A bi / multifunctional non-natural amino acid and its conjugate and application

Abstract

The present invention relates to the field of biomedicine technology, and in particular to a non-natural amino acid with dual / multiple functions and its recombinant protein and application. The non-natural amino acid of the formula I structure of the present invention can be efficiently and point-specifically introduced into any site of the protein, and the protein can be site-specifically coupled with effector molecules including fluorescence, nuclides, drugs, polyethylene glycol (PEG) and nucleic acids through a rapid, efficient and mild reaction to prepare a dual / multiple conjugate with site-specific modification and uniform quality. The conjugate has the potential advantages of low cost, low immunogenicity and simple production. The dual / multiple functional recombinant protein can be applied to clinical applications such as high signal-to-noise ratio tumor imaging, dual-modality tumor diagnosis and treatment integration, and antibody-drug conjugate-mediated tumor killing.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a bi / multi-functional non-natural amino acid and a conjugate thereof and application thereof. Background Art

[0002] Therapeutic proteins, such as antibodies, hormones and interferons, play an important role in the treatment of various diseases. However, some native therapeutic proteins with inherent defects such as low efficacy, short half-life, high immunogenicity and complex preparation can no longer meet the current scientific research and clinical needs. Over the past few decades, with the continuous development of protein engineering and genetic engineering technology, a large number of protein coupling modification strategies have emerged, especially site-selective modification. Although site-specific protein single position labeling has made great progress in studying protein drug expression, intracellular protein localization, transportation and conformational changes, with the in-depth study of diseases, the understanding of the increasingly complex pathogenesis and the need for precise personalized medicine, single protein modification can no longer meet current needs. For example, when monitoring the precise conformational changes of a single protein or studying protein-protein interactions, single-site protein labeling may not be enough; for example, ADCs coupled with a single type of anticancer drug still have problems such as low efficacy and drug resistance, which hinders its further application in treatment. In addition, the demand for new treatment strategies that combine imaging agents for real-time monitoring during the treatment of protein drug molecules (such as antibodies) is also increasing. Therefore, double or multiple modifications of proteins become particularly important in the development of multifunctional protein drugs.

[0003] At present, there are relatively few studies on protein multi-modification, especially site-specific multi-modification strategies. Most of them adopt random modification of natural proteins (amino or thiol); glycosylation modification; fusion expression of proteins; some enzyme-catalyzed labeling, such as introducing affinity tags (SNAP / CLIP-tag), identifying or introducing special polypeptide fragments; reducing disulfide bonds and other methods to introduce some reactive "handle molecules". However, they often result in low labeling efficiency, uneven product mixing, limited modification sites, and reduction of disulfide bonds or introduction of thiol groups will make proteins unstable and large-volume labeled proteins. The products introduced by the white affect the function, which greatly limits their further development. By using the gene codon expansion technology, two or three sets of mutually orthogonal aaRS-tRNA pairs can be used to achieve double or even triple insertion of two mutually orthogonal functional groups (such as azide and alkynyl, azide and tetrazine, azide and ketone, tetrazine and norbornene) amino acids through triple or quadruple stop codons. However, the disadvantages of low insertion efficiency, poor reaction efficiency and continuous introduction of multiple stop codons have greatly limited the large-scale application of this technology in the field of therapeutic proteins. For example:

[0004] 1. Synthetic strategies to achieve protein bifunctionalization

[0005] (1) At two different sites

[0006] Separately modifying two rare amino acid residues on the surface of a protein is the most direct way to achieve dual modification of a protein, while the combination of two different monofunctional modification methods needs to meet strict selectivity to ensure orthogonality, compatibility, and a high modification rate. Gaunt and colleagues developed a chemical selective labeling method for labeling methionine residues in proteins with a hypervalent iodine reagent, achieving site-specific labeling of methionine, and combining this method with the reaction of maleimide and thiol groups on cysteine ​​residues to achieve dual functionalization of the GTP-binding protein fragment Gα (Nature 562, 563–568 (2018)). Similarly, Paavola and colleagues combined cysteine ​​modification with pyridoxal phosphate-mediated protein N-terminal transamination reaction to achieve dual fluorophore labeling of glutamine-binding proteins, and monitored ligand-mediated conformational changes through FRET efficiency (Biosensors and Bioelectronics, 2010, 26 (1): 55-61).

[0007] Another alternative strategy is to achieve site-specific double modification of proteins based on the different reactivity of free cysteine ​​and oxidized cysteine. The Weil team first modified the free cysteine ​​with maleimide, then used disulfide bond reduction to generate two free thiol groups from the oxidized cysteine, and then used allyl phenyl sulfone to modify the free thiol groups. However, the limitation of this method is that the reaction between the thiol group and maleimide must be carried out before the disulfide bond modification by allyl phenyl sulfone, otherwise allyl phenyl sulfone will also react with the free thiol group to produce heterogeneous products (Bioconjugate chemistry, 2017, 29(1): 29-34.).

[0008] Although dual modification of proteins at two different sites is straightforward, the availability of proteins containing two orthogonally reactive amino acid residues is limited, so an alternative approach is to use a versatile bioconjugation reagent to target a specific amino acid residue.

[0009] (2) Introducing multifunctional biological reagents at one site

[0010] Baker, Caddick and their colleagues developed a method for reversible double modification of proteins based on monobromomaleimide and dibromomaleimide. Taking the dibromomaleimide molecule as an example, the first modification is introduced by the reaction of bromine-substituted maleimide with thiol groups, and then the bromine atom is replaced by another thiol conjugate to introduce the second modification (J.Am.Chem.Soc.2010,132,1960–1965.; Chem.Commun.2011,47,8781–8783.), or a disulfide bridge can be formed with a reduced disulfide bond. Both can be modified by adding excess thiol reagents, such as glutathione and mercaptoethanol, and the modified protein can be returned to its original unmodified state, which has the potential to develop prodrugs. Zhou's group developed another maleimide analog called 3Br-5MPs, which has a modification efficiency similar to that of traditional maleimide reagents, but has a higher specificity for thiol groups on cysteine. First, the cysteine ​​on the protein undergoes a Michael addition reaction with 3Br-5MPs, and the produced conjugate can further undergo a secondary Michael addition reaction with a thiol reagent. In order to avoid the slow release of the second conjugate by the reverse Michael addition reaction, sodium borohydride is added for reduction to obtain a stable and active protein double modifier (Nat. Commun. 2020, 11, 1015.).

