A dual-reporter plasmid for homologous recombination and single-base editing, and its construction method and application

Abstract

The present invention belongs to the field of genetic engineering technology, and discloses a dual-report plasmid for homologous recombination and single-base editing, and a construction method and application thereof. The dual-report plasmid for homologous recombination and single-base editing of the present invention includes a backbone sequence and an insertion sequence, and the insertion sequence includes a blue fluorescent sequence BFP, a connecting element T2A, a red fluorescent sequence mCherry, an incomplete green fluorescent sequence GFPHDR and an STgRNA sequence in sequence. When single-base editing and homologous recombination occur in the dual-report plasmid of the present invention, the fluorescence of the reporter plasmid will change, thereby ensuring that the gene editing vector still has a high editing activity after entering the cell, and at the same time, since both homologous recombination and single-base editing can be reported, the scope of application of the reporter plasmid is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a dual-reporter plasmid for homologous recombination and single-base editing, and a construction method and application thereof. Background Art

[0002] Gene editing refers to the technology of modifying the genome at a specific site. This technology can be used to accurately locate a site in the genome, cut the target DNA fragment at this site and insert a new gene fragment. Gene editing technology retains the characteristics of site-specific modification and can be applied to more species. It is more efficient, has a shorter construction time and lower cost. The main gene editing technologies are currently artificial nuclease-mediated zinc finger nuclease (ZFN) technology, transcription activator-like effector nuclease (TALEN) technology and RNA-guided CRISPR-Cas nuclease technology (CRISPR-Cas RGNs).

[0003] In the prior art, the cell screening strategies for homologous recombination and single-base editing are mainly based on the screening markers of gene editing vectors, and gene editing detection is performed after drug or fluorescence screening. However, if several vectors are transferred at the same time, the screened cells can only ensure that the gene editing vectors enter the cells, and cannot guarantee that the screened cells meet the expected editing effect, such as whether they have high editing activity. Moreover, after gene editing occurs at one site in the genome, the efficiency of gene editing at another site will also be greatly improved, resulting in many screened cells still being negative. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a dual-reporter plasmid for homologous recombination and single-base editing and a construction method thereof.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] In the first aspect, the present invention provides a dual-reporter plasmid for homologous recombination and single-base editing, comprising a backbone sequence and an insertion sequence, wherein the insertion sequence sequentially comprises a blue fluorescent sequence BFP, a connecting element T2A, a red fluorescent sequence mCherry, an incomplete green fluorescent sequence GFPHDR and a gRNA sequence.

[0007] When single-base editing and homologous recombination occur in the dual-reporter plasmid of the present invention, the fluorescence of the reporter plasmid will change, thereby ensuring that the gene editing vector still has a high editing activity after entering the cell. At the same time, since both homologous recombination and single-base editing (such as C to T) can be reported, the application scope of the reporter plasmid is improved.

[0008] As a preferred embodiment of the dual reporter plasmid for homologous recombination and single-base editing described in the present invention, the sequence of the target gene of the STgRNA is shown in SEQ ID No.1; the first part of the BFP sequence is shown in SEQ ID No.2; the second part of the BFP sequence is shown in SEQ ID No.3; the mCherry sequence is shown in SEQ ID No.4; and the GFPHDR is shown in SEQ ID No.5.

[0009] As a preferred embodiment of the dual-reporter plasmid for homologous recombination and single-base editing described in the present invention, the backbone sequence comes from the expression vector pCEP4.

[0010] In a second aspect, the present invention provides a method for constructing a dual-reporter plasmid for homologous recombination and single-base editing, comprising the following steps:

[0011] (1) Double digestion of the backbone expression vector;

[0012] (2) Respectively digest the PCR-amplified BFP gene, mCherry gene, incomplete GFPHDR gene and target gene;

[0013] (3) Connecting the fragment recovered after the enzymatic cleavage in step (1) with the fragment recovered after the enzymatic cleavage in step (2) to obtain the product.

