A multi-epitope subunit vaccine against all GBS serotypes

Abstract

The present invention belongs to the field of medicine, and particularly relates to a multi-epitope subunit vaccine against all GBS serotypes. The present invention first provides a multi-epitope chimeric protein MVSA against all GBS serotypes, and the amino acid sequence of the multi-epitope chimeric protein MVSA is shown in SEQ ID No: 1. Active immunoprotection tests in mice showed that MVSA could provide 100% protection rate for mice against lethal GBS infection. At the same time, passive immunoprotection tests in mice showed that pre-injection of MVSA antibody could significantly reduce the bacterial load in organs and the levels of pro-inflammatory cytokines in organs of mice after GBS challenge, and provided 100% protection rate for mice against lethal GBS infection. In vitro, MVSA antibody could significantly inhibit the growth of different serotypes of GBS. Therefore, as a multi-epitope vaccine, the protective antibodies produced by MVSA stimulating the body can resist GBS infection, and it has good application prospects.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and in particular relates to a multi-epitope subunit vaccine targeting all GBS serotypes. Background Art

[0002] Streptococcus agalactiae, also known as Group B Streptococcus (GBS), is a Gram-positive bacterium that infects a variety of species, including fish, reptiles, amphibians, birds, and mammals. In addition to animals, GBS can colonize the vagina and gastrointestinal tract of up to 30% of healthy women. At the same time, GBS is a major pathogen that threatens the life of newborns and can cause meningitis, sepsis, and pneumonia. Vaccines to prevent GBS infection are crucial for humans and animals. Current GBS vaccines target the polysaccharide capsule of the bacteria, but there is a lack of cross-protection between different serotypes. Therefore, it is urgent to develop a new broad-spectrum, multivalent vaccine that provides broad protection against all 10 serotypes of GBS at the same time. In recent years, mature genomics, bioinformatics, and proteomics technologies have made it possible to identify and execute widely distributed conserved immunogenic proteins against pathogens. Some surface or secretory proteins and virulence factors of pathogens are considered candidate protective antigens, such as surface immune protein Sip, cell wall surface anchor family protein, CAMP factor, C5a peptidase, serine-rich repeat glycoprotein Srr, ornithine carbamoyltransferase OTC, etc. However, a single protein cannot induce an effective immune response and provide protection for the host.

[0003] Multiepitope fusion antigen (MEFA) technology is a new vaccine construction technology and platform based on the combination of computer biology and structural biology. It integrates neutralizing (blocking) antigen epitopes from strains of different species or different virulence factors expressed in the same strain into one antigen using computer biology and structural biology techniques, and simulates the immunogenicity of the antigen epitope itself to the maximum extent, aiming to construct a new multivalent epitope vaccine with broad protection. Epitope vaccines designed based on the MEFA technology platform can integrate epitope antigens from multiple different sources, so that the vaccine has broad protection against heterologous pathogens, which gives the concept of traditional epitope vaccines a new look. Summary of the invention

[0004] In view of the shortcomings of the existing problems, the object of the present invention is to provide a multi-epitope subunit vaccine against all GBS serotypes.

[0005] The technical solution adopted by the present invention to solve the technical problem is:

[0006] In a first aspect, the present invention protects a multi-epitope chimeric protein MVSA against all GBS serotypes, and the amino acid sequence of the multi-epitope chimeric protein MVSA is as shown in SEQ ID No: 1.

[0007] The present invention also protects a gene encoding the multi-epitope chimeric protein MVSA against all GBS serotypes described above.

[0008] The present invention also protects an expression cassette, an expression vector, a transgenic cell line or a recombinant engineered bacterium containing the gene described above.

[0009] In a second aspect, the present invention protects a vaccine against all GBS serotypes, which contains the multi-epitope chimeric protein MVSA described above.

[0010] Based on the prediction of the major histocompatibility antigen alleles (HLA) of humans, the global coverage rate of MVSA is 88.91%. In regions where GBS is prevalent, such as the United States (24.7%), Australia (23.8%), and Canada (20.5%), the MVSA vaccine can cover 100%, 92.79%, and 99.2% of the population respectively.

[0011] As a preferred technical solution of the present application, the vaccine is a subunit vaccine.

[0012] Serological tests showed that MVSA antibodies were produced after inoculation with the vaccine of the present invention. In vitro antibacterial tests showed that the MVSA antibodies provided by the present invention could significantly inhibit the growth of 6 different serotype GBS strains, and these six prevalent serotypes (Ia, Ib, II, III, V, VI) covered 98.4% of GBS clinical infection cases.

[0013] Preferably, the vaccine further contains a subunit vaccine adjuvant.

[0014] More preferably, the subunit vaccine adjuvant is seppic ISA206.

[0015] In a third aspect, the present invention protects a preparation method of a multi-epitope subunit vaccine against all GBS serotypes, including the following steps:

[0016] (1) Computer prediction of GBS antigenic epitopes: Determine candidate proteins covering 10 different GBS serotypes; perform T / B cell antigenic epitope prediction on them, and then screen out 11 polypeptide epitopes containing both T and B cell epitopes through multiple sequence alignment and antigenicity prediction.