[0011] Bernardes and colleagues combined a ring-strained bicyclic system with a vinyl sulfone system to develop an azabicyclic vinyl sulfone reagent to achieve double modification of proteins (Chem. Sci. 2019, 10, 4515–4522.). Such a combination can chemically selectively modify cysteine ​​residues, and the dienophile in the ring-strained azabicyclic can also undergo a Diels-Alder reaction with reverse electron demand to introduce a second modification. In addition to vinyl sulfone, allyl phenyl sulfone has also become a feasible strategy for step-by-step double modification due to its stronger water solubility and higher reactivity. The Weil team simply adjusted the pH to 6, and allyl phenyl sulfone could undergo a Michael addition reaction to introduce the first modification, producing a coupled ester. By adjusting the pH to 8, the conjugate can further react with the second thiol-containing part to achieve double modification of proteins (Chem. Sci. 2016, 7, 3234–3239).

[0012] In addition to maleimide analogs and sulfone analogs, there are some other strategies for protein dual modification. For example, Goncalves and colleagues reported that dichloro-1,2,4,5-tetrazine can undergo two-step continuous nucleophilic aromatic substitution reactions, and highly selectively introduce thiol-containing loads at the cysteine ​​residue site. The tetrazine structure serves as another handle for the subsequent bioorthogonal iEDDA reaction, which can realize the preparation of site-specific dual-modified protein conjugates (Angew. Chem. 2018, 130, 10806–10810.). Although this method is simple, if you want to label functional groups that are larger or more hydrophobic, you will encounter the problem of low labeling rate. Waser and colleagues reported a strategy using ethynylbenzimido ketone (EBX) to efficiently and specifically introduce two reactive groups-azido groups and hypervalent iodine, and further achieve protein dual functionalization through SPAAC reaction and Suzuki-Miyaura cross-coupling (Chem 2019, 5, 2243–2263.). Chudasama et al. developed a plug-and-play platform to insert dibromopyridazinedione with two bioorthogonal tags into the disulfide bonds in antibodies or antibody fragments Fab, and then achieved double modification of proteins through two steps of bioorthogonal reactions (SPACC and CuAAC) without affecting the disulfide bonds in the antibody that are critical to activity (Caddick, Nat. Commun. 2015, 6, 6645.), which has far-reaching guiding significance in the development of new multi-modified antibody-drug conjugates. In the previously mentioned site-directed modification of methionine by periodate developed by Gaunt, the generated diazosulfonium conjugate can further undergo photoredox radical cross-coupling reaction with C-4 benzylated Hans ester derivatives to introduce a second functional group to achieve double labeling (Nature 562, 563–568 (2018)).

[0013] A possible limitation of protein single-site double modification is that the two orthogonal reactive groups are connected by a relatively small linker and are therefore spatially close. The steric hindrance effect makes it difficult for some larger modification groups such as polymers to be attached to the protein.

[0014] 2. Genetic engineering to achieve double protein modification

[0015] (1) Introduction of natural amino acids

[0016] In the early days, protein double modification was achieved by genetic engineering methods, which introduced cysteine ​​at two sites on the target protein through point mutation, and then achieved double labeling by reacting the two thiol groups with different thiol-reactive reagents. Caddick et al. reported the use of genetic engineering methods to introduce two cysteines on DARPins proteins. The two thiol groups have different nucleophilic reactivity, so protein double modification can be achieved in two steps (Caddick, Chem. Commun. 2014, 50, 4898–4900). The less reactive bromoacetamide first reacts with the more nucleophilic cysteine, and then the more reactive maleimide reacts with the relatively weaker nucleophilic cysteine. Although the concept of achieving protein double modification in this way is simple, in order to avoid product heterogeneity, it is very challenging to find the balance point of thiol reactivity and the most suitable mutation site of cysteine.

[0017] Caddick et al. also reported that the same sulfhydryl reaction reagent was used to react with two cysteines to produce two identical sulfoniums. Due to the different solvent exposure of the α protons at the two sites, the more easily solvated sulfonium ion will undergo a β elimination reaction to produce dehydroalanine. In contrast, the other sulfonium ion, whose α proton is in a solvent-shielded microenvironment, will not undergo a spontaneous elimination reaction. It will react with azide to obtain an azide-containing side chain, thus obtaining a protein that can undergo two orthogonal reactions, which can achieve double labeling of proteins (Chem. Sci. 2013, 4, 3455–3458.). Pentelute and colleagues developed a method using a tetrapeptide sequence called FCPF (π-clamp) to create a specific chemical environment for cysteine. In this environment, only the specified cysteine ​​can react with the aromatic fluoride reagent, while other sulfhydryls will not participate in the reaction. Therefore, this method is compatible with other sulfhydryl coupling methods (Nat. Chem. 2016, 8, 120–128.).

[0018] (2) Introduction of unnatural amino acids

[0019] The limitation of introducing natural amino acids through point mutation is that the functions and reactivity of the 20 natural amino acids are very limited. Therefore, the introduction of a series of non-natural amino acids with similar structures to natural amino acids but with diverse functions and bioorthogonal reaction functional groups brings more possibilities for protein double modification.

