Fc gamma RIIb affinity enhanced antibody Fc regions

By mutating the Fc region of IgG to enhance FcγRIIB affinity, the shortcomings of agonist antibodies in tumor immunotherapy are addressed, and a significant increase in agonist activity is achieved, making it suitable for the treatment of tumors, inflammatory diseases, and autoimmune diseases.

CN115052888BActive Publication Date: 2026-06-19SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
Filing Date
2020-12-03
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing agonist-type tumor immunotherapy antibodies have not yet been successfully developed, and there are insufficient means to activate the signaling pathways of biological processes with agonist antibodies, making it difficult to effectively enhance the anti-tumor immune response.

Method used

Amino acid mutations in the Fc region of IgG enhance FcγRIIB affinity, optimize antibody agonistic activity, and particularly improve the agonistic activity of agonistic antibodies.

Benefits of technology

It enhances the binding ability of antibodies to FcγRIIB, reduces the binding to activating FcγR, and significantly improves the agonistic activity of agonist antibodies, making it suitable for the treatment of tumors, inflammatory diseases, and autoimmune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HPA0000322236640000011
    Figure HPA0000322236640000011
  • Figure HPA0000322236640000012
    Figure HPA0000322236640000012
  • Figure HPA0000322236640000021
    Figure HPA0000322236640000021
Patent Text Reader

Abstract

This invention discloses a modified Fc region having at least one amino acid mutation compared to the parental Fc region. These modified Fc regions exhibit increased affinity for FcγRIIB compared to the parental Fc region. Antibodies, particularly agonist antibodies, incorporating the aforementioned modified Fc region are also disclosed. The modified Fc region of this invention is of significant use in optimizing the agonist activity of antibodies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biopharmaceuticals, and in particular to a series of variants of the Fc region of human IgG2 antibodies that have enhanced FcγRIIB affinity, and agonist antibodies containing these Fc region variants are expected to have better agonist activity. Background Technology

[0002] The development of biopharmaceuticals has provided new approaches and possibilities for the treatment of a variety of diseases, especially molecularly targeted therapies based on antibodies and heavy chain constant regions (including Fc regions), including antibody-heavy chain constant region fusion proteins. These have achieved great success in the biopharmaceutical field for more than 30 years and continue to be a focus of the field.

[0003] From the perspective of their mechanism of action, biological macromolecules can be mainly divided into three categories: effector molecules that clear targets (molecules and cells), blocking molecules that block signaling pathways involved in the target, and agonist molecules that activate downstream signaling pathways of the target. Tumor immunotherapy has achieved significant breakthroughs in recent years. This is thanks to the use of antibodies that enhance the activity of immune cells to kill tumors by blocking immunosuppressive nodes. However, a large number of cancer patients still do not respond to existing treatments. Therefore, on the one hand, it is necessary to optimize existing tumor immunotherapy methods; on the other hand, it is urgent to develop new tumor immunotherapy drugs. It is worth noting that there is a class of tumor immunotherapy methods called "agonist antibodies," which can indirectly kill tumor cells by binding to target molecules that transmit immune activation signals on the surface of immune cells and activating important immune activation signaling pathways controlled by them, thereby enhancing the anti-tumor immune response. However, although agonist tumor immunotherapy antibodies have demonstrated great potential in animal models and have become a widely accepted and promising concept in tumor immunotherapy, the development of these antibodies has not yet been successful, which is a major challenge in the field of tumor immunotherapy. Furthermore, activation of agonist antibody pathways is also a valuable means of intervening in and regulating key signaling pathways in other biological processes, with broad application prospects in disease prevention and treatment. For example, activation of immunosuppressive signaling pathways may help alleviate inflammation and autoimmune symptoms.

[0004] Antibodies primarily interact with FcγR through their constant regions, and different antibodies exhibit varying binding abilities to FcγR, which in turn affects antibody function in vivo. Antibody Fc modification is an important approach and trend for optimizing therapeutic antibodies, and altering the interaction between the antibody's Fc region and key proteins such as FcγR is a highly effective method for optimizing antibody activity. Summary of the Invention

[0005] To address the aforementioned issues, this invention, based on IgG, modifies the Fc region to obtain amino acid mutations and combinations that enhance FcγRIIB affinity. Fc cells containing these amino acid mutations can be used to optimize antibody activity, particularly to enhance the agonistic activity of agonist antibodies.

[0006] In a first aspect of the present invention, a mutant Fc polypeptide fragment is provided, the mutant Fc polypeptide fragment having the following characteristics:

[0007] (i) The mutant Fc polypeptide fragment is mutated relative to the corresponding wild-type Fc fragment before mutation; and

[0008] (ii) Compared with the wild-type Fc region, the mutant Fc region has increased affinity for FcγRIIB; and the wild-type Fc is the Fc of wild-type IgG2.

[0009] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at a site selected from the group consisting of L328, H268, S267, P271, G327, or a combination thereof, relative to the corresponding wild-type Fc fragment before mutation.

[0010] The amino acid numbers are based on the IgG Eu numbers.

[0011] In another preferred embodiment, the affinity can be expressed as the degree of enrichment by screening or as a combination of analytical signals.

[0012] In another preferred embodiment, the wild-type Fc fragment is positions 233 to 332 of the amino acid sequence of IgG2 based on IgG Eu number, and the amino acid sequence of the wild-type Fc fragment is as shown in SEQ ID NO:20.

[0013] In another preferred embodiment, the mutant Fc polypeptide fragment has enhanced FcγRIIB affinity compared to the wild-type Fc fragment.

[0014] In another preferred embodiment, the mutant Fc polypeptide fragment has an affinity for FcγRIIB that is more than 1 times greater than that for the wild-type Fc fragment; preferably, the affinity is more than 2, 3, 4, 5, 10, 20, 50 or 100 times greater.

[0015] In another preferred embodiment, the mutant Fc polypeptide fragment has a lower affinity for activated FcγR than for FcγRIIB.

[0016] In another preferred embodiment, the mutant Fc polypeptide fragment exhibits increased affinity for FcγRIIB and decreased affinity for activated FcγR compared to the wild-type Fc fragment (I / A ratio higher than that of the wild-type Fc fragment).

[0017] In another preferred embodiment, the mutant Fc polypeptide fragment is associated with FcγRIIB and FcγRIIA, respectively. 131R The affinity ratio (RIIB / RIIAR) of IgG2 is higher than that of wild-type IgG2.

[0018] In another preferred embodiment, the activated FcγR includes: FcγRI and FcγRIIA. 131H 、FcγRIIA 131R 、FcγRIIIA 158F and FcγRIIIA 158V .

[0019] In another preferred embodiment, the mutation L328 includes L328W, L328E, L328Y, L328F, L328M, L328A, L328G, L328N, L328P, L328R, and L328V; preferably L328W or L328E.

[0020] In another preferred embodiment, the mutation H268 includes H268D, H268S, H268E, H268K, and H268N; preferably H268D, H268S, or H268E.

[0021] In another preferred embodiment, the mutation S267 includes S267E, S267V, S267D, S267M, S267Q, S267A, S267G, S267R, S267N, and S267W; preferably S267E, S267V, S267D, and S267M; more preferably S267E.

[0022] In another preferred embodiment, the mutation P271 includes P271C, P271G, P271V, P271A, P271W, P271Y, P271Q, P271T, P271I, P271L, and P271S; preferably P271C, P271G, P271V, P271A, P271W, P271Y, P271Q, and P271T; more preferably P271C and P271G.

[0023] In another preferred embodiment, the mutation G327 includes G327A, G327L, and G327S; preferably G327A.

[0024] In another preferred embodiment, the mutant Fc polypeptide fragment has mutations at sites selected from the group consisting of the wild-type Fc fragment: L328W, L328E, H268D, H268S, H268E, S267E, A330S, P233G, P271G, P271C, P271V, P271A, P271W, P271Y, G327A, or combinations thereof; wherein all amino acids are numbered according to the IgG Eu number.

[0025] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at at least one of the two sites, L328 and H268, relative to the wild-type Fc fragment, and the specific mutation in the mutant Fc polypeptide fragment is selected from one of the following groups: L328W, L328E, H268D, H268S, H268E, H268D / S298L / L328W, S267V / S298L / L328W, V234M / S267E / S298L / L328W, A235W / V266L / S298L / L328W, V23 4Q / A235G / P238L / S239V / H268D / G327A / L328E / A330S / I332T, S239V / V266L / S298L / L328W, V266L / L328W, V266L / S267D / H 268D / E269D / P271Q, S267E / H268S / E269D, P233F / V266L / S298L / L328W, V266L / S298L / L328W, V234Q / A235G / P238L / S239V / G327A / L328E / A330S / I332T, V266L / S267E / H268S / E269V, V266L / S267E / H268S / E269V / P271C, V266L / S267E / H268S / E26 9A / P271C, S267V / S298G / L328W, V266L / S267M / H268E / P271Q, V266L / S267E / H268S / E269G / P271T, V234Q / V266L / S267D / H 268D / E269D / P271Q, V234Q / A235G / P238L / S239V / S267E / H268S / E269D, V266L / S267E / H268S / P271V, V234Q / A235G / P238L / S239V / S267E / S298L / G327A / L328E / A330S / I332T, V234Q / V266L / S267E / H268S / E269V, L328E / I332T; where all amino acid numbers are based on the IgG Eu number.

[0026] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at the S267 site relative to the wild-type Fc fragment, and the specific mutation in the mutant Fc polypeptide fragment is selected from one of the following groups: S267E / A330S, S267E / S298G, P233G / S267E, V234M / S267E / S298G / I332L, P233G / S267E / S298G, V266L / S267E / E269K / P271G. P238Q / S267E, S267A / P271C, S267A / P271G, S267E / D270H, S267E / P271C, S267E / P271V, S267E / P271W, S267E / P271Y, S267E / S298R, S267M / P271C, S267M / P271G, S267V / S298L, S267E / P329R; where all amino acid numbers are based on the IgG Eu number.

[0027] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at the S267 site relative to the wild-type Fc fragment, and the specific mutation in the mutant Fc polypeptide fragment is selected from one of the following groups: S267E / A330S, S267E / S298G, P233G / S267E, V234M / S267E / S298G / I332L, P233G / S267E / S298G, V266L / S267E / E269K / P271G, S267E / P271C; wherein, the amino acid numbering is based on the IgG Eu numbering.

[0028] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at the P271 site relative to the wild-type Fc fragment, and the specific mutation in the mutant Fc polypeptide fragment is selected from one of the following groups: V266L / S267E / E269K / P271G, V266A / P271C, V266A / P271G, S267A / P271C, S267A / P271G, S267E / P271C, S267E / P271V, S267E / P271W, S267E / P271Y, S267M / P271C, S267M / P271G, V266G / P271V. 1C, P271A / S298R, P271G / G236V, P271G / P329S, P271G / P331C, P271G / P331T, P271G / S298D, P271G / S298E, P271G / S298G, P271G / S298K, P271G / S298L, P271G / S298N, P271G / S298R, P271G / T299A, P271G / T299M, P271G / T299S, P271G / T299W, P271G / I332L; where all amino acid numbers are based on the IgG Eu number.

[0029] In another preferred embodiment, the mutant Fc polypeptide fragment has a mutation at the G327 site relative to the wild-type Fc fragment, and the specific mutation in the mutant Fc polypeptide fragment is selected from one of the following groups: G327A / A330R, G327A / A330V, G327A / I332A, G327A / I332C, G327A / I332E.