[0017] (2) Construction of the MVSA protein: Add a Linker fragment "LRMKLPKS" to the N-terminus of each epitope, and insert a second spacer GPGPG between each pair of Linker-epitope sequences; concatenate the epitopes in step (1) and construct the polypeptide chimera MVSA;

[0018] (3) Construction of the recombinant plasmid: Using the amplification product as a template, amplify and obtain the MVSA protein gene, and ligate the MVSA protein gene to the pET-28a(+) plasmid to obtain the recombinant plasmid;

[0019] (4) Expression of the MVSA protein gene: Transform the constructed recombinant plasmid into BL21 competent cells, and after culture, extraction and purification, obtain the MVSA protein.

[0020] As a preferred technical solution of the present application, the epitopes in step (1) are respectively from the GBS self-proteins NT5, BKD-E2, PK, GAPDH, PGK, Srr1, FbsA, Sip, AP1-2b, Beta C protein, BibA.

[0021] As a preferred technical solution of the present application, the preparation method further includes the step of further preparing MVSA into a commercial vaccine.

[0022] The present invention also protects a multi-epitope subunit vaccine obtained by the preparation method of a multi-epitope subunit vaccine against all GBS serotypes described above.

[0023] In vitro antibacterial tests show that the MVSA antibody of the present invention can significantly inhibit the growth of 6 serotype GBS strains.

[0024] The present invention also protects any of the following applications:

[0025] (1) Application of the multi-epitope chimeric protein described above in being or preparing a subunit vaccine against all GBS serotypes;

[0026] (2) Application of the multi-epitope chimeric protein described above in being or preparing a drug for preventing all GBS serotypes;

[0027] (3) Application of the gene, expression cassette, expression vector, transgenic cell line or recombinant engineering bacteria described above in preparing the multi-epitope chimeric protein described above.

[0028] In the third aspect, the present invention also protects a vaccine or drug against all GBS serotypes, the active ingredient of which is the multi-epitope chimeric protein described above.

[0029] Beneficial effects

[0030] The multi-epitope subunit vaccine against all GBS serotypes provided by the present invention has the following beneficial effects compared with the prior art:

[0031] (1) The subunit vaccine of the present invention concatenates the protective epitopes of multiple antigens, which can not only exclude the immune-irrelevant components or immune-tolerant components in the whole protein molecule, induce a more effective immune protective response, but also overcome the capacity limitation of the chimeric expression of multiple antigen antibodies in the expression vector.

[0032] (2) The selected NT5, BKD-E2, PK, GAPDH, PGK, Srr1, FbsA, Sip, AP1-2b, Beta Cprotein, BibA in the present invention cover almost all GBS clinical isolates; the polypeptide chimera MVSA of the present invention can cover about 88.91% of the global population as predicted by computer human allele HLA. Therefore, MVSA is one of the ideal target antigens for developing GBS vaccines.

[0033] (4) The present invention detects the serum antibody production level after immunizing mice with MVSA and the immune protection rate after challenge by indirect ELISA method, WB method and active immunoprotection test. The results show that MVSA can stimulate the body to produce specific antibodies at different levels, and the immune protection rate of immunized mice with MVSA is 100%. (3) In vitro, the MVSA antibodies induced by MVSA in the body can inhibit the growth of different serotypes of GBS. In mice, pre-injection of MVSA hyperimmune serum can significantly reduce the bacterial load in organs and the level of pro-inflammatory cytokines in organs after GBS challenge. The passive immunoprotection test of mice shows that when challenged with a lethal dose of GBS, the survival rate of mice immunized with MVSA hyperimmune serum reaches 100%. Therefore, the protective antibodies stimulated by MVSA can resist GBS infection and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 is the design route of a multi-epitope subunit vaccine against multiple GBS serotypes of the present invention;

[0035] Figure 2 is the computer analysis of predicted epitopes;

[0036] Figure 3 is the schematic diagram of the tandem protein MVSA;

[0037] Figure 4Identification by pET-28a-MVSA-BL21 PCR; among them, A: Identification by T7 universal primer; B: Identification by MVSA target gene primer; M: 2000DL Marker; 1: pET-28a-MVSA-BL21-1; 2: pET-28a-MVSA-BL21-2; 3: pET-28a-MVSA; 4: ddH2O;

[0038] Figure 5 SDS-PAGE analysis of induced expression and purification of MVSA; among them, M: Protein molecular weight 180 kDa; 1: MVSA;

[0039] Figure 6 Results of immunoblotting of recombinant protein;

[0040] Figure 7 Survival curve of immunized ICR mice against BAA-611 infection;

[0041] Figure 8 Survival curve of mice in immunoprotection test;

[0042] Figure 9 Results of in vitro antibacterial test;

[0043] Figure 10 Distribution of organs in passive immunized mice;

[0044] Figure 11 Cytokine transcription levels in mouse organs. Specific implementation manners

[0045] The present invention will be further described in detail below with reference to embodiments. Reagents or instrument and equipment not indicating the manufacturer are regarded as conventional products that can be purchased from the market.

[0046] Materials: Streptococcus agalactiae BAA-611 is a strain purchased and preserved from ATCC. Mice (SPF, ICR, female, 4-week-old) required for this experiment were all purchased from the Comparative Medicine Center of Yangzhou University.