[0020] Benjamin G. Davis's research group introduced cysteine ​​based on site-directed mutagenesis and used nutrient-deficient strains to introduce azidohomoalanine AHA, which has a similar structure to methionine, into the target protein. Then, the double modification of protein was achieved by the reaction of cysteine ​​with methylthiosulfonate derivatives and the CuAAC reaction between the azide group and the acetylene group in AHA (Nature 2007, 446, 1105–1109.). The disadvantage of this method is that the binding efficiency of non-natural amino acids with natural aminoacyl-tRNA synthetases in organisms is low and non-natural amino acids can only replace natural amino acid sites with similar structures.

[0021] Genetic codon expansion technology is a technology that can accurately insert a series of non-natural amino acids with different structures at any target site. Through this technology, more than 150 non-natural amino acids with various "reaction handles" and functional groups can be achieved. Deniz and his colleagues used the amber codon UAG to insert the non-natural amino acid pAcF into T4 lysozyme, combined with site-directed mutagenesis to introduce cysteine, and achieved double modification of proteins through thiol-maleimide reaction and oxime reaction (J.Am.Chem.Soc.2008,130,17664–17665.). Although the strategy of introducing cysteine ​​as one of the two sites for double modification of proteins is simple, its limitation is that if the protein already contains cysteine ​​that plays an important role in structure or function, then this method will face greater difficulties. In addition, cysteine ​​residues can form disulfide bonds, which limit the expression yield of proteins, and the reversibility of the reaction between the product thiol-maleimide will cause stability problems of the coupling product.

[0022] Therefore, introducing two different unnatural amino acids containing bio-orthogonal tags became a solution. Liu and his colleagues introduced two pairs of orthogonal aaRS / tRNA pairs, using two different stop codons, UAG and UAA, to encode two unnatural amino acids, AzF containing azide and PrK containing alkyne, on glutamine-binding proteins, and then carried out a two-step CuAAC reaction to introduce two chromophores on the protein (Angew. Chem. 2010, 122, 3279–3282). In a subsequent report, Liu used a similar method to introduce two amino acids, AzF and AcK, and used the SPAAC reaction of the azide group and the oxime reaction of the carbonyl group to achieve a catalyst-free "one-pot" double modification, avoiding protein aggregation and oxidation caused by copper catalysts (ChemBioChem 2012, 13, 1405–1408). Similarly, Peter G. Schultz's research group introduced non-natural amino acids containing azide and carbonyl groups into the eukaryotic system and obtained a toxin drug and a fluorescent dual-modified antibody (Angew Chem Int Ed Engl. 2013 Dec 23; 52(52): 14080-3.).

[0023] In addition to using triplet stop codons to encode unnatural amino acids, Chin and his colleagues developed two orthogonal aaRS / tRNA pairs, using a quadruple codon and a stop codon to insert two unnatural amino acids containing tetrazine and norbornene structures into calmodulin, and later achieved double modification through a two-step iEDDA reaction (Nat. Chem. 2014, 6, 393–403). However, the efficiency of natural ribosomes in decoding quadruple codons is very low. Chin evolved an orthogonal ribosome (ribo-Q1), which is not responsible for protein synthesis and is only used to selectively decode quadruple codons. Using this system, two unnatural amino groups with azide benzene and alkynyl groups were successfully introduced into proteins, achieving subsequent double modification, but the efficiency and specificity are still low (Nature. 2010 Mar 18; 464 (7287): 441-4.). Chin then used PylRS / tRNA CUA Evolution was performed to obtain the optimized quadruplex decoding variant PylRS / tRNA UACUThe efficiency was greatly improved, and two bioorthogonal tags, norbornene and tetrazine, were site-selectively introduced into proteins, and dual modification was successfully completed through two consecutive iEDDA reactions (Nat Chem. 2014 May; 6 (5): 393-403.). Under this system, chin used the above-mentioned orthogonal aaRS-tRNA pair to insert the unnatural amino acids of alkyne and cyclopropene into calmodulin, and finally achieved the dual functionalization of the protein. (J. Am. Chem. Soc. 2014, 136, 22, 7785–7788). The introduction and modification of bifunctional amino acids can be achieved by using unnatural amino acids, which have the advantages of small amino acid structure, flexible insertion site, high specificity, and rich library of tags that can be modified. However, there are still challenges in this rapidly developing field, such as the low catalytic efficiency of engineered aaRS, and tedious evaluation and optimization are required to improve its performance, and the overall expression yield is low, which requires repeated optimization of effective protein engineering schemes and the range and compatibility of functional groups that can be inserted. In addition to the development of recombinant engineering technologies, the library of bioorthogonal chemical tools should also be expanded to allow more choices of compatible bioorthogonal reaction pairs in terms of reaction rate, catalyst type, and substrate solubility to meet their intended applications.

[0024] (3) Introduction of peptide tags

[0025] In addition to introducing non-natural amino acids containing bioorthogonal reaction handles, double protein modification can also be achieved by introducing two artificial peptide sequences that can be recognized and covalently labeled by specific enzymes. This enzyme-mediated peptide labeling has the advantages of high specificity and labeling efficiency, and little interference with protein structure and function.

[0026] In order to study the conformational dynamics of HIV-1 Env trimer, Mothes and colleagues demonstrated the application of dual site-specific labeling and subsequent smFRET technology. First, they introduced Q3 peptide and A1 peptide, which can be recognized by two enzymes, TGase and Acps PPTase, respectively, into the V1 and V4 / V5 loops of gp120 protein, and then catalytically introduced fluorescent label tags that can produce FRET. When it is not bound to the CD4 receptor, no FRET signal is generated. When it is bound to CD4, a high FRET signal is presented, confirming the change of protein structure and realizing the observation of protein dynamics (Nature 455,109-U176 (2008)). Ploegh and colleagues introduced two peptide tags, LPXTGG and HNV motifs, into the antibody IgG, which can be recognized and labeled by two enzymes, SortaseA and Butelase1, respectively, to achieve site-specific dual modification of antibodies (Bioconjugate Chem. 2018, 29, 3245–3249.). Chen and colleagues have demonstrated the binding of LAP peptide (LplA receptor peptide), which can be recognized by lipoic acid ligase (LpIA) to connect lipoic acid derivatives and pyrrolysine analogs with azide groups for site-selective dual labeling of epidermal growth factor receptor (EGFR) on living cells, achieving dual site-specific labeling of EGFR on the surface of living cells and subsequent conformational changes. (Chembiochem. 2014Aug 18; 15(12): 1738-43.) Geierstanger and colleagues achieved enzyme-mediated dual site-specific fret fluorescent labeling of IgE-Fc by small peptide sequence (S6) and genetically encoded pyrrole-carboxylysine (Pcl). Selective labeling was performed by AlexaFluor488-conjugated coenzyme A (PPTase substrate) and AlexaFluor 594-modified 2-aminobenzaldehyde, respectively. FRET analysis of this dual-site specific labeled IgE-Fc can observe the key process of the allergic cascade reaction, namely the formation of the IgE-FceRI complex (Chembiochem 15, 1787-1791 (2014).)