[0014] As a preferred embodiment of the method for constructing a dual-reporter plasmid for homologous recombination and single-base editing described in the present invention, the primer sequences for PCR amplification are shown in SEQ ID No. 6 to 16.

[0015] In a third aspect, the present invention provides an expression host bacterium, comprising the dual-reporter plasmid for homologous recombination and single-base editing.

[0016] In a fourth aspect, the present invention provides the use of the dual-reporter plasmid, the preparation method, and the expression host bacteria in simultaneously reporting homologous recombination and single-base editing in cells.

[0017] As a preferred embodiment of the application of the present invention, the dual reporter plasmid is co-transfected into the cells with plasmid px459 and / or pCMV-BE4max-P2A-Puro.

[0018] As a preferred embodiment of the application described in the present invention, the ratio of the dual reporter plasmid to the plasmid px459 or pCMV-BE4max-P2A-Puro is 1:0.8-1.2.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] When single-base editing and homologous recombination occur in the dual-reporter plasmid of the present invention, the fluorescence of the reporter plasmid will change, thereby ensuring that the gene editing vector still has a high editing activity after entering the cell. At the same time, since both homologous recombination and single-base editing (such as C to T) can be reported, the application scope of the reporter plasmid is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Flow chart for constructing the pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA expression vector;

[0022] Figure 2 Schematic diagram of the structure of the pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA expression vector;

[0023] Figure 3 This is the fluorescence detection diagram of 293T cells transfected with drugs 24 hours later;

[0024] Figure 4 Schematic diagram of the principle of conversion from blue light to green light. DETAILED DESCRIPTION

[0025] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0027] Example 1: Selection of target sites and design of sgRNA

[0028] A sequence on the genome of a non-eukaryotic organism was selected as the target site. According to the sgRNA target sequence design principle, a sgRNA was constructed (the sequence of its target gene is shown in SEQ ID No. 1: actcacggggtgcagtgctt). The base length of the target site was 20 bp, and the three bases adjacent to the 3' end of the target site constituted the PAM region, and the sequence was NGG (N is an arbitrary base).

[0029] Two oligos were designed for the sgRNA sequence on the genome, namely: ST gRNA-F: CACCGactcacggggtgcagtgctt; ST gRNA-R: AAACaagcactgcaccccgtgagtC.

[0030] Example 2: Construction of pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA expression vector

[0031] The construction flow chart of pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA expression vector is as follows Figure 1 As shown. The blue fluorescent sequence (BFP), the red fluorescent sequence (mCherry), the incomplete green fluorescent sequence (GFPHDR) and a gRNA containing the target site sequence were connected to the plasmid pCEP4 to construct an expression vector pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA that can report both homologous recombination and single base editing, as follows:

[0032] (1) Construction of plasmid pCEP4-BFP-T2A-mCherry

[0033] 1) Plasmid pCEP4 (invitrogen, V044-50) was double-digested with Kpn I and Hind III. The digestion system is shown in Table 1. After digestion at 37°C for 3 h, fragment 1 (10390 bp) was recovered using a gel recovery kit (TIANGEN) for later use.

[0034] Table 1 pCEP4 restriction enzyme digestion system

[0035] pCEP4 3μg Kpn I (Takara, 1618) 2μl Hind III (Takara, 1615) 2μl 10×Buffer 10ul <![CDATA[ddH2O]]> Make up to 100ul

[0036] 2) Using the synthetic plasmid BFP-T2A-EGFP as a template, primers F1 and R1 (the first part of the amplified BFP sequence is shown in SEQ ID No. 2: atggtcagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtcaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctcaccctcaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtcaccaccctcACTCACGGGGTGCAGTGCTTCGGccgcta), primers F2 and R2 (the second part of the amplified BFP sequence is shown in SEQ ID No.3:) PCR amplification was performed, the PCR system was as shown in Table 2, and the amplification conditions were 98°C (1min); [98°C (10s), 58°C (15s), 72°C (20s)] × 30 cycles; 72°C (5min); 16°C (∞). Fragment 2 (245bp) and fragment 3 (558bp) were recovered from gels for later use.