[0047] Example 1: Selection and retrieval of proteins

[0048] Search keywords such as "protein vaccine and streptococcus", "antigen and streptococcus", and "protein antigen and streptococcus immunity" on PubMed (https: / / www.ncbi.nlm.nih.gov / pubmed / ), sort out protein antigens that have been experimentally proven to have protective effects and download and save them (Table 1). Especially 6 proteins (NT5, OTC, BKD-E2, PK, GAPDH, PGK) were identified as proteins with strong immunoreactivity in the previous immunoproteomics research of this research group (Table 1).

[0049] Table 1 Vaccine candidate proteins of Streptococcus agalactiae that have been proven to be immunogenic

[0050]

[0051]

[0052] Example 2 Prediction of antigenic epitopes with affinity for B and T lymphocytes

[0053] Perform B-cell and T-cell epitope prediction on the protein sequences screened in the previous step. B-cell epitope prediction is performed using two programs, BCPred (http: / / ailab.ist.psu.edu / bcpred / predict.html) and ABCPred (http: / / crdd.osdd.net / raghava / abcpred / ), to identify continuous epitopes between 10 and 20 amino acids in length, with a specificity selection greater than 90%. T-cell epitope prediction is performed using the IEDB TEPITOP (http: / / tools.iedb.org / tepitool / ) website to predict peptides that bind to MHC class I and II molecules. Select seven MHC class II HLA alleles of human host, DRB1*01:01, DRB1*03.:01, DRB1*04:01, DRB1*07:01, DRB1*11:01, DRB1*13:01, DRB1*15:01, and collate the predicted T-cell epitope results of the protein.

[0054] Example 3 Epitope alignment, antigenicity analysis, and global coverage analysis

[0055] Upload the collated B / T cell epitopes to the Prabi (https: / / npsa-prabi.ibcp.fr / ) website for multiple sequence alignment. Select epitopes that can be recognized by both B / T cells, and perform antigenicity analysis through the website VaxiJen (VaxiJen (ddg-pharmfac.net)). Select polypeptide epitopes with antigenicity greater than 0.4, and remove long-chain epitopes with low antigenicity, so that the selected epitopes are from 11 different candidate proteins respectively. To determine the coverage of the constructed multi-epitope vaccine for the world's population, analyze the antigenic epitopes through the database provided by the IEDB website (http: / / tools.iedb.org / population / ).

[0056] Example 4 Conservation analysis of antigenic epitopes in 10 serotypes of GBS

[0057] Analyze the distribution of the predicted antigenic epitopes in different GBS strains to verify the conservation of the selected epitopes in GBS. According to the 10 capsular gene types of GBS, we downloaded the complete genomes of 139 published GBS strains (including Ia, Ib, II-VII) and 21 GBS Scaffold genomes (including types VIII and IX) from NCBI, and established a genomic database of 160 GBS strains containing 10 serotypes. Perform TBLASTN on the predicted epitopes based on the established GBS database, and statistically analyze the distribution of epitopes in each GBS strain. At the same time, construct a phylogenetic tree by the NJ method based on the capsular gene clusters of 160 GBS strains, and combine the distribution of epitopes in different GBS strains to analyze the conservation of epitopes in different serotypes.

[0058] Example 5 Design of tandem epitope vaccine

[0059] Upload the determined polypeptide epitopes to EXPASY (https: / / web.expasy.org / protparam / ) for physicochemical property analysis. The average hydrophilicity less than 0 indicates a hydrophilic protein, and greater than 0 indicates a hydrophobic protein.

[0060] Add a Linkey fragment "LRMKLPKS" to the N-terminus of each epitope, and insert a second spacer GPGPG between each pair of Linkey epitope sequences to link the above-screened epitopes. The linking order is based on hydrophilicity, with a hydrophobic polypeptide epitope in the middle and hydrophilic polypeptide epitopes at both ends. Link them into a protein named MVSA( M ulti-epitopesubunit v accine for S treptococcus a galactiae). Upload MVSA to the websites VaxiJen and AllergenFP (http: / / www.ddg-pharmfac.net / AllergenFP / ) for antigenicity and allergen prediction. Link the ligated sequence to a protein expression vector to prepare for expressing the protein, preparing the vaccine, and challenging and protecting mice.

[0061] Example 6 Synthesis and identification of tandem protein

[0062] Dissolve the dry powder of the pET-28a-MVSA plasmid synthesized by the company in sterile water and transform it into E. coli competent cell BL21(DE3). The transformation steps are as follows: 1) Take the commercial DH5α competent cells (containing 100 μL of competent cells) and place them on ice to melt. Add 5 μL of the pET-28a-MVSA plasmid to the competent cells, mix well, and incubate on ice for 30 min; 2) After 30 min, place the EP tube in a 42 °C water bath for heat shock for 45 s - 90 s; 3) Then continue to incubate the EP tube on ice for 3 - 5 min; 4) Add 1 mL of LB liquid medium to the EP tube, place it at 37 °C, and shake culture at 180 rpm for 1 h; 5) Centrifuge at 5000 rpm for 5 min, discard 1 mL of the supernatant, resuspend the bacteria with the remaining 100 μL of supernatant, and then spread it on an LB plate with Kan+ resistance, and place it in a 37 °C incubator for overnight culture. Use a sterile pipette tip to pick monoclonal colonies on the plate, place them in 1 mL of LB liquid medium containing Kan (50 μg / mL), and culture at 37 °C in a constant temperature shaker at 180 rpm for 6 h. Use the method of colony PCR for clone identification.

