Application of transcription factor CsS40 gene in regulating caffeine synthesis in tea plants
By overexpressing the transcription factor CsS40 in tea trees and combining with the TCS4 gene promoter, the TCS4 gene expression is activated, which solves the problem of insufficient synthesis and regulation mechanism of caffeine in tea trees and improves the content of caffeine in tea trees and tobacco.
Patent Information
- Application Number
- CN202210672553.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-15
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2042-06-15
AI Technical Summary
In the prior art, there is insufficient research on the gene regulation mechanism of the synthesis path of cereal caffeine in tea tree, especially the interaction between transcription factors and promoters is less studied, which affects the regulatory effect of cereal caffeine synthesis.
By constructing a recombinant vector, the transcription factor CsS40 gene was inserted into the tea tree and overexpressed. CsS40 was used to bind to the caffeine synthetase TCS4 gene promoter to activate the expression of the TCS4 gene, thereby promoting the synthesis of caffeine in the tea tree.
The content of caffeine in tea trees was increased, and the heterologous overexpression of the CsS40 gene was achieved in tobacco through genetic transformation technology, promoting tobacco aging, and verified the effectiveness of CsS40 in caffeine synthesis regulation.
Smart Images

Figure GDA0005388052060000061 
Figure GDA0005388052060000091 
Figure GDA0005388052060000101
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant molecular biotechnology and genetic engineering technology, and relates to the application of a transcription factor CsS40 gene in promoting the regulation of caffeine synthesis in tea plants. Background Art
[0002] The tea plant (Camellia sinensis (L.) O. Kuntze) is one of the few higher plants in nature that is rich in caffeine. While recent research into the basic pathways of caffeine biosynthesis in tea plants has yielded remarkable results, both domestically and internationally, in terms of the cloning of key genes involved in caffeine biosynthesis, many important scientific questions remain to be elucidated. At the genetic level, studies on the regulatory mechanisms underlying the interactions between promoters and transcription factors, which activate or inhibit gene transcription, and on the relationship between cis-acting elements upstream of the caffeine synthase gene (TCS) and transcription factors are limited. Leaf senescence is the final stage of leaf development before cell death. This process is characterized by the degradation of cellular material and the subsequent regeneration of leaves and seed development. Senescence is not a chaotic decomposition, but rather a highly organized process requiring the expression of specific genes. To date, the S40 gene family has been extensively studied. The barley HvS40 gene and the Arabidopsis AtS40-3 gene are also induced during natural aging and treatment. The OSS40-1, OsS40-2, OsS40-12 and OsS40-14 genes in rice have potential cross-regulatory effects between abiotic, biotic and developmental aging. Summary of the Invention
[0003] The present invention aims to provide a method for using the transcription factor CsS40 gene to regulate caffeine synthesis in tea plants. CsS40 plays a crucial regulatory role in plant aging. Transformation experiments using overexpression vectors in this invention demonstrate that CsS40 promotes caffeine synthesis. This invention plays a significant role in further exploring mechanisms for regulating caffeine synthesis and aging in existing tea varieties, and also provides new insights into the molecular mechanisms of tea plant responses to abiotic stress.
[0004] The invention discloses an application of transcription factor CsS40 in promoting the regulation of caffeine synthesis in tea plants. The amino acid sequence of the protein encoded by the transcription factor CsS40 is shown in SEQ ID No. 2.
[0005] The invention discloses an application of the transcription factor CsS40 in genetic engineering breeding for improving tea leaf quality. The amino acid sequence of the protein encoded by the transcription factor CsS40 is shown in SEQ ID No. 2.
[0006] The nucleotide sequence of the transcription factor CsS40 is shown in SEQ ID No. 1.
[0007] The application is that the transcription factor CsS40 binds to the TEA022575 (TCS4) gene promoter, thereby activating the expression of the TCS4 gene, thereby increasing the caffeine content.
[0008] The application is to construct a recombinant vector of the transcription factor CsS40, and to transfer the vector into tea plants to overexpress the vector and callus the tea plants, thereby increasing the caffeine content.
[0009] The recombinant vector uses pSH737-35S as the original vector, and inserts the transcription factor CsS40 into the multiple cloning site of pSH737-35S.
[0010] Preferably, the transcription factor CsS40 is inserted between the Xba I and Kpn I restriction sites on the original vector pSH737-35S, and is named pSH737-35S-CsS40.
[0011] The recombinant vector was prepared by the following method: using tea plant leaf cDNA as a template and combining with a primer pair to obtain a PCR product of CsS40; pSH737-35S was double-digested with Xba I and Kpn I, recovered and ligated to obtain a recombinant vector named CsS40-pSH737-35S, and the primer pair was primer F: ACGGGGGACGAGCTCGGTACCATGGCGAAGGGTCG, primer R: GCTCACCATGTCGACTCTAGAGCCATTAAATCCGGTTTG.
[0012] The present invention provides a transcription factor, CsS40, that regulates caffeine synthesis in tea plants, belonging to the fields of plant molecular biotechnology and genetic engineering. The CsS40 has the nucleotide sequence shown in SEQ ID NO. 1. In the present invention, the transcription factor CsS40 can bind to the promoter of the caffeine synthase TCS4 gene, activating TCS4 gene expression and thereby promoting caffeine accumulation in tea plants. Overexpression of the CsS40 gene using genetic transformation techniques has been shown to increase caffeine content in tea plants, and heterologous overexpression of the CsS40 gene in tobacco plants has been shown to effectively promote tobacco aging. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 For promoter bait vector,
[0014] Figure 2 is the result of self-activation test of bait colony.
[0015] Figure 3The screening efficiency of the TCS gene promoter library, where the dilution times from left to right are 10 times, 100 times, 1000 times,
[0016] Figure 4 Spot the transformants for positive clones.
[0017] Figure 5 This is the distribution map of cis-acting elements in the CsS40 gene promoter.
[0018] Figure 6 It is the conserved domain of CsS40.
[0019] Figure 7 is the relative molecular mass and isoelectric point of CsS40,
[0020] Figure 8 To predict the subcellular localization of CsS40,
[0021] Figure 9 The subcellular carrier map of CsS40.
[0022] Figure 10 The subcellular localization of CsS40 protein in tobacco leaf cells.
[0023] Figure 11 This is the interaction detection between tea tree transcription factor CsS40 and TCS4 promoter.
[0024] Figure 12 This is the map of the CsS40 overexpression vector.
[0025] Figure 13 For the callus of CsS40 transgenic tea trees,
[0026] Figure 14 GUS staining of CsS40 tea plant callus, where WT: wild type tea plant callus,
[0027] Figure 15 PCR identification of CsS40 tea plant callus, where TP: overexpressed tea plant callus, WT: wild type callus, P: plasmid positive control,
[0028] Figure 16 Caffeine content of wild type and transgenic callus,
[0029] Figure 17 Genetic transformation of tobacco with the CsS40 gene, including A: co-cultivation; B: callus differentiation; C: formation of regenerated shoots; D: tobacco rooting; E: tobacco transplanting (first from the left: wild type, second from the left: transgenic lines),
[0030] Figure 18GUS staining of CsS40 transgenic tobacco, where WT: wild-type tobacco plant; 1-20: transgenic tobacco plant 1-20,
[0031] Figure 19 For PCR identification of CsS40 transgenic tobacco,
[0032] Figure 20 is the xanthine content of transgenic tobacco,
[0033] Figure 21 is the hypoxanthine content of transgenic tobacco,
[0034] Figure 22 The changes of physiological indicators of wild type and transgenic tobacco, including A: chlorophyll content; B: superoxide dismutase activity; C: malondialdehyde content; D: lipoxygenase activity,
[0035] Figure 23 is the expression level of CsS40 gene in transgenic tobacco, where WT01-03 represents different wild-type tobacco, and TP01-20 represents different transgenic plants
[0036] Figure 24 This is the in vitro culture of transgenic tobacco, where serial numbers 1-20 represent different transgenic plants;
[0037] Figure 25 This is the in vitro culture of wild-type tobacco, where serial numbers 1-3 represent different wild-type tobacco. DETAILED DESCRIPTION
[0038] The present invention is further described with reference to the accompanying drawings and embodiments.
