Application of circular RNA circTFDP2 and its siRNA in the diagnosis and treatment of prostate cancer

Abstract

The present invention discloses a circular RNA circTFDP2 and its siRNA application in the diagnosis and treatment of prostate cancer. The fluorescence quantitative PCR method finds that the expression of circTFDP2 in prostate cancer tissue is significantly increased, and the expression level is positively correlated with the Gleason score. The expression level of circTFDP2 detected in the urine of prostate cancer patients after prostate massage is positively correlated with the expression level of prostate cancer tissue. The expression level of circTFDP2 in prostate cancer cells is significantly higher than that in normal prostate epithelial cells. After overexpression, circTFDP2 can significantly promote the proliferation, migration and invasion of prostate cancer, as well as the tumor growth and distant metastasis of xenograft mouse tumor models in vivo. Targeted knockdown of circTFDP2 using siRNA can significantly inhibit the proliferation, migration, invasion and in vivo tumor growth and distant metastasis of prostate cancer cells. circTFDP2 plays an important role in the diagnosis and / or prognosis evaluation and treatment of prostate cancer, and can be used as a diagnostic biomarker and therapeutic target for prostate cancer.

Description

Technical Field

[0001] The present invention belongs to the fields of tumor diagnosis and biomedical engineering, and relates to a new use of an endogenous circular RNA and its antisense nucleic acid, specifically to the application of circular RNA circTFDP2 and its antisense nucleic acid in the diagnosis and treatment of prostate cancer. Background Art

[0002] Prostate cancer is the most common solid organ malignancy in men. In recent years, the incidence rate of prostate cancer in China has been showing an increasing trend year by year and has become an important disease affecting the health of middle-aged and elderly men in China. The determination of prostate-specific antigen (PSA) is currently the most important method for early screening of prostate cancer. However, PSA screening often leads to overdiagnosis and overtreatment of patients. The clinical treatment of prostate cancer patients needs to consider multiple factors, including staging, histopathology, molecular characteristics, and patient background. For early-stage localized prostate cancer, radical prostatectomy can achieve good treatment effects and even a cure. However, nearly 30% of prostate cancer patients in China have metastases at the initial diagnosis. Endocrine therapy for metastatic prostate cancer can prolong the survival period of patients and improve the quality of life, but ultimately prostate cancer will progress to castration-resistant prostate cancer (CRPC). The main treatment drugs for CRPC include docetaxel chemotherapy and new endocrine therapies such as enzalutamide and abiraterone, but the clinical treatment cost is high and the benefits for patients are limited. Therefore, there is an urgent need to discover new prostate cancer biomarkers for early detection and targeted therapy of prostate cancer, reduce the mortality rate of prostate cancer patients, and improve the quality of life of patients.

[0003] Circular RNAs are a new class of non-coding RNAs formed by the back-splicing of precursor RNAs. A large number of circular RNAs have been discovered and play important roles in various physiological and pathological processes. Previous studies have shown that circular RNAs exert their functions by adsorbing microRNAs (miRNAs) or binding to proteins. Recent studies have shown that circular RNAs can encode unique polypeptides through cap-independent translation or m6A-dependent translation. In the occurrence and development of tumors, circRNAs are found to be involved in processes such as stem cell pluripotency maintenance, cell differentiation, cell cycle and apoptosis, and angiogenesis, affecting the progression and metastasis of tumors.

[0004] Exosomes are nanoscale (30 - 150nm) extracellular vesicles surrounded by a lipid bilayer membrane. Exosomes are produced by the endosomal pathway and can be released into body fluids by most types of cells. Exosomes carry a large number of specific proteins as well as functional DNA, mRNA, miRNA, circular RNA, etc., and participate in physiological processes such as cell communication, cell migration, and angiogenesis in vivo, and are closely related to the occurrence and progression of various diseases including tumors. Exosomes are distributed in body fluids such as peripheral blood, urine, saliva, milk, ascites, and amniotic fluid. Each component of exosomes can serve as both a biomarker for disease diagnosis and a specific target for disease treatment.