[0063] The primer sequences are as follows:

[0064] MVSA upstream primer - P1: GGGCCAGGTCCCGGATTAAGGA;

[0065] MVSA downstream primer - P2: TTCTTTGGTCTGACCATCTCT;

[0066] The P1 primer and the P2 primer can amplify the MVSA epitope tandem gene tandemly linked to the pET-28a plasmid. The PCR reaction system and reaction conditions: The 20 μL PCR reaction system is: 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2×Rapid Taq Mix, 1 μL of template, and 7 μL of ddH2O. The PCR reaction conditions are as follows: Pre-denaturation at 95 °C for 5 min; 30 cycles (95 °C, 30 s, 55 °C, 30 s, 72 °C 20 min); Extension at 72 °C for 10 min. After the PCR product is identified by 1% agarose gel electrophoresis, cut out the target band, perform gel recovery with the TaKaRa gel recovery kit, and send the recovered product to Nanjing Genewiz for sequencing.

[0067] Example 7 Prokaryotic expression of tandem protein

[0068] 1 Expression and purification

[0069] Inoculate the fresh bacterial solution into 200 mL of LB liquid medium containing the corresponding antibiotic at a ratio of 1:100, shake culture at 37 °C and 180 rpm for 3 - 4 h until OD 600When it reaches 0.4 - 0.6, induce and collect the bacteria. Wash the bacteria twice with PBS, resuspend the bacteria with 20 mL of supernatant dissolution buffer, perform ultrasonic disruption on ice, with a working time of 5 s, an interval time of 10 s, and 80 working times. When the bacterial solution becomes clear, centrifuge at 4°C and 10,000 rpm for 20 min, collect the supernatant, and filter the supernatant through 0.45 μm and 0.22 μm filters in sequence. Purify it by the method of His-tag Ni-NTA affinity chromatography according to the following steps:

[0070] Washing: Wash the affinity chromatography column with 5 column bed volumes of ddH2O (5 mL);

[0071] Equilibration: Equilibrate the affinity chromatography column with 5 mL of supernatant dissolution buffer;

[0072] Loading: Slowly inject the supernatant solution into the affinity chromatography column with a syringe and collect the effluent;

[0073] Washing: Wash the column with 10 column bed volumes of supernatant dissolution buffer;

[0074] Elution: Elute the target protein with 10 mL of upper cleaning elution buffer, collect with one EP tube for every 1 mL, perform SDS-PAGE electrophoresis on the collected solution to analyze the protein purity, and quantify the protein concentration by the BCA method.

[0075] Washing: First wash the column with 5 column bed volumes of ddH2O, then wash with 3 column bed volumes of 20% ethanol, and store at 4°C for standby.

[0076] Perform SDS-PAGE electrophoresis analysis on the collected protein.

[0077] Determination of protein concentration

[0078] Use the BCA Protein Kit kit to determine the protein concentration. According to the instructions, serially dilute the BSA standard protein (1000, 500, 250, 125, 62.5, 0 μg / mL). Prepare the working solution by mixing reagent A and reagent B at a ratio of 50:1. Mix and pipette the above serially diluted BSA standard protein solution and the working solution at a ratio of 1:8 (20 μL of protein, 200 μL of working solution) in a 96-well plate, incubate at 37°C for 30 min, and measure its absorbance at OD 562 at. With the protein concentration as the abscissa and the corresponding OD 562 absorbance value as the ordinate, plot the standard curve, where Y is the protein content (μg) per 20 μL and X is the absorbance value. Calculate the protein concentration of the purified and ultrafiltered protein according to the standard curve.

[0079] Example 8 Mouse immunization experiment of tandem protein MVSA

[0080] Preparation of inactivated vaccine

[0081] Inoculate strain BAA-611 on Columbia blood agar plate and culture at 37°C for 16 h. Pick single colonies for subculture, perform turbidity counting and viable cell counting. After counting, add formaldehyde solution at a final concentration of 0.8% to a final concentration of 40 mL / L, mix well by shaking, and culture in a 37°C incubator for 24 h, shaking several times intermittently during this period to prepare an inactivated bacterial solution. Rinse three times by centrifugation with sterile normal saline (0.9%). Dilute or concentrate according to the counting results to 5×10 9 CFU / mL. Inoculate the inactivated bacterial solution on Columbia blood agar plate and culture at 37°C for 16 h, and observe whether there is bacterial growth.