[0039] The present invention successfully obtained a bait strain by constructing a pHIS2-575 bait expression vector driven by the TCS4 gene (TEA022575) promoter and transforming the Y187 yeast strain. Nine positive clones were screened from TCS4 using a yeast one-hybrid assay, and an unknown tea plant protein, named CsS40, was detected in the positive clones.
[0040] The present invention provides a transcription factor CsS40 involved in the regulation of caffeine synthesis in tea plants. The nucleotide sequence of the CsS40 is shown in SEQ ID NO.1. The transcription factor CsS40 belongs to the cell aging regulator S40 family.
[0041] In the present invention, the PCR amplification template of CsS40 is preferably tea plant cDNA; the tea plant cDNA is preferably synthesized by reverse transcription of tea plant total RNA; the present invention has no special requirements for the synthesis method of tea plant cDNA, and conventional plant cDNA synthesis methods in the art can be used. In the specific implementation process of the present invention, the TAKARA kit is used for synthesis.
[0042] The present invention provides a protein encoded by the transcription factor CsS40 described in the above scheme, wherein the amino acid sequence of the protein is shown in SEQ ID NO.2; the protein contains 212 amino acids; and the protein has a Senescnece_reg domain.
[0043] The present invention also provides a recombinant vector comprising the transcription factor CsS40 described in the above scheme; the recombinant vector preferably uses pSH737-35S as the original vector, and the transcription factor CsS40 is inserted into the multiple cloning site of pSH737-35S; the CsS40 is inserted between the XbaI and KpnI restriction sites on the original vector pSH737-35S.
[0044] In the present invention, the recombinant vector is preferably prepared by the following method: using cDNA as a template and combining a primer pair to obtain a PCR product of CsS40; pSH737-35S is double-digested with XbaI and KpnI, recovered and ligated to obtain pSH737-35S-CsS40, and the primer pair is primer F: ACGGGGGACGAGCTCGGTACCATGGCGAAGGGTCG, primer R: GCTCACCATGTCGACTCTAGAGCCATTAAATCCGGTTTG.
[0045] In the present invention, the recovery is preferably performed using a TAKARA gel recovery kit; the ligation kit is preferably performed using a Vazyme one-step cloning kit.
[0046] The present invention also provides a recombinant microorganism comprising the recombinant vector described in the above scheme; the recombinant microorganism preferably uses Agrobacterium as the original microorganism, and the recombinant vector pSH737-35S-CsS40 is transferred into the Agrobacterium; the present invention has no special restrictions on the method of transfer, and conventional transformation methods in the field can be used. In the specific implementation process of the present invention, the freeze-thaw method is used for transformation.
[0047] In the present invention, the transcription factor CsS40 can bind to the promoter of the caffeine synthase TCS4 gene involved in the synthesis of caffeine in tea plants, thereby activating the expression of the TCS4 gene.
[0048] The present invention also provides the application of the transcription factor CsS40 described in the above scheme in tea tree breeding; the application is preferably the application of the transcription factor CsS40 in genetic engineering breeding for improving tea quality.
[0049] The following describes in detail a transcription factor CsS40 involved in the regulation of caffeine synthesis in tea plants and its application provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0050] Related culture medium preparation:
[0051] (1) LB medium: 10 g / L tryptone + 10 g / L sodium chloride + 5 g / L yeast extract + 7.5 g / L agar powder
[0052] (2) YEP solid medium: 10g / L peptone + 10g / L yeast extract + 5g / L sodium chloride + 7.5g / L agar powder
[0053] (3) YEP liquid medium: 10g / L yeast extract + 10g / L peptone + 5g / L sodium chloride
[0054] (4) Tobacco co-cultivation medium: 4.432 g / L MS + 1.00 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 7.5 g / L agar powder
[0055] (5) Tobacco screening medium: 4.432 g / L MS + 1.00 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 7.5 g / L agar powder + 100 mg / L timentin + 100 mg / L kanamycin
[0056] (6) Tobacco rooting medium: 2.216 g / L MS + 20 g / L sucrose + 7.5 g / L agar powder + 100 mg / L timentin + 100 mg / L kanamycin
[0057] (7) Tea tree co-cultivation medium: 4.432 g / L MS, 30 g / L sucrose, 0.5 mg / L 6-BA, 1.0 mg / L NAA, and 7.5 g / L agar powder
[0058] (8) Tea callus screening medium: 4.432 g / L MS + 30 g / L sucrose + 0.5 mg / L 6-BA + 1.0 mg / L NAA + 7.5 g / L agar powder + 200 mg / L timentin + 30 mg / L kanamycin
[0059] (9) Yeast defective medium: 8g / L SD-TL / SD-TLH + 20g / L agar powder + 40g / L glucose
[0060] The biological materials involved in the following experiments are all commercially available.
[0061] Example 1 Screening of TCS4 gene promoter-interacting transcription factors
[0062] (1) Experimental methods
[0063] 1. Construction of TCS4 gene promoter sequence bait vector
[0064] To construct the TCS4 gene promoter sequence (SEQ ID NO. 3) onto the yeast one-hybrid bait vector pHIS2, the vector pMD18-T-TCS (1) containing the target gene (the construction of the gene vector was completed by Shanghai Huajin Biotechnology Co., Ltd.) was digested to obtain the cloned fragment, which was then ligated with the yeast one-hybrid bait vector pHIS2 digested with the corresponding enzymes. The reagents used for fragment and vector digestion were EcoR I and Sac I double enzyme digestion (TAKARA endonucleases), the reagent used for enzyme digestion product recovery was a gel recovery kit (Axygen), and the reagent used for fragment and vector ligation was a DNA Ligation Kit (TOYOBO). After the bait vector was constructed, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification.
[0065] 2. Preparation and transformation of competent yeast
[0066] 1) Preparation of competent yeast:
[0067] a) Inoculate a single colony of Y187 yeast from a YPDA plate into 4 ml of YPDA liquid medium. Incubate in a constant temperature incubator at 30°C and 225 rpm with shaking for 18-20 hours until the OD600 of the culture is greater than 1.5, generally around 4.
[0068] b) Transfer the cultured YDPA medium to 50 ml of YPDA liquid medium to an initial OD600 of 0.2. Then, incubate the culture in a constant temperature incubator at 30°C and 225 rpm with shaking for 4-5 hours until the OD600 of the culture reaches 0.6.
[0069] c) The cultured yeast was collected by centrifugation at room temperature, 1000 g, and 5 min.
[0070] d) Resuspend the collected cells in 20 ml of sterile water and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.
[0071] e) Resuspend the cells in 5 ml of 0.1 M LiOAc and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.
[0072] f) Resuspend the cells in 500 μl of 0.1 M LiOAc and dispense into 1.5 ml microcentrifuge tubes. Add 50 μl of liquid to each microcentrifuge tube, which is the competent medium of Y187 yeast.
[0073] 2) Transformation of yeast bait strains:
[0074] a) To the 1.5 ml microcentrifuge tube containing the competent yeast from the previous step, add 240 μl of 50% PEG 3350, 36 μl of 1 M LiOAc, 5 μl of salmon sperm DNA (10 mg / ml), and 5 μl of plasmid DNA (300 ng / μl), in that order. Gently pipette through the tube and then vigorously shake on an oscillator until all reagents and the bacterial suspension are thoroughly mixed. Shake for approximately 1 minute.
[0075] b) Incubate in a 30°C water bath for 30 min.
[0076] c) Heat shock in a 42°C water bath for 25 min.
[0077] d) Resuscitate in a 30°C water bath for 1 h.
[0078] e) Harvest the bacteria by centrifugation at room temperature, 700 rpm, 5 min, and discard the supernatant.
[0079] f) Add 200 μl of sterile water to each transformed centrifuge tube and gently pipette to gently suspend and mix the bacterial solution, and then spread it onto SD-T defect plates.