[0037] Table 2 PCR system with BFP-T2A-EGFP as template

[0038] Plasmid BFP-T2A-EGFP 100ng 2×Primer Star Max Premix(Takara) 2μl Primer F1 1μl Primer R1 1μl <![CDATA[ddH2O]]> Make up to 50 μl

[0039] Table 2 PCR system using BFP-T2A-EGFP as template

[0040]

[0041]

[0042] 3) Plasmid donor-mCherry-lx was used as a template, and primers F3 and R3 (the sequence of the amplified fragment mCherry is shown in SEQ ID No. 4) were used for PCR amplification. The PCR system was shown in Table 3, and the amplification conditions were 98°C (1 min); [98°C (10 s), 58°C (15 s), 72°C (20 s)] × 30 cycles; 72°C (5 min); 16°C (∞). Fragment 4 (780 bp) was recovered from the gel for later use.

[0043] Table 3 PCR system with donor-mCherry-lx as template

[0044] Plasmid donor-mCherry-lx 100ng 2×Primer Star Max Premix(Takara) 2μl Primer F3 1μl Primer R3 1μl <![CDATA[ddH2O]]> Make up to 50 μl

[0045] 4) These four fragments were recombined with recombinase (ClonExpress The recombination was performed using One Step Cloning Kit at 37°C (30 min). The recombination system is shown in Table 4.

[0046] Table 4 Recombination system

[0047] Clip 1 100ng Clip 2 10ng Clip 3 10ng Clip 4 10ng 5×CE MultiS Buffer 2μl Exnase Multis 1μl <![CDATA[ddH2O]]> Make up to 10 μl

[0048] 5) After the recombination is completed, the recombinant product is transferred to competent cells (DH5α) for transformation. After ice bathing for 30 minutes, heat shock at 42°C for 45 seconds, and then placed on ice for 2 minutes. The LB agar solid medium containing antibiotics is taken out of the 4°C refrigerator and placed at room temperature. When the temperature rises to room temperature, the competent cells are spread on the culture medium plate in the clean bench. To prevent the condensed water on the lid of the bacterial culture dish from dripping onto the culture medium and causing contamination, the plate is placed upside down when culturing bacteria and placed in a 37°C bacterial incubator for overnight culture.

[0049] 6) Pick a single colony and identify it by restriction digestion with KpnI and BamH I. Select several plasmids with correct restriction digestion and send them to a sequencing company for sequencing. The sequencing results show that plasmid No. 5 has successfully connected these fragments, and the plasmid pCEP4-BFP-T2A-mCherry has been obtained.

[0050] The primer sequences used are:

[0051] F1: gatctctagaagctgggtaccATGGTCAGCAAGGGCGAGGAGCT;

[0052] R1: tagcggccgaagcactgcaCCCCGTGAGTGAGGGTGG;

[0053] F2:actcacggggTGCAGTGCTCTCGGCCGCTA;

[0054] R2: CATGTGAGCAGACTTCCTCTGCCCTCGttagaattccttgtacagctcgtc;

[0055] F3: AgaggaagtctgctcacatgCGGCGACGTCGAGGAGAATCCTGGCCCAAT

[0056] GGTGAGCAAGGGCGAGGAGGAT;

[0057] R3: cgagcggccgctagcaagcttTTACTTGTACAGTCGTCCATGCC.

[0058] (2) Construction of plasmid pU6-ST-gRNA

[0059] 1) The plasmid pU6-sgRNA was digested with Bbs I. The digestion system was as shown in Table 5. After digestion at 37° C. for 3 h, fragment 5 (3950 bp) was recovered by gel for later use.

[0060] Table 5 pU6-sgRNA restriction enzyme system

[0061] pU6-sgRNA 3μg BbsI (NEB, R3539S) 2μl 10×Buffer 10ul <![CDATA[ddH2O]]> Make up to 100ul

[0062] 2) Synthesize primers ST gRNA-F / R and perform Oligos annealing. The system is shown in Table 6. React at 95° C. for 10 min in a PCR instrument, take out immediately, and cool to room temperature (leave at room temperature for about 30 min).

