Nat Rev Genet. 3(5): 370-9 (2002)) using PRIMER3 (Alu_F1 & Alu_R1, SEQ ID NOs: 285 and 286, respectively). The remaining two Alu primers (Alu_F2 and Alu_R2, SEQ ID NOs: 287 and 288, respectively) were reported in the literature (Marullo et al., Genome Biology 11: R9 (2010)).

[0447] Fig.14 A schematic diagram of the assay design is provided in . Because a single PCR primer can be used to amplify a genomic DNA library ( Fig.14 A), so primers that recognize the adapter sequence but cannot amplify genomic clones were used. The 58-nucleotide ACA2-FLFP primer (abbreviated AF below, SEQ ID NO: 284) meets these criteria because its length induces strong stem-loop PCR inhibition ( Fig.14 B). In addition, a pair of functional Alu primers ( Fig.14 C). In addition, a primer pair consisting of an Alu primer and a long ACA2 primer that does not amplify genomic DNA was used ( Fig.14 D). These same primers also amplified a genomic library clone ( Fig.14 E).

[0448] All necessary elements for functional Alu-based analysis were validated. Figure 15. In particular, the long primer alone was inert, both Alu primer pairs recognized human genomic DNA, and any combination of an Alu primer and the long ACA2 primer amplified genomic library clones ( Fig.15A Finally, the ability of the Alu primer plus the ACA2 primer pair to distinguish between genomic DNA and genomic library clones was as follows Fig. 15B A combination of Alu_R1 primer and AF primer was used to measure the genome equivalent in the newly constructed library.

[0449] A direct comparison between ACA2-based and Alu-based qPCR assays was performed as Fig.16 As shown. An 8-fold difference in genome equivalents was found. In addition, the Alu-based assay provided more consistent performance library to library and better alignment between qPCR-derived equivalents and bioinformatic counted tag equivalents in sequencing runs (Table 11).

[0450] Table 11. Sequencing tags for qPCR and counting

[0451]

[0452] Highly sensitive library adapters for sequence-based counting of genome equivalents

[0453] As mentioned above, the reality of disease monitoring using cfDNA is that mutant sequences may be rare components in an otherwise large excess of "normal" (meaning germline) DNA sequences. Therefore, highly sensitive and quantifiable sequencing analyses are required. Analytical sensitivity can be measured by counting the number of unique sequences present in a sequencing library. However, since cfDNA fragments are quite short, the number of unique sequences present in the library is very high. Such counting will lead to an erroneous underestimation of sensitivity and may result in identical reads that actually originate from independent cloning events. One solution to this problem is to label each independent sequenced clone during library construction by including, for example, a set of DNA tags in the adapters used to construct the library.

[0454] A set of such library construction adapters was specifically designed to measure the number of genomic equivalents present in a cfDNA library and, by extension, to leverage the sensitivity of sequencing analysis to monitor mutant sequences.

[0455] like Fig.17 As shown, the structure of the high-sensitivity library adapter is configured to accommodate a large number of genome equivalents in the cfDNA library. There is a lot of molecular engineering inside the 45-nucleotide linker chain, which is the chain that becomes the link to the end-repaired cfDNA fragment. The adapter contains at least five elements.

[0456] Element 1 is the PCR primer binding site for single primer library amplification primer ACA2 (Table 12).

[0457] Table 12

[0458] element Function sequence number Sequence (5'->3') SEQ ID NO: Element 1 PCR primer binding site 1 TGCAGGACCAGAGAATTCGAATACA 289

[0459] Element 2 is a read encoding of 5 nucleotides. The combination of this encoding and the genomic DNA sequence constitutes a DNA tag for uniquely identifying each read. The 5 nucleotide encoding consists of 256 possible unique sequences, which are selected as 2 base changes different from each other encoding in the group. This feature distinguishes unique and distinguishable reads from reads that appear to be unique due to sequencing errors in the coding region. Seven encodings in which G residues are over-represented and empirically shown to interfere with adapter function are deleted, leaving 249 random encodings. Table 13.

[0460] Table 13

[0461]

[0462]

[0463]

[0464] Element 3 is a sample code of 3 nucleotides that differ by at least two base changes. This element is used to identify different samples and enables sample multiplexing during sequencing runs. Table 14.

[0465] Table 14

[0466]

[0467] Element 4 is a 12 nucleotide anchor sequence with three important features in terms of library construction and downstream sequencing. Table 15. These are: A) Each 12 base stretch is part of a family of four 12 base stretches that together represent each of the four possible DNA bases at each site within the stretch. This balanced representation of bases is a feature that is required by Illumina sequencing instruments in order to correct base calls in sequencing reads. B) Each stretch consists of only two of the four possible bases, and these are specifically selected to be either 6A's+6C's or 6G's+6T's. This stretch, formed of only two bases, greatly reduces the likelihood that the stretch sequence will participate in the formation of secondary structures that would interfere with proper adapter function. C) Because each stretch consists of the same number of A+C or G+T, each stretch shares approximately the same melting temperature and duplex stability as each other stretch in a set of four.

[0468] Table 15

[0469]

[0470] Element 5 is the two base sequence found at the 3' end of element 4. This particular two base extension was chosen based on empirical data showing that these two base sequences are efficient substrates for ligation. Table 15.

[0471] Hybridization of the adapter module to the partner oligonucleotide. Table 16. Hybridization occurs between the sequence in element 4 and the partner oligonucleotide. Ligation of the double-stranded adapter to the end-repaired cfDNA.

[0472] Table 16

[0473]

[0474] To convert a set of 256 independently synthesized and pooled ligation strands (each of which shared a common sample code and thus constituted a subset of adapters for a single sample) into duplexes suitable for ligation, a 45-nucleotide ligation strand was combined with an appropriately complementary 12-nucleotide partner strand, heated to 95°C, cooled to 65°C for 5 minutes, and then cooled to room temperature. This duplex formed a blunt-end ligation substrate, such as Fig.17 B. After ligation and DNA purification, a DNA polymerase-mediated step occurs prior to PCR amplification, displacing the partner strand and replicating the ligated strand to form a double-stranded adaptor suitable for exponential amplification by single-primer PCR.

[0475] Quantitative analysis of genome equivalents from the targeted sequencing data was then performed. Each unique read was considered a unique ligation event, and the sum of unique reads was considered equal to the number of genome equivalents analyzed.

[0476] A crude "back-of-the-envelope", "rule-of-thumb" calculation was performed to determine the number of genome equivalents that could be analyzed. Each cfDNA clone is approximately 150 base pairs, of which 50 base pairs are required to bind the capture probe. This leaves approximately 100 possible sequence start sites in any captured cfDNA clone. 249 random codes are appended to each of the 100 possible start sites, resulting in a total library of approximately 249,000 possible unique clones. As the number of unique clones approaches the total number of possible sequence combinations, probability indicates that the same coding and start site combination will be created by independent events, and these independent events will be inappropriately grouped into a single family. The net result will be an underestimate of the genome equivalents analyzed, and rare mutant reads may be discarded as sequencing errors because they overlap with wild-type reads with the same identifier. To avoid this, qPCR analysis is used to attempt to limit the genome input to one-tenth or less of the number of possible unique clones. For example, a single adapter has 24,900 possible clones, thus providing robust capabilities for accurate analysis of libraries consisting of 2500 genome equivalents or less.

[0477] The process outlined is provided as an example, and the methods involved in this article are not meant to be bound by this example. In some cases, the number of genome equivalents to be analyzed may exceed the 2500 limit shown in the previous paragraph. To expand the depth of genome equivalents, two solutions to this problem are readily available. The first solution is to use more than one adapter set per sample. By combining adapters, the total number of possible clones can be expanded, and therefore the comfortable limit of genome input can be expanded. As a non-limiting example, the combination of four adapter sets for one sample expands the analysis to 24,900×4=99,600 possible sequences, and A second solution is to convert Fig.17 The code for element 2 in A is extended to 6, 7, or more bases. The number of possible codes that differ from every other code by at least 2 bases is 4. (n-1) , where n is the number of bases within element 2. Thus, in the non-limiting example given herein, n=5, and 4 (5-1) =256; therefore, inclusion of additional bases expands the available repertoire fourfold for each additional base.

[0478] in conclusion

[0479] The results of this example show that two independent methods for determining genome equivalents have utility in sample processing workflows. The first method, qPCR, is implemented in the library construction phase of cfDNA analysis, and is used as a quality control step to ensure that a sufficient number of genome equivalents are moved through library amplification, target sequence capture, and DNA sequencing. Another method uses explicit counts of unique reads as a more direct measure of the actual number of genome equivalents under informatics considerations.

[0480] Example 5

[0481] Quantitative genetic analysis

[0482] Purpose

[0483] The goal of this example is to perform quantitative genetic analysis of cancer genomes mixed with normal DNA and uncharacterized cfDNA isolated from cancer patient plasma.

[0484] background

[0485] There are three types of genomic events that are common in human cancer. They are: somatic mutations that change the function of the affected gene and its expressed protein product; genomic rearrangements that produce chimeric gene fusions and thus express fusion proteins with new biological properties; and gene copy number changes that lead to gene loss and low expression of gene products, or conversely gene amplification and overexpression of corresponding gene products. In the circulating DNA of cancer patients, these abnormal loci (many of which are of key significance in guiding patient care) are mixed (mixed) with the patient's normal germline DNA.

[0486] Summarize

[0487] In the previous embodiments, the technology configured for analyzing circulating cell-free DNA (cfDNA) has been described, with the purpose of cancer monitoring. However, the technology is widely applicable to any analysis, diagnosis and monitoring paradigm, including but not limited to: genetic diseases, fetal testing, Mendelian disorders, pathogen screening and organ transplant monitoring, where circulating DNA is a potential analyte. In this embodiment, the technical features emphasized in the previous embodiments are applied to the analysis of mixed cancer samples. In the first stage of this validation, cell lines from cancer were mixed with normal human DNA at a defined dilution and subjected to quantitative genetic analysis. In the second stage of this study, uncharacterized cfDNA was isolated from cancer patient plasma and subsequently examined using quantitative genetic analysis.

[0488] method

[0489] A mixture of cell line genomic DNA and normal human DNA

[0490] The following DNA samples were used:

[0491] NA06994—normal human genomic DNA (Coriell library);

[0492] NCI-H2228—a non-small cell lung cancer cell line (ATCC) with mutations in TP53 (Q331*) and EML4-ALK gene fusion (breakpoint unknown); and

[0493] NCI-H69—a small cell lung cancer cell line (ATCC) containing an amplification of the MYCN gene (~100 copies).

[0494] Library preparation: Genomic DNA isolated from cell lines (all three above) is a high molecular weight material that is different from the small size of cfDNA. To simulate cfDNA in these validation experiments, the genomic DNA was first fragmented using a Covaris Acoustic Sonicator at the "150bp" setting. Sonication typically produces wide fragments, and the DNA was further processed using "double-sided" bead selection. A dilute solution of DNA purification beads was added to the sample, and the higher molecular weight fragments that adhered to the beads were discarded (the size of the purified DNA was proportional to the amount of beads added). An additional aliquot of beads was added to the remaining supernatant, and in this second round, the DNA that adhered to the beads was purified (in a higher total concentration of binding buffer). This "double-sided" purification produces a narrow size distribution that is a reasonable representative of cfDNA ( Fig.18 ).