[0030] In another preferred embodiment, the specific mutation of the mutant Fc polypeptide fragment relative to the wild-type Fc fragment is selected from one of the following groups: H268D / S298L / L328W, S267V / S298L / L328W, V234M / S267E / S298L / L328W, A235W / V266L / S298L / L328W, V234Q / A235G / P238L / S239V / H268D / G327A / L328E / A330S / I332T; wherein, the amino acid numbering is based on the IgG Eu numbering.

[0031] In a second aspect of the invention, a mutant immunoglobulin Fc region is provided, the mutant immunoglobulin Fc region comprising the mutant Fc polypeptide fragment as described in the first aspect of the invention.

[0032] In another preferred embodiment, the immunoglobulin is human IgG2.

[0033] In another preferred embodiment, the mutant immunoglobulin Fc region has enhanced FcγRIIB affinity compared to the wild-type IgG2 Fc region.

[0034] In another preferred embodiment, the affinity of the mutant immunoglobulin Fc region for FcγRIIB is increased by more than 1 times compared to the affinity of the wild-type IgG2 Fc region for FcγRIIB; preferably, the affinity is increased by 2, 3, 4, 5, 10, 20, 50 or 100 times or more.

[0035] In another preferred embodiment, the affinity can be expressed as the degree of enrichment by screening or as a combination of analytical signals.

[0036] In another preferred embodiment, the mutant immunoglobulin Fc region has a lower affinity for activated FcγR than for FcγRIIB.

[0037] In another preferred embodiment, compared with the wild-type IgG2 Fc region, the mutant immunoglobulin Fc region has increased affinity for FcγRIIB and decreased affinity for activated FcγR (I / A ratio higher than that of the wild-type IgG2 Fc region).

[0038] In another preferred embodiment, the mutant immunoglobulin Fc region is associated with FcγRIIB and FcγRIIA, respectively. 131R The affinity ratio (RIIB / RIIAR) of IgG2 is higher than that of wild-type IgG2.

[0039] In a third aspect of the invention, an antibody is provided, the antibody comprising a mutant Fc polypeptide fragment as described in the first aspect of the invention or a mutant immunoglobulin Fc region as described in the second aspect of the invention.

[0040] In another preferred embodiment, the antibody is an antibody based on the human IgG2 backbone.

[0041] In another preferred embodiment, the antibody is an agonist antibody.

[0042] In another preferred embodiment, the antibody specifically targets the tumor necrosis factor receptor superfamily.

[0043] In another preferred embodiment, the antibody is capable of specifically binding to targets selected from the group consisting of: CD40, DR5, OX40, CD137, CD27, CD30, GITR, HVEM, TACI, DR4, FAS, or combinations thereof.

[0044] In another preferred embodiment, the antibody is capable of specifically binding to OX40.

[0045] In another preferred embodiment, the antigen targeted by the antibody is an immune receptor molecule, or a combination thereof.

[0046] In another preferred embodiment, the antigen targeted by the antibody is an immunosuppressive receptor molecule, and the immunosuppressive receptor molecule is selected from PD-1, CTLA-4, VISTA, TIM-3, BTLA, LAG-3, or a combination thereof.

[0047] In another preferred embodiment, the antibody is a human antibody, a humanized antibody, or a chimeric antibody.

[0048] In another preferred embodiment, the antibody is a monoclonal antibody or a polyclonal antibody, preferably a monoclonal antibody.

[0049] In a fourth aspect of the invention, a fusion protein is provided, the fusion protein comprising a mutant Fc polypeptide fragment as described in the first aspect of the invention, a mutant immunoglobulin Fc region as described in the second aspect of the invention, or an antibody as described in the third aspect of the invention.

[0050] In another preferred embodiment, the fusion protein further includes other protein sequences or fragments thereof that have receptor agonist functions.

[0051] In another preferred embodiment, the other proteins with receptor agonist function are cytokines from the TNF gene family.

[0052] In another preferred embodiment, the other proteins with receptor agonist function include ligand molecules of immune receptors.

[0053] In another preferred embodiment, the other proteins having receptor agonistic function include ligand molecules of immune receptors, wherein the ligand molecules of immune receptors are selected from any one of CD80, CD86, ICOSL, OX40L, CD137L, CD40L, CD30L, CD27L, CD244, CD150, CD48, CD84, CD319, Ly118, or CD229, or combinations thereof.

[0054] In another preferred embodiment, the other proteins having receptor agonistic function include ligand molecules of immune receptors selected from the group consisting of PD-L1, PD-L2, B7-H3, B7-H4, CD47, VISTA, HVEM, GAL9, or combinations thereof.

[0055] In another preferred embodiment, the fusion protein may further include a tag sequence that assists in expression and / or purification; preferably, the tag sequence includes a 6His tag, an HA tag, and / or a FLAG tag.

[0056] In a fifth aspect of the invention, a separated polynucleotide is provided, the polynucleotide encoding a mutant Fc polypeptide fragment as described in the first aspect of the invention, a mutant immunoglobulin Fc region as described in the second aspect of the invention, an antibody as described in the third aspect of the invention, or a recombinant protein as described in the fourth aspect of the invention.

[0057] In a sixth aspect of the invention, a carrier is provided, the carrier containing isolated polynucleotides as described in the fifth aspect of the invention.

[0058] In another preferred embodiment, the vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof.

[0059] In another preferred embodiment, the vector includes a viral vector, such as a lentivirus, adenovirus, AAV virus, retrovirus, or a combination thereof.

[0060] In a seventh aspect of the invention, a host cell is provided, the host cell containing a vector as described in the sixth aspect of the invention, or having a polynucleotide as described in the fifth aspect of the invention integrated into its genome;

[0061] Alternatively, the host cell expresses a mutant Fc polypeptide fragment as described in the first aspect of the present invention, a mutant immunoglobulin Fc region as described in the second aspect of the present invention, an antibody as described in the third aspect of the present invention, or a recombinant protein as described in the fourth aspect of the present invention.

[0062] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0063] In another preferred embodiment, the host cell is selected from the group consisting of: Escherichia coli, yeast cells, insect cells, avian cells, and mammalian cells.

[0064] In an eighth aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising:

[0065] (a) a mutant Fc polypeptide fragment as described in the first aspect of the invention, a mutant immunoglobulin Fc region as described in the second aspect of the invention, an antibody as described in the third aspect of the invention, or a recombinant protein as described in the fourth aspect of the invention; and

[0066] (b) Pharmaceutically acceptable carriers.

[0067] In another preferred embodiment, the pharmaceutical composition may further include other drugs for treating tumors, such as cytotoxic drugs.

[0068] In another preferred embodiment, the pharmaceutical composition may further include other active substances with receptor agonist function.

[0069] In another preferred embodiment, the pharmaceutical composition is an injectable dosage form.

[0070] In a ninth aspect of the present invention, a method for generating a mutant Fc polypeptide fragment as described in the first aspect of the present invention, a mutant immunoglobulin Fc region as described in the second aspect of the present invention, an antibody as described in the third aspect of the present invention, or a recombinant protein as described in the fourth aspect of the present invention is provided, comprising the steps of:

[0071] (i) Under suitable conditions, host cells as described in the seventh aspect of the invention are cultured to obtain a culture containing the mutant Fc polypeptide fragment, the mutant immunoglobulin Fc region, the antibody, or the recombinant protein; and

[0072] (ii) The culture obtained in step (i) is purified and / or separated to obtain the mutant Fc polypeptide fragment, mutant immunoglobulin Fc region, antibody, or recombinant protein.

[0073] In another preferred embodiment, the purification can be performed by purifying and separating the target antibody using a protein A affinity column.

[0074] In another preferred embodiment, the purification can be performed by purifying and separating the target antibody using a protein G affinity column.

[0075] In another preferred embodiment, the purity of the purified and separated target antibody is greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, and preferably 100%.

[0076] In a tenth aspect of the invention, the use of a mutant Fc polypeptide fragment as described in the first aspect of the invention, a mutant immunoglobulin Fc region as described in the second aspect of the invention, an antibody as described in the third aspect of the invention, or a recombinant protein as described in the fourth aspect of the invention, a polynucleotide as described in the fifth aspect of the invention, a vector as described in the sixth aspect of the invention, and / or a host cell as described in the seventh aspect of the invention, for the preparation of a pharmaceutical composition for tumor immunotherapy, reducing inflammation, and / or reducing autoimmune symptoms, is provided.

[0077] In an eleventh aspect of the present invention, a method for treating a disease is provided, comprising the steps of administering to a desired subject a mutant Fc polypeptide fragment as described in the first aspect of the present invention, a mutant immunoglobulin Fc region as described in the second aspect of the present invention, an antibody as described in the third aspect of the present invention, or a recombinant protein as described in the fourth aspect of the present invention, a polynucleotide as described in the fifth aspect of the present invention, a vector as described in the sixth aspect of the present invention, a host cell as described in the seventh aspect of the present invention, and / or a pharmaceutical composition as described in the eighth aspect of the present invention.

[0078] In another preferred embodiment, the object includes mammals, preferably humans.

[0079] In another preferred embodiment, the disease is selected from the group consisting of: tumors, inflammatory diseases, autoimmune diseases, or combinations thereof.

[0080] In another preferred embodiment, the cancers include, but are not limited to, breast cancer, prostate cancer, lung cancer, ovarian cancer, cervical cancer, skin cancer, melanoma, colon cancer, stomach cancer, liver cancer, esophageal cancer, kidney cancer, pharyngeal cancer, thyroid cancer, pancreatic cancer, testicular cancer, brain cancer, bone cancer, and blood cancers (such as leukemia and chronic lymphocytic leukemia).

[0081] In another preferred embodiment, the cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer, bladder cancer, bone cancer, brain and central nervous system (CNS) cancer, cervical cancer, choriocarcinoma, colorectal cancer, connective tissue cancer, digestive system cancer, endometrial cancer, esophageal cancer, eye cancer, head and neck cancer, stomach cancer, intraepithelial neoplasia, kidney cancer, laryngeal cancer, liver cancer, lung cancer (small cell, large cell), lymphoma (including Hodgkin's lymphoma and non-Hodgkin's lymphoma); melanoma; neuroblastoma; oral cancer (e.g., lip, tongue, mouth and pharynx); ovarian cancer; pancreatic cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; respiratory system cancer; sarcoma; skin cancer; stomach cancer; testicular cancer; thyroid cancer; uterine cancer; urinary system cancer; and other cancers and sarcomas.

[0082] In another preferred embodiment, the method can be used to stimulate an immune response to treat a tumor by inhibiting or delaying its growth or reducing its size.

[0083] In another aspect of the present invention, a method for screening amino acid mutations that enhance protein-molecule binding ability is also provided, comprising the following steps:

[0084] 1) Provide the parental protein sequence and introduce amino acid mutations into the parental protein sequence via PCR;

[0085] 2) The parental protein and the mutated protein were constructed into an expression vector to form a mutant library;

[0086] 3) The expression vector was transfected into mammalian cells, and the parental protein and the mutant protein were expressed on the cell surface;

[0087] 4) Incubate the labeled interacting molecules with the above-mentioned mammalian cells, and then sort the labeled mammalian cells by flow cytometry or magnetic beads;

[0088] 5) Extract DNA from labeled mammalian cells, sequence it, and analyze and compare the changes in sequence ratios before and after sorting;

[0089] Among them, the amino acid mutations that account for a significantly higher proportion after sorting than before sorting are amino acid mutations that can enhance the binding ability between the protein and interacting molecules.