[0063] Table 6 Annealing system

[0064]

[0065]

[0066] 3) Fragment 5 and the annealing product were connected using solution I at 16°C for 2 h. The connection system is shown in Table 7.

[0067] Table 7 Connection system

[0068] Clip 5 1μl Annealing product 4μl SolutionI(Takara) 5μl total 10μl

[0069] 4) After the connection is completed, transform and pick a single colony for sequencing identification. The sequencing results show that plasmid No. 1 has successfully connected the fragment and obtained the plasmid pU6-ST-gRNA.

[0070] The primer sequences used are:

[0071] ST gRNA-F: CACCGactcacggggtgcagtgctt;

[0072] ST gRNA-R:AAACaagcactgcaccccgtgagtC.

[0073] (3) Construction of plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA

[0074] 1) The plasmid pCEP4-BFP-T2A-mCherry was double-digested with AfeI and AgeI. The enzyme digestion system is shown in Table 8. After digestion at 37°C for 3 hours, fragment 6 (11814 bp) was recovered by gel for later use.

[0075] Table 8 pCEP4-BFP-T2A-mCherry restriction enzyme system

[0076] pCEP4-BFP-T2A-mCherry 3μg AfeI (Thermo, FD0324) 2μl AgeI (Thermo, ER1461) 2μl 10×Buffer 10μl <![CDATA[ddH2O]]> Make up to 100 μl

[0077] 2) Using the synthetic plasmid BFP-T2A-EGFP as a template, primers F4 and R4 (amplified fragment of an incomplete green fluorescent sequence GFPHDR, the sequence of which is shown in SEQ ID No. 5: gtcagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtcaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctcaccctcaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtcaccaccctcacctacggcgtgcagtgcttcagccgcta PCR amplification was performed using the following conditions: 98°C (1 min); [98°C (10 s), 58°C (15 s), 72°C (20 s)] × 30 cycles; 72°C (5 min); 16°C (∞). Fragment 7 (430 bp) was recovered from the gel for later use.

[0078] Table 9 PCR system using BFP-T2A-EGFP as template

[0079] Plasmid BFP-T2A-EGFP 100ng 2×Primer Star Max Premix(Takara) 2μl Primer F4 1μl Primer R4 1μl <![CDATA[ddH2O]]> Make up to 50 μl

[0080] 3) Plasmid pU6-ST-gRNA was used as a template and primers R4 and R5 were used for PCR amplification. The PCR system was as shown in Table 10. The amplification conditions were 98°C (1 min); [98°C (10 s), 58°C (15 s), 72°C (20 s)] × 30 cycles; 72°C (5 min); 16°C (∞). Fragment 8 (392 bp) was recovered from the gel for later use.

[0081] Table 10 PCR system using plasmid pU6-ST-gRNA as template

[0082] Plasmid pU6-ST-gRNA 100ng 2×Primer Star Max Premix(Takara) 2μl Primer R4 1μl Primer R5 1μl <![CDATA[ddH2O]]> Make up to 50 μl

[0083] 4) These three fragments were recombined using a recombinase kit (ClonExpress The recombination was performed using One Step Cloning Kit at 37°C (30 min). The recombination system is shown in Table 11.

[0084] Table 11 Recombination system

[0085] Clip 6 100ng Clip 7 10ng Clip 8 10ng 5×CE MultiS Buffer 2μl Exnase Multis 1μl <![CDATA[ddH2O]]> Make up to 10 μl

[0086] 5) After the recombination is completed, transform and pick a single colony for restriction digestion identification with AfeI and AgeI. The plasmid with the correct band is sent to the company for sequencing. The sequencing results show that plasmid No. 3 has successfully connected these fragments, and the plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA is obtained, with a total length of 12569bp. Figure 2 shown.

[0087] The primer sequences used are:

[0088] F4: cggggcgcagccatgaccggtGTCAGCAAGGGCGAGGAGC;

[0089] R4: atccagtcgacGACCAGGGTGTCGCCCTC;

[0090] R5: cgaatacaaaacaaaagcgctCTAGAAAAAAAGCACCGACTCGG.