[0495] Fragmented genomic DNA was end-repaired, quantified, and pooled at various ratios shown in Table 17 and described in the Results section below.

[0496] Table 17. Samples and mixtures used for validation studies

[0497]

[0498] cfDNA libraries may have limited DNA input. The amount of cfDNA obtained per mL of patient plasma varies widely, but the lower limit (e.g., Example 3) is generally This is equivalent to 3300 human genomes. To prevent the limited number of cfDNA, the simulation mixing experiment was to reflect the lower limit of cfDNA routinely collected from patients. This constraint applies to all mixtures except the most extreme mixtures. In these latter mixtures, the library was prepared to simulate the input of 4mL (NA06994: H2228 1000: 1) or 8mL (NA06994: H69500: 1) of cfDNA from low-yield patients. The mixed sample was then connected to the adapter set described in Example 4. It is also shown in Table 17 that the genome equivalents in each purified library were measured using qPCR (Example 4). The libraries were amplified, quantified, and the equal mass of each library was merged (500ng each). The merged samples were hybridized with the high-density 40mer capture probes for proof of concept listed in Table 6 of Example 2. The resulting complex was captured on streptavidin-coated beads, and the resulting complex was washed, processed, amplified, purified and size-selected as described in the previous example. The resulting libraries were analyzed using the Illumina 150bp-V3 Miseq sequencing kit on an Illumina MiSeq instrument.

[0499] For bioinformatics analysis, rare somatic variant caller was used to detect mutations, split read aligner was used to detect fusion genes, and in-house analysis of quantified and statistically fitted tags was used to call copy number variations (CNVs).

[0500] Detection of mixed point mutations in the TP53 gene Fig.19 The "expected" frequencies deviate from the admixture ratio, as TP53 is known to be hemizygous in the NCI-H2228 cell line. The automated software was able to call the mutant allele in the 50:1 admixture. Manual processing was required to call mutation events at 1000:1. Regarding specificity, the tag filtering described in Example 1 was applied to the analysis, and no additional mutation calls were detected in TP53 after applying this tag filter.

[0501] The cell line NCI-H2228 is known to have a fusion gene between EML4 and ALK; this cell line was used as a positive control in fluorescence in situ hybridization analysis and in the use of RT-PCR to detect the fusion gene transcript. There are no published reports on the exact location of the gene fusion junction. Using dense probe coverage of the intron 19 region of ALK, sequence analysis revealed the precise location and sequence of the junction formed when the two genes fuse ( Fig. 20 In the NCI-H2228 cell line, the frequency of normal reads relative to junction reads (378 vs. 249, respectively) indicated that the fusion gene was heterozygous with the normal copy of ALK.

[0502] Detection of ligated reads as a function of mixture, e.g. Fig.21 As with point mutation detection, the expected values ​​were adjusted to reflect the fact that the mutant allele is found in one copy per diploid genome. No fusion reads were detected in the 1000:1 mixed sample.

[0503] Fig. 22 The CNV determination results of the MYCN gene as a function of the mixture are shown. The NCI-H69 cell line contains a highly amplified MYCN gene. MYCN is usually found as a single copy gene, two per diploid genome, so the expected result for a gradually more diluted mixture is that the CNV calculated by the label should asymptotically approach 2 copies (asymptotes are highlighted in the figure). The validation experiment shown here shows that the analysis system described in the present invention is strongly sensitive to highly amplified genes.

[0504] Variant discovery in cfDNA from cancer patients

[0505] The most rigorous validation of the technology covered in this article was its application to cfDNA samples in which the mutational profile was unknown. The analysis was performed by sequencing matched cfDNA, tumor, and normal adjacent tissue (NAT) samples from two ovarian cancer patients. In addition, two cfDNA samples from colorectal cancer (CRC) patients and two cfDNA samples from healthy volunteers were analyzed. In any case, no mutations, fusions, or abnormal CNVs were detected in the healthy volunteer samples.

[0506] Using the targeted probes described in Table 6 of Example 2, cfDNA libraries from four cancer patients were first screened. These probes were primarily configured to detect point mutations in the TP53 gene, gene fusions with ALK, and amplification of MYCN. The results of this initial sequencing screen are shown in Figure 2. Fig.23 As shown. Point mutations occurring at the same base position were found in cfDNA, tumor, and NAT from one ovarian patient. No TP53 mutations were found in matched samples from another group of ovarian cancer patients. Point mutations were also detected in two CRC cfDNA libraries for which matched tissue was not available. All of these point mutations have been previously identified in tumors, and all of them are known to be causal drivers of tumorigenesis. In the cfDNA library CRC406, 0.9% of mutant sequence detection was well within the range of analytical sensitivity. Sensitivity is defined by the presence of multiple labeled read families, all of which have mutant sequences. These data highlight the clinical utility of the system described in this article.

[0507] To further explore the detection of cancer-related changes in cfDNA libraries and related tissues, the same library was hybridized with a set of 679 probes for a total of 20 different cancer-related genes (Table 18). In this probe set, all coding regions of 14 genes were targeted, while selected loci were targeted in the remaining 6 genes.

[0508] Table 18. Targeted cancer genes

[0509] Gene: Targeted coding region Genes: Selected regions for targeting BRCA1 ALK BRCA2 DPy BRAF EPHX1 CDH1 MYC ERBB2 TNFRSF14 JAK2 ALDH4A1 NF2 PIK3CA RB1 CDKN2A KRAS MYCN PTEN TP53

[0510] like Fig.24As shown, OVA1 samples lacking any detectable changes in TP53 carry KRAS mutations found in cfDNA and in the corresponding tumors. This observation highlights the significant features of the analysis system described herein. Hundreds (as in the present embodiment) or even thousands of targeted probes can be used to query libraries generated from cfDNA. Sequencing of the resulting targeted libraries reveals somatic mutations present inside the tumors of affected individuals but not inside the germline. These tumor-related somatic markers can also be used to quantify the amount of circulating DNA shed from the tumor (as opposed to cfDNA with germline sequences). Therefore, regardless of its biological significance, the discovery of mutations also provides an estimate of the tumor content in mixed cfDNA.

[0511] Many targeted therapies are most successful in the presence of a normal gene (e.g., EGFR inhibitors only work in the presence of wild-type KRAS). In these cases where no genetic mutations are found, quantitative assessment of circulating tumor DNA levels becomes particularly important. In other words, the demonstrable presence of circulating tumor DNA at a specific target gene, combined with a wild-type sequencing result, indicates that the target gene is normal within the tumor, and this result may have a significant impact in guiding the choice of treatment. Fig.24 The case of the OVA1 sample is highlighted in Figure 2. The presence of KRAS mutations in the cfDNA library indicates that this patient’s tumor contains wild-type TP53.

[0512] Another example of abnormal gene discovery is Fig.25 A targeted quantitative genetic analysis system revealed the presence of a significant amplification in the ERBB2 gene, otherwise known as HER-2 / neu. While this type of amplification has been widely documented in breast cancer, it has also been occasionally identified in colorectal cancer.

[0513] in conclusion

[0514] Validation experiments using cell line DNA revealed detection thresholds for three types of genetic variants that are critical for driving tumor growth in cancer. Characterization of cfDNA from cancer patients revealed tumor-associated genetic changes that were well above the thresholds set by reconstruction experiments in all four samples analyzed. These data suggest that the quantitative analysis system described herein could have significant clinical utility, particularly in settings where liquid biopsies are most appropriate.

