Combination products and kits for detecting Xanthomonas oryzae

Abstract

The present invention relates to the field of molecular biology technology, and in particular to a combination product and a kit for detecting rice bacterial blight pathogen. The combination product comprises an upstream primer, a downstream primer and a probe, and can be used in conjunction with an isothermal nucleic acid amplification system. The combination product and the kit provided by the present invention are used to detect the tale gene, and the detection sensitivity and specificity are both high, and the detection is convenient and time-consuming.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a combination product and a kit for detecting rice bacterial blight pathogen. Background Art

[0002] Bacterial blight of rice is a Gram-negative bacterium of the genus Xanthomonas. It is the pathogen that causes bacterial blight of rice. The disease is distributed in 44 countries and regions, including rice-growing areas on all continents. It is a worldwide disease (EPPO). Bacterial blight of rice is listed as a quarantine pest for imported plants in my country. Rapid and accurate quarantine detection technology can effectively prevent its spread and ensure safe rice production.

[0003] At present, the detection of rice bacterial blight pathogen is mainly based on traditional bioassay, direct isolation and molecular detection of polymerase chain reaction (PCR) method, real-time fluorescence PCR (qRT-PCR) method and serological method, such as the PCR method with iron-containing cell receptor factor gene as the target gene in the national standard, and the qRT-PCR based on lipA and rupH genes that can quantify the total colony count in different parts of rice for simultaneous detection of rice bacterial blight and rice blight (GB / T 28078-2011). However, the PCR and ELISA methods have limited sensitivity and are time-consuming. qRT-PCR relies on expensive detection instruments and is sensitive to inhibitory factors and pollution in the environment, and is prone to false positives or false negatives.

[0004] Recombinase polymerase amplification (RPA) is a new type of multi-enzyme constant temperature nucleic acid amplification technology proposed in 2006, which can quickly and conveniently perform nucleic acid detection and analysis. Under constant temperature conditions of 25-43°C, RPA technology can amplify specific nucleic acid sequences and observe the results within 5-20 minutes. This experiment uses an improved RPA technology called multi-enzyme constant temperature rapid nucleic acid amplification (MIRA), which has better stability and higher fluorescence values ​​in the same time. Summary of the invention

[0005] The first object of the present invention is to provide a combination product comprising:

[0006] Upstream primer: GTGGTTCTTCATGCATGCGATCTCAAAG;

[0007] Downstream primer: ATCCACGTCACATCATCCATCTGCGCATC; and

[0008] Probe: AAGTCGGCGACCTCCTGGGCCAGAACGGGATCATTTGXTAT GCGCAAGTTGT;

[0009] The probe is a probe based on recombinase polymerase amplification technology, the 35th base T is marked with a luminescent group, the 38th base X is an abasic nucleotide analog, the 39th base T is marked with a quenching group, and the 3' end is modified with a blocker; the blocker is used to block the polymerase extension of the probe.

[0010] A second object of the present invention is to provide a kit comprising the combination product as described above.

[0011] The third object of the present invention is to provide the combination product as described above, or the use of the kit as described above in detecting rice bacterial blight pathogen.

[0012] A class of effector proteins of Xanthomonas can act as transcriptional activators, interfere with host physiological and biochemical pathways, and cause diseases. The tale gene encoding this class of effector proteins has a small number of conserved sequences in different species and pathogenic variants of Xanthomonas, but there are differences in specific sequences and gene numbers. The combination product and kit provided by the present invention are used to detect the tale gene, with high detection sensitivity and specificity, and are convenient to detect and take less time. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0014] Figure 1 to Figure 6 The results of detecting different plant pathogens of the genus Xanthomonas according to an embodiment of the present invention;

[0015] Figure 1 :A: strain 7; B: strain 4; C: strain 1; D: strain 3; E: strain 6; F: strain 2; G: strain 5; H: strain 8;

[0016] Figure 2 :A: strain 3; B: strain 1; C: strain 2; D: strain 9; E: strain 10; F: strain 11; G: strain 12; H: sterile water control;

[0017] Figure 3 : A: strain 1; BH: strain 13-19;

[0018] Figure 4 : A: strain 1; BH: strain 20-26;

[0019] Figure 5 : A: strain 1; BH: strain 27-33;