[0080] g) Culture the cells in a constant temperature incubator at 30°C for 3-4 days.
[0081] 3) The transformation method for negative and positive controls is the same as that for yeast bait strains, except that AD and BD plasmids are added simultaneously and the corresponding defective plates are coated. The plasmid information, transformation plates, and detection plates are shown in Table 1.
[0082] Table 1 Negative control and positive control yeast strain transformation information
[0083]
[0084] 3. Self-activation detection
[0085] Three single colonies were randomly selected from each of the TCS4 gene promoter, negative control, and positive control transformation reaction plates. These were diluted with sterile water and plated onto SD-TLH-deficient plates containing no His, 50 nM 3AT, and 100 nM 3AT. The plates were then incubated at 30°C for 3 days. The growth of the colonies on each plate was recorded by photographing them.
[0086] 4. Yeast One-Hybrid Screening Library
[0087] The yeast one-hybrid library was constructed using tea leaves. Competent yeast strains were prepared using Y187 yeast transformants containing the correct pHIS2 bait plasmid. The constructed library plasmid, pGADT7 (the yeast one-hybrid library was constructed by other members of our research group), was then transformed into these three competent yeast strains and plated onto SD-Trp-Leu-His-deficient medium supplemented with 50 mM 3AT. The specific transformation method for the library DNA is as follows:
[0088] a) Pick the monoclonal bacteria that grow normally on the SD-T plate and inoculate them into 50 ml of liquid SD-T medium. Then, incubate the culture in a constant temperature incubator at 30°C and 225 rpm with shaking for 18 hours.
[0089] b) Transfer 50 ml of SD-T liquid medium containing normal bacterial growth to 500 ml of YPDA liquid medium to an initial OD600 of 0.2. Incubate the culture in a constant temperature incubator at 30°C and 225 rpm with shaking for 4-5 hours until the OD600 reaches 0.6.
[0090] c) Centrifuge the cultured yeast to collect the yeast and discard the supernatant. Centrifugation conditions: room temperature, 1000 rpm, 5 min.
[0091] d) Resuspend the collected cells in 30 ml of sterile water and centrifuge at room temperature, 1000 rpm, for 5 min, to collect the cells and discard the supernatant.
[0092] e) Resuspend the collected cells in 20 ml of 0.1 M LiOAc and centrifuge at room temperature at 1000 rpm for 5 min to collect the cells and discard the supernatant.
[0093] f) Resuspend the collected cells in 10 ml of 0.1 M LiOAc and centrifuge to collect the cells. Discard the supernatant. Centrifuge at room temperature, 1000 rpm, for 5 minutes. This will now make the Y187 yeast containing the correct pHIS2 bait plasmid competent.
[0094] g) To the centrifuge tube containing the competent yeast, add 9.6 ml of 50% PEG 3350, 1.44 ml of 1 M LiOAc, 3 mg of single-stranded salmon sperm DNA, and 25 μg of library plasmid DNA. Gently pipette and shake vigorously on a shaker until all reagents and the bacterial solution are thoroughly mixed. Shake for approximately 1 minute.
[0095] h) Incubate in a 30°C water bath for 30 min.
[0096] i) Heat shock in a 42°C water bath for 25 min.
[0097] j) Resuscitate in a 30°C water bath for 1 h.
[0098] k) Centrifuge the yeast culture and collect the yeast, discarding the supernatant. Centrifuge at room temperature, 1000 rpm, for 5 minutes. Add 8 ml of sterile water to each transformed centrifuge tube and gently pipette to gently resuspend and mix the culture. Take 20 μl of the culture and make serial dilutions. Plate 200 μl of the culture onto 4 SD-TL high-efficiency plates. Plate 40 plates in total, using 200 μl of the culture, onto SD-TLH-deficient plates supplemented with 50 mM 3AT.
[0099] l) Culture the cells in a constant temperature incubator at 30°C for 3-4 days, observe the transformation results on the SD-TL efficiency plate, and record the transformation efficiency.
[0100] m) Calculate the screening efficiency based on the number of transformants on the efficiency plate.
[0101] n) To eliminate background growth from positive clones, on day 3 of culture, use a homemade flannel copyer to copy-clear the plate onto an SD-TLH-deficient plate supplemented with 50 mM 3AT. Continue incubation at 30°C for 7-14 days. Select transformant colonies that have regrown on the new plate and inoculate them onto SD-TL-deficient plates for 2-3 days before testing.
[0102] o) After 14 days of culture, positive clone transformants grown on SD-TL-deficient plates were diluted with sterile water and spotted onto SD-TL and SD-TLH-deficient plates supplemented with 300 mM 3AT to detect His reporter gene expression in positive clones. The plates were cultured in a constant temperature incubator at 30°C for 3-4 days.
[0103] 5. Yeast Positive Clone DNA Extraction and Sequencing
[0104] First, positive clones identified through His reporter gene detection were inoculated into SD-TL liquid culture medium and cultured in a constant temperature incubator at 30°C and 225 rpm for 18 hours. The yeast plasmids were then extracted using a yeast miniprep kit (Solarbio). The extracted yeast plasmids were then transformed into fresh competent E. coli Top10 cells for amplification.
[0105] Preparation steps of fresh competent E. coli Top10:
[0106] a) Preparation of seed solution: A single clone of E. coli Top10 growing normally on an LB plate was inoculated into 3 ml of LB liquid medium and cultured overnight in a constant temperature incubator at 37°C and 220 rpm with shaking for 16 h.
[0107] b) Inoculate 1 ml of the cultured seed solution into 100 ml of LB liquid medium and culture in a constant temperature incubator at 37°C and 220 rpm with shaking for 2 hours.
[0108] c) Remove the bacterial suspension from the incubator and wait for it to cool to room temperature before centrifuging to collect the bacteria, or place it on ice for a period of time before centrifuging to collect the bacteria. Discard the supernatant. Centrifugation conditions: 4°C, 5000 rpm, 5 min.
[0109] d) Resuspend the collected cells in 10 ml of 0.1 M MgCl2 and gently pipette to mix thoroughly. Place on ice and incubate for 10 min-1 h.
[0110] e) Collect the bacteria by centrifugation and discard the supernatant. Centrifugation conditions: 4°C, 5000 rpm, 5 min.
[0111] f) Resuspend the collected cells in 4 ml of 0.1 M CaCl2 and gently pipette to mix thoroughly. Place on ice and incubate for 30 minutes. At this point, the competent culture is ready. Aliquot 4 ml of competent culture into 1.5 ml microcentrifuge tubes, with 100 μl of competent culture per tube.
[0112] h) Each yeast-extracted plasmid was transformed with 100 μl of competent medium.
[0113] The top 10 colonies containing positive clones were transferred to LB liquid culture containing Amp for amplification, and the plasmid was extracted using the Axygen plasmid mini-extraction kit. The plasmid was sent to Wuhan Jinkairui Bioengineering Co., Ltd. for DNA sequencing.
[0114] 6. Bioinformatics Analysis of Positive Clone Sequencing Results
[0115] The positive clone sequences were first aligned to the tea plant gene data using Blast+ to obtain complete sequence results. The complete sequences were submitted to the Conserved Domain Database (https: / / www.ncbi.nlm.nih.gov / cdd) and pfam (http: / / pfam.xfam.org / ) for analysis of their conserved domains. The plantTFDB database was then compared to confirm whether they were transcription factors. The ExPASy-ProtParm tool (http: / / www.expasy.org / protparam) was used to analyze and screen the basic physicochemical properties and amino acid composition of the protein.