[0515] In general, the terms used in the following claims should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments and the full scope of equivalents to which such claims are entitled. Therefore, the claims are not limited by this disclosure. Sequence Listing <110> RAYMOND, Christopher K.; Lim, Lee P; ARMOUR, Christopher D. <120> Methods for quantitative genetic analysis of cell-free DNA <130> CLFK-002 / 00WO <140> PCT <141> 2014-08-22 <160> 562 <170> PatentIn version 3.5 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 1 taaacattgg aaaggtttct aattaaccag gagatccaaa agaaagcggt tcaagtagca 60 <210> 2 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 2 gatctcagtttttttggtta actatgtatt ttggtatatg aagcttctgg gttttgcaca 60 <210> 3 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 3 gacagataag catacatatt aacatggata tatatgtgaa tttcattcaa atggttctca 60 <210> 4 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 4 agctcttagc ctttgggggg atgacactct tgagcggacg tggggacgcc tcgctcttta 60 <210> 5 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 5 aagcccccac cgccgcctct ttccaaaata aacaccagcc agccgccgag cccggagtcg 60 <210> 6 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 6 gcctcccttc cccctccccg cccgacagcg gccgctcggg ccccggctct cggttataag 60 <210> 7 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 7 ggtgtggcag ccaggggggc gcactctgct ctggctgggc cccttctccc atgttttctt 60 <210> 8 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 8 ttacacaacc tttgggcttg gacaacactt tggggtccaa agaacctaag agtctttctg 60 <210> 9 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 9 tgatgaaact tgggctggat ggggcacagg tagggtgctt gttgctttca gtcagatgaa 60 <210> 10 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 10 aatgaaagaa aaggaggcca gattgctact cctggtccct gccacacact aggtacccta 60 <210> 11 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 11 attgacaata cctacataaa actctttcca gaatgttgtt aagtcttagt cattagggag 60 <210> 12 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 12 ggatttccac caacactgta ttcatgtacc catttttctc ttaacctaac tttattggtc 60 <210> 13 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 13 caaaggggga aaaccatcag gacattattt aacaacggaa atatctaact gaaaggcaaa 60 <210> 14 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 14 caggcagacc aaccaaagtc tttgttccac cttttaaaac taaatcacat tttcacagag 60 <210> 15 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 15 ccccagccag cggtccgcaa cccttgccgc atccacgaaa ctttgcccat agcagcgggc 60 <210> 16 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 16 cgactcatct cagcattaaa gtgataaaaa aataaattaa aaggcaagtg gacttcggtg 60 <210> 17 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 17 ctgtggcgcg cactgcgcgc tgcgccaggt ttccgcacca agaccccttt aactcaagac 60 <210> 18 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 18 ttctactgcg acgaggagga gaacttctac cagcagcagc agcagagcga gctgcagccc 60 <210> 19 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 19 accgagctgc tgggaggaga catggtgaac cagagtttca tctgcgaccc ggacgacgag 60 <210> 20 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 20 gccgccgcct cagagtgcat cgacccctcg gtggtcttcc cctaccctct caacgacagc 60 <210> twenty one <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> twenty one ggcggctagg ggacaggggc ggggtgggca gcagctcgaa tttcttccag atatcctcgc 60 <210> twenty two <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> twenty two agacgagctt ggcggcggcc gagaagccgc tccacataca gtcctggatg atgatgtttt 60 <210> twenty three <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> twenty three aggagagcag agaatccgag gacggagaga aggcgctgga gtcttgcgag gcgcaggact 60 <210> twenty four <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> twenty four taagagtggc ccgttaaata agctgccaat gaaaatggga aaggtatcca gccgcccact 60 <210> 25 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 25 ttgtatttgt acagcattaa tctggtaatt gattatttta atgtaacctt gctaaaggag 60 <210> 26 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 26 gaggccacag caaacctcct cacagcccac tggtcctcaa gaggtgccac gtctccacac 60 <210> 27 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 27 agaggaggaa cgagctaaaa cggagctttt ttgccctgcg tgaccagatc ccggagttgg 60 <210> 28 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 28 tccaacttga ccctcttggc agcaggatag tccttccgag tggagggagg cgctgcgtag 60 <210> 29 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 29 gcttggacgg acaggatgta tgctgtggct tttttaagga taactacctt gggggccttt 60 <210> 30 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 30 gcatttgatc atgcatttga aacaagttca taggtgattg ctcaggacat ttctgttaga 60 <210> 31 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 31 cgccccgcgc cctcccagcc gggtccagcc ggagccatgg ggccggagcc gcagtgagca 60 <210> 32 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 32 ctctggcccc gccggccgcg ggacctcggc ggggcatcca cagggcaggg tcccgccgct 60 <210> 33 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 33 ggcatgactt ggagtgagtt tggatggggt ggccaggtct gagaaggtcc cccgccagtg 60 <210> 34 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 34 gcagggcacc ttcttctgcc acccacctgt aaacagaggg ctcagcccag ctggaggcag 60 <210> 35 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 35 cccaagatct ccaagtactg gggaacccca gggaggccct ggggggtggc agtgttccta 60 <210> 36 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 36 ctaatgcaca caaagcctcc ccctggttag cagtggccct ggtcagctct gaataaccaa 60 <210> 37 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 37 ctgctcctct tttagaaggc aggagggccc caagggaagc agaaggtgac agaaggggaa 60 <210> 38 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 38 tggggcagtg gcgggcaggc actgggttgt aagttggggag tttgcggctg gggtcaggct 60 <210> 39 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 39 tctgctgctg tttgtgcctc tctctgttac taacccgtcc tctcgctgtt agacatctct 60 <210> 40 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 40 cccacccctc ccatgtcacc tgtatgacac ctgcattcca cccggcccca gccctcccct 60 <210> 41 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 41 tgggccaggt agtctcccta gaaggtgatg ctgatgaggg tctggtgccc agggcgccac 60 <210> 42 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 42 ggtgcccacc ccttgcatcc tggggggtag agcacattgg gcacaaagca gaggcacata 60 <210> 43 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 43 caccctgcct ggtactgccc tattgcccct ggcacaccag ggcaaaacag cacagtgaaa 60 <210> 44 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 44 ccatttacag aaacaaacct ccccaccaaa atgagaaaac tgtgtttctc cctggcactc 60 <210> 45 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 45 ttattcttct tgtgcctggg cacggtaatg ctgctcatgg tggtgcacga agggccaggg 60 <210> 46 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 46 gaaggatagg acagggtggg ctgggccagg ctgcatgcgc agagggacag gaactgcagc 60 <210> 47 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 47 gggcccggac cctgatgctc atgtggctgt tgacctgtcc cggtatgaag gctgagacgg 60 <210> 48 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 48 tctgtctcct gccatcccca agagatgctg ccacatctgg atcctcagga ctctgtctgc 60 <210> 49 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 49 tcacgtccca gggcagtttt cttccctgaa gaaagttgga tggcatgatc tgtcttccca 60 <210> 50 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 50 gtgttgagaa cagactactg acttctaata gcagcgactt ctttaccttg ataaaccaca 60 <210> 51 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 51 aaaaaaagga tgggttccat atgggtggtg tcaagtgccc acctcctagc aagtcagcag 60 <210> 52 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 52 ccctcacaag gtcaaagcta tacatcagct cctgtgacat tgactcatcc cccagacctt 60 <210> 53 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 53 aacccaccga gatctgcaaa ctttgcagga tgcaccagat gtcttgtagc catgggtcaa 60 <210> 54 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> TYMSr4r Probe <400> 54 tgcctccctc aggtgcctct gcacaaaacc agattgcttc cctctaagag tatggttagt 60 <210> 55 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 55 gttttacttt gcctttagct gtggtctttc aaaccaccat ccctccttat cttcctctgc 60 <210> 56 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 56 ctctgcaatt tgttttccca tattaaagaa ctgaagagct cagtgtggta ggctggcaag 60 <210> 57 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 57 ttttaaatga tgttttaaag aattgaaact aacatactgt tctgctttct cccccgggtt 60 <210> 58 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 58 cctgcccacc acttctccct aaactgaagccccacatttg gagcagtcat ctttatcttg 60 <210> 59 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 59 ggttgcgctc caatcatgtt acataaccta cggcaaggta tcgacaggat catactcctg 60 <210> 60 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 60 gcacagttac atttgccagt ggcaacatcc ttaaaaatta ataactgata ggtcacggac 60 <210> 61 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 61 cgtcccgccg cgccacttgg cctgcctccg tcccgccgcg ccacttcgcc tgcctccgtc 60 <210> 62 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 62 ctgtaaggcg aggaggacga tgcgtcccct ccctcgcagg attgaggtta ggactaaacg 60 <210> 63 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Chaperone Oligonucleotide #138 <400> 63 gtgaaaacca ggatcaactc ccgtgccagt cacat 35 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(8) <223> n is a, c, g or t <400> 64 nnnnnnnnca tggccgcagg 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(8) <223> n is a, c, g or t <400> 65 nnnnnnnnat cttagtggca 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(8) <223> n is a, c, g or t <400> 66 nnnnnnnncg gaactcggag 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(8) <223> n is a, c, g or t <400> 67 nnnnnnnnga ctccgatccc 20 <210> 68 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 68 atgtgactgg cacggggagtt gatcctggtt ttcacgggtt tgagtggcat gagctaccta 60 ctggatgtgc ctgactgtttccccttcttc ttccc 95 <210> 69 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 69 atgtgactgg cacggggagtt gatcctggtt ttcacctatc tccaggatgg agagagggaa 60 aaaaaagatg ggtctgtgtg ggagggcagg tactt 95 <210> 70 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 70 atgtgactgg cacggggagtt gatcctggtt ttcacgaaag aagccaggtc ttcaattaat 60 aagattccct ggtctcgttt gtctacctgt taatg 95 <210> 71 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 71 atgtgactgg cacggggagtt gatcctggtt ttcaccagac tcgcgcccaa ttttccccca 60 ccccttgtta ttgccacaaa atcctgagga tgatc 95 <210> 72 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 72 atgtgactgg cacggggagtt gatcctggtt ttcacaagca cctagcccca ttcctgctga 60 gcaggaggtg gcaggtaccc cagactggga ggtaa 95 <210> 73 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 73 atgtgactgg cacggggagtt gatcctggtt ttcacagtcg gtggggccag gatgaggccc 60 agtctgttca cacatggctg ctgcctctca gctct 95 <210> 74 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 74 atgtgactgg cacggggagtt gatcctggtt ttcaccctgg ccctcagcca gtacagaaag 60 tcatttgtca aggccttcag ttggcagacg tgctc 95 <210> 75 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 75 atgtgactgg cacggggagtt gatcctggtt ttcacagaat tcattgccag ctataaatct 60 gtggaaacgc tgccacacaa tcttagcaca caaga 95 <210> 76 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 76 atgtgactgg cacggggagtt gatcctggtt ttcacttact tccctccagt tttgttgctt 60 gcaaaacaac agaatcttct ctccatgaaa tcatg 95 <210> 77 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 77 atgtgactgg cacggggagtt gatcctggtt ttcaccaggg gtatctatta tccccatttt 60 ctcacaaagg aaaccaagat aaaaggttta aatgg 95 <210> 78 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 78 atgtgactgg cacggggagtt gatcctggtt ttcactgtta cctttaaaag acatctgctt 60 tctgccaaaa ttaatgtgct gaacttaaac ttacc 95 <210> 79 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 79 atgtgactgg cacggggagtt gatcctggtt ttcacttccc agtaaattac tcttaccaat 60 gcaacagact ttaaagaagt tgtgttttac aatgc 95 <210> 80 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 80 atgtgactgg cacggggagtt gatcctggtt ttcactaaat gacataacag ttatgatttt 60 gcagaaaaca gatctgtatt tatttcagtg ttact 95 <210> 81 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 81 atgtgactgg cacggggagtt gatcctggtt ttcacgacag gttttgaaag atatttgtgt 60 tactaatgac tgtgctataa cttttttttc tttcc 95 <210> 82 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 82 atgtgactgg cacgggagtt gatcctggtt ttcacctgtg gcgcgcactg cgcgctgcgc 60 caggtttccg caccaagacc cctttaactc aagac 95 <210> 83 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 83 atgtgactgg cacggggagtt gatcctggtt ttcacggcgg ctaggggaca ggggcggggt 60 gggcagcagc tcgaatttct tccagatatc ctcgc 95 <210> 84 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 84 atgtgactgg cacggggagtt gatcctggtt ttcacaccga gctgctggga ggagacatgg 60 tgaaccagag tttcatctgc gacccggacg acgag 95 <210> 85 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 85 atgtgactgg cacggggagtt gatcctggtt ttcacaggag agcagagaat ccgaggacgg 60 agagaaggcg ctggagtctt gcgaggcgca ggact 95 <210> 86 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 86 atgtgactgg cacggggagtt gatcctggtt ttcacctgta agttatcgta aaaaggagca 60 tctaggtagg tctttgtagc caatgttacc cgatt 95 <210> 87 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 87 atgtgactgg cacggggagtt gatcctggtt ttcacaatgg ccattcttcc aggaggcaca 60 gaaattacag gccatgcaca gagagaaata cccga 95 <210> 88 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 88 atgtgactgg cacgggagtt gatcctggtt ttcaccttgt tcgttccttg tactgagacc 60 ctagtctgcc actgaggatt tggtttttgc ccttc 95 <210> 89 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 89 atgtgactgg cacggggagtt gatcctggtt ttcacatcaa gactcatcag taccatcaaa 60 agctgagatg aaacagtgta agtttcaaca gaaat 95 <210> 90 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 90 atgtgactgg cacggggagtt gatcctggtt ttcactgtgt ccagctgtga aactcagaga 60 tgtaactgct gacatcctcc ctattttgca tctca 95 <210> 91 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 91 atgtgactgg cacggggagtt gatcctggtt ttcacatttg aaacaatttt atcatgaatg 60 ccatgaccaa agtattcttc tgtatcttct ttctt 95 <210> 92 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 92 atgtgactgg cacggggagtt gatcctggtt ttcactgatg ggtgggctcc cgaaggggcc 60 tcccgcagac ttgcgaagtt cccactctct gggcg 95 <210> 93 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 93 atgtgactgg cacggggagtt gatcctggtt ttcaccaggg tgcgggggca tccaggctgc 60 ccaagcggag gctgggccgg ctgtgctggc ctctt 95 <210> 94 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 94 atgtgactgg cacggggagtt gatcctggtt ttcacttttg aaatgtgggt ttgttgccat 60 gaaacgtgtt tcaagcatag ttttgacaga taacg 95 <210> 95 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 95 atgtgactgg cacggggagtt gatcctggtt ttcactgccc taaaagtgta tgtataacat 60 ccctgatgtc tgcatttgtc ctttgactgg tgttt 95 <210> 96 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 96 atgtgactgg cacggggagtt gatcctggtt ttcacaaccc ctcgaggctc agacctttgg 60 agcaggagtg tgattctggc caaccacctctctg 95 <210> 97 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 97 atgtgactgg cacggggagtt gatcctggtt ttcaccataa atatgtgtgc tagtcctgtt 60 agacccaagt gctgcccaag ggcagcgccc tgctc 95 <210> 98 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 98 atgtgactgg cacggggagtt gatcctggtt ttcactactt gttaattaaa aattcaagag 60 tttttttttc ttattctgag gttatctttt tacca 95 <210> 99 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 99 atgtgactgg cacggggagtt gatcctggtt ttcacccaaa atctgttttc caataaattc 60 tcagatccag gaagaggaaa ggaaaaacat caaaa 95 <210> 100 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 100 atgtgactgg cacggggagtt gatcctggtt ttcacatact ccatctcccg taaaaatagt 60 gagacttgag taatgtttga tgtcacttgt ctttc 95 <210> 101 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 101 atgtgactgg cacggggagtt gatcctggtt ttcaccagtc accactatat tattctaggt 60 atcccagaaa agttaaagtc aaatctgaaa cacat 95 <210> 102 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 102 atgtgactgg cacgggagtt gatcctggtt ttcaccgccc cgcgtccgac ccgcggatcc 60 cgcggcgtcc ggcccgggtg gtctggatcg cggag 95 <210> 103 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 103 atgtgactgg cacgggagtt gatcctggtt ttcacccata cgggcagcac gacgcgcgga 60 ctgcgattgc agaagatgac ctgggagggc tcgcg 95 <210> 104 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 104 atgtgactgg cacgggagtt gatcctggtt ttcactagag gggcttcaga ccgtgctatc 60 gtccctgctg ggtcgggcct aagcgccggg cccgt 95 <210> 105 