[0090] This screening method can efficiently screen for various amino acid mutations, and has excellent convenience and effectiveness. It can be used to screen for amino acid mutations that enhance various protein-protein interactions or protein-other molecule interactions.

[0091] The beneficial effects of this invention are: the modified Fc region or Fc fragment provided by this invention has enhanced FcγRIIB affinity, and some of these also have reduced affinity for activating FcγRs while possessing enhanced FcγRIIB affinity. These proteins can be used to design, modify, or optimize the agonistic activity of antibodies or fusion proteins. In particular, they can be used to design antibodies or fusion proteins based on the human IgG2 backbone with enhanced agonistic activity. Thus, protein molecules with significantly enhanced agonistic activity can be provided for the treatment of tumors, inflammatory diseases, autoimmune diseases, or combinations thereof, showing significant application prospects. Attached Figure Description

[0092] Figure 1 The map shows the construction of antibody plasmids on the surface of mammals.

[0093] Figure 2 The diagram illustrates the mutation screening process. Specifically, it involves first constructing a mutation library, then transfecting it into cells via retrovirus, expressing the Fc mutation library on the cell surface, sorting cells with high affinity for FcγRIIB, extracting DNA, performing high-throughput sequencing (NSG), and then analyzing the enrichment of various mutations before and after sorting to select mutation types with relatively high enrichment folds compared to wild-type.

[0094] Figure 3 The Eu number corresponding to the amino acid encoded by CH2 on human IgG2 Fc is shown.

[0095] Figure 4 The results show that flow cytometry can progressively enrich cells with high binding affinity to FcγRIIB. The figures show the flow cytometry analysis results of wild-type human IgG2 cells and human IgG2 LibraryMix cells after one and two rounds of FcγRIIB sorting, respectively.

[0096] Figure 5 The results show that the binding ability of cells selected from the library to FcγRIIB is significantly enhanced. The figures show the flow cytometry results of wild-type human IgG2 cells and cells after two rounds of FcγRIIB sorting, respectively.

[0097] Figure 6The diagrams show two types of combined mutation libraries. Type 1 consists of single-point combined mutations across four regions: P233-V240, V266-P271, S298-T299, and G327-I332, with 0-1 mutations in each region, for a total of 0-4 combined mutation sites. Type 2 consists of multiple amino acid combined mutations within a single region: P233-V240, V266-P271, S298-T299, or G327-I332, with combined amino acid mutations within each region (0-7, 0-6, 0-2, and 0-6 combined mutations, respectively).

[0098] Figure 7 The flow cytometry analysis results of wild-type IgG2 and the flow cytometry-sorted libraries IgG2_C01 and IgG2_C02 are shown, indicating that the proportion of cells binding to FcγRIIB was increased in both libraries IgG2_C01 and IgG2_C02.

[0099] Figure 8 The images show the Cmix and C2 cell libraries before ("before") and after ("1") flow cytometry sorting. st " and "_2 nd The binding affinity of FcγRIIB to FcγRIIB was investigated, and the results showed that the proportion of cells in the sorted library that bound to FcγRIIB gradually increased (2). nd >1 st >befor).

[0100] Figure 9 The binding ability of different IgG2 antibody Fc mutants to FcγRI was shown (expressed as ELISA signal: absorbance at 650 nm (A650)).

[0101] Figure 10 Different IgG2 antibody Fc mutants and FcγRIIA were shown. 131H The binding ability (expressed as the ELISA signal: absorbance at 650 nm (A650)).

[0102] Figure 11 Different IgG2 antibody Fc mutants and FcγRIIA were shown. 131R The binding ability (expressed as the ELISA signal: absorbance at 650 nm (A650)).

[0103] Figure 12 The binding ability of different IgG2 antibody Fc mutants to FcγRIIB was shown (expressed as ELISA signal: absorbance at 650 nm (A650)).

[0104] Figure 13Different IgG2 antibody Fc mutants and FcγRIIIA were shown. 158F The binding ability (expressed as the ELISA signal: absorbance at 650 nm (A650)).

[0105] Figure 14 Different IgG2 antibody Fc mutants and FcγRIIIA were shown. 158V The binding ability (expressed as the ELISA signal: absorbance at 650 nm (A650)).

[0106] Figure 15 This shows the ELISA analysis of the mutant on IgG1 V11 (hIgG1V11) corresponding to IgG2 and FcγRIIA. 131H And its binding ability with FcγRIIB (expressed as an ELISA signal: absorbance at 650 nm (A650)).

[0107] Figure 16 The results of immune activation activity analysis of different antibody Fc mutants against human OX40 are shown, and the average fluorescence intensity bar graph of CFSE in CD4 positive cells is displayed (the lower the CFSE signal, the higher the activity).

[0108] Figure 17 The results of immune activation activity analysis of different Fc mutants against human OX40 antibody are shown, along with the fluorescence intensity histogram of CFSE in CD4-positive cells (lower CFSE signal indicates higher activity). Detailed Implementation

[0109] Unless otherwise stated, the scientific and technical terms used herein shall have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless otherwise required herein, singular terms shall include plural terms, and plural terms shall include singular terms. Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, and protein and nucleic acid chemistry described herein are known and commonly used in the art.

[0110] The methods and techniques of this invention are generally performed according to conventional methods known in the art and described in various general and more specialized references extracted and discussed in this specification, unless otherwise stated. See, for example, Sambrook et al., *Molecular Cloning: A Laboratory Manual*, 2nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), Ausubel et al., *Current Protocols in Molecular Biology* (Greene Publishing Associates (1992)), and Harlow and Lane, *Antibodies: A Laboratory Manual* (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1990)), the contents of which are incorporated herein by reference. Enzyme reactions and purification techniques are performed according to the manufacturer's instructions and are generally performed according to methods known in the art or as described herein. The nomenclature, experimental methods, and techniques related to analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are known and commonly used in the art. Standard techniques are used in chemical synthesis, chemical analysis, pharmaceutical manufacturing, formulation and drug delivery, as well as in patient treatment.

[0111] Unless otherwise stated, the following terms have the following definitions.

[0112] An antibody (Ab) should include, but is not limited to, a glycoprotein immunoglobulin that specifically binds to an antigen and includes at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds, or their antigen-binding portions. Each H chain contains a heavy chain variable region (abbreviated as VH) and a heavy chain constant region. The antibody heavy chain constant region, also known as CDs, contains three domains: CH1, CH2, and CH3, as well as a hinge region located between the CH1 and CH2 domains. Each light chain contains a light chain variable region (abbreviated as VL) and a light chain constant region. The light chain constant region consists of a single domain, CL. The VH and VL regions can be further subdivided into highly denatured regions called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen.

[0113] The “Fc region” (crystallizable fragment region), “Fc domain”, or simply “Fc” refers to the C-terminal region of an antibody heavy chain that mediates the binding of immunoglobulins to host tissues or factors, including binding to Fc receptors on various cells of the immune system (e.g., effector cells) or to the first component (C1q) of the classical complement system. Therefore, the Fc region is the portion of the antibody heavy chain constant region that constitutes the portion other than the first constant region, the immunoglobulin domain (CH1 domain). In IgG, IgA, and IgD antibody isotypes, the Fc region consists of two identical protein fragments from the second (CH2 domain) and third (CH3 domain) constant domains of the two antibody heavy chains; the Fc regions of IgM and IgE contain three heavy chain constant domains (CH2-CH3-CH4 domains) in each polypeptide chain. For IgG, the Fc region contains the immunoglobulin domains CH2 and CH3, as well as the hinge region between CH1 and CH2. Although the boundaries of the Fc region of the immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is defined in this invention as the sequence segment from the amino acid residue at position P231 of the heavy chain to the carboxyl terminus, where the numbering is based on EU numbering, as in Kabat. The CH2 domain of the human IgG Fc region extends from approximately amino acid 231 to approximately amino acid 340, while the CH3 domain is located on the C-terminal side of the CH2 domain of the Fc region, i.e., it extends from approximately amino acid 341 to approximately amino acid 447 of IgG.

[0114] "Fc polypeptide fragment" refers to a fragment contained within an Fc region. The Fc polypeptide fragment referred to in this invention is a fragment extending from amino acid 233 to amino acid 332 in an Fc region, or a fragment contained in other Fc regions, such as the Fc CH2 domain or the Fc region.

[0115] As used herein, "Fc region" or "Fc polypeptide fragment" can refer to native or modified Fc. Furthermore, "Fc region" or "Fc polypeptide fragment" can also refer to this region in a separated state, or to this region within a protein polypeptide containing Fc, such polypeptides are also called "Fc fusion proteins" (e.g., antibodies or immunoadhesins).

[0116] "Fc receptors" or "FcRs" are receptors that bind to the Fc region of immunoglobulins. FcRs that bind IgG antibodies include receptors of the FcγR family, including allelic variants and alternative splicing forms of these receptors. The human Fcγ receptor family includes several members: FcγRI (CD64), FcγRIIA (CD32a), FcγRIIB (CD32b), FcγRIIIA (CD16a), and FcγRIIIB (CD16b). Of these, FcγRIIB is the only inhibitory Fcγ receptor; the others are activating Fcγ receptors. Most natural effector cell types co-express one or more activating FcγRs and one or more inhibitory FcγRIIBs, while natural killer (NK) cells selectively express one activating Fcγ receptor (FcγRIII in mice and FcγRIIIA in humans) but do not express the inhibitory FcγRIIB in mice or humans. These Fcγ receptors have different molecular structures, and therefore different affinities for different IgG antibody subclasses. Among these Fcγ receptors, FcγRI is a high-affinity receptor, while FcγRIIA, FcγRIIB, and FcγRIIIA are low-affinity receptors. Genetic polymorphisms are also present in these different Fcγ receptors and affect their binding affinity. The most common genetic polymorphisms are the R131 / H131 polymorphism in FcγRIIA and the V158 / F158 polymorphism in FcγRIIIA. Some of these polymorphisms have been found to be associated with multiple diseases, and the efficacy of some specific therapeutic antibodies also depends on whether the patient carries a specific Fcγ receptor genetic polymorphism.

[0117] The term "sequence" as used in this invention should be understood to include sequences substantially identical to those of this invention. "Substantially identical sequence" means that, after optimal alignment, such as using GAP or BESTFIT programs with default nick values, two peptide sequences exhibit at least 70, 75, or 80% sequence identity, preferably at least 90 or 95%, and more preferably at least 97, 98, or 99%. Preferably, the difference in the position of the dissimilar residues is a conserved amino acid substitution. "Conserved amino acid substitution" refers to the substitution of an amino acid residue by another amino acid residue with a similar side chain R group, possessing similar chemical properties (e.g., charge or hydrophilicity). Generally, conserved amino acid substitutions do not substantially alter the functional properties of the protein. If the difference between two or more amino acid sequences lies in a conserved substitution, the sequence identity percentage or similarity can be increased to correct for the conservatism of the substitution. See, for example, Pearson, Methods Mol. Biol. 243:307-31 (1994). Examples of amino acid groups with side chains having similar chemical properties include: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxy side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conserved amino acid groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamic acid-aspartic acid, and asparagine-glutamine. As noted above, the Fc region, antibody, Fc fragment, or fusion protein according to the present invention, in addition to the amino acid mutations provided by the present invention, may further include other possible modifications not disclosed in the present invention, provided that the substantially identical sequence requirements described above are met.