[0091] Example 3: Transfection of 293T cells and analysis of results

[0092] (1) The frozen 293T cells were taken out from liquid nitrogen for recovery and cultured in high-glucose DMEM (HyClone) medium supplemented with 10% FBS (Gibco), 1% L-glutamine (Gibco), 1% Non-essential amino acids (Gibco) and 1% Sodium pyruvate (Gibco). When the cells were in good condition, cell passaging and cell transfection were performed. The specific steps are as follows:

[0093] 1) Observe the growth rate of 293T cells. When the cell growth density reaches about 80%, remove the culture medium in the culture dish, wash twice with PBS (Gino) without calcium and magnesium ions, add 0.25% trypsin (NCM Biotech) digestion solution, and digest in a 37°C incubator for 2-3 minutes. When cell detachment is observed under a microscope, add DMEM culture medium to terminate digestion, transfer the cells to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 minutes, remove the supernatant, add about 1 mL of cell culture medium, and gently blow to mix the cells.

[0094] 2) Take part of the 293T cells and inoculate them into a 24-well plate, and freeze the rest and inoculate them into a 10 cm dish for further culture.

[0095] 3) After the cells adhered, use Lipo8000 TM (Biyuntian, C0533) transfection reagent was used for cell transfection, and the plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA and plasmid px459 (Miaoling, providing Cas9 protein) were transfected into 293T cells at a ratio of 1:1, and the plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA and plasmid pCMV-BE4max-P2A-Puro (purchased from addgene, 112093, providing cytosine base editor) were transfected into 293T cells at a ratio of 1:1.

[0096] After preparing according to the ratio in Table 12, gently and evenly add it dropwise into the 24-well plate.

[0097] Table 12 Transfection system

[0098]

[0099] 4) After transfection, the 24-well plate was placed in an incubator at 37°C and 5% CO2 for culture.

[0100] (2) After 24 hours, the culture medium was removed and fresh culture medium containing fetal bovine serum and fresh culture medium containing fetal bovine serum and Farrerol (Selleck) (10 μM), a drug that promotes homologous recombination, was added according to the groups in Table 13.

[0101] Table 13 Grouping

[0102] Grouping Plasmids Whether to add medicine 1 pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA no 2 pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA+px459 no 3 pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA+px459 yes 4 pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA+pCMV-BE4max-P2A-Puro no

[0103] (3) 24 hours after drug addition, the fluorescence of the cells was observed under a fluorescence microscope and photographed.

[0104] The results are as follows Figure 3As shown, the fluorescence of the cells was analyzed and compared with the first group, and it was found that:

[0105] The second and third groups were transfected with plasmids pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA and px459. In theory, Cas9-gRNA will play a role and restore the normal expression of the red fluorescence expression frame. The experimental results showed that both groups expressed red fluorescence. At the same time, 10μM Farrerol was added to the third group. In theory, the incomplete green fluorescent sequence will restore the complete green fluorescent expression frame through homologous recombination to achieve green light expression. Compared with the second group, the third group expressed more green fluorescence, indicating that homologous recombination played a role and converted part of the blue light into green light. There was green fluorescence expression in the fourth group, indicating that the cytosine base editor played a role and converted blue light into green light.

[0106] It shows that the constructed plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA can report homologous recombination and single base editing.

[0107] The working principle of the pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA plasmid of the present invention is:

[0108] 1) The codon CAC (coding for histidine) on exon 66 of the blue fluorescent sequence will form new codons TAC and TAT (coding for tyrosine) and CAT (coding for histidine) under the action of the cytosine editor, thereby achieving the conversion from blue light to green light. Figure 4 shown.

[0109] 2) The blue fluorescent sequence contains a partial sequence expressing green fluorescence. The incomplete green fluorescent sequence can form a complete sequence expressing green fluorescence through homologous recombination, thereby achieving the expression of green light.