[0005] In this invention, screening was carried out in 50 pairs of paired prostate cancer and adjacent tissues by RT-PCR technology, and it was found that circular RNA circTFDP2 (circbase ID: hsa_circ_0008304) was significantly highly expressed in prostate cancer tissues, and its expression level was positively correlated with the Gleason score of prostate cancer. For the first time, the relationship between circTFDP2 and prostate cancer was revealed. And through functional experiments, it was confirmed that overexpression of circTFDP2 promoted the proliferation and metastasis of prostate cancer, and interfering with the expression of circTFDP2 could inhibit the proliferation and metastasis of prostate cancer. Moreover, circTFDP2 exists in the culture medium of prostate cancer cells and in the urine exosomes after prostate massage of prostate cancer patients. This invention provides a diagnosis and treatment target for prostate cancer, which has important clinical application value. Summary of the Invention

[0006] One object of this invention is to provide the application of circTFDP2 and its siRNA in the diagnosis and treatment of prostate cancer, determine that circTFDP2 is a circular RNA with up-regulated expression in the cancer tissues of prostate cancer patients and in the urine exosomes after prostate massage, and apply circTFDP2 and its siRNA to the diagnosis and treatment of prostate cancer.

[0007] Another object of this invention is to provide a kit for diagnosing and / or evaluating prostate cancer disease.

[0008] The third object of this invention is to provide a drug for treating prostate cancer.

[0009] To achieve the above objects, the technical solutions of this invention are as follows:

[0010] The application of circTFDP2 as a diagnostic marker in the preparation of reagents for diagnosing and / or evaluating prostate cancer, and the nucleotide sequence of the said circTFDP2 is as shown in SEQ ID No.1.

[0011] Prostate cancer can be diagnosed and / or evaluated by detecting the expression level of circTFDP2 in prostate or urine exosomes after prostate massage.

[0012] A kit for diagnosing and / or evaluating prostate cancer contains primers for specifically amplifying circTFDP2. The kit can be a fluorescence quantitative PCR kit; further, the primers for specifically amplifying circTFDP2 are: the upstream primer sequence is SEQ ID No.2, and the downstream primer sequence is SEQ ID No.3.

[0013] The application of circTFDP2 as a therapeutic target in the preparation of drugs for treating prostate cancer.

[0014] The application of circTFDP2 siRNA in the preparation of drugs for treating prostate cancer, the drug targets circTFDP2, and the circTFDP2 siRNA includes at least one of the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5.

[0015] A therapeutic drug for prostate cancer, the drug contains a nucleic acid, a bioactive functional fragment or a variant having at least one of the sequences shown in SEQ ID No.4 and SEQ ID No.5. Further, the drug includes a pharmaceutically acceptable carrier or excipient, including chitosan, cholesterol, liposomes, nanoparticles, etc.

[0016] Beneficial effects:

[0017] The present invention first discovers that circTFDP2 plays an important role in the diagnosis and / or prognostic evaluation and treatment of prostate cancer, and can be used as a diagnostic biomarker and a therapeutic target for prostate cancer.

[0018] The present invention discovers by fluorescence quantitative PCR that the expression of circTFDP2 is significantly increased in prostate cancer tissues, and the expression level is positively correlated with the Gleason score. And the expression level of circTFDP2 detected in the urine after prostate massage of prostate cancer patients is positively correlated with the expression level in prostate cancer tissues. Therefore, non-invasive and rapid diagnosis of prostate cancer can be achieved by detecting the expression level of circTFDP2 in the urine after prostate massage.

[0019] The present invention discovers that the expression level of circTFDP2 in prostate cancer cells is significantly higher than that in normal prostate epithelial cells. After overexpression of circTFDP2, it can significantly promote the proliferation, migration, invasion of prostate cancer, as well as tumor growth and distal metastasis in the xenograft mouse tumor model in vivo. Conversely, knockdown of circTFDP2 will significantly inhibit the proliferation, migration, invasion of prostate cancer cells, and tumor growth and distal metastasis in vivo. The above findings indicate the importance of circTFDP2 in tumor growth and metastasis, and suggest the feasibility of using siRNA to target and knockdown circTFDP2 for the treatment of prostate cancer. Brief Description of the Drawings

[0020] Appendix Figure 1 It is a comparison of the expression levels of circTFDP2 in 50 pairs of prostate cancer tissues and adjacent tissues;

[0021] Appendix Figure 2 It is a comparison of the relative expression levels of circTFDP2 in prostate cancer tissues with different Gleason scores;

[0022] Appendix Figure 3 It is to compare the correlation of the expression of circTFDP2 in 10 cases of prostate cancer tissues and the urine exosomes of the corresponding prostate cancer patients after prostate massage;

[0023] Appendix Figure 4 It is the relative expression levels of circTFDP2 in normal prostate epithelial cells and prostate cancer cell lines;

[0024] Appendix Figure 5 It is the expression level of circTFDP2 after transfection of si-circTFDP2 and overexpression plasmid of circTFDP2 in prostate cancer cells.