[0082] 2 Immunization of mice

[0083] To evaluate the immune effect of the MVSA multi-epitope tandem vaccine, the purified recombinant protein MVSA and the inactivated bacterial solution BAA-611 were mixed and shaken evenly with ISA 201 adjuvant (SEPPIC, France) at a ratio of 1:1 to prepare the MVSA recombinant vaccine and the BAA-611 inactivated vaccine. Divide 4-week-old SPF-grade female ICR mice into 3 groups. The first group is the recombinant vaccine protection group, immunized with the MVSA recombinant vaccine at an immunization dose of 50 μg / mouse. The second group is the BAA-611 inactivated vaccine protection group, immunized with the BAA-611 inactivated vaccine at an immunization dose of 1×10 8 CFU / mouse; the third group is only immunized with PBS + adjuvant as the control group. The mice in each experimental group were immunized by the subcutaneous multi-point injection route. The immunization schedule is as follows: The second immunization is carried out 10 days after the first immunization, and the third immunization is carried out 10 days later. Before each immunization and before challenge, collect the blood of the mice in each group by orbital venous blood sampling. After standing and incubating at 37°C for 1 h, let it stand overnight at 4°C, centrifuge at 1000 rpm at 4°C for 10 min, collect the serum, and aseptically aliquot and store at -80°C for later use.

[0084] Example 9 Determination of ELISA specific antibody titer

[0085] 1) Take a 96-well detachable ELISA microtiter plate, coat with 0.2 μg / 100 μL of purified MVSA protein per well and 1×10 7 CFU of BAA-611 per well, and coat overnight at 4°C;

[0086] 2) Wash the plate 3 times with PBST washing solution, drain the water, add 200 μL of 0.5% BSA solution to each well, and coat overnight at 4°C.

[0087] 3) Wash the plate 3 times with PBST washing solution, drain the water;

[0088] 4) The sera collected after immunization with dilutions of 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, 1:51200, 1:102400 and 1:204800.

[0089] 5) Add the above-diluted sera to the ELISA plates coated with antigen, 100 μL per well, and make duplicate wells.

[0090] 6) Incubate in a 37 °C incubator for 1 h, then wash the plates 3 times with PBS-T washing solution and drain the water.

[0091] 7) Add 100 μL of HRP-goat anti-mouse IgG diluted 1:4,000 to each well and incubate in a 37 °C incubator for 1 h.

[0092] 8) Wash the plates 3 times with PBST washing solution and drain the water.

[0093] 9) Add 100 μL of TMB chromogenic solution to each well and incubate at room temperature in the dark for 15 min until the reaction is complete.

[0094] 10) Add 50 μL of stop solution to each well and measure the OD value at 450 nm using an ELISA reader.

[0095] 11) Calculate the P / N value, and the critical value is 2.1.

[0096] Example 10 Detection of WB specific antibodies

[0097] Perform SDS-PAGE electrophoresis on the purified MVSA protein, cut the protein gel according to the target protein, transfer the protein to PVDF (Millipore) using a transfer apparatus. After transfer, immerse the PVDF membrane in 5% skim milk and block at 37 °C for 2 h. After blocking, add the self-made triple-immunized serum as the primary antibody (diluted 1:1,000) and incubate at 37 °C at 70 rpm for 2 h. After washing 3 times with PBST, add HRP-goat anti-mouse IgG diluted 1:4000 as the secondary antibody and incubate at 37 °C at 70 rpm for 45 min. After washing 3 times with PBST, develop the color with ECL luminescent solution in the dark environment, and finally expose with an exposure apparatus.

[0098] Example 11 Mouse challenge experiment

[0099] Rejuvenation of strain 1

[0100] Streptococcus agalactiae BAA-611 was inoculated into THB medium and cultured at 37°C with 180 rpm for 6 h. The cells were collected by centrifugation at 5,000 rpm, resuspended in PBS and washed 3 times. The precipitate was resuspended in 200 μL of PBS and injected intraperitoneally into mice. The morbidity of the mice was observed within 6 - 24 h. Blood was taken from the apex of the heart of the moribund mice and cultured on blood agar plates overnight at 37°C. The bacterial suspension was used to identify the strain by rapid PCR.

[0101] 2 Challenge experiment

[0102] Single colonies on the rejuvenated blood agar plates were picked. After the bacteria were shaken and mixed, the bacterial suspension was used to identify the strain by rapid PCR. At OD 600 ≈0.6, the cells were collected by centrifugation at 5,000 rpm, washed 3 times with PBS, and the bacterial amount was adjusted. Seven days after the last immunization, mice in different groups were challenged by intraperitoneal injection with 20×LD 50 of BAA-611 (2×10 8 CFU / mouse).

[0103] Example 12 In vitro antibacterial test

[0104] To determine the antibacterial activity of MVSA antibody against GBS, an in vitro antibacterial test was carried out. Single colonies of strains with different serotypes were picked into THB liquid medium and cultured overnight. They were transferred 1:100 to 5 mL of THB liquid medium and cultured on a shaker at 37°C with 180 rpm until the logarithmic phase (OD 600 =0.6 - 0.8). The GBS bacterial suspensions with different serotypes were diluted 1:50 in THB liquid and 100 μL was added to the microplate. 100 μL of THB liquid diluted 50-fold MVSA, the hyperimmune serum of BAA-611 and the negative serum were added to each different GBS dilution respectively. This was repeated three times. After incubation at 37°C for 2 h, the bacterial suspensions in different wells were serially diluted and drop-plated on THB solid medium for counting.