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 105 atgtgactgg cacgggagtt gatcctggtt ttcacggcgc cgaggaggag atggaggccg 60 ggcggccgcg gcccgtgctg cgctcggtga actcg 95 <210> 106 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 106 atgtgactgg cacggggagtt gatcctggtt ttcacggtgt gggccaccgt gcccagccac 60 cggtgtggct ctttaacaac ctttgcttgt cccga 95 <210> 107 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 107 atgtgactgg cacggggagtt gatcctggtt ttcacaagtg gtctatcctg tacttaccac 60 aacaacctta tctttttaaa aagtaaaacg tcagt 95 <210> 108 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 108 atgtgactgg cacgggagtt gatcctggtt ttcaccttgt tcgttccttg tactgagacc 60 ctagtctgcc actgaggatt tggtttttgc ccttc 95 <210> 109 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 109 atgtgactgg cacggggagtt gatcctggtt ttcacatcaa gactcatcag taccatcaaa 60 agctgagatg aaacagtgta agtttcaaca gaaat 95 <210> 110 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 110 atgtgactgg cacggggagtt gatcctggtt ttcacaccta ctggatgtgc ctgactgttt 60 ccccttcttc ttccc 75 <210> 111 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 111 atgtgactgg cacggggagtt gatcctggtt ttcacgggaa aaaaaagatg ggtctgtgtg 60 ggagggcagg tactt 75 <210> 112 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 112 atgtgactgg cacggggagtt gatcctggtt ttcacttaat aagattccct ggtctcgttt 60 gtctacctgt taatg 75 <210> 113 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 113 atgtgactgg cacggggagtt gatcctggtt ttcaccccca ccccttgtta ttgccacaaa 60 atcctgagga tgatc 75 <210> 114 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 114 atgtgactgg cacggggagtt gatcctggtt ttcacgctga gcaggaggtg gcaggtaccc 60 cagactggga ggtaa 75 <210> 115 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 115 atgtgactgg cacggggagtt gatcctggtt ttcacggccc agtctgttca cacatggctg 60 ctgcctctca gctct 75 <210> 116 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 116 atgtgactgg cacggggagtt gatcctggtt ttcacgaaag tcatttgtca aggccttcag 60 ttggcagacg tgctc 75 <210> 117 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 117 atgtgactgg cacggggagtt gatcctggtt ttcacaatct gtggaaacgc tgccacacaa 60 tcttagcaca caaga 75 <210> 118 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 118 atgtgactgg cacggggagtt gatcctggtt ttcactgctt gcaaaacaac agaatcttct 60 ctccatgaaa tcatg 75 <210> 119 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 119 atgtgactgg cacggggagtt gatcctggtt ttcacatttt ctcacaaagg aaaccaagat 60 aaaaggttta aatgg 75 <210> 120 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 120 atgtgactgg cacggggagtt gatcctggtt ttcactgctt tctgccaaaa ttaatgtgct 60 gaacttaaac ttacc 75 <210> 121 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 121 atgtgactgg cacggggagtt gatcctggtt ttcacccaat gcaacagact ttaaagaagt 60 tgtgttttac aatgc 75 <210> 122 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 122 atgtgactgg cacggggagtt gatcctggtt ttcacatttt gcagaaaaca gatctgtatt 60 tatttcagtg ttact 75 <210> 123 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 123 atgtgactgg cacggggagtt gatcctggtt ttcactgtgt tactaatgac tgtgctataa 60 cttttttttc tttcc 75 <210> 124 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 124 atgtgactgg cacggggagtt gatcctggtt ttcactgcgc caggtttccg caccaagacc 60 cctttaactc aagac 75 <210> 125 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 125 atgtgactgg cacggggagtt gatcctggtt ttcacggggt gggcagcagc tcgaatttct 60 tccagatatc ctcgc 75 <210> 126 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 126 atgtgactgg cacggggagtt gatcctggtt ttcaccatgg tgaaccagag tttcatctgc 60 gacccggacg acgag 75 <210> 127 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 127 atgtgactgg cacggggagtt gatcctggtt ttcacgacgg agagaaggcg ctggagtctt 60 gcgaggcgca ggact 75 <210> 128 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 128 atgtgactgg cacggggagtt gatcctggtt ttcacgagca tctaggtagg tctttgtagc 60 caatgttacc cgatt 75 <210> 129 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 129 atgtgactgg cacggggagtt gatcctggtt ttcacgcaca gaaattacag gccatgcaca 60 gagagaaata cccga 75 <210> 130 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 130 atgtgactgg cacggggagtt gatcctggtt ttcacagacc ctagtctgcc actgaggatt 60 tggtttttgc ccttc 75 <210> 131 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 131 atgtgactgg cacggggagtt gatcctggtt ttcactcaaa agctgagatg aaacagtgta 60 agtttcaaca gaaat 75 <210> 132 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 132 atgtgactgg cacggggagtt gatcctggtt ttcacagaga tgtaactgct gacatcctcc 60 ctattttgca tctca 75 <210> 133 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 133 atgtgactgg cacggggagtt gatcctggtt ttcacgaatg ccatgaccaa agtattcttc 60 tgtatcttct ttctt 75 <210> 134 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 134 atgtgactgg cacgggagtt gatcctggtt ttcacgggcc tcccgcagac ttgcgaagtt 60 cccactctct gggcg 75 <210> 135 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 135 atgtgactgg cacggggagtt gatcctggtt ttcacgctgc ccaagcggag gctgggccgg 60 ctgtgctggc ctctt 75 <210> 136 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 136 atgtgactgg cacggggagtt gatcctggtt ttcacgccat gaaacgtgtt tcaagcatag 60 ttttgacaga taacg 75 <210> 137 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 137 atgtgactgg cacggggagtt gatcctggtt ttcacaacat ccctgatgtc tgcatttgtc 60 ctttgactgg tgttt 75 <210> 138 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 138 atgtgactgg cacggggagtt gatcctggtt ttcactttgg agcaggagtg tgattctggc 60 caaccaccct ctctg 75 <210> 139 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 139 atgtgactgg cacggggagtt gatcctggtt ttcacctgtt agacccaagt gctgcccaag 60 ggcagcgccc tgctc 75 <210> 140 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 140 atgtgactgg cacggggagtt gatcctggtt ttcacaagag tttttttttc ttatctgag 60 gttatctttt tacca 75 <210> 141 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 141 atgtgactgg cacggggagtt gatcctggtt ttcacaattc tcagatccag gaagaggaaa 60 ggaaaaacat caaaa 75 <210> 142 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 142 atgtgactgg cacggggagtt gatcctggtt ttcacatagt gagacttgag taatgtttga 60 tgtcacttgt ctttc 75 <210> 143 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 143 atgtgactgg cacggggagtt gatcctggtt ttcactaggt atcccagaaa agttaaagtc 60 aaatctgaaa cacat 75 <210> 144 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 144 atgtgactgg cacggggagtt gatcctggtt ttcacgatcc cgcggcgtcc ggcccgggtg 60 gtctggatcg cggag 75 <210> 145 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 145 atgtgactgg cacggggagtt gatcctggtt ttcacgcgga ctgcgattgc agaagatgac 60 ctgggagggc tcgcg 75 <210> 146 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 146 atgtgactgg cacgggagtt gatcctggtt ttcacctatc gtccctgctg ggtcgggcct 60 aagcgccggg cccgt 75 <210> 147 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 147 atgtgactgg cacgggagtt gatcctggtt ttcacggccg ggcggccgcg gcccgtgctg 60 cgctcggtga actcg 75 <210> 148 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 148 atgtgactgg cacggggagtt gatcctggtt ttcacgccac cggtgtggct ctttaacaac 60 ctttgcttgt cccga 75 <210> 149 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 149 atgtgactgg cacggggagtt gatcctggtt ttcacaccac aacaacctta tctttttaaa 60 aagtaaaacg tcagt 75 <210> 150 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 150 atgtgactgg cacggggagtt gatcctggtt ttcacagacc ctagtctgcc actgaggatt 60 tggtttttgc ccttc 75 <210> 151 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 151 atgtgactgg cacggggagtt gatcctggtt ttcactcaaa agctgagatg aaacagtgta 60 agtttcaaca gaaat 75 <210> 152 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> ACA2_FLFP Primers <400> 152 aatgatacgg cgaccaccga gatctacacg tcatgcagga ccagagaatt cgaataca 58 <210> 153 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> CAC3_FLRP Primers <400> 153 caagcagaag acggcatacg agatgtgact ggcacggggag ttgatcctgg ttttcac 57 <210> 154 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 154 atgtgactgg cacggggagtt gatcctggtt ttcaccgaat gagggtgatg tttttccgcg 60 gcacctcctt caggt 75 <210> 155 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 155 atgtgactgg cacggggagtt gatcctggtt ttcacgttgt agtcggtcat gatggtcgag 60 gtgcggagct tgctc 75 <210> 156 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 156 atgtgactgg cacggggagtt gatcctggtt ttcacgcagc tcctggtgct tccggcggta 60 cactgcaggt gggtg 75 <210> 157 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 157 atgtgactgg cacggggagtt gatcctggtt ttcacctaca caggccactt cctacaggaa 60 gcctccctgg atctc 75 <210> 158 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 158 atgtgactgg cacggggagtt gatcctggtt ttcacgaaat actaataaaa tgattaaaga 60 aggtgtgtct ttaat 75 <210> 159 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 159 atgtgactgg cacggggagtt gatcctggtt ttcactatat ggaaaataat tatttgtatt 60 atatagggca gagtc 75 <210> 160 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 160 atgtgactgg cacgggagtt gatcctggtt ttcacattag acccaatatg gtctgcagat 60 tttattagaa gaaat 75 <210> 161 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 161 atgtgactgg cacggggagtt gatcctggtt ttcacgtgaa ccagcagact gtgttgcaag 60 tataacccca cgtga 75 <210> 162 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 162 atgtgactgg cacggggagtt gatcctggtt ttcacgccat ggagcctaag gaagtttcag 60 caaggcccta agggg 75 <210> 163 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 163 atgtgactgg cacggggagtt gatcctggtt ttcaccccag gaattggcct gccttagtat 60 ttctgctgtg ctcag 75 <210> 164 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 164 atgtgactgg cacggggagtt gatcctggtt ttcactttga gggtgcagct gggatcttgg 60 tcagttgtgt ttcct 75 <210> 165 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 165 atgtgactgg cacggggagtt gatcctggtt ttcaccacat catgaaaaga tctctgaatt 60 ggtgtctggg gatct 75 <210> 166 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 166 atgtgactgg cacggggagtt gatcctggtt ttcactgagg accaggtcac aggacctctt 60 tggactgcag tttcc 75 <210> 167 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 167 atgtgactgg cacggggagtt gatcctggtt ttcactaacc actgccactc cccaccctct 60 agggttgtca atgaa 75 <210> 168 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 168 atgtgactgg cacggggagtt gatcctggtt ttcacgagct ctaccaatgt gagtgaccat 60 tatcactcct acatg 75 <210> 169 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 169 atgtgactgg cacggggagtt gatcctggtt ttcacaaaat tgtgattcag tgggtagatt 60 ctgtgtgtaa agccc 75 <210> 170 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 170 atgtgactgg cacggggagtt gatcctggtt ttcactatgt gctcagttcc ctcctctatg 60 caatggaccg accgt 75 <210> 171 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 171 atgtgactgg cacgggagtt gatcctggtt ttcacgtgta aattgccgag cacgtagtaa 60 ccatgcaaca agtgt 75 <210> 172 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 172 atgtgactgg cacggggagtt gatcctggtt ttcactgggg acacagtgtg tgctgccatc 60 tcccttctac cggca 75 <210> 173 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 173 atgtgactgg cacggggagtt gatcctggtt ttcacaagag cctttccctc tgcccttttc 60 aagcctctgc ccatc 75 <210> 174 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 174 atgtgactgg cacggggagtt gatcctggtt ttcacgacca cactgagttc tctgtgacct 60 gcaggtcagc tcacc 75 <210> 175 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 175 atgtgactgg cacgggagtt gatcctggtt ttcactttcc tatctctctg cctggagggt 60 ggtggagggc tggtt 75 <210> 176 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 176 atgtgactgg cacgggagtt gatcctggtt ttcacaaaca ggagctgcgc cggtggaagc 60 atgtgggagc tagaa 75 <210> 177 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 177 atgtgactgg cacgggagtt gatcctggtt ttcacggaca ctgaaggagc tccccacccc 60 ctgatcagcc aggag 75 <210> 178 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 178 atgtgactgg cacgggagtt gatcctggtt ttcacgggaa ctgcagctgc tctggtgggg 60 ggaaggttgg gagct 75 <210> 179 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 179 atgtgactgg cacggggagtt gatcctggtt ttcacaccca attccaggga ctagcataac 60 gaagtgacac cttgg 75 <210> 180 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 180 atgtgactgg cacgggagtt gatcctggtt ttcaccctgc ccccttggga gtccctgggg 60 ctctgtgcac tcacc 75 <210> 181 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 181 atgtgactgg cacggggagtt gatcctggtt ttcacggaag cacccccggt attaaaacga 60 acggggcgga aagaa 75 <210> 182 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 182 atgtgactgg cacggggagtt gatcctggtt ttcacctaac aaaggggacg cgacccgggg 60 tccagtgccc caggg 75 <210> 183 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 183 atgtgactgg cacggggagtt gatcctggtt ttcaccctgg ggggactggg tggcctcacc 60 cccaacccgg tcatc 75 <210> 184 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 184 atgtgactgg cacggggagtt gatcctggtt ttcaccgcgc tccagcttct cgcgggcgga 60 gaagccgctc cacat 75 <210> 185 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 185 atgtgactgg cacggggagtt gatcctggtt ttcaccccac ccggccgccg agtgcgtgga 60 tcccgccgtg gtctt 75 <210> 186 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 186 atgtgactgg cacggggagtt gatcctggtt ttcacgggca cgggcgctgg ctcgcgcttg 60 ttcacgggaa agggg 75 <210> 187 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 187 atgtgactgg cacggggagtt gatcctggtt ttcacaacat ggatatatat gtgaatttca 60 ttcaaatggt tctca 75 <210> 188 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 188 atgtgactgg cacggggagtt gatcctggtt ttcactaaac caacattctt aatgtcaaca 60 caatgtttgt ttaaa 75 <210> 189 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 189 atgtgactgg cacggggagtt gatcctggtt ttcaccccta cgtggagagt gaggatgcac 60 ccccacagaa gaaga 75 <210> 190 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 190 atgtgactgg cacggggagtt gatcctggtt ttcacatgac actcttgagc ggacgtgggg 60 acgcctcgct cttta 75 <210> 191 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 191 atgtgactgg cacggggagtt gatcctggtt ttcactctca cgctcaggga ccacgtgccg 60 gagttggtaa agaat 75 <210> 192 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 192 atgtgactgg cacggggagtt gatcctggtt ttcaccagtg gcctttttca aaatgaccac 60 cttggcggcc ttctc 75 <210> 193 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 193 atgtgactgg cacggggagtt gatcctggtt ttcacgctag ggggctgggg ttggggtggg 60 ggtggtgggc ctgcc 75 <210> 194 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 194 atgtgactgg cacggggagtt gatcctggtt ttcaccagtt tccataggtc tgaaaatgtt 60 tcctgactca gaggg 75 <210> 195 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 195 atgtgactgg cacggggagtt gatcctggtt ttcacctgcc atggaggagc cgcagtcaga 60 tcctagcgtc gagcc 75 <210> 196 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 196 atgtgactgg cacggggagtt gatcctggtt ttcactcatg ctggatcccc acttttcctc 60 ttgcagcagc cagac 75 <210> 197 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 197 atgtgactgg cacggggagtt gatcctggtt ttcacagccc cccagccctc caggtcccca 60 gccctccagg tcccc 75 <210> 198 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 198 atgtgactgg cacggggagtt gatcctggtt ttcacgcaga gacctgtggg aagcgaaaat 60 tccatgggac tgact 75 <210> 199 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 199 atgtgactgg cacggggagtt gatcctggtt ttcacgcagg gggatacggc caggcattga 60 agtctcatgg aagcc 75 <210> 200 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 200 atgtgactgg cacggggagtt gatcctggtt ttcacccgtg caagtcacag acttggctgt 60 cccagaatgc aagaa 75 <210> 201 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 201 atgtgactgg cacggggagtt gatcctggtt ttcacccaga aaacctacca gggcagctac 60 ggtttccgtc tgggc 75 <210> 202 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 202 atgtgactgg cacggggagtt gatcctggtt ttcacgaagg gacagaagat gacaggggcc 60 aggagggggc tggtg 75 <210> 203 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 203 atgtgactgg cacgggagtt gatcctggtt ttcacgtggc ccctgcacca gcagctccta 60 caccggcggc ccctg 75 <210> 204 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 204 atgtgactgg cacggggagtt gatcctggtt ttcacggggg gagcagcctc tggcattctg 60 ggagcttcat ctgga 75 <210> 205 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 205 atgtgactgg cacggggagtt gatcctggtt ttcacccccg gacgatattg aacaatggtt 60 cactgaagac ccagg 75 <210> 206 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 206 atgtgactgg cacggggagtt