[0025] Appendix Figure 6 It is a result diagram of the effects of interfering with and overexpressing circTFDP2 on the proliferation ability of prostate cancer cells;

[0026] Appendix Figure 7 It is a result diagram of the effects of interfering with and overexpressing circTFDP2 on the proliferation ability of subcutaneous transplanted tumors of prostate cancer;

[0027] Appendix Figure 8 It is a result diagram of the effects of interfering with and overexpressing circTFDP2 on the migration and invasion abilities of prostate cancer cells;

[0028] Appendix Figure 9 It is a result diagram of the effects of interfering with and overexpressing circTFDP2 on the metastasis of prostate cancer in vivo. Detailed Embodiments

[0029] First, the present invention designs specific primers capable of amplifying circular RNA, PCR amplifies the circular RNA of the TFDP2 gene, and determines the accurate circularization site of circTFDP2 by first-generation sequencing, determining that circTFDP2 is a circular RNA molecule composed of 174 nucleotides with a closed circular structure. The nucleotide sequence of circTFDP2 is shown in SEQ ID No.1.

[0030] Furthermore, the present invention detects the expression difference of the circTFDP2 gene in prostate cancer tissues and paired normal tissues by fluorescence quantitative PCR. The results show that the expression level of circTFDP2 in prostate cancer tissues is significantly higher than that in adjacent tissues, and the expression level is positively correlated with the Gleason score of prostate cancer. Moreover, the abundance of circTFDP2 in urine exosomes after prostate massage in prostate cancer patients is positively correlated with the abundance in prostate cancer tissues. Therefore, a kit for detecting the expression change of this circRNA can be prepared, and prostate cancer can be diagnosed by detecting the expression level of circTFDP2 in urine exosomes of patients.

[0031] Next, in vitro and in vivo functional studies of circTFDP2 are carried out. By transfecting the prostate cancer cell line with the specific siRNA sequence of the circTFDP2 gene sequence or the circTFDP2 overexpression plasmid, the expression level of circTFDP2 in prostate cancer cells is successfully adjusted. The results of functional experimental studies show that the proliferation, migration, invasion of cells and the growth and metastasis of prostate cancer xenograft tumors are significantly inhibited after knocking down circTFDP2. On the contrary, overexpressing circTFDP2 can significantly promote the proliferation, migration, invasion of prostate cancer cells and the growth and metastasis of prostate cancer xenograft tumors. Therefore, circTFDP2 can be used as a target in the preparation or screening of drugs for treating prostate cancer.

[0032] Next, the technical solutions of the present invention will be described clearly and completely in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0033] Example 1 Analysis of the expression level of circTFDP2 in prostate cancer tissues and paired normal tissues

[0034] I. Materials

[0035] All tissue specimens were from patients pathologically diagnosed with prostate cancer from October 2018 to October 2021. Fifty pairs of prostate cancer tissues and paired normal tissues were selected for grouping and numbering.

[0036] II. Method

[0037] 1) RNA extraction: Take 30 mg of tissue sample and put it into 500 μL of RNA lysis buffer (Yishan Biotech), add Jingxin grinding beads, homogenize in a homogenizer, then extract RNA according to the operation of Yishan tissue RNA rapid extraction kit, and quantify the purity and concentration of the extracted RNA with a NanoDrop ND-1000 nucleic acid quantifier, and use agarose quality inspection to ensure the integrity of the extracted RNA.

[0038] 2) cDNA synthesis: Use the Kangwei Century reverse transcription kit HiFiScript gDNA Removal RTMasterMix to reverse transcribe the extracted total RNA into cDNA.