[0110] 3) The red fluorescent sequence does not express red light due to frameshift. Through the action of CRIPSR / Cas9 and the gRNA targeting the target site, the nuclease cuts the target gene and causes double-stranded DNA breaks. At this time, the cell will initiate a series of repair methods, such as NHEJ, to restore the normal red fluorescent expression sequence.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention. SEQUENCE LISTING <110> Wuyi University <120> A dual-reporter plasmid for homologous recombination and single-base editing, and its construction method and application <130> 2022 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Synthetic <400> 1 actcacgggg tgcagtgctt 20 <210> 2 <211> 224 <212> DNA <213> Synthetic <400> 2 atggtcagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtca acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctca ccctcaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtcacca ccctcactca cggggtgcag tgcttcggcc gcta 224 <210> 3 <211> 529 <212> DNA <213> Synthetic <400> 3 ccccgaccac atgcgacagc acgacttctt caagtccgcc atgcccgaag gctacgtcca 60 ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg aggtcaagtt 120 cgagggcgac accctggtca accgactcga gctcaagggc atcgactca aggaggacgg 180 cacaatcctg gggcacaagc tggagtacaa ctacacagc cacaacgtct atatcatggc 240 cgacaagcag aagaacggca tcaggtcaa cttcaagatc cgccacaca tcgaggacgg 300 cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg gccccgtgct 360 gctgcccgac aaccactacc tcagcacccca gtccgccctc agcaagacc ccaacgagaa 420 gcgcgatcac atggtcctgc tggattcgt caccgccgcc gggatcactc tcggcatgga 480 cgagctgtac aaggaatttct aacgagggca gaggagtct gctcacatg 529 <210> 4 <211> 739 <212> DNA <213> Synthetic <400> 4 cggcgacgtc gaggagaatc ctggcccaat ggtgagcaag ggcgaggagg atacatggc 60 catcatcaag gagttcatgc gctcaggt gcacatggag ggctccgtga acggccacga 120 gttcgagatc gagggcgagg gcgaggggccg cccctacgag ggcaccaga ccgccaagct 180 gaaggtgacc aagggtggcc ccctgcctt cgcctgggac atccgtccc ctcagttcat 240 gtacggctcc aaggcctacg tgaagcaccc cgccgacatc cccgactact tgaagctgtc 300 cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg gcgtggtgac 360 cgtgacccag gactcctccc tgcaggacgg cgagttcatc tacaaggtga agctgcgcgg 420 caccaacttc ccctccgacg gccccgtaat gcagaagaag accatgggct gggaggcctc 480 ctccgagcgg atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa 540 gctgaaggac ggcggccact acgacgctga ggtcaagacc acctacaagg ccaagaagcc 600 cgtgcagctg cccggcgcct acaacgtcaa catcaagttg gacatcacct cccacaacga 660 ggactacacc atcgtggaac agtacgaacg cgccgagggc cgccactcca ccggcggcat 720 ggacgagctg tacaagtaa 739 <210> 5 <211> 360 <212> DNA <213> Synthetic <400> 5 gtcagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc 60 gacgtcaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc 120 aagctcaccc tcaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 180 gtcaccaccc tcacctacgg cgtgcagtgc ttcagccgct accccgacca catgcgacag 240 cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcttcttc 300 aaggacgacg gcaactacaa gacccgcgcc gaggtcaagt tcgagggcga caccctggtc 360 <210> 6 <211> 25 <212> DNA <213> Synthetic <400> 6 caccgactca cggggtgcag tgctt 25 <210> 7 <211> 25 <212> DNA <213> Synthetic <400> 7 aaacaagcac tgcaccccgt gagtc 25 <210> 8 <211> 44 <212> DNA <213> Synthetic <400> 8 gatctctaga agctgggtac catggtcagc aagggcgagg agct 44 <210> 9 <211> 37 <212> DNA <213> Synthetic <400> 9 tagcggccga agcactgcac cccgtgagtg agggtgg 37 <210> 10 <211> 29 <212> DNA <213> Synthetic <400> 10 actcacgggg tgcagtgctt cggccgcta 29 <210> 11 <211> 51 <212> DNA <213> Synthetic <400> 11 catgtgagca gacttcctct gccctcgtta gaattccttg tacagctcgt c 51 <210> 12 <211> 72 <212> DNA <213> Synthetic <400> 12 agaggaagtc tgctcacatg cggcgacgtc gaggagaatc ctggcccaat ggtgagcaag 60 ggcgaggagg at 72 <210> 13 <211> 45 <212> DNA <213> synthetic <400> 13 cgagcggccg ctagcaagct tttacttgta cagctcgtcc atgcc 45 <210> 14 <211> 40 <212> DNA <213> Synthetic <400> 14 cggggcgcag ccatgaccgg tgtcagcaag ggcgaggagc 40 <210> 15 <211> 29 <212> DNA <213> Synthetic <400> 15 atccagtcga cgaccagggt gtcgccctc 29 <210> 16 <211> 44 <212> DNA <213> Synthetic <400> 16 cgaatacaaa acaaaagcgc tctagaaaaa aagcaccgac tcgg 44