[0116] (2) Experimental results
[0117] 1. Bait vector construction
[0118] The TCS4 promoter sequence was amplified to obtain the target fragment, and the results showed that the target fragment was in the expected size. The TCS4 gene promoter fragment was inserted into the pHIS2 plasmid, and the expression vector was successfully constructed ( Figure 1 )pHIS2-TCS575. The company's sequencing results showed that the sequenced fragments were correct, indicating that the bait vector was constructed correctly. The pHIS2 plasmid containing the correct sequenced fragment was transferred into Y187 yeast using the heat shock method to obtain bait yeast strains. All three bait yeast strains survived on SD-TRP-deficient medium, demonstrating TRP gene expression and the successful transfer of the pHIS2 plasmid into the Y187 yeast strain, ready for the next step of the experiment.
[0119] 2. Bait vector self-activation detection
[0120] 3AT is a competitive inhibitor of yeast His protein synthesis and is used to inhibit leaky expression of His genes. After the vector carrying the TCS4 promoter was transformed into Y187 yeast, the number of transformants needed to be detected and the growth rate calculated. The results are as follows ( Figure 2 ): The growth rate of the TCS575 negative control on the SD-TLH plates supplemented with 50mM and 100mM 3AT was 0, indicating that the growth of the TCS4 transformants was significantly inhibited on the SD-TLH plates supplemented with 50mM and 100mM 3AT, and the growth ratio was the same as that of the negative control, both of which were 0, indicating that the expression leakage of the His reporter gene can be inhibited under 50mM 3AT. Therefore, the yeast one-hybrid screening library was performed based on 50mM 3AT.
[0121] 3. Calculation of Yeast One-Hybrid Screen Library Efficiency
[0122] After eliminating the self-activation phenomenon, the Y187 yeast transformant containing the correct pHIS2-172NX bait plasmid was used as the recipient bacteria to prepare the competent state. The successfully constructed library plasmid was transformed into the yeast strain containing pHIS2-TEA022575 and the bait vector and plated. The screening efficiency of the three transformations was calculated based on the growth data of the transformants on the efficiency plate ( Figure 3 Table 2): The pHIS2-TEA022575 bait vector had a transformation efficiency of 4.44×10⁴ / μg. The Clontech Yeast Protocols Handbook recommends that positive clones be screened when the screening efficiency exceeds 1.0×10⁴ / μg. Both bait vectors had screening efficiencies exceeding 1.0×10⁴ / μg, allowing for further experiments.
[0123] Table 2 TCS gene promoter library screening efficiency Plate number of transformants and transformation efficiency
[0124]
[0125] Note: The formula for calculating the total number of transformants = (10-fold number of transformants / 20 + 100-fold number of transformants / 2 + number of transformants after 1000-fold dilution / 0.2) / 3*8000
[0126] Transformation efficiency calculation formula = total number of transformants / 25μg
[0127] 4. Detection of His reporter gene in positive clones
[0128] In order to eliminate the interference of background growth colonies, on the third day of culture, the screening library plate was photocopied and cleaned with flannel cloth, and then cultured for 7-14 days. A total of 354 positive clone transformants were picked from the screening library plate and transferred to the SD-TL defective plate for continued culture for 2-3 days. The transformant colonies that grew again were picked in batches for the next step of detection. The grown transformants were diluted with sterile water and spotted on SD-TL and SD-TLH+300mM 3AT defective plates, and cultured at a constant temperature of 30°C for 3-4 days to obtain positive clone transformants. The 17 initial positive clones obtained from the pHIS2-TEA022575 screening library were transferred to the SD-TL plate for culture, and then these 17 normally growing positive clones, negative controls and positive controls were spotted on the screening plates of SD-TL and SD-TLH+300Nm3AT, respectively. The results are as follows. Figure 4As shown, all colonies can grow normally on the SD-TL screening plate, while the negative control can grow normally on the SD-TL screening plate because the His reporter gene is not activated, but cannot grow normally on the screening plate lacking histidine and supplemented with 300nM 3AT. Therefore, among the initial positive clones, those that can grow vigorously on the screening plate supplemented with 3AT have activated the His reporter gene.
[0129] Identification results such as Figure 4 As shown, 12 out of 17 positive clones obtained from the pHIS2-TEA022575 screening library grew normally on the screening plate lacking histidine and supplemented with 300 nM 3AT, and passed the His reporter gene assay. Strains 1, 2, 5, 6, 14, and 24 could not grow normally and could not pass the His reporter gene assay.
[0130] Therefore, a total of 9 positive clone transformants were obtained by yeast single hybrid screening of the TCS4 gene. In order to identify the 9 positive clones screened, these positive clone plasmids were recovered from the yeast cells for DNA extraction and sequencing, and BLAST comparison analysis was performed with the sequences in the GenBank database. First, the positive clone strains were respectively inoculated into SD-TL liquid culture medium, and after shaking culture overnight, the yeast plasmids were extracted using a yeast small amount extraction kit (Solabo Company). Then, the extracted yeast plasmids were transformed into fresh competent Escherichia coli Top10 for amplification. After extracting the positive clone plasmids from the 9 yeast positive colonies screened from the library, and performing DNA sequencing and BLAST comparison, the results showed that these 9 positive clones belonged to the coding genes of 9 different proteins. The sequencing results are shown below (Table 3):
[0131] Table 3 Sequencing results of positive clones (TEA022575)
[0132]
[0133]
[0134] Example 2 Bioinformatics Analysis of Tea Plant CsS40 Gene (I) Experimental Methods
[0135] The CDS and protein sequences of the CsS40 gene were determined using the BLAST function on TBtool in combination with the tea plant genome (http: / / tpia.teaplant.org) and NCBI (http: / / www.ncbi.nlm.nih.gov) databases. The 2000 bp sequence upstream of the promoter start codon of the CsS40 gene was submitted to the online analysis software PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) and SoftBerry (http: / / linux1.softberry.com / all.htm) for prediction of possible cis-acting elements and transcription start sites in the promoter region. The protein sequence was uploaded to the NCBI (https: / / www.ncbi.nlm.nih.gov / ) online software for analysis of its conserved domains. The relative molecular mass and isoelectric point were identified online using Expasy (http: / / web.expasy.org / compute_pi / ). Finally, the subcellular localization analysis software WoLF PSORT was used to analyze the protein sequence. II (https: / / www.genscript.com / tools / wolf-psort) predicts the localization of the protein in the cell.
[0136] (2) Experimental results
[0137] The results are as follows Figure 5-Figure 8As shown in Table 4, the basic information, promoter cis-acting elements, conserved domains, relative molecular mass, isoelectric point, and subcellular localization of the CsS40 gene were predicted using bioinformatics methods. The results showed that the CsS40 gene was numbered LOC114277741 in NCBI and CSS0010485.1 in the tea plant genome, with a homology of 100%, a length of 1211bp, and composed of 212 amino acids; the CsS40 gene promoter sequence contained one ARE element related to the environment (anaerobic induction regulation) and one circadian element (circadian rhythm regulation); two ABRE elements related to hormones (abscisic acid response), one GARE-motif element (involved in gibberellin response), and one The TGA-element element (involved in auxin response) contains one AE-box element, one G-box element, one Gap-box element, one I-box element and one TCT-motif element related to light regulation; the CsS40 gene forms a Senescnece_reg domain at amino acids 289 to 825 and belongs to the S40 family of cell senescence regulators; the relative molecular mass and isoelectric point of the CsS40 gene are 23369.73DA and 5.98; the CsS40 gene is located in the cell nucleus.
[0138] Table 4 Analysis of cis-acting elements in the CsS40 gene promoter sequence
[0139]
[0140]
[0141] Example 3 Subcellular Localization of Tea Plant CsS40 Gene
[0142] (1) Experimental methods
[0143] 1. The tobacco used is Nicotiana benthamiana.
[0144] 2. Construction of fusion expression vector
[0145] Primers with restriction enzyme sites were designed based on the CsS40 ORF (Table 5). Plasmids were extracted from the cloned products with the correct CsS40 gene ORF. The gene was digested with KpnI, and the vector was digested with XbaI. The plasmids were ligated to the PCAMBIA1300-35S-GFP vector using T4 DNA ligase. The obtained ligation products were transformed into DH5a competent cells. After PCR amplification, restriction enzyme screening, and sequencing verification, positive clones were screened and plasmids were extracted to obtain a fusion expression vector of GFP and the target gene ( Figure 9)PCAMBIA1300-CsS40-35S-GFP. The subcellular localization vector was synthesized by Wuhan Transduction Biolabs Co., Ltd.