[0105] Example 13 Passive immunoprotection test - Organ distribution test

[0106] To determine the preventive and neutralizing effects of MVSA antibody against GBS in vivo, 4-week-old female ICR mice were intraperitoneally injected with 200 μL of MVSA hyperimmune serum, and the control group mice were intraperitoneally injected with 200 μL of PBS. After 24 h, a lethal dose of GBS BAA-611 (2×10 8 CFU) was intraperitoneally injected, and the mice were observed for 7 days and the death situation was recorded.

[0107] Blood of mice was collected by eye puncture 9 hours after challenge, serially diluted 10-fold with PBS buffer and enumerated on a drop plate on THA. Mice were humanely euthanized by CO2 sedation followed by cervical dislocation. Before organ excision, the visceral surface was wiped with a sterile cotton swab to check for bacterial translocation. The spleen, liver, and brain were further excised and transferred to sterile pre-weighed MP tubes. After homogenization with PBS, both the blood and homogenate were serially diluted 10-fold, plated, and incubated at 37 °C for 24 hours before colony counts were measured.

[0108] Example 14 Passive Immunoprotection Assay - Organ Cytokine Determination

[0109] To further evaluate the effect of MVSA antibodies on organ inflammation in mice after GBS challenge, RT-qPCR was performed on isolated different organs to analyze the transcriptional levels of cytokines. First, total RNA of each organ was extracted according to the TRIzol extraction method. Using a reverse transcription kit (PrimeScript TM RT reagent Kit with gDNA Eraser), exogenous DNA was removed by a two-step method, and RNA was reverse-transcribed into cDNA. Fluorescent quantitative experiments were performed using a QuantStudio 6Flex real-time fluorescence quantitative PCR instrument and ChamQ Universal SYBR qPCR master mix to detect the transcriptional levels of cytokines IL-1β, IL-6, and TNFα. The housekeeping gene GAPDH was used as an internal reference, and the primers used are shown in Table 2, and the 2 -ΔΔCT -ΔΔCt method was used to calculate the transcriptional differences.

[0110] Table 2 RT-qPCR Primers

[0111]

[0112] 2 Test Results

[0113] 1 Antigen Epitope Prediction and Analysis

[0114] The downloaded protective proteins were subjected to B-cell epitope prediction using BCPred and ABCPred respectively, and T-cell epitope prediction using IEDB TEPITOP. Only the epitopes recognized by both B-cells and T-cells were selected. Among them, no suitable B-cell prediction epitopes were generated for the OTC protein. Epitopes with an antigenicity greater than 0.4 were selected, and two long-chain epitopes with low antigenicity, such as BP-2b and lrrg, were removed. Finally, 11 epitopes were screened out, as shown in Table 2. Its predicted global coverage based on human alleles reached 88.91%. In regions where GBS is prevalent, such as the United States (24.7%), Australia (23.8%), and Canada (20.5%), these 11 epitopes can cover 100%, 92.79%, and 99.2% of the population respectively.

[0115] According to the physicochemical property analysis of EXPASY, the linkers "GPGPG" and "LRMKLPKS" were selected to link the 11 epitopes to obtain the sequence of MVSA (SEQ ID No: 1). After prediction, the antigenicity of MVSA was 1.1909 and it had no allergenicity. The MVSA multi-epitope protein contained a total of 430 amino acids and was sent to the company for synthesis and ligation to pET-28a(+).

[0116] Table 2 Epitopes with affinity for B / T cells and antigenicity scores

[0117]

[0118] 2 Identification of recombinant plasmids

[0119] Sequencing of pET-28a-MVSA confirmed by BLAST comparison showed that the obtained sequence had 100% homology with the target sequence. The results indicated that the MVSA recombinant protein gene was correctly inserted into the multiple cloning site of the prokaryotic expression vector pET-28a. The plasmid was transformed into BL21(DE) competent cells and spread on LB plates containing kan + and cultured for 12 - 16 h. Single colonies were picked for culture and identified by PCR, and the results were positive ( Figure 4 ).

[0120] 3 Prokaryotic expression and purification of tandem vaccines

[0121] The SDS-PAGE electrophoresis results of the recombinant plasmid genetic engineering bacteria BL21 after inducing proteins at a small dose showed that the size of the MVSA protein was 55 kDa, and the protein existed in both the supernatant and precipitate after ultrasonic lysis. Among them, when the induction conditions were 28 °C, 14 h, and IPTG 0.5 mM, the expression level in the supernatant was the highest, which was the optimal induction condition. The SDS-PAGE electrophoresis results of induced purification are as Figure 6As shown, the standard curve was determined using a BCA protein quantification detection kit: Y = 24.788X - 2.7234, and the concentration of the purified protein was measured to be 0.84 mg / mL.