[0020] Figure 6 :A: strain 1; BG: strains 34-39; H: sterile water control;

[0021] Figure 7 The results of testing bacterial solutions of different concentrations of Xanthomonas oryzae pathogen in one embodiment of the present invention are as follows;

[0022] A: The concentration is 8.83×10 5 CFU / ml Rice Xanthomonas oryzae strain 1; B: concentration is 8.83 × 10 4 CFU / ml Rice Xanthomonas oryzae strain 1; C: concentration is 8.83×10 3 CFU / ml Rice Xanthomonas oryzae strain 1; D: concentration is 8.83×10 2 CFU / ml Rice Xanthomonas oryzae strain 1; E: concentration is 8.83×10 1 CFU / ml rice bacterial blight pathogen strain 1; F: concentration of 8.83 CFU / ml rice bacterial blight pathogen strain 1; G: concentration of 8.83×10 -1 CFU / ml oryzae bacterial blight strain 1; H: sterile water control;

[0023] Figure 8 The results of detecting different concentrations of rice bacterial blight pathogen DNA according to an embodiment of the present invention;

[0024] A: The concentration of 7.66ng / μL rice bacterial blight pathogen strain 1 DNA; B: The concentration of 7.66× 10 -1 ng / μL oryzae bacteria strain 1 DNA; C: concentration is 7.66×10 -2 ng / μL oryzae bacteria strain 1 DNA; D: concentration is 7.66×10 -3 ng / μL oryzae bacteria strain 1 DNA; E: concentration is 7.66×10 -4 ng / μL oryzae bacteria strain 1 DNA; F: concentration is 7.66×10 -5 ng / μL oryzae bacteria strain 1 DNA; G: concentration is 7.66×10 -6 ng / μL oryzae bacteria strain 1 DNA; H: sterile water control. DETAILED DESCRIPTION

[0025] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0026] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0027] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and", and undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0028] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0029] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0030] The present invention relates to concentration values, which include fluctuations within a certain range. For example, it can fluctuate within a corresponding precision range. For example, 2% can allow fluctuations within ±0.1%. For values ​​that are large or do not require too fine control, it is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc.

[0031] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0032] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0033] In the present invention, "preferably", "better", "more preferably", and "suitably" are only used to describe implementation methods or embodiments with better effects, and it should be understood that they do not constitute a limitation on the scope of protection of the present invention. In the present invention, "optionally", "optional", and "optional" refer to being optional, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent of each other.

[0034] The present invention relates to a combination product comprising:

[0035] Upstream primer: GTGGTTCTTCATGCATGCGATCTCAAAG;

[0036] Downstream primer: ATCCACGTCACATCATCCATCTGCGCATC; and

[0037] Probe: AAGTCGGCGACCTCCTGGGCCAGAACGGGATCATTTGXTAT GCGCAAGTTGT;

[0038] The probe is a probe based on recombinase polymerase amplification technology, the 35th base T is marked with a luminescent group, the 38th base X is an abasic nucleotide analog, the 39th base T is marked with a quenching group, and the 3' end is modified with a blocker; the blocker is used to block the polymerase extension of the probe.

[0039] In some embodiments, the abasic nucleotide analog is tetrahydrofuran.

[0040] In some embodiments, the blocking moiety is selected from a spacer, a phosphate group, biotin-TEG, or an amine (eg, C6 amine).

[0041] In some embodiments, the spacer is selected from any one of ethylene glycol, C9 spacer (Spacer 9), C18 spacer (Spacer18), dideoxy spacer [1',2'-Dideoxyribose (dSpacer)], and C3 spacer (C3 Spacer).

[0042] In some embodiments, the spacer modification is selected from a C3 spacer.

[0043] Spacer can provide necessary spacing for oligonucleotide labeling to reduce the interaction between the labeling group and the oligonucleotide, and is mainly used in the study of DNA hairpin structure and double-stranded structure. C3 spacer is mainly used to mimic the three-carbon spacing between the 3' and 5' hydroxyl groups of ribose, or to "replace" an unknown base in a sequence. 3'-Spacer C3 is used to introduce a 3' spacer to prevent 3' end exonuclease and 3' end polymerase from functioning.