gatcctggtt ttcacctggg gggctggggg gctgaggacc 60 tggtcctctg actgc 75 <210> 207 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 207 atgtgactgg cacggggagtt gatcctggtt ttcaccctgg gcaaccagcc ctgtcgtctc 60 tccagcccca gctgc 75 <210> 208 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 208 atgtgactgg cacgggagtt gatcctggtt ttcacccatc gctatctgag cagcgctcat 60 ggtgggggca gcgcc 75 <210> 209 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 209 atgtgactgg cacggggagtt gatcctggtt ttcacgccat ctacaagcag tcacagcaca 60 tgacggaggt tgtga 75 <210> 210 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 210 atgtgactgg cacggggagtt gatcctggtt ttcaccatgg cgcggacgcg ggtgccgggc 60 gggggtgtgg aatca 75 <210> 211 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 211 atgtgactgg cacggggagtt gatcctggtt ttcactttgc caactggcca agacctgccc 60 tgtgcagctg tgggt 75 <210> 212 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 212 atgtgactgg cacggggagtt gatcctggtt ttcactgctt tatctgttca cttgtgccct 60 gactttcaac tctgt 75 <210> 213 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 213 atgtgactgg cacggggagtt gatcctggtt ttcacgaggg ccactgacaa ccacccttaa 60 cccctcctcc cagag 75 <210> 214 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 214 atgtgactgg cacggggagtt gatcctggtt ttcaccctca ggcggctcat agggcaccac 60 cacactatgt cgaaa 75 <210> 215 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 215 atgtgactgg cacggggagtt gatcctggtt ttcacaggaa atttgcgtgt ggagtatttg 60 gatgacagaa acact 75 <210> 216 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 216 atgtgactgg cacggggagtt gatcctggtt ttcacccagg gtccccaggc ctctgattcc 60 tcactgattg ctctt 75 <210> 217 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 217 atgtgactgg cacggggagtt gatcctggtt ttcacgaggc aagcagaggc tggggcacag 60 caggccagtg tgcag 75 <210> 218 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 218 atgtgactgg cacggggagtt gatcctggtt ttcaccctgg agtcttccag tgtgatgatg 60 gtgaggatgg gcctc 75 <210> 219 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 219 atgtgactgg cacggggagtt gatcctggtt ttcacactac atgtgtaaca gttcctgcat 60 gggcggcatg aaccg 75 <210> 220 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 220 atgtgactgg cacggggagtt gatcctggtt ttcaccttgc cacaggtctc cccaaggcgc 60 actggcctca tcttg 75 <210> 221 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 221 atgtgactgg cacggggagtt gatcctggtt ttcacctgca cccttggtct cctccaccgc 60 ttcttgtcct gcttg 75 <210> 222 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 222 atgtgactgg cacggggagtt gatcctggtt ttcaccctcg cttagtgctc cctgggggca 60 gctcgtggtg aggct 75 <210> 223 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 223 atgtgactgg cacgggagtt gatcctggtt ttcacgaccg gcgcacagag gaagagaatc 60 tccgcaagaaaggg 75 <210> 224 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 224 atgtgactgg cacggggagtt gatcctggtt ttcactctcc caggacaggc acaaacacgc 60 acctcaaagc tgttc 75 <210> 225 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 225 atgtgactgg cacggggagtt gatcctggtt ttcactctct tttcctatcc tgagtagtgg 60 taatctactg ggacg 75 <210> 226 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 226 atgtgactgg cacggggagtt gatcctggtt ttcacggaca ggtaggacct gatttcctta 60 ctgcctcttg cttct 75 <210> 227 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 227 atgtgactgg cacggggagtt gatcctggtt ttcacggcat tttgagtgtt agactggaaa 60 ctttccactt gataa 75 <210> 228 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 228 atgtgactgg cacggggagtt gatcctggtt ttcaccctga agggtgaaat attctccatc 60 cagtggtttc ttctt 75 <210> 229 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 229 atgtgactgg cacggggagtt gatcctggtt ttcaccctag cactgcccaa caacaccagc 60 tcctctcccc agcca 75 <210> 230 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 230 atgtgactgg cacggggagtt gatcctggtt ttcactgcct cagattcact tttatcacct 60 ttccttgcct ctttc 75 <210> 231 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 231 atgtgactgg cacggggagtt gatcctggtt ttcacatggc tttccaacct aggaaggcag 60 gggagtaggg ccagg 75 <210> 232 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 232 atgtgactgg cacggggagtt gatcctggtt ttcaccctgg agtgagccct gctcccccct 60 ggctccttcc cagcc 75 <210> 233 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 233 atgtgactgg cacggggagtt gatcctggtt ttcactccga gagctgaatg aggccttgga 60 actcaaggat gccca 75 <210> 234 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 234 atgtgactgg cacggggagtt gatcctggtt ttcaccatct tttaactcag gtactgtgta 60 tatacttact tctcc 75 <210> 235 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 235 atgtgactgg cacggggagtt gatcctggtt ttcacggcag gggagggaga gatgggggtg 60 ggaggctgtc agtgg 75 <210> 236 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 236 atgtgactgg cacgggagtt gatcctggtt ttcacgtcag tctgagtcag gcccttctgt 60 cttgaacatg agttt 75 <210> 237 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 237 atgtgactgg cacggggagtt gatcctggtt ttcaccctga agtccaaaaa gggtcagtct 60 acctcccgcc ataaa 75 <210> 238 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 238 atgtgactgg cacggggagtt gatcctggtt ttcacggcac agaccctctc actcatgtga 60 tgtcatctct cctcc 75 <210> 239 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 239 atgtgactgg cacggggagtt gatcctggtt ttcaccaggg gctttatgtgt ctccttgatg 60 acctgcggcg acgtc 75 <210> 240 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 240 atgtgactgg cacggggagtt gatcctggtt ttcacccatc atctcctccc ttccccttct 60 gcccaggctg ttgca 75 <210> 241 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 241 atgtgactgg cacggggagtt gatcctggtt ttcacaattc tggcttctcc ctgctcacac 60 tttcttccat tgcat 75 <210> 242 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 242 atgtgactgg cacggggagtt gatcctggtt ttcacgtcag ctcgtgttgg caacatacca 60 tcttcaacct ctgca 75 <210> 243 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 243 atgtgactgg cacggggagtt gatcctggtt ttcactaatt tcttggcccc tcttcggtaa 60 ccctgagcca aatgt 75 <210> 244 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 244 atgtgactgg cacggggagtt gatcctggtt ttcacggtga aataaaggaa gatactagtt 60 ttgctgaaaa tgaca 75 <210> 245 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 245 atgtgactgg cacggggagtt gatcctggtt ttcacactca tttgtatctg aagtggaacc 60 aaatgatact gatcc 75 <210> 246 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 246 atgtgactgg cacggggagtt gatcctggtt ttcacagttg agaccattca caggccaaag 60 acggtacaac ttcct 75 <210> 247 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 247 atgtgactgg cacggggagtt gatcctggtt ttcacgaaaa tgaatgctct gagctttgga 60 agctctcagg gtaca 75 <210> 248 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 248 atgtgactgg cacggggagtt gatcctggtt ttcacgggcc atcgcgatgt cgcacggtac 60 ctgcgcgcgg ctgcg 75 <210> 249 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 249 atgtgactgg cacggggagtt gatcctggtt ttcaccccca tccagcttca aaagctcttc 60 gaatcattga tgtgc 75 <210> 250 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 250 atgtgactgg cacggggagtt gatcctggtt ttcactgcca agcctgaact acccctcttt 60 tacactccta ttgat 75 <210> 251 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 251 atgtgactgg cacgggagtt gatcctggtt ttcacccacc ctgactgtgc tctgtccccc 60 cagggctgga catcc 75 <210> 252 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 252 atgtgactgg cacggggagtt gatcctggtt ttcacagtca ggagtggggat gatcttataa 60 aactcgtaga aagag 75 <210> 253 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 253 atgtgactgg cacggggagtt gatcctggtt ttcaccttcg gggagacaac gacggcggtg 60 gcgggagctt ctcca 75 <210> 254 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 254 atgtgactgg cacggggagtt gatcctggtt ttcaccatac agtcctggat gatgatgttt 60 ttgatgaagg tctcg 75 <210> 255 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 255 atgtgactgg cacggggagtt gatcctggtt ttcactttta ctgttcttcc tcagacattc 60 aaacgtgttt tgatc 75 <210> 256 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 256 atgtgactgg cacggggagtt gatcctggtt ttcacgtgga agcatactgc aaaatatttg 60 ttttcagtct ctgca 75 <210> 257 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 257 atgtgactgg cacggggagtt gatcctggtt ttcacacgta cccctctcag cccctcctct 60 tggactccag ccatg 75 <210> 258 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 258 atgtgactgg cacgggagtt gatcctggtt ttcacgtggc gtaagcgcgg cacgcggcgc 60 agtggtcccc gtcct 75 <210> 259 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 259 nnnnnaagat cttagtggca c 21 <210> 260 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 260 nnnnncgaca gaactattgc c 21 <210> 261 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <223> n is a, c, g or t <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 261 nnnnnactat cttagtggca c 21 <210> 262 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 262 nnnnnctcca gaactattgc c 21 <210> 263 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 263 nnnnnagcat cttagtggca c 21 <210> 264 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 264 nnnnncatca gaactattgc c 21 <210> 265 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 265 nnnnnataat cttagtggca c 21 <210> 266 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 266 nnnnnaagaa ggtagaccct c 21 <210> 267 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 267 nnnnntttct ctactcgtga c 21 <210> 268 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 268 nnnnnactaa ggtagaccct c 21 <210> 269 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 269 nnnnngaagc tacgagtatc c 21 <210> 270 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 270 nnnnnagcaa ggtagaccct c 21 <210> 271 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 271 nnnnncattg acgtctagag c 21 <210> 272 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 272 nnnnntcact ctactcgtga c 21 <210> 273 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 273 nnnnnataaa ggtagaccct c 21 <210> 274 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 274 nnnnntacct ctactcgtga c 21 <210> 275 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 275 nnnnnttttg tgtgtgtgtg 20 <210> 276 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 276 nnnnnactac acacacacac 20 <210> 277 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 277 nnnnnctcgt gtgtgtgtgtgt 20 <210> 278 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 278 nnnnngaaca cacacacaca 20 <210> 279 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 279 nnnnncatgt gtgtgtgtgtgt 20 <210> 280 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 280 nnnnngtgca cacacacaca 20 <210> 281 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 281 nnnnnataac acacacacac 20 <210> 282 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Adaptor <220> <221> misc_feature <222> (1)..(5) <223> n is a, c, g or t <400> 282 nnnnntactg tgtgtgtgtg 20 <210> 283 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 283 tgcaggacca gagaattcga ataca 25 <210> 284 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 284 aatgatacgg cgaccaccga gatctacacg tcatgcagga ccagagaatt cgaataca 58 <210> 285 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 285 cggtggctca cgcctgta 18 <210> 286 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 286 gcctcggcct cccaaagt 18 <210> 287 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 287 gaggctgagg caggagaatc g 21 <210> 288 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 288 gtcgcccagg ctggagtg 18 <210> 289 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Element 1 <400> 289 tgcaggacca gagaattcga ataca 25 <210> 290 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 290 cgggt 5 <210> 291 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 291 cggtg 5 <210> 292 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 292 cgtgg 5 <210> 293 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 293 gcggt 5 <210> 294 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 294 gcgtg 5 <210> 295 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 295 gctgg 5 <210> 296 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 296 ggcgt 5 <210> 297 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 297 ggctg 5 <210> 298 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 298 gggct 5 <210> 299 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 299 ttaaa 5 <210> 300 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 300 ttacc 5 <210> 301 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 301 ttatt 5 <210> 302 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 302 ttcac 5 <210> 303 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 303 ttcca 5 <210> 304 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 304 tttat 5 <210> 305 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 305 tttta 5 <210> 306 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 306 gcacg 5 <210> 307 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 307 gcagc 5 <210> 308 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 308 gccag 5 <210> 309 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 309 gccga 5 <210> 310 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 310 gcgac 5 <210> 311 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 311 gcgca 5 <210> 312 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 312 ggaaa 5 <210> 313 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 313 ggacc 5 <210> 314 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 314 ggatt 5 <210> 315 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 315 ggcac 5 <210> 316 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 316 ggcca 5 <210> 317 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 317 ggtat 5 <210> 318 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 318 ggtta 5 <210> 319 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 319 gtagt 5 <210> 320 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 320 gtatg 5 <210> 321 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 321 gtgat 5 <210> 322 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 322 ccgtc 5 <210> 323 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 323 cctcg 5 <210> 324 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 324 cctgc 5 <210> 325 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 325 cgaat 5 <210> 326 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 326 cgata 5 <210> 327 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 327 cgcct 5 <210> 328 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 328 cgctc 5 <210> 329 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 329 cgtaa 5 <210> 330 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 330 cgtcc 5 <210> 331 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 331 cgttt 5 <210> 332 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 332 ctaag 5 <210> 333 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 333 ctaga 5 <210> 334 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 334 ctccg 5 <210> 335 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 335 ctcgc 5 <210> 336 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 336 ctgaa 5 <210> 337 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 337 ctgcc 5 <210> 338 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 338 ttgtc 5 <210> 339 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 339 tttcg 5 <210> 340 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 340 tttgc 5 <210> 341 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 341 aaaaa 5 <210> 342 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 342 aaacc 5 <210> 343 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 343 aaatt 5 <210> 344 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 344 aacac 5 <210> 345 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 345 aacca 5 <210> 346 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 346 aatat 5 <210> 347 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 347 aatta 5 <210> 348 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 348 acaac 5 <210> 349 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 349 acaca 5 <210> 350 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 350 accaa 5 <210> 351 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 351 