[0122] Table 3 Antibody detection enzyme-linked immunosorbent assay of sera from mice immunized with recombinant protein and inactivated vaccine

[0123]

[0124] 4 Evaluation of immunogenicity

[0125] To evaluate the immunogenicity of MVSA, an antibody detection enzyme-linked immunosorbent assay was performed using sera from mice immunized with the collected recombinant protein and inactivated vaccine. As shown in Table 3, compared with non-immunized mice, the total immunoglobulin content in the sera of MVSA hyperimmunized mice was extremely high, with the lowest titer being 1 / 25600. Table 3 shows that compared with non-immunized mice, the lowest titer of total immunoglobulin in the sera of inactivated vaccine hyperimmunized mice was 1 / 200. Western blot analysis of the MVSA hyperimmune serum showed that there was a specific band at around 55 kDa, as shown in the figure, confirming that the MVSA protein has good immunogenicity ( Figure 7 ).

[0126] 5 Mouse challenge protection test

[0127] The experimental results showed that when challenged with 20 LD 50 of BAA-611 (2 × 10 8 CFU / mouse), the mice in the MVSA recombinant vaccine group did not die, and no disease symptoms were observed after 7 days of observation, with a protection rate of 100%; compared with the mice in the PBS adjuvant group, the number of deaths in the mice in the BAA-611 inactivated vaccine group decreased, and the protection rate was 58.33% (Figure 8).

[0128] 6 Immunoprotection test

[0129] Serological tests showed that MVSA antibodies were produced after vaccination with the vaccine of the present invention. When challenged with 20 × LD 50 of BAA-611 (2 × 10 8 CFU / mouse), 100% of the challenged mice survived after the observation period in the MVSA antibody treatment group, while all the mice in the PBS treatment group died within 2 days ( Figure 9 ), indicating that rMVSA provided a 100% protection rate for mice.

[0130] 7 In vitro antibacterial test

[0131] The results of the in vitro antibacterial test are as Figure 10As shown, the MVSA antibody provided by the present invention can significantly inhibit the growth of 6 different serotype GBS strains, and these six prevalent serotypes (Ia, Ib, II, III, V, VI) cover 98.4% of GBS clinical infection cases. Meanwhile, the hyperimmune serum of the inactivated BAA-611 vaccine significantly inhibits the growth of BAA-611, but has no obvious inhibitory effect on the remaining serotypes (Ib, II, III, VI), indicating that the antibodies induced by the inactivated BAA-611 vaccine have limited protective effects on strains of cross serotypes, which is similar to previous research results.

[0132] 8. Determination of Organ Distribution and Cytokines

[0133] To evaluate the protective effect provided by the MVSA antibody against GBS invasion, mice were pre-injected with MVSA hyperimmune serum, and the bacterial loads and cytokine levels in different organs and tissues of the mice were measured 9 h after challenge. Bacterial counts on different organs or tissues showed that after challenge with 20×LD 50 of BAA-611, the number of bacteria in the blood, liver and spleen of the mice in the MVSA antibody treatment group was less than that in the PBS treatment group (control group). Meanwhile, no viable GBS bacteria were counted in the brains of both groups of mice ( Figure 11 ). Measurement of the transcriptional levels of pro-inflammatory cytokines in different organs or tissues by RT-qPCR showed that the transcriptional levels of IL-1β, IL-6 and TNFα in the spleen of the MVSA antibody treatment group were significantly higher than those in the PBS treatment group. The transcriptional level of TNFα in the liver of the MVSA antibody treatment group was significantly increased, except for IL-1β and IL-6. These data confirm that the MVSA immune serum inhibits GBS invasion and colonization in vivo.