[0044] In some embodiments, the luminescent group is selected from any one of AMCA, Pacific Blue, Atto 425, BODIPY FL, FAM, Alexa Fluor 488, TET, JOE, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, Aqua Phluor593, Texas Red, Atto 590, Cy5, Quasar 670, Cy5.5 and Cy5.5.

[0045] In some embodiments, the quencher group is selected from any one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse and MGB.

[0046] In some specific embodiments, the luminescent group is FAM, and the quenching group is BHQ.

[0047] It should be noted that, in one aspect, useful primers and probes include upstream primers, downstream primers or probes with the above-mentioned specific sequences provided that have a nucleotide sequence greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity. Such primers and probes are also contemplated to be modified and can be prepared according to standard techniques.

[0048] The term "% identity" in the context of two or more nucleotide sequences or amino acid sequences refers to two or more sequences or subsequences that are identical or have a specified percentage of identical amino acid residues or nucleotides when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example, the % identity is relative to the entire length of the coding region of the sequences being compared.

[0049] For sequence comparison, usually a sequence is used as a reference sequence, and the test sequence is compared with the sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, If necessary, subsequence coordinates are specified, and sequence algorithm program parameters are specified. Then, the sequence comparison algorithm calculates the percentage sequence identity of the test sequence relative to the reference sequence according to the specified program parameters. Search algorithms such as BLAST and PSI-BLAST (Altschul et al., 1990, J Mol Biol 215: 3, 403-410; Altschul et al., 1997, Nucleic Acids Res 25: 17, 3389-402) can be used to determine the percentage identity.

[0050] Primer and probe modifications can be made using known methods. Modified versions of these primer and / or probe sequences can include, by way of non-limiting example, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' end and the 3' end, adding a tail, shortening the sequence, extending the sequence, moving the sequence up or downstream by a few bases, or any combination thereof. In addition to the modifications mentioned above, other modifications that can be applied without significantly negatively affecting the primer / probe function include 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2'-deoxyadenosine, C-5 propynyl-deoxycytidine, C-5 propynyl-deoxyuridine, 2-amino-2'-deoxyadenosine-5'-triphosphate, 2,6-diaminopurine (2-amino-dA), reverse dT, reverse dideoxy-T, hydroxymethyl dC, iso-dC, 5-methyl dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNA's), and include at least one mismatched base at one of the bases, or replace at least one of the bases with an RNA base, to achieve, for example, increased nucleic acid interactions at the 3' end of the mutant-specific primer to increase Tm. The addition of double-stranded stabilizing base modifications has a positive effect on PCR, thereby enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. The modified probe should retain the ability to distinguish between the mutant site to be detected and the wild-type site.

[0051] The invention also relates to a kit comprising a combination as described above.

[0052] The term "kit" refers to any article of manufacture (eg, a package or container) comprising at least one device, and may further comprise instructions for use, supplementary reagents and / or components or assemblies for use in the methods described herein or steps thereof.

[0053] In some embodiments, the kit further comprises one or more of a nucleic acid extraction reagent, a reagent for isothermal nucleic acid amplification, a positive control, and a negative control.

[0054] In some embodiments, the reagents used for isothermal nucleic acid amplification include one or more of a recombinase capable of binding to single-stranded nucleic acid, a single-stranded DNA binding protein, a strand displacement DNA polymerase, an auxiliary protein, exonuclease III, a reverse transcriptase, ATP, a reagent used in an ATP regeneration system, a pH regulator, dNTPs, BSA and / or PEG of various molecular weight distributions, DTT, and water;

[0055] The auxiliary protein is used to change the reversible reaction process of the dissociation and reassociation of the recombinase-primer complex, so that the reaction is more conducive to isothermal nucleic acid amplification.

[0056] The pH regulator may include an acid and a base that do not significantly affect the reaction, and a buffer component (such as Tris and acetate, etc.) Further, the Tris buffer is Tris-tricine, and its working concentration may be about 80 mM to 120 mM.

[0057] In some embodiments, the recombinase is selected from uvsX and / or RecA;

[0058] In some embodiments, the single-stranded DNA binding protein is gp32;

[0059] In some embodiments, the strand displacement DNA polymerase is selected from BSu DNA polymerase and / or Sau DNA polymerase. The DNA polymerase used in the recombinase-mediated nucleic acid isothermal amplification technology is Bacillus subtilis Pol I (Bsu) or Staphylococcus aureus Pol I (Sau), both of which belong to the DNA polymerase I family. The DNA polymerase I family is responsible for the repair of damage during DNA replication, and most of the DNA polymerases in this family have low processivity, that is, the number of polymerization reactions that can be catalyzed by the polymerases of this family when combined with the template is small.