[0027] Although it is simple to introduce the required functional groups in one step through two independent reactions, the labeling efficiency may be affected by steric hindrance and the hydrophobicity of the introduced probe. This problem can be solved by using a molecule that introduces a multifunctional "scaffold" containing a bioorthogonal tag. Distefano et al. used farnesyl transferase to transfer the isoprenoid group in farnesyl pyrophosphate to the cysteine ​​at the CVIA tetrapeptide sequence, introduced two reactive tags on the model protein GFP, and then carried out two independent bioorthogonal reactions to achieve double protein modification (J.Am.Chem.Soc.2013,135,16388–16396.).

[0028] In some cases, enzyme-mediated protein labeling can occur at specific sites on the surface of natural proteins without the need to insert artificial peptide sequences. Alabi and colleagues used microbial glutamine aminotransferase to introduce azide groups and methyl tetrazine groups on IgG antibodies, and then achieved drug and PEG dual modification on antibodies through SPAAC reaction and iEDDA reaction (Bioconjugate Chem. 2019, 30, 2452–2457.). However, this strategy is greatly limited by protein substrates, which requires that the recognition motif of the protein substrate must be displayed at a specific site on the surface.

[0029] Genetic code expansion (GCE) is one of the site-specific modification technologies for proteins, which can achieve the introduction of ncAAs at specific sites of any target protein in the body. This technology uses aminoacyl-tRNA synthetase (aaRS) / tRNA pairs that are orthogonal to the host cell to insert ncAAs at the mutated stop codon (UAG / UGA / UAA) site in the protein to obtain proteins that site-specifically encode non-natural amino acids. This technology can introduce non-natural amino acids at any site of the protein. Using this technology, non-natural amino acids containing bioorthogonal reaction groups can be introduced at any site of the antibody. Through rapid, efficient, and mild reactions, antibodies can be site-specifically coupled to effector molecules such as fluorescence, nuclides, drugs, polyethylene glycol (PEG), and nucleic acids to produce site-specific modified antibodies or protein conjugates with uniform quality. However, to couple two effector molecules, it is necessary to simultaneously introduce two different bioorthogonal reaction functional groups on the antibody fragment to serve as the "target head" for coupling. Most of the non-natural amino acids reported in the literature contain only one bioorthogonal reaction group. Therefore, if you want to achieve site-specific double modification of proteins, you can only introduce two different non-natural amino acids into the protein. This strategy will greatly reduce the expression yield of the protein and increase the cost of preparation.

[0030] At present, the antibody-coupled effector molecules generally use whole antibody proteins, which are about 150kd in size, have a long half-life in the human body, about 1-2 weeks, slow metabolism, and a long retention time in the blood, especially in the process of coupling toxin drugs, with a high risk of off-target; and the permeability to solid tumors is not high, so the efficacy will also be limited; in the process of whole antibody coupling fluorescent molecules or nuclides for tumor imaging, the time to reach the optimal signal-to-noise ratio is too long, which will not only affect the timely diagnosis and treatment of malignant tumors but also cause damage to the human body by radioactive nuclides. At the same time, the modification on the antibody generally uses a large number of amino groups or multiple functional natural amino acids such as reduced cysteines to generate a mixture of random coupling modifications with an average DAR of 5-8. Drug molecules with strong hydrophobicity may cause aggregation of antibodies, and when coupled to the specific antigen binding region, it will affect the binding of antibodies to target cells. The coupling of multiple drugs will lead to higher immunogenicity, and it is possible to produce antibodies against the multi-conjugate and degradation products. At the same time, due to the inability to modify the site, the uniformity of the prepared drugs (such as ADC) cannot be guaranteed, and there are huge challenges in quality control. In addition, the expression of whole antibodies is generally produced by eukaryotic cell fermentation. The entire production process is complex, the cost is high, and the yield is low. Therefore, these have limited the development of antibodies in the field of biomedicine. Summary of the invention

[0031] In view of this, the present invention provides a non-natural amino acid with dual / multiple functions and its recombinant protein and application. The non-natural amino acid can be efficiently and site-specifically introduced into any site of the protein, and the site-specific coupling of the protein and the effector molecule is achieved through a fast, efficient, and mild reaction to produce site-specific modified dual / multi-conjugates with uniform quality, low cost, and low immunogenicity. The production method is simple and has huge potential advantages.

[0032] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0033] An unnatural amino acid having a structure shown in Formula I;

[0034] or a pharmaceutically acceptable salt, solvate or prodrug thereof:

[0035]

[0036] Wherein, at least one of Ra, Rb, Rc, Rd and Re is R1 or The rest are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido, azido-substituted alkanoyl, unsubstituted alkanoyl or alkynyl; R1 is selected from hydrogen, substituted or unsubstituted C1-C10 alkyl, hydroxyl, halogen, carboxyl, cyanonitro, substituted or unsubstituted C1-C10 alkoxy, azido, hydroxylamino, azido-substituted alkanoyl or unsubstituted alkanoyl; provided that Ra, Rb, Rc, Rd and Re contain alkanoyl, azido and At least two groups in .