[0039] 3) Real-time quantitative PCR: Design specific primers according to the nucleic acid sequences of circTFDP2 and GAPDH, and use the Kangwei Century UltraSYBR Mixture for PCR reaction. The upstream and downstream primers of circTFDP2 are SEQ ID NO.2 and SEQ ID NO.3 respectively, and the upstream and downstream primers of GAPDH are SEQ ID NO.6 and SEQ ID NO.7 respectively. The reaction system is as follows:

[0040] Table 1 PCR reaction system

[0041]

[0042] After mixing the above components evenly, follow the following procedure: pre-denature at 95 °C for 10 min, 40 cycles: 95 °C for 15 s, 60 °C for 30 s. Judge the specificity of the reaction according to the melting curve, and calculate the relative expression level of circTFDP2 by the formula 2 -ΔΔCt The results are shown in Figure 1 . From Figure 1 It can be seen that the expression of circTFDP2 was detected in 50 pairs of clinical prostate cancer tissue specimens. The results showed that circTFDP2 was significantly up-regulated in cancer tissues. Combining the Gleason score information of 50 prostate cancer samples for analysis, the results are shown in Figure 2 , and the results showed that the expression level of circTFDP2 was relatively higher in the high Gleason score group.

[0043] Example 2 Detection of the expression level of circTFDP2 in urine exosomes after prostate massage in prostate cancer patients

[0044] 1) Extraction of urinary exosomes after prostate massage in prostate cancer patients: Urine was collected after prostate massage in prostate cancer patients before radical prostatectomy. The urine supernatant was obtained after centrifugation at 300 g for 30 minutes. 50 ml of the urine supernatant was centrifuged at 100,000 g for 70 minutes using an ultracentrifuge. The precipitate obtained by centrifugation was resuspended in PBS buffer and filtered through a 0.22 μM filter.

[0045] 2) Detection of circTFDP2 expression level in exosomes: The relative expression level of circTFDP2 in exosomes was obtained by performing RNA extraction, cDNA synthesis, and real-time quantitative PCR as described in Example 1 on the filtered product.

[0046] 3) Calculate the correlation between circTFDP2 expression in urinary exosomes and prostate cancer tissues using Graphpad Prism 8.0.2 software. The results are shown in Figure 3 . As Figure 3 shown, the expression level of circTFDP2 in urinary exosomes of prostate cancer is positively correlated with the expression level of circTFDP2 in prostate cancer tissues, with a correlation coefficient of 0.8, and the data has significant differences.

[0047] Example 3 Detection of circTFDP2 expression in prostate cancer cells and normal prostate epithelial cells

[0048] I. Materials

[0049] Prostate cancer cell lines C4-2B, LNCap, 22Rv-1, DU145, PC-3 and normal prostate epithelial cell RWPE-1J were all purchased from the American Type Culture Collection (ATCC).

[0050] II. Methods

[0051] The relative expression level of circTFDP2 in each cell was obtained by performing RNA extraction, cDNA synthesis, and real-time quantitative PCR as described in Example 1. The results are shown in Figure 4 . Compared with the normal prostate epithelial cell RWPE-1, the circTFDP2 in 5 prostate cancer cell lines was significantly increased.

[0052] Example 4 Construction of circTFDP2 interference fragments and overexpression plasmids

[0053] 1) Design of circTFDP2 interference fragments: siRNA sequences were synthesized by Shanghai GenePharma. The two siRNA sequences of circTFDP2 are shown as SEQ ID NO.4 and SEQ ID NO.5 respectively.

[0054] 2) Construction of overexpression vector: Synthesize the linear full sequence of circTFDP2. The sequence is annealed into a double-stranded DNA fragment and inserted into the pcircRNA vector through a multiple cloning site. The recombinant plasmid is identified by sequencing. The negative control is the pcircRNA empty vector without the inserted sequence.

[0055] 3) Verification of interference and overexpression efficiency:

[0056] After digesting the cells, inoculate them into a 24-well plate and culture them overnight in an incubator at 37°C and 5% CO2. The cell density is about 80% the next day. Transfect siRNA according to the operation instructions of lipofectamine RNAimax; transfect the circRNA overexpression plasmid according to the operation instructions of lipofectamine TM 3000. Collect the cells 24 hours after transfection, and detect the relative expression level of circTFDP2 by RNA extraction, cDNA synthesis and real-time quantitative PCR described in Example 1. From the results Figure 5 It can be seen that the designed siRNA fragment interfering with the expression of circTFDP2 can significantly reduce the expression of circTFDP2, while transfection of the circTFDP2 overexpression plasmid can significantly increase the expression level of circTFDP2.