[0060] In some embodiments, the accessory protein is selected from uvsY;

[0061] In the case where a recombinase is used for the chain insertion step, the system may require an energy source. Most of these enzymes utilize ATP as an energy source, but because ATP collates the magnesium ions necessary for enzyme activity, it is advantageous to provide an additional ATP regeneration system rather than increasing the concentration of ATP. In some embodiments, the reagents used in the ATP regeneration system are selected from one or more of magnesium ions, creatine phosphate and its counterion, creatine kinase, myokinase, pyrophosphatase, sucrose, and sucrose phosphorylase.

[0062] As can be seen from the above components, the kit of the present invention can and preferably uses the recombinase polymerase amplification (RPA) method, but can also use improved methods based on this technology, such as recombinase-dependent amplification (RDA) technology.

[0063] In some embodiments, the reagents used for the isothermal nucleic acid amplification are lyophilized powder reagents or mixed liquid reagents.

[0064] Each component is preferably in a lyophilized form, for example, in the form of one or more so-called lyophilized beads. Lyophilized beads are generally understood to refer to a lyophilized material that is pressed into a spherical shape after manufacture (after the manufacture, the material is generally present as a powder). Therefore, the components required for the amplification reaction, particularly various enzymes, nucleic acid components and reaction buffer components, can be provided in a lyophilized form. In this way, the amplification process can be directly started in a very user-friendly manner by adding a sample to be quantified and optionally other required components. In particular, the provision of lyophilized form is very conducive to automated applications.

[0065] According to another aspect of the present invention, it also relates to the use of the above-mentioned combination product or the above-mentioned kit in detecting rice bacterial blight pathogen.

[0066] The reaction principle of the recombinase polymerase amplification reaction system provided by the present invention is as follows: (1) a recombinase-primer complex formed by the combination of the recombinase and the primer in the reaction system searches for a target site in a double-stranded DNA template; (2) after the recombinase-primer complex recognizes the template-specific sequence, it locates and initiates strand exchange, and the single-stranded binding protein then binds to the displaced DNA strand to form a D-Loop structure; (3) the recombinase-primer complex hydrolyzes the dATP in the system to change its conformation, and after the recombinase dissociates, the 3' end of the primer is exposed and recognized by the DNA polymerase, and the DNA polymerase initiates DNA synthesis at the 3' end of the primer according to the template sequence; (4) the DNA polymerase has a strand displacement function, and while the primer is extended, it continues to unwind the double-helix DNA structure of the template, and the DNA synthesis process continues; (5) the amplification of the two primers is completed, that is, a complete amplicon is formed; (6) in the reaction system, dATP is hydrolyzed to provide energy for the recombinase and then becomes dADP, and phosphocreatine can transfer its phosphate group to the dADP molecule under the catalysis of creatine kinase to form dATP, thereby restoring the level of dATP in the reaction system. The above process is repeated continuously, ultimately achieving efficient amplification of nucleic acids.

[0067] In some embodiments, the detection is performed under isothermal amplification conditions, with a temperature of 37° C. to 42° C. and a reaction time of ≥20 min.

[0068] The samples to be tested applicable to the present invention may be various components suspected of containing Xanthomonas oryzae, such as water sources and soil near the rice planting environment, and of course also rice plants and their corresponding tissues. The varieties of rice are not limited, and may be japonica rice, Java rice, indica rice, glutinous rice, mountain rice, leach rice or various infiltration lines. The rice tissue may be cuttings, roots, stems, cells, protoplasts, leaves, pollen, embryos, cotyledons, hypocotyls, anthers, flowers and seeds of rice.