[0118] The amino acid sequences of the antibodies and their fragments or domains in this invention are based on the IgG Eu numbering system. Table 1 shows the mutation types and nomenclature of some of the mutants involved in this invention.

[0119] Antibodies typically bind to their associated antigens with high affinity and specificity (similarly, the proteins of this invention can also specifically bind to their epitope recognition molecules), which manifests as 10 -5 -10 -11 M or smaller dissociation constant (KD). Any greater than approximately 10 -4 M -1KD is generally considered to indicate nonspecific binding. As used herein, antibodies that "specifically bind" to an antigen refer to antibodies that bind with high affinity to the antigen and substantially the same antigen, implying a KD of 10. -7 M or smaller, preferably 10 -8 M or smaller, or even more preferably 5×10 -9 M or smaller, most preferably 10 -8 -10 -10 M or smaller, but will not bind to unrelated antigens with high affinity. An antigen is "substantially identical" to a given antigen if it shows a high degree of sequence identity, for example, if it shows at least 80%, at least 90%, preferably at least 95%, more preferably at least 97%, or even more preferably at least 99% sequence identity with the given antigen.

[0120] Immunoglobulins can originate from any commonly known isotype. IgG isotypes can be further subdivided into subclasses in some species: IgG1, IgG2, IgG3, and IgG4 in humans, and IgG1, IgG2a, IgG2b, and IgG3 in mice. "Isotype" refers to an antibody class (e.g., IgM or IgG1) encoded by a heavy chain constant region gene. "Antibodies" include, for example, naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or non-human antibodies; fully synthetic antibodies; and single-chain antibodies.

[0121] The "natural IgG" mentioned in this invention refers to IgG that exists naturally in nature, and whose sequences have not been artificially modified. It should be noted that, due to gene polymorphism, even natural IgG can exist in different mutants. Regardless of whether it is mutated or not, any IgG that is naturally occurring and not artificially modified is called natural IgG.

[0122] "Agonistic antibodies" are antibodies that bind to and activate receptors. A functional example of agonist antibodies is their binding to receptors in the tumor necrosis factor receptor (TNFR) superfamily and their induction of apoptosis in cells expressing TNF receptors. Assays describing the apoptosis-inducing effect are described in WO98 / 51793 and WO99 / 37684, which are hereby incorporated by reference. In specific embodiments of this invention, anti-CD40 agonist antibodies can indirectly kill tumor cells by enhancing anti-tumor immune responses through binding to target molecules that transmit immune activation signals on the surface of immune cells and activating important immune activation signaling pathways controlled by these molecules. Examples of agonist antibodies that have entered clinical trials can be found in patent PCT / CN2017 / 087620.

[0123] "Agonistic activity" refers to the activity that induces specific physiological changes by causing antibodies to bind to antigen molecules, thereby triggering the antigen molecules to produce signals. Antigen molecules include receptor molecules and other molecules with signaling or physiological functions. The aforementioned specific physiological activities include, for example: proliferative activity, survival activity, differentiation activity, transcriptional activity, membrane transport activity, affinity, proteolytic activity, phosphorylation / dephosphorylation activity, redox activity, transfer activity, nucleic acid degradation activity, dehydration activity, cell death induction activity, and apoptosis induction activity, but are not limited to these.

[0124] "Parent" refers to the object of modification during protein modification. The parent can be a naturally occurring polypeptide, or a variant or modified form of a naturally occurring polypeptide. In some embodiments, the parent Fc region of this invention is the Fc region of natural IgG.

[0125] "Variant" refers to a protein obtained by modifying the parent protein during protein engineering. Specifically, it can be a protein derived through mutation, deletion, and / or addition of amino acids from the parent protein, retaining some or all of the functions inherent in the parent protein. Preferably, the sequence of the variant shares at least about 80% homology with the parent sequence, most preferably at least about 90% homology, and more preferably at least about 95% homology. Correspondingly, "Fc variant" as used herein refers to an Fc sequence that differs from the parent Fc sequence due to modification of at least one amino acid. An Fc variant may contain only the Fc region, or it may exist in the context of an antibody, Fc fusion, isolated Fc, Fc region, or other polypeptides substantially encoded by Fc. An Fc variant may refer to the Fc polypeptide itself, a composition containing an Fc variant polypeptide, or the amino acid sequence encoding it.

[0126] The term "tumor necrosis factor receptor superfamily" or "TNF receptor superfamily" in this article refers to receptor polypeptides that can bind to cytokines of the TNF family. Generally, these receptors are type I transmembrane receptors with one or more cysteine-rich repetitive sequences in their extracellular regions. Examples of cytokines in the TNF gene family include: tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β or lymphotoxin), CD30 ligand, CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (also known as Fas ligand or CD95 ligand), Apo-2 ligand (also known as TRAIL), Apo-3 ligand (also known as TWEAK), osteoprotegerin (OPG), APRIL, RANK ligand (also known as TRANCE), and TALL-1 (also known as BlyS, BAFF, or THANK). Examples of receptors in the TNF receptor superfamily include: tumor necrosis factor receptor type 1 (TNFR1), tumor necrosis factor receptor type 2 (TNFR2), p75 nerve growth factor receptor (NGFR), B cell surface antigen CD40, T cell antigen OX-40, Apo-1 receptor (also known as Fas or CD95), Apo-3 receptor (also known as DR3, sw1-1, TRAMP, and LARD), receptors called "transmembrane activators and CAML-interactors" or "TACI", BCMA protein, DR4, DR5 (or, also known as A... po-2; TRAIL-R2, TR6, Tango-63, hAPO8, TRICK2 or KILLER), DR6, DcR1 (also known as TRID, LIT or TRAIL-R3), DcR2 (also known as TRAIL-R4 or TRUNDD), OPG, DcR3 (also known as TR6 or M68), CAR1, HVEM (also known as ATAR or TR2), GITR, ZTNFR-5, NTR-1, TNFL1, CD30, lymphotoxin β receptor (LTBr), 4-1BB receptor and TR9 (EP988, 371 A1).

[0127] The “affinity ratio to inhibitory Fcγ receptors and activating Fcγ receptors” or “I / A ratio” described in this invention is equal to the affinity of the antibody heavy chain constant region to the inhibitory Fcγ receptor (e.g., human FcγRIIB) divided by the highest affinity of the antibody heavy chain constant region to the activating Fcγ receptors of the same species (e.g., including human FcγRI, FcγRIIA, FcγRIIIA, and FcγRIIIB).

[0128] The term "affinity" refers to the binding ability between two molecules, which is usually measured by KD. In this invention, it can also be measured by enrichment factor (as shown in Table 7) or binding analysis signal (as shown in Table 8). Figure 12 "KD" refers to the equilibrium dissociation constant of the interaction between two molecules (e.g., a specific antibody and antigen, or a ligand and receptor). "Enrichment factor" refers to the percentage of cells expressing antibodies containing a specific Fc mutation after sorting using the flow cytometry or magnetic bead sorting methods provided in this invention, divided by the percentage before sorting (analyzed by next-generation sequencing, as shown in Table 7). "Binding analysis signal" refers to the absorbance value in the ELISA analysis provided in this invention (e.g., ...). Figure 12 ).

[0129] A "human" antibody refers to an antibody whose variable region has a frame region and a CDR region derived from a human germline immunoglobulin sequence. Furthermore, if the antibody contains a constant region, that constant region is also derived from a human germline immunoglobulin sequence. The human antibodies of this invention may include amino acid residues not encoded by a human germline immunoglobulin sequence (e.g., mutations introduced through random or site-directed mutagenesis in vitro or through somatic mutations in vivo). However, as used herein, the term "human antibody" is not intended to include antibodies in which a germline CDR sequence from another mammalian species (such as a mouse) has been grafted onto a human frame sequence. The terms "human" antibody and "fully human" antibody are used synonymously.

[0130] The term "antibody" in this invention includes, for example, naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; human or non-human antibodies; and fully synthetic antibodies.

[0131] "Humanized" antibodies are antibodies in which some, most, or all of the amino acids outside the CDR domain of a non-human antibody are replaced by corresponding amino acids from human immunoglobulins. In one embodiment of a humanized antibody, some, most, or all of the amino acids outside the CDR domain are replaced by amino acids from human immunoglobulins, while some, most, or all of the amino acids within one or more CDR domains remain unchanged. Minor additions, deletions, insertions, substitutions, or modifications of amino acids are permitted, as long as they do not eliminate the antibody's ability to bind to a specific antigen. "Humanized" antibodies retain antigen specificity similar to that of the original antibody.

[0132] "Chimeric antibody" refers to an antibody whose variable region comes from one species and whose constant region comes from another species, such as an antibody whose variable region comes from a mouse antibody and whose constant region comes from a human antibody.

[0133] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0134] Table 1. Mutation types and their names corresponding to some of the mutants involved in this invention.

[0135]

[0136]

[0137] Materials and Methods

[0138] Construction of mammalian surface display carriers

[0139] The full-length light and heavy chains of human IgG2 anti-mouse CD40 antibody were constructed into the retroviral vector MIGRI (Addgene, Pear et al., Blood. 1998 Nov 15.92(10):3780-92.) using a multi-fragment one-step rapid cloning kit (Shanghai Yisheng Biotechnology Co., Ltd., China). The primers used are shown in Table 2, and the construction pattern is as follows. Figure 1 As shown, after single digestion with restriction endonuclease BglII, the light and heavy chain DNA of the intact antibody were inserted, linked by a self-cleaving linker P2A. The heavy chain DNA contained a transmembrane domain at its end (DNA sequences of each fragment are shown in Table 3). This plasmid expresses both the human IgG2 antibody and the GFP protein. The amino acid sequences of the antibody and its associated Fc region are shown on the surface in Table 4. Sequencing confirmed successful construction.

[0140] Table 2. Primers used for constructing mammalian surface display antibody plasmids

[0141]

[0142]

[0143] Table 3. DNA sequences of antibody fragments displayed on the surface

[0144]

[0145]

[0146] Table 4. Amino acid sequences of surface-displaying antibodies and their associated Fc regions

[0147]

[0148] Construction of Fc mutant library

[0149] Point mutation libraries are created by introducing mutations using degenerate primers; multiple degenerate primers are designed. For example, the degenerate primer used for the P233 site mutation is CCACCGTGCCCAGCACCANNSGTGGCAGGACCGTCAGTC (SEQ ID NO:21). The mutant library fragments and the desired ligation vectors are obtained separately by PCR, and then ligated and transformed into DH5α cells using a one-step rapid cloning kit (Shanghai Yisheng Biotechnology Co., Ltd., China) to obtain the mutant libraries. Twenty colonies from each library are selected for sequencing to confirm whether the mutation has been introduced at the target location.

[0150] The method for combining mutant libraries is similar. Primers are designed based on the enriched mutation types obtained from the point mutation library. The degenerate primers in the middle are replaced with codons encoding specific amino acids or primer sequences composed of degenerate codons encoding several amino acids, such as: L328W (TGCAAGGTCTCCAACAAAGGCTGGCCAGCCCCCATCGAGAAAAC, SEQ ID NO:22) and Combine2_1 (ACGTGCGTGGTGGTGGACKNGWBGVASRWSSACCHGGAGGTCCAGTTCAACTGG, SEQ ID NO:23).