[0037] In some embodiments, the Rb or Re is The non-natural amino acid has a structure shown in Formula I-1 or Formula I-2:

[0038]

[0039] The R1 is selected from -(CH2) X N3, -(CH2CH2O) X N3, -(CH2) X CO-(CH2) X 、-(CH2 CH2O) X CO-(CH2CH2O) X 、-(CH2) X CO-(CH2) X N3 or -(CH2 CH2O) X CO-(CH2 CH2O) X N3; x = 1-10;

[0040] The remaining substituents on the benzene ring are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido, alkanoyl or alkynyl.

[0041] In some embodiments, the Rb or Re is R1, and the non-natural amino acid has a structure shown in Formula I-3 or Formula I-4:

[0042]

[0043] The R1 is selected from -(CH2) X N3, -(CH2CH2O) X N3, -(CH2) X CO-(CH2) X 、-(CH2 CH2O) X CO-(CH2CH2O) X 、-(CH2) X CO-(CH2)X N3 or -(CH2 CH2O) X CO-(CH2 CH2O) X N3; x = 1-10;

[0044] The remaining substituents on the benzene ring are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido, alkanoyl or alkynyl.

[0045] In some embodiments, in the non-natural amino acid, the benzene ring is connected to five carbon atoms connected to an azido group, an alkanoyl group, At least two groups in the above formula. The two or more groups are located at different positions on the benzene ring. Assume that n of Ra, Rb, Rc, Rd and Re are substituents A, n is an integer from 2 to 5, and the n substituents are not completely the same; that is, the n substituents A are selected from azido, alkanoyl, At least two groups in

[0046] Wherein, the R1 is selected from hydrogen, methyl, CH2CO-, -(CH2) X N3, -(CH2CH2O) X N3, -(CH2) X CO-(CH2) X 、-(CH2 CH2O) X CO-(CH2 CH2O) X 、-(CH2) X CO-(CH2) X N3 or -(CH2CH2O) X CO-(CH2 CH2O) X N3; x = 1-10;

[0047] The remaining substituents on the benzene ring are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy or alkynyl.

[0048] In some specific embodiments, the non-natural amino acid has any of the following structures:

[0049]

[0050]

[0051] The non-natural amino acids described in the present invention are L-amino acids, D-amino acids or a combination of the two.

[0052] The present invention does not specifically limit the method for preparing the non-natural amino acid, and any method well known in the art may be used.

[0053] In the present invention, the pharmaceutically acceptable salts (including sodium salts, potassium salts, trifluoroacetates, sulfonates, etc.), solvates or prodrugs of the natural amino acids are synthesized according to common methods in the art.

[0054] The present invention also provides the use of the non-natural amino acid in preparing recombinant protein or recombinant protein conjugate.

[0055] The present invention provides a recombinant protein, wherein the amino acid at at least one position in the sequence of the wild-type protein is mutated into the non-natural amino acid described in the present invention.

[0056] In the present invention, the protein includes functional proteins, diagnostic proteins, industrial enzymes, or antibodies or antibody fragments thereof that have the effect of treating or preventing diseases.

[0057] Genetic code expansion (GCE) is one of the site-specific modification technologies for proteins. The present invention utilizes this technology to site-specifically introduce the non-natural amino acids containing bioorthogonal reaction groups of the present invention into the wild-type protein (including functional proteins, diagnostic proteins, industrial enzymes, or antibodies or antibody fragments thereof with therapeutic and / or preventive effects). Through rapid, efficient, and mild reactions, site-specific coupling of antibodies with effector molecules such as fluorescence, nuclides, drugs, polyethylene glycol (PEG), and nucleic acids can be achieved to produce site-specifically modified antibodies or protein conjugates with uniform quality.

[0058] In some embodiments, the protein or its active fragment is selected from alpha-1 antitrypsin, angiostatin, antihemolytic factor, antibody, apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide, atrial peptide, CXC chemokine, T39765, NAP-2, ENA-78, gro-a, gro-b, gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, C-kit ligand, cytokine, CC chemokine, monocyte chemoattractant protein-1, monocyte chemoattractant protein 2, monocyte chemoattractant protein-3, monocytic inflammation inflammatory protein-1α, monocyte inflammatory protein-1β, RANTES, I309, R83915, R91733, HCC1, T58847, D31065, T64262, CD40, CD40 ligand, C-kit ligand, collagen, colony stimulating factor, complement factor 5a, complement inhibitor, complement receptor 1, cytokine, epithelial neutrophil activation peptide-78, MIP-16, MIP-1, epidermal growth factor, epithelial neutrophil activation peptide, erythropoietin, exfoliating toxin, factor IX, factor VII, factor VIII, factor X, fibroblasts Cell growth factor, fibrinogen, fibronectin, four-helix bundle protein, G-CSF, glp-1, GM-CSF, glucocerebrosidase, gonadotropin, growth factor, growth factor receptor, hedgehog protein, hemoglobin, hepatocyte growth factor, hirudin, human growth hormone, human serum albumin, ICAM-1, ICAM-1 receptor, LFA-1, LFA-1 receptor, insulin, insulin-like growth factor, IGFI, IGF-II, interferon, IFN-α, IFN-β, IFN-γ, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor, lactoferrin, leukemia inhibitory factor, luciferase, nerve growth factor, neutrophil inhibitory factor, oncostatin M, osteogenic protein, oncogene products, paracitonin, parathyroid hormone, PD-ECSF, PDGF, peptide hormones, pleiotrophin, protein A, protein G, pth, pyrogenic exotoxin A, pyrogenic exotoxin B and pyrogenic exotoxin C, pyy, relaxin, renin, SCF, small biosynthetic protein, soluble complement receptor I, soluble I-CAM1. At least one of soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, growth hormone, streptokinase, superantigen, staphylococcal enterotoxin, SEA, SEB, SECT, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase, toxic shock syndrome toxin, thymosin α1, tissue plasminogen activator, tumor growth factor, tumor necrosis factor, tumor necrosis factor α, tumor necrosis factor β, tumor necrosis factor receptor, VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor, urokinase, mos, ras, raf, met, p53, tat, fos, myc, jun, myb, rel, estrogen receptor, progesterone receptor, testosterone receptor, aldosterone receptor, LDL receptor, and corticosterone.