[0057] Example 5: Determination of the proliferation ability of prostate cancer cells after knocking down or overexpressing circTFDP2

[0058] 1) Digest the prostate cancer cells (C4-2B, 22Rv-1) transfected with circTFDP2 siRNA or overexpression plasmid into single-cell suspensions one day in advance, count, adjust the cell concentration to 20,000 cells / ml, and inoculate them into a 96-well plate, 100 μL per well, that is, 2,000 cells per well.

[0059] 2) Add CCK8 reagent at different time points (1, 2, 3, 4, 5 days) when the cell confluence is reached, with a ratio of 1:10, that is, add 10 μL of the detection solution to 100 μL of the culture medium.

[0060] 3) Incubate at 37°C for 2 h, and then detect the absorbance at 450 nm with an enzyme-labeled instrument.

[0061] 4) Figure 5 A is a schematic diagram of the cell growth curve after specifically interfering with the expression of circTFDP2 in prostate cancer cells. From Figure 5 A, it can be seen that the proliferation of the prostate cancer cell line with the expression of circTFDP2 interfered slows down; Figure 5 B is a schematic diagram of the cell growth curve of prostate cancer cells after overexpressing the circTFDP2 plasmid. From Figure 5It can be seen from B that the proliferation of the prostate cancer cell line with overexpressed circTFDP2 is accelerated.

[0062] Example 6: Determination of the proliferation ability of prostate cancer xenograft tumors after knocking down or overexpressing circTFDP2

[0063] 1) Construction of stable cell lines with knocked-down and overexpressed circTFDP2: The plasmid pcircTFDP2 (the overexpression plasmid constructed in Example 4) and the plasmid pcirc-Vector (the backbone plasmid without inserted circTFDP2) can be directly used for lentivirus packaging; the circTFDP2 knockdown sequence SEQ ID NO.4 was inserted into the plko.1 vector to obtain the circTFDP2 lentivirus knockdown plasmid for lentivirus packaging for knockdown. Mix 7.5 μg of the target gene plasmid with 7.5 μg of the virus packaging plasmid (pMDL:VSV-G:REV = 5:3:2) and 30 μl of lipofectamine2000 thoroughly, and after standing for 15 minutes, add dropwise to the medium of 10 cm 293T monolayer cells. After transfection for 6 hours, change the medium and continue culturing for 48 hours, collect the supernatant containing lentivirus, and use it for cell infection after ultrafiltration and concentration. Subsequently, the prepared lentivirus was used to infect prostate cancer 22Rv-1 cells. After 24 hours of infection, change the medium and add puromycin for screening. After 2 weeks, the expression level of circTFDP2 was detected by qPCR.

[0064] 2) Observation of the effect of circTFDP2 on the proliferation of xenograft tumors in the subcutaneous transplantation tumor model: The constructed stable knockdown and overexpressed circTFDP2 cells were inoculated subcutaneously into male BALB / c nude mice at a density of 10 7 per mouse. After 5 to 6 weeks, the nude mice were sacrificed, the tumors were collected, and the tumor volume was measured. The results are shown in Figure 7 . As Figure 7 shown, the growth of the xenograft tumors was significantly inhibited after knocking down circTFDP2, while the growth of the xenograft tumors in the overexpressed circTFDP2 group was significantly accelerated.

[0065] Example 7: Effects of knocking down or overexpressing circTFDP2 on the migration and invasion abilities of prostate cancer cells

[0066] The stably knocked-down and overexpressed circTFDP2 prostate cancer cells constructed in Example 6 were seeded into transwell chambers, 100 μL per well (without FBS). 0.6 mL of complete medium containing 10% FBS was added to the lower chamber of the transwell to stimulate cell migration. After culturing in a cell incubator for 24 hours, the culture medium in the wells was discarded, and the cells were fixed with tissue fixative at room temperature for 15 minutes, stained with 0.1% crystal violet for 10 minutes, rinsed with water, and the non-migrated cells on the upper layer were gently wiped off with a cotton swab. Four fields of view were observed and photographed under a microscope for counting. For the cell invasion assay, 50 μL of Matrigel was added to the upper chamber of the transwell, and the rest of the steps were basically the same as above. The experiment was independently repeated 3 times. The number of migrated and invaded cells was counted using ImageJ software, and a statistical t-test was performed. **P < 0.01 indicates significant statistical difference, and ***P < 0.001 indicates extremely significant statistical difference. The results showed that after knocking down circTFDP2, the migration and invasion abilities of prostate cancer cells were significantly weakened, while overexpression of circTFDP2 promoted the migration and invasion of prostate cancer cells( Figure 8 ).