[0151] The primer sequences above contain degenerate bases other than normal bases: R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents G / C, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0152] Construction of stable cell lines

[0153] The above-mentioned library plasmid and helper plasmid Phoenix-Eco (molar ratio 2:1) were mixed with transfection reagent PEI (mass ratio 1:5) and added to pre-coated Phoenix cells (density 80%). After 6 hours, the medium was replaced with fresh medium, and after 48 hours, the supernatant containing retroviruses was collected. 3T3 cells pre-coated at 80% density were infected with 50% of the above retrovirus supernatant mixed with 50% fresh medium. The medium was changed after 24 hours, and a stable cell line expressing antibodies was obtained after 48 hours.

[0154] Flow cytometry analysis of stable cell lines expressing antibodies

[0155] 3T3 cells were collected by trypsin digestion and a single-cell suspension was prepared. Approximately 1-5 × 10⁻⁶ cells were then added. 6 Cells were resuspended in 50 μl FACS buffer (1xPBS containing 0.5% FBS and 2 mM EDTA) containing PE-F(ab')2Fragment Goat Anti-Human IgG (1:500, Jackson ImmunoResearch Laboratories) or Biotin-FcγRIIB (1 μg / ml, Yiqiao Shenzhou) and Streptavidin-APC (1:500, BD Biosciences), incubated on ice for 15 min, washed twice with FACS buffer, resuspended in 200 μl FACS buffer, and analyzed by flow cytometry.

[0156] Flow cytometry sorting and FcγRIIB high-affinity cells

[0157] The staining system was scaled up proportionally according to the flow cytometry staining method described above, and the cells were finally resuspended at approximately 1-5 × 10⁻⁵ cells / mL. 7 Cells / ml were selected for testing. Cells expressing IgG (strong PE fluorescence signal) and having high affinity for FcγRIIB (strong APC fluorescence signal) were selected, with the proportion controlled to be less than 1% of IgG positive cells.

[0158] Magnetic beads were used to sort cells with high affinity for FcγRIIB but low affinity for activated FcγR (high I / A ratio).

[0159] 3T3 cells were collected by trypsin digestion and a single-cell suspension was prepared. Approximately 1×10⁻⁶ cells were then used to collect the suspension. 7 Cells were resuspended in a solution containing Biotin-FcγRIIB (1 μg / ml, from Yiqiao Shenzhou) and activating FcγRs (including FcγRI, FcγRIIA). 131H 、FcγRIIA 131R 、FcγRIIIA 158V 、FcγRIIIA 158FCells were incubated for 15 minutes on ice in 50 μl of MACS buffer (containing 0.5% BSA, 2 mM EDTA, and PBS) from Shanghai Nearshore Technology Co., Ltd. (all at 1 μg / ml). Cells were then washed twice with MACS buffer, resuspended in 100 μl of MACS buffer, and 25 μl of anti-Biotin beads were added. Cells were incubated for 15 minutes on ice, washed once with MACS buffer, and resuspended to 500 μl. This was added to an LS column placed under a magnetic field, and the eluent was collected. The column was washed with 3 ml of MACS buffer and collected. Finally, the LS column was removed from the magnetic field, and 5 ml of MACS buffer was used to quickly elute the cells retained on the sorting column. Positive cells, i.e., cells with a high I / A ratio, were collected.

[0160] High-throughput sequencing analysis

[0161] Take approximately 0.1-5 × 10⁻⁶ cells from the target cell population. 6 Cells were lysed, genomic DNA was extracted, PCR was performed, and high-throughput sequencing (PE150 or PE250) was conducted using a self-built library. Approximately 600,000 to 300,000 sequences were obtained from each sample. Nucleotide sequences of mutated regions were extracted and translated into corresponding amino acid sequences in batches (http: / / www.cbs.dtu.dk / services / VirtualRibosome / , Rasmus Wernersson. Nucl. Acids Res. 2006 34:W385-W388). The proportion of each mutated sequence in each sample was calculated: Proportion of mutated sequences = Number of mutated sequences / Total number of sequences.

[0162] Antibody expression and purification

[0163] Favorable Fc mutants or novel combinatorial mutants obtained from next-generation sequencing were incorporated into the heavy chain of the anti-human OX40 antibody. These, along with the corresponding antibody light chain, were transiently transfected into HEK293S cells for protein expression. Protein G purification yielded different Fc mutant antibodies, and SDS-PAGE analysis confirmed that all antibody structures were intact. The DNA and protein sequences of the anti-human OX40 antibody are shown in Tables 5 and 6.

[0164] Table 5. DNA sequence of wild-type IgG2 anti-human OX40 antibody

[0165]

[0166]

[0167] Table 6. Wild-type IgG2 anti-human OX40 antibody protein sequence

[0168]

[0169]

[0170] Enzyme-linked immunosorbent assay (ELISA) was used to analyze the binding characteristics of mutant antibodies to FcγR.

[0171] Add 2 μg / mL, 100 μL of antibody or its mutant to an ELISA plate and coat overnight. Discard the supernatant, block with PBS containing 1% BSA for 2 hours, wash with PBST (PBS containing 0.05% Tween 20), then add an appropriate concentration of Biotin-tagged FcγR extracellular domain protein (Beijing Yiqiao Shenzhou Biotechnology Co., Ltd.), incubate at room temperature for 1 hour, discard the supernatant, and wash with PBST. Add Streptavidin-HRP (BD Biosciences), incubate at room temperature for 1 hour to detect Biotin protein, remove the supernatant, add chromogenic buffer, develop for 20-40 minutes, and measure the absorbance at 650 nm (A650).

[0172] In vitro immune activation activity analysis of different Fc-mutated anti-human OX40 antibodies (promoting T cell proliferation)

[0173] Spleens from humanized FCγR / OX40 mice were isolated, and single-cell suspensions of lysed erythrocytes were prepared. These suspensions were labeled with CFSE, and the cells were resuspended in PBS containing 5 μM CFSE to a concentration of 5 × 10⁻⁶ cells. 6 / mL, incubate at 37℃ for 15 minutes, wash twice with 600g PBS containing 5% FBS for 5 minutes, then resuspend the cells in primary cell culture medium (RPMI + 10% FBS + 1% Pen / Strep + 1% HEPES + 1% Sodium Pyruvate + 0.1% 2ME (final 50μM) + 1% L-glutamine + 1% Non-essential Aa) to a cell concentration of 3×10⁻⁶. 6 / ml, add 100μl of cell culture to each well, that is, each well contains 3×10 5 Cells were cultured. Antibody concentrations were diluted to 2, 0.2, and 0.02 μg / ml using primary cell culture medium containing 0.2 μg / ml anti-CD3. 100 μL of the prepared antibody mixture was transferred to wells of humanized FCγR / OX40 spleen cells pre-labeled with CFSE. Two control groups were included: a CD3only group with CFSE-labeled cells and anti-mouse CD3, but without other antibodies; and a CD3+CD28 group with CFSE-labeled cells and anti-mouse CD3, plus 2 μg / ml anti-mouse CD28 antibody (Clone37.51(RUO), BD Pharmaceuticals) (final concentrations of anti-mouse CD3 and CD28 were 0.1 μg / ml and 1 μg / ml, respectively). Cells were incubated at 37°C in a 5% CO2 incubator for 3 days. After incubation, cells were collected and CD4+ was detected by flow cytometry. +and CD8 + Cell number and expansion. Flow cytometry detection of T cell proliferation: The cultured cells were transferred to 96-well U-plates, washed twice with PBS, centrifuged at 500g for 5 minutes, the supernatant was discarded, and the cells were resuspended in 50 μl FACS buffer (PBS containing 0.5% FBS and 2 mM EDTA) containing PE anti-mouse CD4 (Clone: ​​GK1.5, 1:500, BD) and APC anti-mouse CD8a (Clone: ​​53-6.7, 1:500, BioLegend). The cells were incubated on ice in the dark for 15 minutes. Then, the cells were washed twice with PBS buffer and resuspended in 200 μl FACS buffer containing DAPI (0.5 μg / ml, Invitrogen) and CountBright Absolute Counting Beads (Life Technologies, 2 μl / sample). The cells were then analyzed by flow cytometry.

[0174] This invention primarily provides Fc mutant sequences of antibodies that enhance the interaction between human IgG2 and FcγRIIB. It also provides methods for screening to obtain these mutants, such as... Figure 2 As shown, Fc mutants with specific affinity properties can be screened using the above method.

[0175] Furthermore, those skilled in the art, based on the screening method provided by the present invention, can screen for amino acid mutations that enhance various protein-protein interactions or protein-other molecule interactions; general screening methods include:

[0176] 1) Provide the parental protein sequence and introduce amino acid mutations into the parental protein sequence via PCR.

[0177] 2) The parental protein and the mutated protein are constructed into the expression vector to form a mutant library.

[0178] 3) The expression vector was transfected into mammalian cells, and the parental protein and the mutated protein were expressed on the cell surface.

[0179] 4) Incubate the labeled interacting proteins with the above-mentioned mammalian cells, and then sort the labeled mammalian cells by flow cytometry or magnetic beads.

[0180] 5) Extract DNA from labeled mammalian cells, sequence it, and analyze and compare the changes in the sequence ratio before and after sorting; among them, amino acid mutations in which the proportion after sorting is significantly higher than that before sorting are amino acid mutations that can enhance the binding ability between the protein and the interacting protein.

[0181] Example 1: Construction of a human antibody IgG2_Fc point mutation library.

[0182] This invention selects several sites on human IgG2_Fc_CH2, including P233-S239, V266-P271, S298-T299, and G327-I332 (Eu number, see below). Figure 3 (See Table 4). Single-point random mutations were performed on the amino acids at these sites, with each site containing a total of 20 amino acid types (A, R, D, C, Q, E, H, I, G, N, L, K, M, F, P, S, T, W, Y, V), including the wild type. Plasmid libraries (Library1, Library2, Library3, Library4) corresponding to the single-point random mutations of the four regions of human IgG2_Fc were prepared, as well as a mixed library of these four libraries (LibraryMix).

[0183] Example 2: Flow cytometry analysis of cell enrichment before and after sorting.

[0184] After successful construction of the aforementioned plasmid libraries, retroviruses were used to infect 3T3 cells, obtaining stable cell lines expressing these libraries. This invention utilizes flow cytometry sorting technology to separate cells expressing human IgG2 (detected by anti-human IgG F(ab')2) and binding to human FcγRIIB. For example... Figure 4 As shown, flow cytometry can progressively enrich cells with high binding capacity to FcγRIIB. Cells from different rounds of flow cytometry sorting of the human IgG2 library LibraryMix were analyzed. The proportion of cells bound to FcγRIIB detected by flow cytometry increased after each round of sorting: 0.90% in the first round and 22.2% in the second round, representing increases of 2.65 times and 65.29 times respectively compared to 0.34% for wild-type human IgG2.