[0059] In some embodiments, the wild-type antibody comprises at least one of a whole antibody, scFv, Fab, Fab', F(ab')2, scFv-Fc, Triabody, Diabody, Minibody, Nanobody, DARPins or affibody.

[0060] The present invention also provides a recombinant protein conjugate, which is a recombinant protein of the present invention coupled to an effector molecule. In the present invention, the effector molecule is selected from at least two of a marker, polyethylene glycol, a small molecule chemical drug, a polypeptide, a protein, an enzyme, and a nucleic acid; the present invention does not specifically limit the specific types of effector molecules, and any common or commonly used type in the art can be used. Among them, the marker includes but is not limited to a fluorescent group and / or a nuclide. The preparation and structural diagram of the recombinant protein conjugate are shown in FIG. Fig. 20 In some specific embodiments, the effector molecule is a combination of a nuclide and a fluorescent group (such as a near-infrared fluorescent molecule), a combination of PEG and a fluorescent group (such as a near-infrared fluorescent molecule), a combination of PEG and a toxin small molecule, or a combination of PEG and an antibody fragment drug (such as ADC).

[0061] The present invention also provides the use of the recombinant protein or the recombinant protein conjugate in cell imaging and / or disease diagnosis imaging.

[0062] The present invention also provides the use of the recombinant protein or the recombinant protein conjugate in preparing a drug for treating tumors and / or preventing tumor recurrence, or in preparing a tumor detection reagent.

[0063] The present invention also provides a composition, comprising the recombinant protein or the recombinant protein conjugate.

[0064] When the composition is a medicine, it also includes pharmaceutically acceptable excipients.

[0065] The above pharmaceutically acceptable excipients are common in the art and are not particularly limited in the present invention.

[0066] The bi / multifunctional non-natural amino acids provided by the present invention can be efficiently and site-specifically introduced into any site of a protein, and site-specific coupling of the protein with effector molecules including fluorescence, nuclides, drugs, polyethylene glycol (PEG), and nucleic acids can be achieved through a rapid, efficient, and mild reaction, producing site-specifically modified bi / multi-conjugates with uniform quality, which have the potential advantages of low cost, low immunogenicity, and simple production. Specifically:

[0067] 1) The non-natural amino acid was site-specifically introduced into the antibody fragment J591Fab targeting the prostate cancer PSMA antigen, and a single conjugate thereof with a near-infrared fluorescent molecule and a double conjugate of PEG and a near-infrared fluorescent molecule were obtained. The protein imaging effect clearly showed that the PEG-conjugated modification group was significantly better than the unconjugated PEG-conjugated group. The drug half-life was appropriately prolonged by conjugating PEG, thereby improving the signal-to-noise ratio. The overall conjugation has the advantage of low cost;

[0068] 2) The non-natural amino acid and the nuclide (TCO-NOTA-Cu 64 ) and near-infrared molecules (DBCO-Cy5) were simultaneously coupled to the antibody fragment J591Fab targeting the PSMA antigen of prostate cancer, and then injected into mice inoculated with prostate cancer. The lesions were detected by radionuclide imaging, and then, with the assistance of near-infrared light (NIRF) imaging, the tumor boundaries were delineated to achieve precise resection of prostate cancer, ultimately realizing the goal of integrated tumor diagnosis and treatment.

[0069] 3) The non-natural amino acid is introduced into the antibody fragment (scFv / Fab) to achieve the site-specific coupling of the antibody fragment with small molecule drugs and PEG, and produce FPDC with site-specific modification and uniform quality. The conjugate has the potential advantages of low cost, low immunogenicity, and high tumor permeability. After coupling with PEG, it does not affect cell endocytosis and killing effects, and it has been verified at the animal level that the antibody fragment molecule coupled with PEG has a stronger killing effect, which has a very high development prospect in the clinic. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 The pUltra-p-TetN3FRS / tRNA plasmid map is shown;

[0071] Figure 2 The pET22b-sfGFP-Y151TAG plasmid map is shown;

[0072] Figure 3 This is the SDS gel electrophoresis diagram of p-TetN3F inserted into sfGFP;

[0073] Figure 4 Protein profile of p-TetN3F inserted into sfGFP;

[0074] Figure 5 Schematic diagram of the effect of the reaction of the azide group on the reaction rate of tetrazine

[0075] Figure 6 is the rate of tetrazine before and after the azide reaction;

[0076] Figure 7 It is a tetrazine rate test curve diagram;

[0077] Figure 8 The SDS gel electrophoresis diagram of the wild type and p-TetN3F inserted into J591-Fab;

[0078] Fig. 9 To verify the targeting properties of J591 and its mutant J591-Fab-121-p-TetN3F by flow cytometry;

[0079] Fig.10 : Schematic diagram of the structure of the J591-Fab-A121-p-TetN3F antibody site-directed dual-modification of fluorescence and nuclide;

[0080] Fig.11 :(A) Microscopic PET imaging of 22Rv1 tumor; (B) 64 Biodistribution of Cu-labeled J591-Fab-A121-Cy5-NOTA 12 hours after injection. PC3 group N=3, 22Rv1 group N=4; *p<0.01. Unpaired two-tailed t-test; data are shown as mean ± SD (C) Fluorescence imaging-guided tumor dissection. (D) Immunofluorescence staining of 22Rv1 tumor tissue slices. Tumor tissue was stained with PSMA antibody, shown in green, cell nuclei were stained with DAPI, shown in blue, and J591-Fab-A121-Cy5-NOTA was shown in red;

[0081] Fig.12 : Schematic diagram of the structure of J591-Fab-A121-p-TetN3F antibody site-directed dual modification with fluorescence and PEG;