[0146] Table 5 Amplification primer names and sequences
[0147]
[0148] 3. Tobacco Transient Transformation Steps
[0149] (1) Shake the successfully detected Agrobacterium culture overnight at 28°C, 200 rpm;
[0150] ⑵ Take 1-1.5ml of bacterial solution and add it to a sterilized 1.5ml centrifuge tube;
[0151] (3) 8000 rpm, 2 min, sediment the bacteria (room temperature), remove the supernatant, add 1 ml of permeate, and suspend the bacteria;
[0152] (4) Repeat step 3 to further remove a small amount of antibiotics;
[0153] 5. Take a small amount of suspended bacterial solution and dilute it 10 times, measure the OD600 value, and multiply it by 10 to obtain the OD600 value of the suspended bacterial solution;
[0154] (6) Determine the titer of the bacterial suspension to the permeate and calculate the dilution factor so that the final bacterial suspension (for infection) is 0.5-5.0 ml and the OD600 is 0.4 (0.1-0.8 as needed, not exceeding 1). Usually 0.5-1.0 ml of the final bacterial suspension is sufficient for infection.
[0155] ⑺ Prepare the final bacterial suspension in a 1.5ml centrifuge tube and let it stand at room temperature for 1 to 3 hours to prepare for infection;
[0156] ⑻ Before infection, place the tobacco under a white fluorescent light for 1 hour to open its stomata;
[0157] (9) Select the third and fourth leaves from the bottom for infection (infect between two leaf veins). Select two leaves from one plant and infect with one bacterial solution.
[0158] ⑽Use a syringe without a needle to gently rub the back of the leaf to be rotated (0.5 cm2), or pierce it with a small needle to remove its wax layer;
[0159] ⑾Before infection, mark the area to be transferred with a marker;
[0160] ⑿ Aspirate the final bacterial suspension from step 7 into a 1 ml syringe without a needle;
[0161] ⒀Point the syringe at the area to be transferred on the back of the leaf, press the leaf with one hand, and gently push the piston with the other hand until the liquid spreads, then infect other parts. After infection, circle the infected area with a marker;
[0162] ⒁Then spray the leaves with water, put them in a fresh-keeping bag, put the infected tobacco back into the culture room, and leave it in the dark overnight.
[0163] ⒂Open the fresh-keeping bag on the next day. The expression level is highest 2-3 days after injection.
[0164] ⒃Cut the infected area, tear off the epidermis to prepare slices, and observe under a fluorescence microscope.
[0165] (2) Experimental results
[0166] like Figure 10 As shown, fluorescence signals of PCAMBIA1300-CsS40-35S-GFP fusion protein and empty vector with GFP were detected in the nucleus and cytoplasm of tobacco leaf cells, proving that the CsS40 gene was expressed in the nucleus and cytoplasm.
[0167] Example 4 Point-to-point verification of the interaction between CsS40 and TCS4 promoter
[0168] (1) Experimental methods
[0169] The transcription factor linked to the PGADT7 vector and the promoter linked to the pHIS2 vector were co-transformed into the yeast strain Y187. The bacterial suspension was diluted and plated onto SD-Trp / -Leu plates, a yeast selective medium. After 3-4 days of incubation at 28°C, a single yeast colony was selected and transferred to the selective liquid medium SD-Trp / -Leu. The cells were shaken at 28°C, 200 rpm, and the OD value was between 0.8 and 1.0. A 2 μL aliquot was then pipetted onto the defective medium SD-Trp / -Leu / -His+3-AT (50 mM, 100 mM, 150 mM, 200 mM, or 250 mM). The plates were then incubated at 28°C for 3-4 days to observe yeast growth and analyze transcriptional activation.
[0170] (2) Experimental results
[0171] like Figure 11As shown, the successfully constructed vector pGADT7-CsS40 and the promoter attached to the vector pHIS2 were co-transformed into the yeast strain Y187, and then plated on the defective medium SD--Trp / -Leu / -His+3-AT (50mM, 100mM, 150mM, 200mM, 250mM). The results showed that yeast could continue to grow on the three-deficient medium with 3-AT concentrations of (50mM, 100mM, 150mM, 200mM, 250mM), indicating that the transcription factor has a binding effect on the gene.
[0172] Example 5 Functional analysis of CsS40 gene in tea plant callus
[0173] (1) Experimental methods
[0174] 1. Experimental Materials
[0175] The materials were young stem segments of 'Fuding Dabai' tea plants from the College of Tea, Guizhou University, which were used as explants for Agrobacterium-mediated genetic transformation.
[0176] 2. Construction of plant expression vector
[0177] Construction of plant expression vector Based on the initial vector pSH737, the pSH737-35S-CsS40 plant expression vector was designed and constructed ( Figure 12Based on the sequencing results, the upstream restriction site was selected as XbaI, and the downstream restriction site was selected as KpnI. Primers containing these restriction sites were designed to amplify CsS40. Both the amplified CsS40 and pSH737 were double-digested and purified. The cohesive ends were ligated using DNA ligase. The recombinant plasmid was transformed into competent Escherichia coli (DH5α). Positive clones were screened with 100 mg / L Kan. The recombinant plasmid was extracted and double-digested with XbaI and KpnI for verification. Recombinant plasmids that tested positive for restriction enzyme digestion were transformed into competent Agrobacterium strain LBA4404 cells. Positive Agrobacterium strains were screened with 100 mg / L Kan and 20 mg / L Rif. Colony PCR was performed on these strains using the primers. Agrobacterium strains that tested positive for PCR were expanded and stored at -80°C. The plasmid containing the expression vector pSH737-35S-CsS40 was transformed into Agrobacterium strain LBA4404 by the freeze-thaw method to prepare the engineered strain. Thaw LBA4404 competent cells stored at -80°C on ice for 10 min; add 5 μL of plasmid DNA to each competent cell, gently flick to mix, and then place on ice for 30 min; quick-freeze in liquid nitrogen for 5 min, and immediately place in a 37°C water bath for 2 min; add 900 μL of 37°C preheated YEP liquid medium, and culture at 28°C, 200 rpm, and shake for 3 h; centrifuge at 4000 × g for 1 min at room temperature, and discard the supernatant; add 100 μL YEP liquid medium to the bacteria and mix it with a pipette tip; take an appropriate amount of bacterial solution and spread it on a YEP plate culture medium containing 100 mg / L Kan and 20 mg / L Rif, place it upside down in a 28°C constant temperature incubator and culture for 2 days, and store the bacterial solution at -80°C.
[0178] 3. Genetic transformation of tea plant stem segments with the tea plant CsS40 overexpression vector to form callus
[0179] Through Agrobacterium-mediated genetic transformation, tea plant stem segments were used as explants, and Agrobacterium containing pSH-CsS40 was used to genetically transform tea plant stem segments. After culturing in the dark for 2 days, the segments were transferred to screening medium. The medium was changed every 14 days. When relatively swollen callus tissue ( Figure 13 ).
[0180] Cut the overexpressed transgenic tea callus with scissors and immerse the removed callus completely in GUS dye solution and place the dye solution in a 37℃ constant temperature incubator for 24 to 48 hours. After the dyeing is completed, transfer the leaves to 95% ethanol until the material is completely decolorized. Then, observe the leaves under a stereo microscope and take pictures. Figure 14 As shown. Wild-type callus and GUS histochemically stained positive callus were selected to extract DNA, and PCR amplification was performed using CsS40 gene-specific primers. The products were detected by 1% agarose gel ( Figure 15 ).
[0181] 4. Determination of caffeine content in tea callus
[0182] After the tea tree stem segments were infected with the CsS40 overexpression vector and the gene editing vector, the culture medium was replaced every 14 days. When the callus grew to a relatively swollen state, each callus tissue was collected and withered. After withering, the callus was dried to a constant weight, ground into powder, and stored at low temperature for later use.