acccc 5 <210> 352 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 352 acctt 5 <210> 353 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 353 actct 5 <210> 354 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 354 gggtc 5 <210> 355 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 355 ggtcg 5 <210> 356 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 356 ggtgc 5 <210> 357 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 357 gtcgg 5 <210> 358 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 358 gtgcg 5 <210> 359 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 359 gtggc 5 <210> 360 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 360 tgcgg 5 <210> 361 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 361 tggcg 5 <210> 362 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 362 tgggc 5 <210> 363 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 363 aaagg 5 <210> 364 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 364 aagag 5 <210> 365 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 365 aagga 5 <210> 366 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 366 accgg 5 <210> 367 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 367 acgcg 5 <210> 368 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 368 acggc 5 <210> 369 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 369 agaag 5 <210> 370 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 370 gtgta 5 <210> 371 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 371 gttag 5 <210> 372 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 372 gttga 5 <210> 373 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 373 taggt 5 <210> 374 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 374 tagtg 5 <210> 375 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 375 taggg 5 <210> 376 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 376 tgagt 5 <210> 377 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 377 tgatg 5 <210> 378 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 378 tggat 5 <210> 379 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 379 tggta 5 <210> 380 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 380 tgtag 5 <210> 381 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 381 tgtga 5 <210> 382 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 382 ttagg 5 <210> 383 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 383 ttgag 5 <210> 384 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 384 ttgga 5 <210> 385 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 385 aacgt 5 <210> 386 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 386 ctgtt 5 <210> 387 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 387 cttgt 5 <210> 388 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 388 ctttg 5 <210> 389 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 389 gaact 5 <210> 390 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 390 gaatc 5 <210> 391 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 391 gacat 5 <210> 392 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 392 gacta 5 <210> 393 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 393 gatac 5 <210> 394 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 394 gatca 5 <210> 395 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 395 gcaat 5 <210> 396 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 396 gcata 5 <210> 397 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 397 gccct 5 <210> 398 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 398 gcctc 5 <210> 399 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 399 gctaa 5 <210> 400 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 400 gctcc 5 <210> 401 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 401 gcttt 5 <210> 402 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 402 acttc 5 <210> 403 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 403 ataat 5 <210> 404 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 404 atata 5 <210> 405 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 405 atcct 5 <210> 406 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 406 atctc 5 <210> 407 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 407 attaa 5 <210> 408 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 408 attcc 5 <210> 409 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 409 atttt 5 <210> 410 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 410 caaac 5 <210> 411 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 411 caaca 5 <210> 412 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 412 cacaa 5 <210> 413 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 413 caccc 5 <210> 414 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 414 cactt 5 <210> 415 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 415 catct 5 <210> 416 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 416 cattc 5 <210> 417 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 417 ccaaa 5 <210> 418 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 418 agaga 5 <210> 419 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 419 agccg 5 <210> 420 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 420 agcgc 5 <210> 421 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 421 aggaa 5 <210> 422 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 422 aggcc 5 <210> 423 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 423 aggtt 5 <210> 424 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 424 agtgt 5 <210> 425 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 425 agttg 5 <210> 426 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 426 atggt 5 <210> 427 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 427 atgtg 5 <210> 428 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 428 attgg 5 <210> 429 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 429 cacgg 5 <210> 430 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 430 cagcg 5 <210> 431 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 431 caggc 5 <210> 432 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 432 ccagg 5 <210> 433 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 433 ccgag 5 <210> 434 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 434 aactg 5 <210> 435 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 435 aagct 5 <210> 436 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 436 aagtc 5 <210> 437 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 437 aatcg 5 <210> 438 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 438 aatgc 5 <210> 439 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 439 acagt 5 <210> 440 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 440 acatg 5 <210> 441 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 441 acgat 5 <210> 442 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 442 acgta 5 <210> 443 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 443 actag 5 <210> 444 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 444 ACTGA 5 <210> 445 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 445 agact 5 <210> 446 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 446 agatc 5 <210> 447 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 447 agcat 5 <210> 448 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 448 agcta 5 <210> 449 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 449 agtac 5 <210> 450 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 450 gtaac 5 <210> 451 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 451 gtaca 5 <210> 452 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 452 gtcaa 5 <210> 453 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 453 gtccc 5 <210> 454 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 454 gtctt 5 <210> 455 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 455 gttct 5 <210> 456 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 456 gtttc 5 <210> 457 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 457 5 <210> 458 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 458 taagc 5 <210> 459 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 459 tacag 5 <210> 460 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 460 tacga 5 <210> 461 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 461 tagac 5 <210> 462 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 462 tagca 5 <210> 463 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 463 tcaag 5 <210> 464 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 464 tcaga 5 <210> 465 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 465 tcccg 5 <210> 466 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 466 ccacc 5 <210> 467 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 467 ccatt 5 <210> 468 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 468 cccac 5 <210> 469 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 469 cccca 5 <210> 470 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 470 CCTV5 <210> 471 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 471 cctta 5 <210> 472 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 472 ctact 5 <210> 473 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 473 ctatc 5 <210> 474 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 474 ctcat 5 <210> 475 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 475 ctcta 5 <210> 476 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 476 cttac 5 <210> 477 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 477 cttca 5 <210> 478 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 478 taaat 5 <210> 479 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 479 taata 5 <210> 480 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 480 tacct 5 <210> 481 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 481 tactc 5 <210> 482 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 482 ccgga5 <210> 483 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 483 cgacg 5 <210> 484 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 484 cgagc 5 <210> 485 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 485 cgcag 5 <210> 486 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 486 cgcga 5 <210> 487 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 487 cggac 5 <210> 488 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 488 cggca 5 <210> 489 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 489 gaaag 5 <210> 490 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 490 gaaga 5 <210> 491 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 491 gaccg 5 <210> 492 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 492 gacgc 5 <210> 493 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 493 gagaa 5 <210> 494 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 494 gagcc 5 <210> 495 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 495 gagtt 5 <210> 496 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 496 gatgt 5 <210> 497 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 497 gattg 5 <210> 498 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 498 agtca 5 <210> 499 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 499 atacg 5 <210> 500 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 500 atagc 5 <210> 501 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 501 atcag 5 <210> 502 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 502 atcga 5 <210> 503 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 503 atgac 5 <210> 504 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 504 atgca 5 <210> 505 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 505 caagt 5 <210> 506 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 506 caatg 5 <210> 507 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 507 Cagat 5 <210> 508 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 508 cagta 5 <210> 509 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 509 Category 5 <210> 510 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 510 catga 5 <210> 511 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 511 cccgt 5 <210> 512 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 512 ccctg 5 <210> 513 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 513 ccgct 5 <210> 514 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 514 tccgc 5 <210> 515 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 515 tcgaa5 <210> 516 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 516 tcgcc 5 <210> 517 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 517 tcgtt 5 <210> 518 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 518 tctgt 5 <210> 519 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 519 tcttg 5 <210> 520 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 520 tgaac 5 <210> 521 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 521 tgaca 5 <210> 522 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 522 tgcaa 5 <210> 523 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 523 tgccc 5 <210> 524 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 524 tgctt 5 <210> 525 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 525 tgtct 5 <210> 526 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 526 tgttc 5 <210> 527 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 527 ttcgt 5 <210> 528 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 528 ttctg 5 <210> 529 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 529 ttgct 5 <210> 530 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 530 tataa 5 <210> 531 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 531 tatcc 5 <210> 532 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 532 tattt 5 <210> 533 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 533 tcact 5 <210> 534 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 534 tcatc 5 <210> 535 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 535 tccat 5 <210> 536 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 536 tccta 5 <210> 537 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 537 tctac 5 <210> 538 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Element 2 <400> 538 tctca 5 <210> 539 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 539 aag 3 <210> 540 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 540 ctc 3 <210> 541 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 541 ggt 3 <210> 542 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 542 tca 3 <210> 543 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 543 act 3 <210> 544 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 544 cga 3 <210> 545 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 545 gtg 3 <210> 546 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 546 tac 3 <210> 547 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 547 agc 3 <210> 548 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 548 ccg 3 <210> 549 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 549 gaa 3 <210> 550 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 550 ttt 3 <210> 551 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 551 ata 3 <210> 552 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 552 cat 3 <210> 553 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 553 gcc 3 <210> 554 <211> 3 <212> DNA <213> Artificial Sequence <220> <223> Element 3 <400> 554 tgg 3 <210> 555 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 555 acccacacca aa 12 <210> 556 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 556 caaacacaac cc 12 <210> 557 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 557 gtgtgggttg tt 12 <210> 558 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 558 tgtgtttggt gg 12 <210> 559 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 559 tttggtgtgg gt 12 <210> 560 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 560 gggttgtgtt tg 12 <210> 561 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 561 aacaacccac ac 12 <210> 562 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Element 4 <400> 562 ccaccaaaca ca 12