[0067] Example 8: Observation of the effect of circTFDP2 on the in vivo metastasis of prostate cancer using the tail vein metastasis tumor model. The stably knocked-down and overexpressed circTFDP2 cells constructed in Example 6 were inoculated into male BALB / c nude mice by tail vein injection at a dose of 10 7 cells / mouse. After culturing for 6 - 8 weeks, the metastasis of prostate cancer was observed using a small animal imaging system, and the results are shown in Figure 9 . It can be seen from the experimental results that the number of metastatic foci in the circTFDP2 knockdown group was significantly less than that in the control group, while overexpression of circTFDP2 significantly increased the number of metastatic foci.

[0068] SEQUENCE LISTING

[0069] SEQ ID NO.1

[0070] >hsa_circ_0008304|NM_001178138|TFDP2

[0071] GTTGTTCTTTTAAAGAATTATTGAAGACGAAGGTTTTTTTCTTTTTATTTTTT TAATGGCTTTACAGAATCTTAAATAGAATACAGTTTGACATGACGGCAAAAAATGTTGGTTTGACTTCCACAAATGCAGAAGTAAGAGGATTTATAGATCAG AATCTCAGTCCAACAAAAG

[0072] SEQ ID NO.2

[0073] TGGTTTGACTTCCACAAATGC

[0074] SEQ ID NO.3

[0075] AAACCTTCGTCTTCAATAATTC

[0076] SEQ ID NO.4

[0077] GTCCAACAAAAGGTTGTTC

[0078] SEQ ID NO.5

[0079] CCAACAAAAGGTTGTTCTT

[0080] SEQ ID NO.6

[0081] CAAGGTCATCCATGACAACTTTG

[0082] SEQ ID NO.7

[0083] GTCCACCACCCTGTTGCTGTAG。 Sequence Listing <110> Zhejiang University <120> Application of Circular RNA circTFDP2 and Its siRNA in the Diagnosis and Treatment of Prostate Cancer <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 174 <212> DNA <213> Homo sapiens <400> 1 gttgttcttt taaagaatta ttgaagacga aggttttttt ctttttattt ttttaatggc 60 tttacagaat cttaaataga atacagtttg acatgacggc aaaaaatgtt ggtttgactt 120 ccacaaatgc agaagtaaga ggatttatag atcagaatct cagtccaaca aaag 174 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <400> 2 tggtttgact tccacaaatg c 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <400> 3 aaaccttcgt cttcaataat tc 22 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <400> 4 gtccaacaaa aggttgttc 19 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <400> 5 ccaacaaaag gttgttctt 19 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <400> 6 caaggtcatc catgacaact ttg 23 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <400> 7 gtccaccacc ctgttgctgt ag 22

Claims

1. Use of a reagent for detecting circTFDP2 in the preparation of a reagent for diagnosing and / or evaluating prostate cancer, wherein the nucleotide sequence of circTFDP2 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The reagent is used to diagnose and / or evaluate prostate cancer by detecting the expression level of circTFDP2 in the prostate or in urine exosomes after prostate massage.

3. Use of primers in the preparation of a kit for diagnosing and / or evaluating prostate cancer, characterized in that: The primers can specifically amplify circTFDP2, the nucleotide sequence of which is shown in SEQ ID No.1, and the primers are: the upstream primer sequence is SEQ ID No.2, and the downstream primer sequence is SEQ ID No.

3.

4. The use according to claim 3, characterized in that: The test sample in the kit is urine after prostate massage.

5. Use of circTFDP2 siRNA in the preparation of a drug for treating prostate cancer, wherein the drug uses circTFDP2 as a therapeutic target, the nucleotide sequence of circTFDP2 is shown in SEQ ID No.1, and the circTFDP2 siRNA includes at least one of the nucleotide sequences shown in SEQ ID No.4 and SEQ ID No.5.

Images