Claims

1. A method for constructing a dual-reporter plasmid for homologous recombination and single-base editing, characterized in that: The following steps are involved: (1) Construction of plasmid pCEP4-BFP-T2A-mCherry 1) Plasmid pCEP4 was used Kpn I and Hind III double enzyme digestion, after digestion at 37℃ for 3h, fragment 1 was recovered using gel recovery kit; 2) Using the synthetic plasmid BFP-T2A-EGFP as a template, primers F1 and R1 were used to amplify the first part of the fragment BFP sequence, and primers F2 and R2 were used to amplify the second part of the fragment BFP sequence; fragments 2 and 3 were recovered by gel-gel respectively; The PCR amplification system for the first part of the BFP sequence using primers F1 and R1 is: Plasmid BFP-T2A-EGFP 100ng, 2× Primer Star Max Premix 2μL, primer F1 1μL, primer R1 1μL, ddH2O to 50μL; The PCR amplification system for the second part of the BFP sequence using primers F2 and R2 is: Plasmid BFP-T2A-EGFP 100ng, 2× Primer Star Max Premix 2μL, primer F2 1μL, primer R2 1μL, ddH2O to 50μL; The first part of the BFP sequence is shown in SEQ ID No. 2; the second part of the fragment BFP sequence is shown in SEQ ID No. 3 3) Using plasmid donor-mCherry-lx as template, primers F3 and R3 were used to amplify the mCherry sequence; fragment 4 was recovered from the gel; The PCR system for the amplification is: Plasmid donor-mCherry-lx 100ng, 2× Primer Star Max Premix 2μL, primer F3 1μL, primer R3 1μL, ddH2O to 50μL; The mCherry sequence of the fragment is shown as SEQ ID No.4; 4) Recombining the fragment 1, fragment 2, fragment 3, and fragment 4 using a recombinase at 37° C. for 30 min; The recombinant system was: fragment 1 100 ng, fragment 2 100 ng, fragment 3 100 ng, fragment 4 100 ng, 5×CE MultiS Buffer 2 μl, Exnase Multis 1 μl, ddH2O to 10 μL; 5) After the recombination is completed, the recombinant product is transferred to the competent cell DH5α for transformation, placed in a bacterial incubator at 37°C, and cultured overnight; 6) Pick a single colony and use Kpn I and Bam HI was used for restriction enzyme digestion identification, and the plasmid with the correct enzyme digestion was selected to obtain the plasmid pCEP4-BFP-T2A-mCherry; The sequences of the primers are: F1: gatctctagaagctgggtaccATGGTCAGCAAGGGCGAGGAGCT; R1: tagcggccgaagcactgcaCCCCGTGAGTGAGGGTGG; F2:actcacggggTGCAGTGCTCTCGGCCGCTA; R2: CATGTGAGCAGACTTCCTCTGCCCTCGttagaattccttgtacagctcgtc; F3: AgaggaagtctgctcacatgCGGCGACGTCGAGGAGAATCCTGGCCCAAT GGTGAGCAAGGGCGAGGAGGAT; R3: cgagcggccgctagcaagcttTTACTTGTACAGTCGTCCATGCC; (2) Construction of plasmid pU6-ST-gRNA 1) Use the plasmid pU6-sgRNA Bbs I digestion, at 37°C for 3 h, and fragment 5 was recovered by gel; The enzyme digestion system is: pU6-sgRNA 3μg, Bbs I 2μl, 10×Buffer 10μl, add ddH2O to 100μL; 2) Synthesize primers ST gRNA-F and ST gRNA-R, perform Oligos annealing, react at 95°C for 10 min in a PCR instrument, immediately remove and cool to room temperature; The annealing system is: ST