Claims

1. A reagent combination for targeted genetic analysis of cell-free DNA (cfDNA) fragments, comprising: (a) one or more adaptors capable of ligating to the ends of the cfDNA fragments, wherein each adaptor comprises a PCR primer binding site; and (b) a plurality of capture probe modules, wherein each capture probe module comprises a nucleotide sequence comprising a tail sequence and a capture probe sequence; wherein the tail sequence comprises a sequencing primer binding site located at the 5' end of the capture probe module; and The capture probe sequence has a length of 40 to 45 nucleotides.

2. The reagent combination of claim 1, wherein each adaptor comprises one or more unique read codes.

3. The reagent combination of claim 1, wherein each adaptor comprises one or more sample codes for multiplex analysis of samples.

4. The reagent combination as described in claim 1, wherein each adapter comprises one or more anchor sequences, and wherein the length of each anchor sequence is 8-16 nucleotides, each anchor sequence is selected from four nucleotide sequences, and the two 3' terminal nucleotides of each anchor sequence are AA, CC, TT or GG.

5. The reagent combination of claim 2, wherein each read encoding is configured to identify a unique sequencing read.

6. The reagent combination of claim 3, wherein each sample code is configured to identify a sample from which a labeled cfDNA library was obtained, wherein the labeled cfDNA library comprises cfDNA fragments connected to the adapter at each end.

7. The reagent combination of claim 1, wherein the PCR primer binding site is configured for single primer amplification of a cfDNA library.

8. The reagent combination of claim 1, wherein the PCR primer binding site is 12 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides or 40 nucleotides.

9. The reagent combination of claim 1, wherein the PCR primer binding site is 12-40 nucleotides.

10. The reagent combination of claim 2, wherein each read code is 2 nucleotides, 3 nucleotides, 4 nucleotides or 5 nucleotides and differs from every other read code by at least two nucleotides.

11. The reagent combination of claim 3, wherein each sample code is 2 nucleotides, 3 nucleotides, 4 nucleotides or 5 nucleotides and differs from every other sample code by at least two nucleotides.

12. The reagent combination of claim 4, wherein each anchor sequence is 8 nucleotides, 12 nucleotides or 16 nucleotides.

13. The reagent combination of claim 1, wherein the adaptor comprises a plurality of adaptor species.

14. The reagent combination of claim 1, wherein each adaptor comprises a connecting strand and a complementary strand, wherein the complementary strand hybridizes to the 3' end of the connecting strand and forms a partial duplex therewith.

15. The reagent combination of claim 14, wherein the duplex region of the adaptor is blunt-ended.

16. The reagent combination of claim 14, wherein the duplex region of the adaptor comprises an overhang at the 3' end of the ligated strand, wherein the overhang is complementary to the 5' overhang of the cfDNA fragment to be ligated thereto.

17. The reagent combination of claim 14, wherein the one or more adaptors are configured to be ligated to cfDNA fragments to generate a labeled cfDNA library using a method comprising: (a) ligating a plurality of adaptors to cfDNA fragments to generate a plurality of complexes comprising the cfDNA fragments ligated to ligated strands of the adaptors, and (b) contacting the plurality of complexes with one or more DNA polymerases to form a labeled cfDNA library comprising a plurality of adaptor-tagged cfDNA fragments.

18. The reagent combination of claim 17, wherein the complementary strand is configured to be displaced from the partial duplex in step (b).

19. The reagent combination of claim 17, comprising one or more DNA polymerases of step (b).

20. The reagent combination of claim 17, comprising a DNA ligase for ligating the plurality of adaptors to the cfDNA fragments in step (a). The reagent combination of claim 20 , wherein the DNA ligase is T4 DNA ligase.

22. The reagent combination of claim 1, wherein the one or more adaptors each comprise one or more sequencing primer binding sites.

23. The reagent combination of claim 1, wherein the one or more adaptors each comprise one or more sequences for DNA sequencing.

24. The reagent combination of claim 1, wherein the capture probe sequence is 40 nucleotides or 45 nucleotides.

25. The reagent combination of claim 1, wherein the capture probe sequence is complementary to a target region in a labeled cfDNA library.

26. The reagent combination of claim 1, wherein the capture probe sequence has at least 70% complementarity with a target region in a labeled cfDNA library.

27. The reagent combination of claim 1, wherein the capture probe sequence is configured to hybridize to a target region in a labeled cfDNA library.