[0185] like Figure 5 As shown, after two rounds of sorting, the proportions of cells binding to FcγRIIB in Library1, Library2, Library3, Library4, and LibraryMix were all increased by flow cytometry, reaching 1.85%, 16.3%, 0.57%, 2.19%, and 22.2%, respectively. Compared with the 0.34% proportion of wild-type human IgG2, these proportions increased by 5.44 times, 47.94 times, 1.69 times, 6.44 times, and 65.29 times.

[0186] Example 3: Next-generation sequencing analysis of IgG2Fc mutation types with enhanced binding ability to FcγRIIB after flow cytometry sorting.

[0187] This invention selects mutations whose proportion of the sequence before and after sorting increases more than twice that of wild-type human IgG2 (enrichment fold / wild-type enrichment fold > 2), that is, mutations on human IgG2 that are beneficial to its binding ability to FcγRIIB (the enrichment fold is at least 1 times higher than that of wild-type), as shown in Table 7. For example, the proportion of L328W before sorting was 0.39%, and the proportion after sorting was 12.84%, with an enrichment fold of 33.20, which is 22.21 times the enrichment fold of wild-type (1.49).

[0188] Table 7. Mutants in human IgG2 that enhance its binding affinity to FcγRIIB

[0189]

[0190]

[0191]

[0192] #1-3: This data comes from experiments in Library2 (#1), Library4 (#2), and LibraryMix (#3).

[0193] In addition to point mutations, this invention also screened for several double mutation types. The proportion of these amino acid mutations increased more than twice that of wild-type human IgG2 before and after flow cytometry sorting. Among these, the double mutation combinations (V266A / P271C or G, S267A / P271C or G, S267E / D270H, S267E / P271C or V or W or Y, S267E / S298R, S267M / P271C or G, P271A / S298R, P271G / G236V, P271G / G329S, P271G / P331C or T) were also observed. The enhancement ratios of mutations such as P271G / S298D or E or G or K or L or N or R, P271G / T299A or M or S or W, G327A / A330R or V, G327A / I332A or C or E, L328E / I332T, etc., are higher than those of any single point mutation, indicating that both amino acids in this mutation combination contribute to the enhancement of FcγRIIB binding ability. Another mutation combination, such as S267V / S298L, shows an enhancement factor approximately equal to that of the higher-enhancing S298L mutation, indicating that the enhancement of this mutation combination is only due to the contribution of this one site mutation, while the other point mutation has virtually no effect (see Table 8). Therefore, in addition to the amino acid mutations provided by this invention, the Fc region, antibody, Fc fragment, or fusion protein of this invention can further include other possible combinations or modifications.

[0194] Table 8. Double mutation types in human IgG2 that enhance its binding affinity to FcγRIIB

[0195]

[0196]

[0197] a. The ratio of the enrichment fold of the mutant after sorting to the enrichment fold of the wild type.

[0198] b. The ratio of the enrichment fold of mutants after original mutation sorting to the enrichment fold of wild-type mutants.

[0199] c. The ratio of the fold increase from a combined mutation to the fold increase from a single point mutation.

[0200] Example 4: Next-generation sequencing analysis of favorable mutant types after magnetic bead sorting.

[0201] This invention utilizes magnetic bead sorting technology to further sort the FcγRIIB high-affinity cells obtained from the above flow cytometry sorting. Biotin-labeled FcγRIIB and unlabeled activating FcγR are mixed and incubated with the cells. Then, anti-Biotin magnetic beads are used to sort the labeled cells. Next-generation sequencing analysis of the enrichment ratio before and after sorting allows for the screening of mutations with high I / A ratios (see Table 9). The mutation selection method is as follows: select mutations whose proportion increases more than twice that of wild-type human IgG2 before and after sorting, while simultaneously showing a decrease in proportion in the unbound magnetic bead portion (i.e., the effluent from the LS column).

[0202] Table 9. Mutations in human IgG2 that enhance binding to FcγRIIB while exhibiting weaker binding to activating FcγRs than FcγRIIB.

[0203]

[0204]

[0205] NA was not detected in the corresponding mutation type in this row of samples.

[0206] #1-#4: This data comes from two experiments (#3 and #4) of Library2 (#1), Library4 (#2), and LibraryMix.

[0207] G236D, S239D (reported by Seung Y. Chu et al. (Molecular Immunology 45 (2008) 3926–3933)) and S298A mutations (reported by patent US20090042291A1) can increase the affinity of human IgG1 for FcγRIIB. However, the next-generation sequencing analysis results of this invention show that the proportion of IgG2 variants containing G236D or S298A mutations did not increase after sorting, but rather decreased to some extent (Table 10); the proportion of human IgG2 variants containing S239D mutations was 0.026% before sorting, but was not detected in the sequencing results after sorting. These results indicate that G236D, S239D and S298A mutations do not increase the FcγRIIB binding ability of human IgG2, as shown in Table 10.

[0208] Table 10. The effect of known mutations on the FcγR binding capacity of IgG1 cannot be directly predicted on the FcγR binding capacity of IgG2.

[0209]

[0210] NA indicates that the mutant type in this row was not detected in the experiments in this column, and the percentage and multiple cannot be calculated.

[0211] Example 5: Amino acid mutations in human IgG2 Fc polypeptide fragments that enhance FcγRIIB affinity.

[0212] Table 11 summarizes the amino acid mutations that enhance FcγRIIB affinity screened using the point mutation library screening method of this invention. Compared with previous patents, it was found that: S267G and P271C are novel mutation types on human IgG2 that can improve FcγRIIB binding ability. H268S, L328A, and G327A are novel mutation types on human IgG2 that can improve FcγRIIB binding ability while having weaker affinity for other activating FcγRs than for FcγRIIB.

[0213] Table 11. Amino acid mutations in human IgG2 that enhance FcγRIIB affinity

[0214]

[0215] Example 6: Construction of a human antibody IgG2_Fc combinatorial mutant library

[0216] Based on the aforementioned point mutation libraries and high-throughput sequencing results, Fc mutation types that enhance FcγRIIB affinity (mutations with an enrichment fold greater than 1-fold compared to wild-type) were screened. Two types of combined mutation libraries were designed: Type 1, single-point combined mutations across four regions, i.e., 0-1 mutations in each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332, for a total of 0-4 combined mutation sites; Type 2, multiple amino acid combined mutations within a single region, i.e., combined amino acid mutations within each of the four regions P233-V240, V266-P271, S298-T299, or G327-I332 (0-7, 0-6, 0-2, and 0-6 combined mutations, respectively). Figure 6 As shown. The largest plasmid library size is 4.67 × 10⁻⁶. 5 .

[0217] Example 7: Cell enrichment before and after flow cytometry sorting of a combined mutant library

[0218] Based on the high-throughput sequencing results of point mutation screening, a combined mutation library of type I and type II was constructed (Example 6) to obtain a cell library expressing the combined mutation. Then, flow cytometry was used to sort cells with high affinity for FcγRIIB, repeating the sorting process two to three times. Figure 7 As shown, after two rounds of sorting, the proportions of cells binding to FcγRIIB in libraries IgG2_C01 and IgG2_C02 were significantly increased by flow cytometry, reaching 9.53% and 26.9% respectively, representing increases of 41.43 times and 116.96 times compared to the 0.23% proportion of wild-type human IgG2. IgG2_C01 was a combined mutation library (Type I) with a maximum of one mutation in each of the four regions P233-V240, V266-P271, S298-T299, and G327-I332; IgG2_C02 was a cell library created by combining consecutive combined mutation libraries (Type II) in the four regions P233-V240, V266-P271, S298-T299, and G327-I332 and transfecting them into 3T3 cells.

[0219] like Figure 8As shown, after two rounds of sorting, flow cytometry revealed a significant increase in the binding ability of cells in libraries Cmix and C2 to FcγRIIB. The proportion of cells binding to FcγRIIB increased significantly after each round of sorting: after the first and second rounds of sorting, the proportion of Cmix cells binding to FcγRIIB reached 1.86% and 28.9%, respectively, representing increases of 246.03 times and 3822.75 times compared to 0.00756% before sorting; the proportion of Cmix cells binding to FcγRIIB reached 6.46% and 28.9%, respectively, representing increases of 718.58 times and 3214.68 times compared to 0.00899% before sorting. Library Cmix is ​​a combined mutation library with a maximum of one mutation in each of the four regions (Type I); library C2 is a combined mutation library in the V266-P271 region (Type II).

[0220] Example 8: Flow cytometry sorting followed by next-generation sequencing analysis of IgG2Fc combined mutation types with enhanced binding ability to FcγRI IB.

[0221] To screen for IgG2 Fc combined mutations with enhanced binding affinity to FcγRIIB, the combined mutation library constructed in this invention was subjected to flow cytometry sorting to obtain cells with high binding affinity to FcγRIIB. Next-generation sequencing was then used to analyze the enrichment fold of each mutation type before and after sorting. The results are shown in Table 12. All selected mutations showed high fold enrichment (after / before the last round of sorting), or significant enrichment in at least one round of sorting (after / before that round), or were detected only after the last round of sorting. For example, the enrichment fold of V266L / S298L / L328W was 21920.33 times that of the wild type (after / before the last round of sorting); the enrichment fold of the point mutation L328W was 8.78 times that of the wild type (after / before the last round of sorting); and the enrichment folds of H268D / S298L / L328W were 43.98 (after / before the second round of sorting). The enrichment factor of V234M / S267E / S298L / L328W was 5.13 (before / after the third round of sorting); the enrichment factor of V234Q / A235G / P238L / S239V / G327A / L328E / A330S / I332T was only detected after the last round of sorting.

[0222] Table 12. Mutants on human IgG2 that enhance its binding affinity to FcγRIIB, selected from combined mutant libraries.

[0223]

[0224]

[0225] #1-4: This data comes from experiments with libraries IgG2_C01(#1), IgG2_C02(#2), Cmix(#3), and C2(#4). The mutation type corresponding to NA in this column of samples was not detected.

[0226] Example 9: Enzyme-linked immunosorbent assay (ELISA) analysis of the binding characteristics of mutant antibody to FcγR

[0227] Based on the favorable Fc single-point mutations and mutation combinations screened by next-generation sequencing, new Fc mutation combinations were constructed. Anti-human OX40 antibodies containing these new Fc mutation combinations were then expressed, and the binding characteristics of the mutant antibodies to FcγR were analyzed using enzyme-linked immunosorbent assay (ELISA). Figure 9-14 As shown, different Fc mutants are associated with FcγRI and FcγRIIA. 131H 、FcγRIIA 131R 、FcγRIIB、FcγRIIIA 158F and FcγRIIIA 158V The binding affinity of IgG1 to each FcγR was calculated. The binding affinity of IgG1 to each FcγR was set to 1. The relative binding affinity of each mutant to these FcγRs was calculated (ELISA absorbance of the mutant binding to the FcγR divided by the ELISA absorbance of IgG1 binding to the FcγR), and the fold increase in the binding affinity of each mutant to FcγRIIB relative to wild-type IgG2 was calculated (ELISA absorbance of the mutant binding to FcγRIIB divided by the ELISA absorbance of wild-type IgG2 binding to FcγRIIB). As shown in Table 13, the fold increase in the binding affinity of each mutant to FcγRIIB relative to wild-type IgG2 ranged from 4.23 to 25.55 times. Furthermore, the FcγRIIB and FcγRIIA of each mutant were calculated. 131R The binding capacity ratio (RIIB / RIIAR) results (Table 13) showed that the RIIB / RIIAR ratios of these mutants were all higher than those of wild-type IgG2 (wild-type IgG2: 0.34; mutants: 0.46-3.67).