[0082] Fig.13 : J591Fab-Cy5 was isolated using the AKTA protein purification system;

[0083] Fig.14 : The PEG20K-modified J591Fab-Cy5 protein was isolated using the AKTA protein purification system;

[0084] Fig.15:(A) Fluorescence imaging of 22Rv1 tumors; 0.6 nmol J591-Fab-A121-Cy5 and J591-Fab-A121-Cy5-PEG20K were injected intravenously, respectively; images were collected at 2h, 4h, 6h, 10h, 24h and 36h after injection; the white dotted circle indicates the location of the tumor; (B) Quantification of fluorescence intensity of 22Rv1 tumors in group a; 3 mice in each group. (C) Tumor-to-background ratio (TBR) of 22Rv1 tumor-bearing mice in group a; the ipsilateral auricle was outlined as background at the same time; 3 mice in each group; *p<0.01. Unpaired two-tailed t test Data in B and C are expressed as mean ± sd;

[0085] Fig.16 :pUltra-m-TetN3FRS / tRNA plasmid map;

[0086] Fig.17 :Schematic diagram of m-TetN3F inserted into green fluorescent protein and SDS gel electrophoresis;

[0087] Fig.18 : pCMV-MfPylRS-m-TetN3FRS / tRNA plasmid map;

[0088] Fig.19 :Insertion verification of m-TetN3F in eukaryotic system;

[0089] Fig. 20 : The invention discloses the preparation of bi / multifunctional non-natural amino acid encoded proteins and mediated protein conjugates. DETAILED DESCRIPTION

[0090] The present invention provides a non-natural amino acid with dual / multiple functions and its recombinant protein and application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0091] The bi / multifunctional non-natural amino acids provided by the present invention can be efficiently and point-specifically introduced into any site of the protein, and the protein (including antibodies or antibody fragments, such as) and the effector molecule package can be site-specifically coupled through a fast, efficient, and mild reaction to produce a site-specific modified bi / multi-conjugate with uniform quality, wherein the effector molecule is selected from at least two of a marker, polyethylene glycol, a small molecule chemical drug, a polypeptide, a protein, an enzyme, and a nucleic acid; the present invention does not specifically limit the specific types of effector molecules, and the common or commonly used types in the art can be used. Among them, the marker includes but is not limited to a fluorescent group and / or a nuclide. Specifically, the effector molecule is a combination of a nuclide and a fluorescent group (such as a near-infrared fluorescent molecule), a combination of PEG and a fluorescent group (such as a near-infrared fluorescent molecule), a combination of PEG and a toxin small molecule, or a combination of PEG and an antibody fragment drug (such as ADC), and the antibody fragment J591-Fab against the prostate cancer-specific membrane antigen PSMA and the antibody fragment scFv against HER2 are used as examples for illustration:

[0092] (1) Antibody-conjugated fragments of radionuclides and near-infrared fluorescent molecules ( Fig.10 (shown)

[0093] Early and accurate diagnosis and treatment of cancer have always been a hot and difficult issue in medical research. Early and accurate diagnosis, staging and classification are of great significance for the choice of cancer treatment methods. Finding highly sensitive and highly specific imaging diagnostic methods is crucial to solving clinical problems. It is also the key to basic scientific research to assist in solving major clinical needs and transforming products and technologies. For early prostate cancer, surgery is still the most effective treatment method. Accurate removal of diseased tissue during surgery is particularly critical and directly affects the patient's prognosis. Specific marking and identification technology for diseased tissue during surgery can achieve effective surgical assistance and navigation. Aiming at assisting clinical medicine, combined with superior antibody engineering technology, a novel bio-orthogonal reaction-mediated antibody site-specific dual labeling technology based on tetrazine and azide was developed. With prostate cancer as the research target, the antibody fragment J591-Fab targeting the prostate cancer-specific membrane antigen PSMA was analyzed. The Fab part was selected for antibody engineering. The modification design was carried out at 2-4 sites away from the antigen binding site (A121, K169 and S202). The conditions were optimized, and the tetrazine and azide bifunctional unnatural amino acid p-TetN3F was efficiently introduced into the antibody fragment by using the aminoacyl tRNA synthetase / tRNA pair that is orthogonal to the host cell. Then, the nuclide (TCO-NOTA-Cu) was introduced into the antibody fragment in vitro. 64) and near-infrared molecules (DBCO-Cy5) were simultaneously coupled to antibodies and then injected into mice inoculated with prostate cancer. The lesions were detected through radionuclide imaging, and then, with the assistance of near-infrared light (NIRF) imaging, the tumor boundaries were delineated to achieve precise resection of the prostate cancer, ultimately achieving the goal of integrated tumor diagnosis and treatment.

[0094] (2) PEG and near-infrared fluorescent molecule antibody conjugated fragment ( Fig.12 shown);

[0095] Although the above experiment can achieve dual-modal imaging of tumors, the signal-to-noise ratio is relatively weak compared to the whole antibody. Considering that the molecular size filtered by the kidney is about 60kd, the smaller molecular weight of the antibody fragment will also lead to the problem of too short half-life in vivo, so that the antibody fragment molecules are quickly cleared by the kidneys, and the circulation time in the blood is shortened, further affecting its enrichment effect at the tumor site. Additional site-specific coupling of PEG on proteins is a common method to achieve a long half-life of Fab. To address the above problems, we also use the bifunctional non-natural amino acid p-TetN3F containing tetrazine functional groups and azide functional groups. We obtained site-modified J591Fab-Cy5 and site-coupled PEG-modified J591Fab-Cy5 proteins, respectively, and proved that the imaging effect of PEG-coupled J591Fab-Cy5 protein was better than that of uncoupled PEG-modified J591Fab-Cy5 protein. It is speculated that by coupling PEG, the half-life of J591-Fab was increased, thereby increasing the enrichment in tumors, and then developing an economical, long half-life, and high signal-to-noise ratio antibody fragment Fab small animal imaging system, which reflects the advantages of bifunctional amino acids in the field of pharmaceutical proteins and the potential for producing homogeneous dual-modified therapeutic proteins.