28. The reagent combination of claim 1, wherein the tail sequence of each capture probe module is configured to hybridize to and form a partial duplex with a partner oligonucleotide, wherein the partner oligonucleotide comprises a member of a binding pair to allow separation and / or purification.

29. The reagent combination of claim 1, wherein the tail sequence comprises a PCR primer binding site.

30. The reagent combination of claim 1, wherein at least one capture probe module is configured to hybridize downstream of the target region, and at least one capture probe module is configured to hybridize upstream of the target region.

31. The reagent combination of claim 1, wherein each capture probe module of the plurality of capture probe modules is configured to hybridize to its target sequence within 200 bp of any other capture probe module.

32. The reagent combination of claim 1, wherein the plurality of capture probe modules are configured to hybridize with labeled cfDNA library fragments to form a plurality of cfDNA library fragment-capture probe module complexes.

33. The reagent combination of claim 28, wherein the partner oligonucleotide chain comprises a biotin molecule.

34. The reagent combination of claim 32, comprising one or more enzymes for enzymatically treating the cfDNA library fragment-capture probe module complex to produce an enzymatically treated complex.

35. The reagent combination of claim 34, wherein the one or more enzymes comprise a 5'-3' DNA polymerase configured to extend each capture probe module of the cfDNA library fragment-capture probe module complex using the cfDNA library fragment as a template.

36. The reagent combination of claim 34, comprising one or more reagents for amplifying the enzymatically treated complex to produce an amplified hybrid nucleic acid molecule.

37. The reagent combination of claim 36, wherein each amplified hybrid nucleic acid molecule comprises a sequence complementary to a capture probe sequence and a sequence complementary to a tail sequence.

38. The reagent combination of claim 36, comprising components for performing quantitative genetic analysis on the amplified hybrid nucleic acid molecules, wherein the quantitative genetic analysis comprises performing DNA sequencing on the amplified hybrid nucleic acid molecules to generate a plurality of sequencing reads.

39. The reagent combination of claim 36, comprising components for performing quantitative genetic analysis on amplified hybrid nucleic acid molecules, wherein the quantitative genetic analysis comprises determining the number of genomic equivalents in a labeled cfDNA library.

40. The reagent combination of claim 38, wherein the quantitative genetic analysis is used to detect nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, or copy number variations.

41. The reagent combination of claim 6, comprising reagents for generating the labeled cfDNA library.

42. The reagent combination of claim 41, comprising one or more reagents for performing end repair, wherein the cfDNA fragments of the labeled cfDNA library have been end repaired prior to ligation with adapters.

43. The reagent combination of claim 42, wherein the one or more reagents for performing end repair comprise one or more enzymes that generate blunt ends, 5'-overhangs, or 3'-overhangs.

44. A method of generating a labeled cell-free DNA (cfDNA) library, comprising: (a) connecting a plurality of adapters each comprising a PCR primer binding site to the cfDNA fragments, wherein each adapter comprises a connecting strand and a complementary strand, wherein the complementary strand hybridizes with the 3' end of the connecting strand and forms a partial duplex therewith, wherein a plurality of complexes comprising cfDNA fragments ligated to said adaptors are generated; (b) contacting the plurality of complexes with one or more DNA polymerases to form a tagged cfDNA library comprising a plurality of adaptor-tagged cfDNA fragments; and (c) hybridizing a plurality of capture probe modules to the target genetic locus to form a capture probe module-cfDNA clonal complex, wherein each capture probe module comprises a capture probe sequence of 40-45 nucleotides in length.

45. The method of claim 44, wherein the complementary strand is configured to be displaced from the partial duplex in step (b).

46. ​​The method of claim 44, comprising extending the 3' end of the cfDNA fragment using the one or more DNA polymerases of step (b) using the ligated strand as a template.

47. The method of claim 44, comprising ligating the plurality of adaptors to the cfDNA fragments using a DNA ligase in step (a).

48. The method of claim 47, wherein the DNA ligase is T4 DNA ligase.

49. The method of claim 44, wherein each of the plurality of adaptors comprises one or more sequencing primer binding sites.

50. The method of claim 44, wherein each of the plurality of adaptors comprises one or more sequences for DNA sequencing.

51. A method of generating and amplifying a labeled cell-free DNA (cfDNA) library, the method comprising: (a) treating cfDNA with one or more end-repair enzymes to produce end-repaired cfDNA; (b) ligating one or more adapters, each comprising a PCR primer binding site, to each end of the end-repaired cfDNA to generate a cfDNA library; (c) amplifying the cfDNA library to generate cfDNA library clones comprising labeled cfDNA molecules; and (d) hybridizing a plurality of capture probe modules to the target genetic locus to form a capture probe module-cfDNA clonal complex, wherein each capture probe module comprises a capture probe sequence of 40-45 nucleotides in length.

52. The method of claim 51, wherein each adaptor comprises (a) PCR primer binding site, (b) a unique read code that identifies each unique sequencing read, (c) one or more sequences for DNA sequencing; and optionally, (d) One or more sample codes for multiplex analysis of samples.

53. The method of claim 51, wherein each capture probe module comprises a capture probe sequence and a tail sequence comprising a sequencing primer binding site at the 5' end of the capture probe module.

54. The method of claim 51, wherein each of the plurality of capture probe sequences hybridizes to a target genetic locus within 200 bp of any other capture probe sequence.

55. The method of claim 51, wherein the one or more capture probe modules are not immobilized to a surface.

56. The method of claim 53, wherein the tail sequence is configured to hybridize to a partner oligonucleotide comprising a member of a binding pair to allow separation and / or purification.

57. The method of claim 56, wherein the partner oligonucleotide comprises biotin.

58. The method of claim 51, wherein the capture probe sequence is 40 nucleotides or 45 nucleotides in length.

59. The method of claim 51, comprising separating the one or more capture probe module-cfDNA clonal complexes to form separated capture probe module-cfDNA clonal complexes, wherein each separated capture probe module-cfDNA clonal complex comprises a labeled cfDNA molecule and a capture probe module.

60. The method of claim 59, comprising enzymatically treating the one or more separated capture probe module-cfDNA clone complexes to produce one or more labeled hybrid nucleic acid molecules.

61. A method as claimed in claim 60, wherein the enzymatic treatment includes using the labeled cfDNA molecule as a template to perform 5'-3' DNA polymerase extension on the capture probe module; wherein each labeled hybrid nucleic acid molecule contains a complementary sequence of the capture probe module and the labeled cfDNA molecule.

62. The method of claim 61, wherein the complementary sequence of the labeled cfDNA molecule comprises an adaptor.

63. The method of claim 60, comprising performing PCR on the labeled hybrid nucleic acid molecule to produce an amplified labeled hybrid nucleic acid molecule.

64. The method of claim 51, wherein the one or more capture probe modules hybridize to a specific cfDNA target region.

65. The method of claim 64, wherein at least one capture probe module hybridizes downstream of a specific cfDNA target region and at least one capture probe module hybridizes upstream of a specific cfDNA target region.

66. A method for capturing and amplifying a target genetic locus, comprising: (a) hybridizing a plurality of capture probe modules to target genetic loci in a labeled cell-free DNA (cfDNA) library to form one or more capture probe module-cfDNA complexes, wherein the one or more capture probe modules hybridize to a specific cfDNA target region, wherein the one or more capture probe modules each comprise a capture probe sequence and a tail sequence, wherein the tail sequence comprises a sequencing primer binding site at the 5' end of the capture probe module, Each capture probe sequence is 40-45 nucleotides in length, and wherein the labeled cfDNA library comprises cfDNA ligated at each end to an adaptor comprising a PCR primer binding site; (b) separating the one or more separated capture probe module-cfDNA complexes from (a); (c) enzymatically treating one or more separated capture probe module / labeled cfDNA complexes from (b); wherein step (c) comprises subjecting the separated capture probe / labeled cfDNA complexes from (b) to 3'-5' exonuclease treatment with an enzyme having 3'-5' exonuclease activity; and (d) performing PCR on the enzymatically treated complex of (c) to produce an amplified hybrid nucleic acid molecule, wherein the amplified hybrid nucleic acid molecule comprises a DNA strand comprising: i. a sequence of a target genetic locus capable of hybridizing to a capture probe sequence, and ii. A sequence complementary to the tail sequence.

67. The method of claim 66, wherein each adaptor comprises (a) PCR primer binding site, (b) a unique read code that identifies each unique sequencing read, (c) one or more sequences for DNA sequencing; and optionally, (d) One or more sample codes for multiplex analysis of samples.

68. The method of claim 66, wherein each of the plurality of capture probe sequences hybridizes to a target genetic locus within 200 bp of any other capture probe sequence.

69. The method of claim 66, wherein the one or more capture probe modules are not immobilized to a surface.

70. The method of claim 66, wherein the tail sequence is configured to hybridize to a partner oligonucleotide comprising a member of a binding pair to allow separation and / or purification.

71. The method of claim 70, wherein the partner oligonucleotide comprises biotin.

72. The method of claim 66, wherein the capture probe sequence is 40 or 45 nucleotides in length.

73. The method of claim 66, wherein at least one capture probe module hybridizes downstream of the specific cfDNA target region and at least one capture probe module hybridizes upstream of the specific cfDNA target region.

74. A method for capturing and amplifying a target genetic locus, comprising: (a) hybridizing a plurality of capture probe modules to target genetic loci in a labeled cell-free DNA (cfDNA) library to form one or more capture probe module-cfDNA complexes, wherein the one or more capture probe modules hybridize to a specific cfDNA target region, wherein the one or more capture probe modules each comprise a capture probe sequence and a tail sequence, wherein the tail sequence comprises a sequencing primer binding site at the 5' end of the capture probe module, Each capture probe sequence is 40-45 nucleotides long. wherein the labeled cfDNA library comprises cfDNA ligated at each end to an adaptor comprising a PCR primer binding site; (b) separating the one or more separated capture probe module-cfDNA complexes from (a); (c) enzymatically treating one or more separated capture probe module / labeled cfDNA complexes from (b); wherein step (c) comprises performing the coordinated action of 5' FLAP endonuclease, DNA polymerization, and nick sealing by DNA ligase; and (d) performing PCR on the enzymatically treated complex of (c) to produce an amplified hybrid nucleic acid molecule, wherein the amplified hybrid nucleic acid molecule comprises a DNA strand comprising: i. Sequence of the target genetic locus capable of hybridizing to the capture probe sequence ii. a sequence complementary to the tail sequence.

75. The method of claim 74, wherein each adaptor comprises (a) PCR primer binding site, (b) a unique read code that identifies each unique sequencing read, (c) one or more sequences for DNA sequencing; and optionally, (d) One or more sample codes for multiplex analysis of samples.

76. The method of claim 74, wherein each of the plurality of capture probe sequences hybridizes to a target genetic locus within 200 bp of any other capture probe sequence.

77. The method of claim 74, wherein the one or more capture probe modules are not immobilized to a surface.

78. The method of claim 74, wherein the tail sequence is configured to hybridize to a partner oligonucleotide comprising a member of a binding pair to allow separation and / or purification.

79. The method of claim 78, wherein the partner oligonucleotide comprises biotin.

80. The method of claim 74, wherein the capture probe sequence is 40 nucleotides or 45 nucleotides in length.

81. The method of claim 74, wherein at least one capture probe hybridizes downstream of the specific cfDNA target region and at least one capture probe module hybridizes upstream of the specific cfDNA target region.

Images