[0228] Table 13. Binding of different IgG2 antibody Fc mutants to FcγR.

[0229]

[0230]

[0231] Note: In the table, RI, RIIAH, RIIAR, RIIB, RIIIAF, and RIIIAV represent FcγRI, FcγRIIA, and RIIIAV, respectively. 131H 、FcγRIIA 131R、FcγRIIB、FcγRIIIA 158F 、FcγRIIIA 158V .

[0232] Example 10: Favorable mutations support stronger immune activation activity

[0233] The immune-activating activity of the anti-human OX40 antibody containing the beneficial mutation (Example 9) in FCγR / OX40 humanized mouse spleen cells was analyzed. Figure 16 , 17 The results showed that at an antibody concentration of 1 μg / ml, CD4 + The CFSE fluorescence intensity and corresponding histogram of cells were analyzed. Lower values ​​indicated stronger activity, and the selected antibodies showed superior activity compared to wild-type IgG2. Activity values ​​from two experiments with different antibody concentrations were analyzed together. The activity of the antibody with only αCD3 was set as 0, and the activity of the positive control with both αCD3 and αCD28 antibodies was set as 1. The relative activity of each mutant antibody was calculated, and the average value was calculated. Table 14 shows that the activity of all 30 selected mutant antibodies was superior to wild-type IgG2, with activities increasing from 9.17 to 16.51 times that of wild-type.

[0234] Table 14 shows the immune activation activity analysis of anti-human OX40 antibodies with different Fc mutations.

[0235]

[0236]

[0237] The mutant antibody in this row was not tested in this column.

[0238] Example 11: The effect of known mutations on the FcγR binding ability of IgG1 cannot be directly predicted on the FcγR binding ability of IgG2.

[0239] G236D, S239D (reported by Seung Y. Chu et al. (Molecular Immunology 45 (2008) 3926–3933)) and S298A mutations (reported by patent US20090042291A1) can increase the affinity of human IgG1 for FcγRIIB. However, the next-generation sequencing analysis results of this invention show that the proportion of IgG2 variants containing G236D or S298A mutations did not increase after sorting, but rather decreased to some extent (Table 10); the proportion of human IgG2 variants containing S239D mutations was 0.026% before sorting, but was not detected in the sequencing results after sorting. These results indicate that G236D, S239D and S298A mutations do not increase the FcγRIIB binding ability of human IgG2, as shown in Table 10.

[0240] Furthermore, we obtained IgG2_M2(H268D / P271G), IgG2_M3(H268D / P271G / A330R), IgG2_M4(G236D / P238D / H268D / P271G / A330R), and IgG2_M5(G236D / P238D / H268D / P271G / A330R) by introducing the V11 mutation site (G237D / P238D / H268D / P271G / A330R) into IgG2, which can significantly enhance the FcγRIIB binding ability of IgG1. The mutation of M5 in IgG2 corresponds to the mutation of IgG1 V11. Figure 15 ELISA results showed that these mutants did not enable IgG2 to acquire the same FcγRIIB binding ability as IgG1 V11.

[0241] Therefore, the effect of known mutations on the FcγR binding ability of IgG1 cannot be directly predicted on the FcγR binding ability of IgG2.