[0134] The protection scope of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be conceived by those skilled in the art are included in the present invention, and the scope of protection is defined by the appended claims. Sequence Listing <110> Nanjing Agricultural University <120> Multiepitope Subunit Vaccine Against All GBS Serotypes <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 430 <212> PRT <213> Artificial Sequence <400> 1 Gly Pro Gly Pro Gly Leu Arg Met Lys Leu Pro Lys Ser Leu Val Gly 1 5 10 15 Phe Gly Leu Ile Leu Leu Thr Ser Arg Cys Gly Leu Arg Arg Gln Arg 20 25 30 Asp Val Glu Asn Lys Ser Gln Gly Asn Val Leu Glu Arg Arg Gln Arg 35 40 45 Gly Pro Gly Pro Gly Leu Arg Met Lys Leu Pro Lys Ser Asn Ser Thr 50 55 60 Glu Glu Ile Asn Asn Thr Leu Pro Gln Gly Arg Ile Ile Lys Gln Ser 65 70 75 80 Ile Pro Val Val Arg Leu Lys Val Gly Pro Gly Pro Gly Leu Arg Met 85 90 95 Lys Leu Pro Lys Ser Ile Val Lys Asn Asp Val Leu Ala Ala Met Ser 100 105 110 Pro Gln Ala Ala Met Ser Pro Gln Ala Ala Glu Ala Pro Val Glu Thr 115 120 125 Lys Ala Thr Pro Thr Thr Gly Pro Gly Pro Gly Leu Arg Met Lys Leu 130 135 140 Pro Lys Ser Gly Val Met Asp Ala Ile Val Lys Gln Pro Gly Val Lys 145 150 155 160 Ser Ile Ile Gly Gly Gly Asp Gly Pro Gly Pro Gly Leu Arg Met Lys 165 170 175 Leu Pro Lys Ser Ala Ala Glu Thr Pro Ala Pro Val Ala Lys Val Ala 180 185 190 Pro Val Arg Thr Val Ala Ala Pro Arg Val Ala Gly Pro Gly Pro Gly 195 200 205 Leu Arg Met Lys Leu Pro Lys Ser Ile Val Ile Val Ala Gly Val Pro 210 215 220 Val Gly Thr Gly Gly Thr Asn Thr Met Arg Val Arg Thr Val Lys Gly 225 230 235 240 Pro Gly Pro Gly Leu Arg Met Lys Leu Pro Lys Ser Lys Glu Leu Gln 245 250 255 Ala Lys Asn Val Lys Ala Ile Val Val Leu Ala His Val Pro Ala Thr 260 265 270 Ser Gly Pro Gly Pro Gly Leu Arg Met Lys Leu Pro Lys Ser Ser His 275 280 285 Phe Asn Leu Phe Lys Ala Ile Lys Gly Arg Ala Thr Val Glu Ala Asp 290 295 300 Val Cys Val Gln Asn Ile Glu Gly Pro Gly Pro Gly Leu Arg Met Lys 305 310 315 320 Leu Pro Lys Ser Phe Lys Thr Asn His Phe Ser Leu Phe Ala Ile Lys 325 330 335 Thr Leu Ser Lys Asp Gln Asn Val Thr Gly Pro Gly Pro Gly Leu Arg 340 345 350 Met Lys Leu Pro Lys Ser Ile Asn Gly Phe Gly Arg Ile Gly Arg Leu 355 360 365 Ala Phe Arg Arg Ile Leu Asp Gly Pro His Arg Gly Gly Asp Leu Arg 370 375 380 Arg Ala Arg Ala Gly Ala Ala Asn Gly Pro Gly Pro Gly Leu Arg Met 385 390 395 400 Lys Leu Pro Lys Ser Lys Asp Phe Leu Phe Asn Pro Ser Glu Thr Leu 405 410 415 Gln Gln Glu Asn Phe Pro Leu Arg Asp Gly Gln Thr Lys Glu 420 425 430

Claims

1. A multi-epitope chimeric protein MVSA against all GBS serotypes, characterized in that, The amino acid sequence of the multi-epitope chimeric protein MVSA is shown in SEQ ID No:

1.

2. A gene encoding the multi-epitope chimeric protein MVSA against all GBS serotypes as claimed in claim 1.

3. An expression cassette, expression vector, transgenic cell line or recombinant engineered bacterium containing the gene as claimed in claim 2.

4. A vaccine against all GBS serotypes, containing the multi-epitope chimeric protein MVSA as claimed in claim 1.

5. The vaccine according to claim 4, characterized in that, The vaccine is a subunit vaccine.

6. The vaccine according to claim 5, characterized in that, The vaccine further comprises a subunit vaccine adjuvant.

7. The vaccine according to claim 6, characterized in that, The subunit vaccine adjuvant is seppic ISA206.

8. A method for preparing a multi-epitope chimeric protein MVSA against all GBS serotypes according to claim 1, characterized in that, Comprising the following steps: (1) Computer prediction of GBS antigenic epitopes: determining candidate proteins covering all 10 serotypes of GBS; performing T / B cell antigenic epitope prediction on them, and then screening out polypeptide epitopes containing both T and B cell epitopes by multiple sequence alignment; (2) Construction of the MVSA protein: adding a Linker fragment "LRMKLPKS" to the N-terminus of each epitope, and inserting a second spacer GPGPG between each pair of Linker epitope sequences; concatenating the epitopes of step (1) and constructing the polypeptide chimera MVSA; (3) Construction of the recombinant plasmid: using the amplification product as a template, amplifying and obtaining the MVSA protein gene, and ligating the MVSA protein gene to the pET-28a(+) plasmid to obtain the recombinant plasmid; (4) Expression of the MVSA protein gene: transforming the constructed recombinant plasmid into BL21 competent cells, culturing, extracting and purifying to obtain the MVSA protein.

9. The preparation method of a multi-epitope chimeric protein MVSA targeting all GBS serotypes according to claim 8, characterized in that, The epitopes in step (1) are respectively from GBS self-proteins NT5, BKD-E2, PK, GAPDH, PGK, Srr1, FbsA, Sip, AP1-2b, Beta C protein, BibA.

10. Any of the following applications: (1) The application of the multi-epitope chimeric protein MVSA as claimed in claim 1 in the preparation of a subunit vaccine against all GBS serotypes; (2) The application of the multi-epitope chimeric protein MVSA as claimed in claim 1 in the preparation of a drug for preventing infections of all GBS serotypes; (3) The application of the gene as claimed in claim 2 or the expression cassette, expression vector, transgenic cell line or recombinant engineered bacterium as claimed in claim 3 in the preparation of the chimeric protein MVSA as claimed in claim 1; The applications in (1) and (2) are directed to 6 serotypes, namely Ia, Ib, II, III, V, VI.

11. A drug against all GBS serotypes, the active ingredient of which is the multi-epitope chimeric protein MVSA as claimed in claim 1.

12. The drug according to claim 11, wherein the drug is a vaccine.

Images