[0069] In some embodiments, the application further comprises the step of isolating DNA (particularly genomic DNA) from a component suspected of containing Xanthophyllotoxin. Isolating DNA fragments from treated materials may include using a separation solvent such as methanol, ethanol, water, acetone or a combination thereof. In some embodiments, a kit of a DNA isolation kit may be used, including, for example, using a Dneasy Mericon food kit (Qiagen, Germantown, MD, USA) or a hexadecyltrimethylammonium bromide (CTAB) DNA isolation protocol. Other separation techniques include lysis, heating, alcohol precipitation, salt precipitation, organic separation, solid phase separation, silica membrane separation, CSCL gradient purification, or any combination thereof.

[0070] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0071] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0072] Example 1

[0073] 1. Materials and Instruments

[0074] Nutrient agar medium preparation: weigh 23g Nutrient Agar and 14g agar powder in a clean wide-mouth bottle, add 1L deionized water and mix well, sterilize in an autoclave at 121℃ for 20 min, pour the plate in a sterile operating table, cool and solidify into NA solid medium, invert for later use. TIANGEN Bacterial Genomic DNA Extraction Kit (centrifugal column type), Weifang Amp Future Constant Temperature Fluorescence Detector (WL-16-Ⅱ), Weifang Amp Future Constant Temperature DNA Rapid Amplification Kit (fluorescence type).

[0075] 2. Experimental Methods

[0076] 1. Primer specificity experiment: The required strains are shown in Table 1, 1 to 10 are different rice bacterial blight strains, 11 to 29 are other bacteria of the same genus, i.e., Xanthomonas, and 30 to 39 are other bacteria that can also infect rice. Take 2 μL of bacterial solution from each strain as a template, and perform fluorescent RPA detection using the primer probes shown in Table 2 according to the instructions of the Amp Future kit.

[0077] Table 1. Test strains for primer specificity experiments

[0078]

[0079]

[0080] Table 2 Primer and probe sequences required for fluorescence RPA detection

[0081]

[0082] 2. Primer sensitivity experiment: Take the rice bacterial blight pathogen NCPPB793 and the DNA extracted by the kit method and dilute it 10 times with sterile water, and take 2 μL of each concentration for fluorescence RPA test.

[0083] 3. The detection method used in this embodiment includes the following steps:

[0084] (1) Fluorescence RPA amplification: According to the method of the Amp Future kit,

[0085] ① Add 29.4 μL of buffer A to each dry powder reaction tube.

[0086] ② Add 2μL upstream primer, 2μL downstream primer and 0.6μL probe to each reaction tube.

[0087] ③ Add 11.5 μL ddH2O and 2 μL nucleic acid template to the reaction tube in sequence.

[0088] ④Finally, add 2.5 μL of buffer B to the reaction tube and mix thoroughly by inverting the tube 10 times.

[0089] ⑤ After mixing, the reaction solution was thrown to the bottom of the reaction tube (or centrifuged) and immediately placed in the fluorescence detection equipment. The fluorescence equipment was set to a constant temperature of 39°C, and the FAM channel fluorescence value was collected every 30 seconds. The reaction time was 20 minutes.

[0090] (2) Primer specificity test experiment: Different strains of rice bacterial blight pathogen, other pathogens of the same genus, i.e., Xanthomonas, and other species of bacteria on rice were used, 10, 19, and 10, respectively, as shown in Table 1. 2 μL of each was added as a template to the above reaction system for fluorescence RPA amplification and signal acquisition.

[0091] (3) Sensitivity test experiment of bacterial blight pathogen: The rice bacterial blight pathogen strain NCPPB793 was streaked and purified on nutrient agar plates. After 48 h of culture, the colonies were washed with sterile water and the bacterial solution was collected and shaken evenly. The collected bacterial solution was diluted tenfold with sterile water to obtain an initial bacterial count of 0.1 to 10 -8 40 μL of bacterial solution was taken and spread on nutrient agar plate. After 48 hours of culture, the number of colonies was calculated and converted to colony CFU. Seven groups of bacterial solutions with appropriate gradients were taken for fluorescence RPA amplification and signal collection.

[0092] (4) Extraction of DNA from Xanthoceras oryzae: DNA from Xanthoceras oryzae strain NCPPB793 was extracted using a bacterial genomic DNA extraction kit. After sequencing and identification, the concentration was measured three times using a Nano Drop 2000 ultra-micro UV spectrophotometer. The average of the three results was taken as the final concentration.