[0183] The callus was steam-fixed for 1 minute, then dried at 80°C until fully dry, and ground into tea powder for later use. The caffeine content of the overexpressed tea callus was determined by high performance liquid chromatography, referring to the method of GB / T8313-2013.
[0184] (2) Experimental results
[0185] like Figure 16 As shown, the caffeine content of overexpressing tea plant calluses was measured by high-performance liquid chromatography. The results showed that the caffeine content of wild-type calluses was 2.17%, while that of transgenic calluses was 4.09%, representing 1.88 times the caffeine content of wild-type calluses. This suggests that the CsS40 gene can increase the caffeine content of tea plants.
[0186] Example 6 Functional Analysis of CsS40 Gene in Tobacco
[0187] 1. Experimental Materials
[0188] The tobacco used was the 'Three Star' sterile tobacco seedlings preserved by our research group.
[0189] 2. Construction of plant expression vector
[0190] The construction method is as described in Example 4.
[0191] 3. Genetic transformation of tobacco with CsS40 overexpression vector
[0192] The genetic transformation method is as described in Example 4. The tobacco leaves were genetically transformed using the Agrobacterium-mediated leaf disc transformation method, using tobacco plant leaves as explants. The Agrobacterium solution containing pSH-CsS40 was used to genetically transform the tobacco leaves. After 2 days of co-cultivation, the leaves were transferred to a screening medium (Tim, Kan) and cultured for about 14 days. After green callus appeared on the leaf margin, resistant buds were induced to form by subculture. The resistant buds of about 2 cm were cut off and placed on a rooting medium to induce rooting. After the regenerated seedlings grew to 3-6 cm, they were hardened and transplanted into pots for culture. Transgenic regenerated seedlings with kanamycin (Kan) resistance were obtained, and 20 transgenic strains were obtained. The stages of the Agrobacterium-mediated method are as follows: Figure 17 As shown, transgenic plants were stained and identified by PCR. Figure 18-19 shown.
[0193] 4. Analysis of the Expression of the CsS40 Gene in Transgenic Tobacco
[0194] (1) Extraction of total RNA from tobacco samples
[0195] Leaves from 20 transgenic plants with the same leaf position and growth were taken, quickly frozen in liquid nitrogen, and stored at -80°C until use. RNA from the plant samples was extracted using the CTAB method. The specific steps are as follows:
[0196] 1. Material grinding: Take about 0.1g of leaves and grind them into fine powder in liquid nitrogen, then add 1ml of RNA extraction solution.
[0197] Place in a 2.65°C water bath for 10 min, mixing every 2 min.
[0198] 3. Cool to room temperature. Centrifuge at 12,000 rpm for 5 minutes and transfer the supernatant to a new centrifuge tube.
[0199] 4. Add equal volumes of water-saturated phenol:chloroform (25:24), then add 800 μL of NaCl (5 mol / L) and mix well. Incubate at room temperature for 3 minutes, then centrifuge at 25°C, 12,000 rpm / min for 5 minutes.
[0200] 5. Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol and 2 times the volume of NaCl (5 mol / L), mix well, and place at -80℃ overnight for precipitation.
[0201] Centrifuge at 6.4°C, 12,000 rpm / min for 5 min, wash the precipitate twice with 5 ml of 75% ethanol, and air-dry at room temperature for about 5 min; add appropriate amount of RNase H2O, and store the product in a -80°C refrigerator until use.
[0202] 7. Detect RNA concentration using a nucleic acid concentration meter.
[0203] (2) cDNA synthesis
[0204] The extracted RNA was reverse transcribed into cDNA using a first-strand cDNA synthesis kit for subsequent quantitative analysis. The reaction system is shown in Table 6:
[0205] Table 6 Synthesis of first-strand cDNA
[0206]
[0207]
[0208] Mix gently, if using Oligo(dT) 18Or gene-specific primers (GSP) are incubated at 42°C for 30-50 minutes (if the product is used for qPCR, incubate at 42°C for 15-20 minutes); if using Random Primer, incubate at 25°C for 10 minutes and then at 42°C for 30-50 minutes (if the product is used for qPCR, incubate at 42°C for 15-20 minutes). Heat at 85°C for 5 minutes to inactivate TRUEscript H - RTase. The resulting cDNA product can be used immediately for PCR or qPCR reactions, or stored at -20°C and used within six months. For long-term storage, it is recommended to store the product in aliquots at -80°C. Avoid repeated freezing and thawing of the cDNA.
[0209] (3) Detection of CsS40 gene expression
[0210] The synthesized cDNA was used for fluorescence quantitative PCR to determine CsS40 gene expression. CsS40-specific primers were designed using PrimerPremier 5.0 software (primers were synthesized by the Chongqing Branch of Beijing Qingke Biotechnology Co., Ltd.), using the tobacco actin gene as an internal reference (Table 7). qRT-PCR experiments were performed on a Bio-Rad CFXConnect™ Real-Time PCR System (Bio-Rad). The qRT-PCR reaction system was configured using the Nanjing Novozymes Universal High-Sensitivity Dye-Based Quantitative PCR Detection Kit according to the kit's instructions. The 10 μL system is shown in Table 8 below, and the qRT-PCR reaction procedure is shown in Table 9.
[0211] Table 7 Fluorescence quantitative PCR primer sequences
[0212]
[0213] Table 8 Fluorescence quantitative PCR reaction system
[0214]
[0215] Table 9 Fluorescence quantitative PCR reaction program
[0216]
[0217]
[0218] 5. Determination of xanthine and hypoxanthine in transgenic tobacco
[0219] Accurately weigh 2.0 g of sample, add 40 ml of 50% ethanol, and ultrasonically extract for 25 minutes. Transfer to a 50 ml volumetric flask, adjust to volume, and filter. Transfer 1 ml of the filtrate to a 10 ml volumetric flask, adjust to volume with water, filter, and use the filtrate for chromatographic analysis. Repeat three times for each sample. Determine xanthine and hypoxanthine content using the method described by Liu Songqing et al. (1994). Conditions: Mobile phase: methanol: 0.01 mol / L ammonium dihydrogen phosphate (7:93), detection wavelength: 254 nm, flow rate: 1.2 ml / min, injection volume: 10 μL, column temperature: 32°C. Preparation of standard solution: Accurately weigh a certain amount of xanthine and hypoxanthine standards, place them in a volumetric flask, and dissolve them in water to the same volume. The concentrations of xanthine and hypoxanthine are 50ug / ml and 100ug / ml, respectively. Take 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0ml of the above solutions in a 10ml volumetric flask, add water to the same volume, shake well, inject, and calculate the peak area. The regression equation is as follows:
[0220] Xanthine: C = -0.08119 + 3.23*10-4X
[0221] Hypoxanthine: C = -0.03382 + 4.46*10-4X
[0222] 6. Inducing Senescence in Transgenic Tobacco
[0223] Leaves from 8- to 10-week-old transgenic and wild-type tobacco plants were soaked in 0.5% to 0.8% sodium hypochlorite for 30 seconds, rinsed several times with running water, and then rinsed three times with deionized water. Leaves were cut into approximately 2 x 2 cm pieces using scissors, mixed, and transferred to a stoppered conical flask. The leaves were treated with a 300 mg / L ethephon solution and incubated in a dark incubator. An equal amount of distilled water was used as a control group. Samples were collected on days 0, 1, 3, 5, and 7 after treatment and various parameters were measured. Three replicates were used for each experiment, and all experiments were repeated three times under the same conditions. Chlorophyll content, malondialdehyde (MDA) content, and superoxide dismutase activity were measured according to the methods of Li Yushuai (2021); malondialdehyde content was measured according to the methods of Li Yakun (2020); superoxide dismutase activity was measured according to the methods of Sun Hongmei (2020); and lipoxygenase activity was measured according to the methods of Hao Ruili (2018).