gRNA-F 10 μl, ST gRNA-R 10 μl, 10×Buffer 5 μl, ddH2O to 10 μL; 3) The fragment 5 and the annealing product were connected using solution I at 16°C for 2 hours; The ligation system was: fragment 5 1 μl, annealing product 4 μl, Solution I 5 μl; 4) After the connection is completed, transform and pick a single colony for sequencing identification to obtain the plasmid pU6-ST-gRNA; The sequences of the primers are: ST gRNA-F: CACCGactcacggggtgcagtgctt; ST gRNA-R: AAACaagcactgcaccccgtgagtC; (3) Construction of plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA 1) Plasmid pCEP4-BFP-T2A-mCherry was used Afe I and Age I double enzyme digestion, and fragment 6 was recovered by gel; 2) Using the synthetic plasmid BFP-T2A-EGFP as a template, primers F4 and R4 were used to amplify the incomplete green fluorescent sequence GFPHDR; fragment 7 was recovered by gel extraction; The PCR system for the amplification is: Plasmid BFP-T2A-EGFP 100ng, 2× Primer Star Max Premix 2μl, primer F4 1μL, primer R4 1μL, ddH2O to 50μL; The incomplete green fluorescent sequence GFPHDR is shown as SEQ ID No. 5; 3) Using plasmid pU6-ST-gRNA as template, PCR amplification was performed with primers R4 and R5; fragment 8 was recovered from the gel; The system of the PCR amplification is: Plasmid pU6-ST-gRNA 100 ng, 2× Primer Star Max Premix 2 μl, primer R4 1 μl, primer R5 1 μl, ddH2O to 50 μl; 4) Recombining the fragments 6, 7 and 8 with a recombinase at 37° C. for 30 min; The recombinant system was: fragment 6 100 ng, fragment 7 10 ng, fragment 8 10 ng, 5×CE MultiS Buffer 2 μl, Exnase Multis 1 μl, ddH2O to 10 μL; 5) After the recombination is completed, transform and pick a single colony for use Afe I and Age I was used for enzyme digestion identification, and the plasmid with the correct identification band was the plasmid pCEP4-BFP-T2A-mCherry-GFPHDR-STgRNA; The primer sequences are: F4: cggggcgcagccatgaccggtGTCAGCAAGGGCGAGGAGC; R4: atccagtcgacGACCAGGGTGTCGCCCTC; R5: cgaatacaaaacaaaagcgctCTAGAAAAAAAGCACCGACTCGG.

2. The dual-reporter plasmid for homologous recombination and single-base editing constructed by the construction method of claim 1.

3. An expression host bacterium, characterized in that: Including the dual reporter plasmid for homologous recombination and single base editing as described in claim 2.

4. Use of the dual reporter plasmid according to claim 2 in homologous recombination and single base editing in reporter cells, characterized in that: The cells are 293T cells; the drug Farrerol is added to the reporter cells during homologous recombination.

5. The use according to claim 4, characterized in that: The cells were co-transfected with the dual reporter plasmid and plasmid px459, or the cells were co-transfected with the dual reporter plasmid and pCMV-BE4max-P2A-Puro.

6. The use according to claim 5, characterized in that: The ratio of the dual-report plasmid to plasmid px459 is 1:0.8~1.2; the ratio of the dual-report plasmid to pCMV-BE4max-P2A-Puro is 1:0.8~1.2.

Images