[0093] (5) DNA sensitivity test of bacterial blight pathogen: The above extract was diluted 10 times with ddH2O to obtain an initial concentration of 10 -1 ~10 -6The diluted solution was used for fluorescence RPA amplification and signal collection.

[0094] (6) Result determination: The fluorescence signal threshold was set to 100, the determination value was set to 2, and a CT value below 35 and a peak shape that was part of an S-shaped curve was determined to be a positive result.

[0095] 3. Experimental Results

[0096] The CT values ​​of the real-time fluorescence RPA detection of bacterial blight-specific experiments are shown in Table 3, and the corresponding fluorescence value signal is shown in Figures 1 to 6 The sensitivity test of primers was carried out using bacterial solution and DNA of rice bacterial blight pathogen NCPPB793. The corresponding bacterial solution concentration was calculated by plate counting method. The negative control was sterile water. The CT value results are shown in Table 4, and the corresponding fluorescence value signal is shown in Figure 4. Figures 7 and 8 As shown in the table, the detection limit of real-time fluorescence RPA for Xanthomonas oryzae bacteria is 8.83 CFU / ml, and the detection limit of DNA is 7.66×10 -5 ng / μL.

[0097] Table 3 Real-time fluorescence RPA specificity test results

[0098]

[0099] Table 4 Results of real-time fluorescence RPA amplification of bacterial suspensions of Xanthomonas oryzae at different concentrations and DNA

[0100]

[0101] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims, and the description and drawings can be used to interpret the content of the claims.

Claims

1. Combination products, including: Upstream primer: GTGGTTCTTCATGCATGCGATCTCAAAG; Downstream primer: ATCCACGTCACATCATCCATCTGCGCATC; and Probe: AAGTCGGCGACCTCCTGGGCCAGAACGGGATCATTTGXTATGCGCAA GTTGT; The probe is based on recombinase polymerase amplification technology, the 35th base T is labeled with a luminescent group, the 38th base X is tetrahydrofuran, the 39th base T is labeled with a quenching group, and the 3' end is modified with a blocker; the blocker is used to block the polymerase extension of the probe.

2. The combination product according to claim 1, wherein the blocking agent is a spacer.

3. The combination product according to claim 2, wherein the blocking agent is a C3 inter-arm. The combination product according to claim 1 , wherein the luminescent group is FAM and the quenching group is BHQ.

5. A kit comprising the combination product according to any one of claims 1 to 4.

6. The kit according to claim 5, further comprising one or more of a nucleic acid extraction reagent, a reagent for isothermal nucleic acid amplification, a positive control and a negative control.

7. The kit according to claim 6, wherein the reagents used for isothermal nucleic acid amplification include one or more of a recombinase capable of binding to single-stranded nucleic acid, a single-stranded DNA binding protein, a strand displacement DNA polymerase, an auxiliary protein, exonuclease III, a reverse transcriptase, ATP, a reagent used for an ATP regeneration system, a pH regulator, dNTPs, BSA and / or PEG of various molecular weight distributions, DTT, and water; The auxiliary protein is used to change the reversible reaction process of the dissociation and reassociation of the recombinase-primer complex, so that the reaction is more conducive to isothermal nucleic acid amplification.

8. The kit according to claim 7, wherein the recombinase is selected from uvsX and / or RecA. The kit according to claim 7 , wherein the single-stranded DNA binding protein is gp32.

10. The kit according to claim 7, wherein the strand displacement DNA polymerase is selected from BSu DNA polymerase and / or Sau DNA polymerase.

11. The kit according to claim 7, wherein the auxiliary protein is selected from uvsY.

12. The kit according to claim 7, wherein the reagents used in the ATP regeneration system are selected from one or more of creatine phosphate and its counterion, creatine kinase, myokinase, pyrophosphatase, sucrose and sucrose phosphorylase. The kit according to claim 12 , wherein the counter ion is selected from magnesium ions. 14 . The kit according to claim 6 , wherein the reagent used for isothermal nucleic acid amplification is a lyophilized powder reagent or a mixed liquid reagent.

15. Use of the combination product according to any one of claims 1 to 4, or the kit according to any one of claims 5 to 14 in detecting Xanthomonas oryzae.

16. The use according to claim 15, wherein the detection is carried out under the condition of constant temperature amplification, the temperature is 37°C to 42°C, and the reaction time is ≥20 min.

Images