[0224] 7. In vitro culture of transgenic tobacco
[0225] Take the fully expanded leaves of transgenic tobacco and wild-type tobacco at the same leaf position, wrap the base of the petiole with wet cotton and place it in a culture bottle with wet filter paper. Keep it moist in vitro and culture it at (25±2)℃ with a light intensity of 16h / d. Place it in the tissue culture room and observe the aging of the tobacco.
[0226] (2) Experimental results
[0227] like Figure 20-21 As shown, the xanthine content of transgenic plants ranged from 0.32 to 1.85 mg / g, while that of wild-type plants was 1.10 mg / g. Transgenic lines TP17, TP13, TP01, TP19, TP20, TP18, and TP09 were higher than those of the wild-type, with contents of 1.85, 1.84, 1.72, 1.59, 1.57, 1.51, and 1.42 mg / g, respectively. Furthermore, the xanthine content of TP01, TP13, and TP17 was extremely significant (p < 0.01), while that of TP09, TP18, TP19, and TP20 transgenic lines was significant (p < 0.05). The xanthine content of TP03, TP04, TP05, TP06, TP08, TP10, TP12, TP14, TP15, and TP16 was lower than that of the wild type, and the xanthine content of TP03, TP05, TP06, TP08, TP10, and TP14 was extremely significant (p < 0.01), and that of TP04, TP12, TP15, and TP16 transgenic lines was significant (p < 0.05), while the others had no significant differences; the hypoxanthine content of transgenic plants was between 0.05 and 0.23 mg / g, and that of wild type plants was significantly lower than that of wild type plants. The hypoxanthine content of the strain was 0.12 mg / g. The transgenic strains TP01, TP17, TP19, TP20, TP18, TP13, TP09 and TP03 were higher than that of the wild type, with contents of 0.23, 0.21, 0.19, 0.17, 0.16, 0.15, 0.14 and 0.12 mg / g, respectively. The hypoxanthine content of TP01 and TP17 was extremely significant (p < 0.01), and that of TP13, TP18, TP19 and TP20 transgenic strains was significant (p < 0.05). The xanthine content of TP05, TP06, TP08, TP10, TP11, TP12, TP14, and TP16 was lower than that of the wild type, and the hypoxanthine content of TP05 and TP08 was extremely significant (p < 0.01), and the xanthine content of TP06, TP10, TP11, TP12, TP14, and TP16 transgenic lines was significant (p < 0.05), while the other transgenic lines had no significant differences. Based on the above, it can be concluded that the xanthine content of TP01, TP13, and TP17 in transgenic tobacco lines increased, while the xanthine content of TP05 and TP08 in transgenic tobacco lines decreased.
[0228] like Figure 22As shown, the chlorophyll content of transgenic tobacco was lower than that of wild-type tobacco at 0, 3, 5, and 7 days, with no significant difference at 0 day. The chlorophyll content was extremely significant at 5 days (p < 0.01), and the chlorophyll content was significant at other times (p < 0.05). The average chlorophyll content of transgenic tobacco was 14.30% lower than that of wild-type, indicating that the CsS40 gene accelerated the degradation of chlorophyll. The SOD activity of wild-type tobacco and transgenic tobacco was extremely significant at 1 day (p < 0.01), the SOD content was significant at 5 and 7 days (p < 0.05), and it dropped sharply on the third day. The SOD content of transgenic tobacco was lower than that of wild-type tobacco at 0, 3, 5, and 7 days, and there was no significant difference in SOD content at 0 day, indicating that the CsS40 gene plays a role in plant aging. Expression of the gene reduced its ROS scavenging ability. MDA activity in both wild-type and transgenic tobacco plants was extremely significant on day 1 (p < 0.01), with significant MDA content at days 0, 5, and 7 (p < 0.05), before declining sharply on day 3. MDA activity in transgenic tobacco plants was higher than that in wild-type plants at days 0, 1, 3, and 7. Excessive MDA accumulation in plant leaves can increase cellular damage. LOX activity in both wild-type and transgenic tobacco plants was extremely significant on day 3 (p < 0.01), with significant LOX activity at days 0, 1, 5, and 7 (p < 0.05). By day 7 of senescence induction, LOX activity in transgenic tobacco plants was 56.25% higher than that in wild-type plants. Higher LOX activity in plant leaves can lead to a decline in plant nutritional quality. These results suggest that transgenic tobacco plants can effectively promote senescence compared to wild-type tobacco.
[0229] To understand the expression level of the CsS40 gene in transgenic tobacco, RNA was extracted from 20 transgenic plants and 3 wild-type plants by CTAB method. RT-qPCR was performed after designing CsS40 gene-specific primers to determine the relative expression level ( Figure 23 The results showed that the expression levels of CsS40 genes in transgenic tobacco were higher than those in wild type, in the order of TP20, TP19, TP09, TP13, TP17, TP18, TP07, TP03, TP01, TP06, TP02, TP12, TP11, TP16, TP15, TP04, TP14, TP10, TP05, and TP08.
[0230] like Figures 24-25As shown, the leaf margins of transgenic plants TP1, TP2, TP8, and TP18 turned yellow and wilted, but the water loss was minimal. Transgenic plants TP9, TP11, TP12, TP13, TP14, TP15, TP17, and TP19 had lost their green color and were severely yellowing. Transgenic plants TP3, TP4, TP5, TP6, TP7, TP10, TP16, and TP20 had all withered, yellowed, and even dried up. Wild-type plants, on the other hand, had slightly yellowed margins but remained green. These results suggest that transgenic tobacco is more effective at accelerating senescence than wild-type tobacco. Sequence Listing <110> Guizhou University <120> Application of transcription factor CsS40 gene in regulating caffeine synthesis in tea plants <130> PP22075-GZD <140> 2022106725536 <141> 2022-06-15 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1211 <212> DNA <213> Tea Tree (Camellia sinensis) <400> 1 tatgttaaaa gggtctcctc taatggaaga cctatagata tatatagaat ctgtgcatat 60 tcttataatt tagatacaga gtcctgaaaa atcaggactc cggtcgctag ctacggtggt 120 tttagtggtg gtggtggtgg tggtgatata tggcgaaggg tcggaaacta acaactagtc 180 gcagcgatcg tctgttgggc cgatacaact acggtcaggc ccaaggaatg gtgaccgagt 240 catcggagct cggtgaagag gacgtgtggt cgatggtcga tgacatggtc aacggcggcg 300 aaaatcactc aatgggcagt tccggaggcg cgtggagccc acgcgccgcc gcggagagta 360 acgggtccat gaactaccta acccgccggc acgtcgttcc ccgtgaggag agccaacatg 420 tgggcgggct gtcactggcc tttgaggatt ccggaaaaac ggcgtcgtct aggatcctgc 480 accaattccg tacccaggac agcatggcga gcccacatgg tggacgacat atggccacgt 540 cagccccagt gaacgtgcct gattggtcaa agatttaccg agttgactcg gtcgagtcgc 600 tgcatgactc ggatgacggc gtggaagatc gggactcgga