[0242] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Shanghai Jiao Tong University School of Medicine <120> The Fc region of the antibody with enhanced affinity for FcγRIIB <130> P2020-2571 <150> CN201911223227.1 <151> 2019-12-03 <160> twenty three <170> PatentIn version 3.5 <210> 1 <211> 40 <212> DNA <213> Artificial sequence <400> 1 ctaggcgccg gaattagatc taccatggag acagacagac 40 <210> 2 <211> 36 <212> DNA <213> Artificial sequence <400> 2 gtttgttgcg ccggatccac actctcccct gttgaa 36 <210> 3 <211> 36 <212> DNA <213> Artificial sequence <400> 3 ttcaacaggg gagagtgtgg atccggcgca acaaac 36 <210> 4 <211> 36 <212> DNA <213> Artificial sequence <400> 4 gctgagcctg atgtccatgg gtccaggatt ctcttc 36 <210> 5 <211> 36 <212> DNA <213> Artificial sequence <400> 5 gaagagaatc ctggacccat ggacatcagg ctcagc 36 <210> 6 <211> 36 <212> DNA <213> Artificial sequence <400> 6 ggatggagga ggctcgagtt tacccggaga caggga 36 <210> 7 <211> 36 <212> DNA <213> artificial sequence <400> 7 tccctgtctc cgggtaaact cgagcctcct ccatcc 36 <210> 8 <211> 39 <212> DNA <213> artificial sequence <400> 8 ttcgttaacc tcgagagatc ttcacgctag agaatgagg 39 <210> 9 <211> 699 <212> DNA <213> artificial sequence <400> 9 atggagacag acagactcct gctatgggtg ctgctgctct gggtgccagg ctccactggt 60 gacactgtac tgacccagtc tcctgctttg gctgtgtctc caggagagag ggttaccatc 120 tcctgtaggg ccagtgacag tgtcagtaca cttatgcact ggtaccaaca gaaaccagga 180 cagcaaccca aactcctcat ctatctagca tcacacctag aatctggggt ccctgccagg 240 ttcagtggca gtgggtctgg gacagacttc accctcacca ttgatcctgt ggaggctgat 300 gacactgcaa cctattactg tcagcagagt tggaatgatc cgtggacgtt cggtggaggc 360 accaagctgg aattgaaacg aactgtggct gcaccatctg tcttcatctt cccgccatct 420 gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc tgctgaataa cttctatccc 480 agagaggcca aagtacagtg gaaggtggat aacgccctcc aatcgggtaa ctcccaggag 540 agtgtcacag agcaggacag caaggacagc acctacagcc tcagcagcac cctgacgctg 600 agcaaagcag actacgagaa acacaaagtc tacgcctgcg aagtcaccca tcagggcctg 660 agctcgcccg tcacaaagag cttcaacagg ggagagtgt 699 <210> 10 <211> 66 <212> DNA <213> Artificial Sequence <400> 10 ggatccggcg caacaaactt ctctctgctg aaacaagccg gagatgtcga agagaatcct 60 ggaccc 66 <210> 11 <211> 1383 <212> DNA <213> Artificial Sequence <400> 11 atggacatca ggctcagctt ggttttcctt gtccttttca taaaaggtgt ccagtgtgag 60 gtgcagctgg tggagtctga tggaggctta gtgcagcctg gaaggtccct aaaactcccc 120 tgtgcagcct caggattcac tttcagtgac tattacatgg cctgggtccg ccaggctcca 180 acgaaggggc tggagtgggt cgcaagcatt agttatgatg gtagtagcac ttactatcga 240 gactccgtga agggccgatt cactatctcc agagataatg caaaaagcac cctatacctg 300 caaatggaca gtctgaggtc tgaggacacg gccacttatt actgcggaag acacagtagc 360 tactttgatt actggggcca aggagtcatg gtcacagtct cgagcgcctc caccaagggc 420 ccatcggtct tccccctggc gccctgctcc aggagcacct ccgagagcac agcggccctg 480 ggctgcctgg tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgct 540 ctgaccagcg gcgtgcacac cttcccagct gtcctacagt cctcaggact ctactccctc 600 agcagcgtgg tgaccgtgcc ctccagcaac ttcggcaccc agacctacac ctgcaacgta 660 gatcacaagc ccagcaacac caaggtggac aagacagttg agcgcaaatg ttgtgtcgag 720 tgcccaccgt gcccagcacc acctgtggca ggaccgtcag tcttcctctt ccccccaaaa 780 cccaaggaca ccctcatgat ctcccggacc cctgaggtca cgtgcgtggt ggtggacgtg 840 agccacgaag accccgaggt ccagttcaac tggtacgtgg acggcgtgga ggtgcataat 900 gccaagacaa agccacggga ggagcagttc aacagcacgt tccgtgtggt cagcgtcctc 960 accgttgtgc accaggactg gctgaacggc aaggagtaca agtgcaaggt ctccaacaaa 1020 ggcctcccag cccccatcga gaaaaccatc tccaaaacca aagggcagcc ccgagaacca 1080 caggtgtaca ccctgccccc atcccgggag gagatgacca agaaccaggt cagcctgacc 1140 tgcctggtca aaggcttcta ccccagcgac atcgccgtgg agtgggagag caatgggcag 1200 ccggagaaca actacaagac cacacctccc atgctggact ccgacggctc cttcttcctc 1260 tacagcaagc tcaccgtgga caagagcagg tggcagcagg ggaacgtctt ctcatgctcc 1320 gtgatgcatg aggctctgca caaccactac acgcagaaga gcctctccct gtctccgggt 1380 aaa 1383 <210> 12 <211> 228 <212> DNA <213> Artificial Sequence <400> 12 ctcgagcctc ctccatccac tgtctccaac atggcgaccg ttgctgttct ggttgtcctt 60 ggagctgcaa tagtcactgg agctgtggtg gcttttgtga tgaagatgag aaggagaaac 120 acaggtggaa aaggagggga ctatgctctg gctccaggct cccagacctc tgatctgtct 180 ctcccagatt gtaaagtgat ggttcatgac cctcattctc tagcgtga 228 <210> 13 <211> 791 <212> PRT <213> Artificial sequence <400> 13[[ID=I5]] Met Glu Thr Asp Arg Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Thr Val Leu Thr Gln Ser Pro Ala Leu Ala Val 20 25 30 Ser Pro Gly Glu Arg Val Thr Ile Ser Cys Arg Ala Ser Asp Ser Val 35 40 45 Ser Thr Leu Met His Trp Tyr Gln Gln Lys Pro Gly Gln Gln Pro Lys 50 55 60 Leu Leu Ile Tyr Leu Ala Ser His Leu Glu Ser Gly Val Pro Ala Arg 65 70 75 80 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asp Pro 85 90 95 Val Glu Ala Asp Asp Thr Ala Thr Tyr Tyr Cys Gln Gln Ser Trp Asn 100 105 110 Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Leu Lys Arg Thr 115 120 125 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly Glu Cys Gly Ser Gly Ala Thr Asn Phe 225 230 235 240 Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met 245 250 255 Asp Ile Arg Leu Ser Leu Val Phe Leu Val Leu Phe Ile Lys Gly Val 260 265 270 Gln Cys Glu Val Gln Leu Val Glu Ser Asp Gly Gly Leu Val Gln Pro 275 280 285 Gly Arg Ser Leu Lys Leu Pro Cys Ala Ala Ser Gly Phe Thr Phe Ser 290 295 300 Asp Tyr Tyr Met Ala Trp Val Arg Gln Ala Pro Thr Lys Gly Leu Glu 305 310 315 320 Trp Val Ala Ser Ile Ser Tyr Asp Gly Ser Ser Thr Tyr Tyr Arg Asp 325 330 335 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Thr 340 345 350 Leu Tyr Leu Gln Met Asp Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr 355 360 365 Tyr Cys Gly Arg His Ser Ser Tyr Phe Asp Tyr Trp Gly Gln Gly Val 370 375 380 Met Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 385 390 395 400 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 405 410 415 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 420 425 430 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 435 440 445 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 450 455 460 Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 465 470 475 480 Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys Cys Cys Val Glu Cys 485 490 495 Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe 500 505 510 Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val 515 520 525 Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Gln Phe 530 535 540 Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro 545 550 555 560 Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr 565 570 575 Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val 580 585 590 Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr 595 600 605 Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg 610 615 620 Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly 625 630 635 640 Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro 645 650 655 Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly Ser 660 665 670 Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln 675 680 685 Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His 690 695 700 Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Leu Glu Pro Pro 705 710 715 720 Pro Ser Thr Val Ser Asn Met Ala Thr Val Ala Val Leu Val Val Leu 725 730 735 Gly Ala Ala Ile Val Thr Gly Ala Val Val Ala Phe Val Met Lys Met 740 745 750 Arg Arg Arg Asn Thr Gly Gly Lys Gly Gly Asp Tyr Ala Leu Ala Pro 755 760 765 Gly Ser Gln Thr Ser Asp Leu Ser Leu Pro Asp Cys Lys Val Met Val 770 775 780 His Asp Pro His Ser Leu Ala 785 790 <210> 14 <211> 216 <212> PRT <213> artificial sequence <400> 14 Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 1 5 10 15 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 20 25 30 Val Asp Val Ser His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val 35 40 45 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 50 55 60 Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gln 65 70 75 80 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly 85 90 95 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Gln Pro 100 105 110 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr 115 120 125 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 130 135 140 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 145 150 155 160 Lys Thr Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 165 170 175 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 180 185 190 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 195 200 205 Ser Leu Ser Leu Ser Pro Gly Lys 210 215 <210> 15 <211> 109 <212> PRT <213> Artificial sequence <400> 15 Ala Pro Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 1 5 10 15 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 20 25 30 Val Asp Val Ser His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val 35 40 45 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 50 55 60 Phe Asn Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gln 65 70 75 80 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly 85 90 95 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys 100 105 <210> 16 <211> 708 <212> DNA <213> Artificial sequence <400> 16 atggaaaccc cagcgcagct tctcttcctc ctgctactct ggctcccaga taccaccgga 60 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 120 ctctcctgca gggccagtca gagtgttagc ggcgactact tagcctggta ccagcagaaa 180 cttggccagg ctcccaggct cctcatctat ggtgcatcca tcagggccac tggcatccca 240 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag caaactggag 300 cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcaccgct cactttcggc 360 ggagggacca aggtggagat caaacgaact gtggctgcac catctgtctt catcttcccg 420 ccatctgatg agcagttgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 480 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 540 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 600 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 660 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgttga 708 <210> 17 <211> 1392 <212> DNA <213> Artificial Sequence <400> 17 atgaaacacc tgtggttctt cctcctcctg gtggcagctc ccagatgggt cctgtctcag 60 gtgcagctgc aggagtcggg cccaggactg gtgaagcctt cggggaccct gtcactcacc 120 tgcgctgtct ctggtggctc catcagcagt agtatctggt ggagctgggt ccgccagccc 180 ccagggaagg ggctggaatg gattggggaa atccatcata gtgggaacac caactgcaat 240 ccgtccctca agagtcgagt caccatatca atagacaagt ccaagaacca gttctccctg 300 aaactgacct ctgtgaccgc cgcggacacg gccgtatatt attgtgcgag agcgggaact 360 ggaactacgc ttgactactg gggccaggga accctggtca ccgtctcgag cgcctccacc 420 aagggcccat cggtcttccc cctggcgccc tgctccagga gcacctccga gagcacagcg 480 gccctgggct gcctggtcaa ggactacttc cccgaaccgg tgacggtgtc gtggaactca 540 ggcgctctga ccagcggcgt gcacaccttc ccagctgtcc tacagtcctc aggactctac 600 tccctcagca gcgtggtgac cgtgccctcc agcaacttcg gcacccagac ctacacctgc 660 aacgtagatc acaagcccag caacaccaag gtggacaaga cagttgagcg caaatgttgt 720 gtcgagtgcc caccgtgccc agcaccacct gtggcaggac cgtcagtctt cctcttcccc 780 ccaaaaccca aggacaccct catgatctcc cggacccctg aggtcacgtg cgtggtggtg 840 gacgtgagcc acgaagaccc cgaggtccag ttcaactggt acgtggacgg cgtggaggtg 900 cataatgcca agacaaagcc acggggaggag cagttcaaca gcacgttccg tgtggtcagc 960 gtcctcaccg ttgtgcacca ggactggctg aacggcaagg agtacaagtg caaggtctcc 1020 aacaaaggcc tcccagcccc catcgagaaa accatctcca aaaccaaagg gcagccccga 1080 gaaccacagg tgtacaccct gcccccatcc cggggaga tgaccaagaa ccaggtcagc 1140 ctgacctgcc tggtcaaagg cttctacccc agcgacatcg ccgtggagtg ggagagcaat 1200 gggcagccgg agaacaacta caagaccaca cctcccatgc tggactccga cggctccttc 1260 ttcctctaca gcaagctcac cgtggacaag agcaggtggc agcaggggaa cgtcttctca 1320 tgctccgtga tgcatgaggc tctgcacaac cactacacgc agaagagcct ctccctgtct 1380 ccgggtaaat ga 1392 <210> 18 <211> 235 <212> PRT <213> Artificial sequence <400> 18 Met Glu Thr Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser 20 25 30 Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser 35 40 45 Val Ser Gly Asp Tyr Leu Ala Trp Tyr Gln Gln Lys Leu Gly Gln Ala 50 55 60 Pro Arg Leu Leu Ile Tyr Gly Ala Ser Ile Arg Ala Thr Gly Ile Pro 65 70 75 80 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile 85 90 95 Ser Lys Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr 100 105 110 Gly Ser Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 115 120 125 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 130 135 140 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 145 150 155 160 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 165 170 175 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 180 185 190 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 195 200 205 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 210 215 220 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 235 <210> 19 <211> 463 <212> PRT <213> artificial sequence <400> 19 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp No. 1 5 10 15 Val Leu Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gly Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile 35 40 45 Ser Ser Ser Ile Trp Trp Ser Trp Val Arg Gln Pro Pro Gly Lys Gly 50 55 60 Leu Glu Trp Ile Gly Glu Ile His His Ser Gly Asn Thr Asn Cys Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Ile Asp Lys Ser Lys Asn 85 90 95 Gln Phe Ser Leu Lys Leu Thr Ser Val Thr Ala Ala Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Ala Gly Thr Gly Thr Thr Leu Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser 130 135 140 Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala 145 150 155 160 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 165 170 175 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val 195 200 205 Pro Ser Ser Asn Phe Gly Thr Gln Thr Tyr Thr Cys Asn Val Asp His 210 215 220 Lys Pro Ser Asn Thr Lys Val Asp Lys Thr Val Glu Arg Lys Cys Cys 225 230 235 240 Val Glu Cys Pro Pro Cys Pro Ala Pro Pro Val Ala Gly Pro Ser Val 245 250 255 Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 260 265 270 Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu 275 280 285 Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 290 295 300 Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg Val Val Ser 305 310 315 320 Val Leu Thr Val Val His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 325 330 335 Cys Lys Val Ser Asn Lys Gly Leu Pro Ala Pro Ile Glu Lys Thr Ile 340 345 350 Ser Lys Thr Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 355 360 365 Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 370 375 380 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 385 390 395 400 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Met Leu Asp Ser 405 410 415 Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg 420 425 430 Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu 435 440 445 His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 450 455 460 <210> 20 <211> 99 <212> PRT <213> artificial sequence <400> 20 Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 1 5 10 15 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 20 25 30 Val Ser His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly 35 40 45 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn 50 55 60 Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp 65 70 75 80 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro 85 90 95 Ala Pro Ile <210> 21 <211> 39 <212> DNA <213> artificial sequence <220> <221> misc_feature <222> (19)..(20) <223> n is a, c, g, or t <400> 21 ccaccgtgcc cagcaccann sgtggcagga ccgtcagtc 39 <210> 22 <211> 44 <212> DNA <213> artificial sequence <400> 22 tgcaaggtct ccaacaaagg ctggccagcc cccatcgaga aaac 44 <210> 23 <211> 54 <212> DNA <213> singular sequence (artificial sequence) <220> <221> misc_feature <222> (20)..(20) <223> n is a, c, g, or t <400> 23 acgtgcgtgg tggtggackn gwbgvasrws sacchggagg tccagttcaa ctgg 54

Claims

1. A mutant immunoglobulin IgG2 Fc region, characterized in that, The mutant immunoglobulin IgG2 Fc region contains a mutant Fc polypeptide fragment, wherein the mutant Fc polypeptide fragment has the following characteristics: (i) The mutant Fc polypeptide fragment has a mutation relative to the wild-type IgG2 Fc fragment shown in SEQ ID NO: 20, wherein the mutation is selected from: L328W, V266L / L328W, V266L / S298L / L328W, H268D / S298L / L328W, S267V / S298L / L328W, S239V / V266L / S298L / L328W, A235W / V266L / S298L / L328W, P233F / V266L / S298L / L328W, S267V / S298G / L328W, or V234M / S267E / S298L / L328W; wherein all amino acid numbers are based on the IgG Eu number; and (ii) The mutant Fc polypeptide fragment has increased affinity for FcγRIIB compared to the wild-type IgG2 Fc polypeptide fragment shown in SEQ ID NO:

20.

2. The mutant immunoglobulin IgG2 Fc region of claim 1, wherein, The mutant immunoglobulin IgG2 Fc region enhances the agonistic activity of agonist antibodies.

3. An antibody, characterized in that, The antibody contains the Fc region of mutant immunoglobulin IgG2 as described in claim 1 or 2.

4. A fusion protein, characterized in that, The fusion protein comprises the Fc region of mutant immunoglobulin IgG2 as described in claim 1 or 2, or the antibody as described in claim 3.

5. An isolated polynucleotide, comprising, The polynucleotide encodes the Fc region of the mutant immunoglobulin IgG2 as described in claim 1 or 2, the antibody as described in claim 3, or the fusion protein as described in claim 4.

6. A vector, characterized in that, The carrier contains the isolated polynucleotide as described in claim 5.

7. A host cell, characterized in that, The host cell contains the vector as described in claim 6, or its genome is integrated with the polynucleotide as described in claim 5; Alternatively, the host cell expresses the mutant immunoglobulin IgG2 Fc region as described in claim 1 or 2, the antibody as described in claim 3, or the fusion protein as described in claim 4.

8. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises: (a) the antibody as claimed in claim 3, or the fusion protein as claimed in claim 4; and (b) Pharmaceutically acceptable carriers.

9. A method of producing a mutant immunoglobulin IgG2 Fc region according to claim 1 or 2, an antibody according to claim 3, or a fusion protein according to claim 4, characterized in that, Including the following steps: (i) Under suitable conditions, the host cells as described in claim 7 are cultured to obtain a culture containing the mutant immunoglobulin IgG2 Fc region, the antibody, or the fusion protein; and (ii) The culture obtained in step (i) is purified and / or separated to obtain the mutant immunoglobulin IgG2 Fc region, antibody, or fusion protein.

10. The use of the antibody as claimed in claim 3, or the fusion protein as claimed in claim 4, the polynucleotide as claimed in claim 5, the vector as claimed in claim 6, and / or the host cell as claimed in claim 7, characterized in that, This is used to prepare a pharmaceutical composition for tumor immunotherapy, reducing inflammation and / or alleviating autoimmune symptoms.