gatggttccg ccacacgagt 660 tcttggcgcg tgagtaccgg aggatggcgg cgaagtcggt tttcgaaggt gtgggccgga 720 cgctaaaagg ccgggacttg agccgggttc gggatgccgt gtggagccaa accggattta 780 atggctaaaa ccattattgt tattaatgca tcttttaaga agtgatttaa agttagttgg 840 ttggtggttt tattgctaaa ttgttttggg tgggcaatga ctcgaccgag tgaactcaga 900 gagaacgaat caactcggca acgactgagc ccaacgagag gtgtctccgt tctcttcatc 960 tactctgtct ttagtagttt ttgtggtgtc ctgagttgga atttcgaaaa ttgtgatgag 1020 tccttgtcag tggtaagtcg gtcatttcag tactataatg ttgttccaac atagtattat 1080 agtgtgccag tgccaatgaa attttgagct agtagtgtgg tgtctcttgg tataccaaac 1140 ttgctaatta ttgggggtag cactagcatc tccgtccatt ggttagaaag aaagctacaa 1200 attttattta a 1211 <210> 2 <211> 212 <212> PRT <213> Camellia sinensis <400> 2 Met Ala Lys Gly Arg Lys Leu Thr Thr Ser Arg Ser Asp Arg Leu Leu 1 5 10 15 Gly Arg Tyr Asn Tyr Gly Gln Ala Gln Gly Met Val Thr Glu Ser Ser 20 25 30 Glu Leu Gly Glu Glu Asp Val Trp Ser Met Val Asp Asp Met Val Asn 35 40 45 Gly Gly Glu Asn His Ser Met Gly Ser Ser Gly Gly Ala Trp Ser Pro 50 55 60 Arg Ala Ala Ala Glu Ser Asn Gly Ser Met Asn Tyr Leu Thr Arg Arg 65 70 75 80 His Val Val Pro Arg Glu Glu Ser Gln His Val Gly Gly Leu Ser Leu 85 90 95 Ala Phe Glu Asp Ser Gly Lys Thr Ala Ser Ser Arg Ile Leu His Gln 100 105 110 Phe Arg Thr Gln Asp Ser Met Ala Ser Pro His Gly Gly Arg His Met 115 120 125 Ala Thr Ser Ala Pro Val Asn Val Pro Asp Trp Ser Lys Ile Tyr Arg 130 135 140 Val Asp Ser Val Glu Ser Leu His Asp Ser Asp Asp Gly Val Glu Asp 145 150 155 160 Arg Asp Ser Glu Met Val Pro Pro His Glu Phe Leu Ala Arg Glu Tyr 165 170 175 Arg Arg Met Ala Ala Lys Ser Val Phe Glu Gly Val Gly Arg Thr Leu 180 185 190 Lys Gly Arg Asp Leu Ser Arg Val Arg Asp Ala Val Trp Ser Gln Thr 195 200 205 Gly Phe Asn Gly 210 <210> 3 <211> 2212 <212> DNA <213> Camellia sinensis <400> 3 tgacaatgcc agtgctagaa aatgtagttg aaactctctt ctccaaagat ttccaccttc 60 ttcaagctct taatgtagcg gacttggtt gtcaacgag ttcaaccg ttcacagtga 120 tttctacgat cagagaatg atggaaag attgcaggga attgaattgc caacactgg 180 aacttcaggt ttacttgaat gatctcctg gaacgattt caatagccctc ttcaaggct 240 tgttgtctaa gtttgttgtt ggtaacaaat gcaggaagt ttctgttat gtgatgggag 300 taccggggtc gttacatggc cggctttc ctcgtaacag cttgcattta gttcattcct 360 gttacagtgc gcattggctt tctcaggttt gtacatccat tgttcac tagtactag 420 taattaacct tgtacttatc aaattatctt atgttaattc ccatcacaat atgagaagg 480 gagttagatg ttggtcgcat actgtgatgg acacatgaat aatttcatt gaccatgcca 540 tgccactga gaaaaatca tattactct aactatatga ctggtactat atgtatttat 600 ttgtatttgt tgtatggata catataaaag tttttaaaa attataaaat tattcaaat 660 atgtagactc aaaaaaatgg acaatataaa catgtgtaaa aaggtctttc tccatgtctt 720 tcccattgtt tacgaaaaat ttcataagt ttgaaattt catatgatgg gcttggtgca 780 tgtgccaact taattaggat gtgcttctta accaatgaat gatgctttga tcctactcac 840 tttttgttaa tataatatca ttgtactgct tgtataagtt gtattactta ttcatatga 900 cccatttgct tttgatgtat ataagcttg cacactaacc atttcaatgg tttctttggt 960 gaaaaaag gcaccaaaag gactcacaag cagagaaggc ttggcattaa acaaggaaa 1020 gatttacata tcaagacaa gccctcctgt tgtagagaa gcctacttat ctcaatgaag 1080 atttcataat gtttctcaat gctagatccc aagaggtggt tccaatggt tgtatggtgt 1140 tgatacttcc tgtaggca tcttgatc cttcgagcat ggagagctgc tcacttggg 1200 aactattagc tatagccatt gctgaatttgg ttcacaggt agctcatt ttacactt 1260 ctttaccatt aaatgtcttc gttgatgtt cacaagctct tacataccctc tagacacaca 1320 ttttctagg cctaaaaatg gtaaaacatg CAactataa accgaaattt cccttaggtg 1380 tcgtccacaa tggtctgatt tcgctgtta tatatttt gtgaaaaatt tctcattctt 1440 caaaatttggt ttcaatcatt cgtcattact ctcaaattc gtacagaca tataaact 1500 attatttaat tgagttaaaa tgaaatagtt attagcattt tacaaaaatg agtattcttc 1560 tttgctctca aaaagcattt catatatata aactacgctt caatcagagt taaaatgaaa 1620 ttattatgaa catgatatca cattgactca tattttactc tctgaaggta aaatattcgt 1680 aactcaaaaa cgtactaaga gtttggtgct cataccagtt ggattcttaa agctttccaa 1740 ctatttcgaa tcatgacaaa cagagttcaa atgtgtccaa aattagtaat tttttgttca 1800 atttttttcc ccaacatttt aaatatataa gtcatgttga tgagttcttt cctttaaaat 1860 gataaaatca atacttatcc cgtcatttgt atatatatat atatatattt ggcatagcac 1920 tactctaaaa ttatttgctt tatttattcc tatctattga ttttctctct ttccttcgtg 1980 ataatagggga ttgataaatg aagataaatt agacaccttc aatgtaccta gatatttcc 2040 atcacttgag gaagtgaaag atatagtgga gggcgacgga tcattcacaa ttgatcatat 2100 ggaggggttt gaacttgata ccctacagat gcaagagaat gataaatggg ttagaggggga 2160 aaagcttgcc aaggctatca gggccttcac agagcctata atctcaaact ag 2212
Claims
1. Application of transcription factor CsS40 in promoting the positive regulation of caffeine synthesis in tea plants. The amino acid sequence of the protein encoded by the transcription factor CsS40 is shown in SEQ ID No.
2.
2. Application of transcription factor CsS40 in genetic engineering breeding for increasing the caffeine content in tea leaves of tea plants. The amino acid sequence of the protein encoded by the transcription factor CsS40 is shown in SEQ ID No.
2.
3. The use according to claim 1 or 2, wherein the nucleotide sequence of the transcription factor CsS40 is shown as SEQ ID No.
1.
4. The use according to claim 3, wherein the transcription factor CsS40 binds to the TCS4 gene promoter, thereby activating the expression of the TCS4 gene, thereby increasing the caffeine content, and the TCS4 gene promoter sequence is shown in SEQ ID No.
3.
5. The use according to claim 4, characterized in that: A recombinant vector of transcription factor CsS40 was constructed and introduced into tea plants to overexpress the TCS4 gene in order to increase the caffeine content.
6. The use according to claim 5, wherein the recombinant vector uses pSH737-35S as the original vector, and the transcription factor CsS40 is inserted into the multiple cloning site of pSH737-35S.
7. The use according to claim 6, wherein the transcription factor CsS40 is inserted between the Xba I and Kpn I restriction sites on the original vector pSH737-35S, and is named pSH737-35S-CsS40.
8. The use according to claim 7, wherein the recombinant vector is prepared by the following method: using tea plant leaf cDNA as a template, a primer pair is used to obtain a PCR product of CsS40; pSH737-35S is double-digested with Xba I and Kpn I, recovered and ligated to obtain a recombinant vector named CsS40-pSH737-35S, and the primer pair is primer F: ACGGGGGACGAGCTCGGTACCATGGCGAAGGGTCG, primer R: GCTCACCATGTCGACTCTAGAGCCATTAAATCCGGTTTG.
Citation Information
Patent Citations
Application of transcription factor CsDUF1 for regulating and controlling synthesis of tea tree caffeine in regulating and controlling synthesis of tea tree caffeine
CN114540410A
Compositions and methods for activating cellular signaling pathways
US20210213092A1