[0096] (3) PEG-drug antibody conjugated fragments

[0097]

[0098] Referring to the above-mentioned advantages of adding PEG to achieve high tumor enrichment, we verified whether the antibody fragment drug with added PEG has a stronger killing effect. We chose a breast cancer model, in which human epidermal growth factor receptor 2 (HER2) is lowly expressed in normal tissues and highly expressed in breast cancer, making it an effective target in tumor treatment. Nowadays, antibody-drug conjugates (ADCs) are a class of therapeutic drugs that combine antigen-specific antibodies with effective cytotoxic payloads. Compared with traditional small molecule chemotherapy drugs, ADCs have better targeting to tumor tissues and less toxic side effects to normal tissues, so the therapeutic window is wider and safer and more effective. Currently, many drugs have been launched and are in clinical research, but traditional ADC drugs still have some disadvantages. For example, due to the large molecular weight (about 150kDa) of monoclonal antibodies, they are metabolized slowly, have a long retention time in the blood, and have a high risk of off-target toxin drugs; and the permeability to solid tumors is not high, so the efficacy will also be limited; at the same time, antibodies generally adopt a random drug conjugation strategy, with an average DAR of 5-8. Drug molecules with strong hydrophobicity may cause antibody aggregation. At the same time, due to the inability to modify the site, the uniformity of the prepared ADC drugs cannot be guaranteed, and there are huge challenges in quality control. Therefore, we upgraded the existing ADC drugs through bifunctional non-natural amino acids, introduced bifunctional non-natural amino acids p-TetN3F at specific sites of antibody fragments, and achieved site-specific conjugation of antibody fragments (scFv / Fab) with small molecule drugs and PEG through rapid, efficient, and mild reaction conditions, and produced site-specific modified and uniform quality antibody fragment polyethylene glycol drug conjugates (AFPDC), which have the potential advantages of low cost, low immunogenicity, and high tumor permeability. The PEG-coupled product does not affect cell endocytosis and killing effects, and it has been verified at the animal level that the PEG-coupled antibody fragment molecules have a stronger killing effect. If this effect is better than the existing ADC molecules on the market, it will have huge commercial development potential. At the same time, this product also has certain development prospects in clinical practice.

[0099] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0100] The present invention will be further described below in conjunction with embodiments:

[0101] Example 1 Synthesis of tetrazine and azide-containing amino acid p-TetN3F

[0102]

[0103] (1) Synthesis of 4-azidobutanenitrile (2)

[0104] Weigh 4-bromobutyronitrile (10 g, 68.0 mmol) and dissolve it in 150 mL DMF. Add NaN3 (5.71 g, 87.8 mmol) at room temperature and react at 80 °C for 12 h. After the reaction, add water and ether to extract three times, 150 mL each time. Wash three times with saturated brine and dry with anhydrous sodium sulfate. Filter, spin dry the filtrate, wash three times with petroleum ether, and characterize the synthetic product according to the literature (J.Med.Chem.2010,53,2,616–623).

[0105] Reagents: 4-Bromobutyronitrile was purchased from Bidex Pharmaceuticals, product number: BD95224. DMF, ether, petroleum ether, anhydrous sodium sulfate and sodium chloride were purchased from Beijing Tongguang Fine Chemicals Company.

[0106] (2) Synthesis of p-TetN3F-Boc

[0107] Place tert-butyloxycarbonyl-p-cyano-L-phenylalanine (3) (1 g, 3.5 mmol) in a 100 mL flask, add 4-azidobutyronitrile (3 g, 27.3 mmol) and 3-mercaptopropionic acid (0.36 g, 3.4 mmol), and cool to 0°C in an ice bath. Add hydrazine monohydrate (2.72 g, 54.4 mmol) dropwise, then protect with argon, and react at 40°C overnight. Cool the reaction solution to 0°C, add an excess of sodium nitrite solution and stir, slowly add 2 mol / L dilute hydrochloric acid, and adjust the pH to 3-4. Extract three times with ethyl acetate and dry over anhydrous sodium sulfate overnight. Filter, spin dry, and separate by silica gel column chromatography (DCM: MeOH = 80: 1) to obtain (4). The characterization of the synthetic product is shown in the next characterization.

[0108] Reagents: tert-Butyloxycarbonyl-p-cyano-L-phenylalanine was purchased from Bidex Pharmaceuticals, product number: BD16025. 3-Mercaptopropionic acid was purchased from Bidex Pharmaceuticals, product number: BD41154. Hydrazine hydrate was purchased from Aladdin, product number: H104517. Sodium nitrite was purchased from Beijing Tongguang Fine Chemicals Co., Ltd., product number: 106007. Hydrochloric acid, ethyl acetate, dichloromethane, methanol and silica gel were purchased from Beijing Tongguang Fine Chemicals Co., Ltd.

[0109] (3) Deprotection

[0110] The product from the previous step was dissolved in a TFA / DCM = 1:1 (v / v) mixture, stirred at room temperature for 4 h, and the solvent was dried under vacuum. Add 50 mL of ether and stir overnight, then filter to obtain a purple solid p-TetN3F, H NMR (400 MHz, CD3OD) δ10.30 (1H, s), 8.53 (2H, m), 7.62-7.64 (2H, m), 3.53 (2H, m), 3.45 (3H, m), 2.70 (2H, m), 2.26 (2H, m). 13C NMR (175 MHz, CD3OD) δ173.89, 169.54, 164.02, 133.26, 132.83, 129.69, 128.48, 126.86.9, 50.40, 39.03, 33.34, 32.91, 31.56, 26.69. ESI-MS calculated for C 14 H 18 N7O2([M+H]+)329.1,found 329.1

[0111] Example 2: Synthesis, insertion and characterization of tetrazine and azide-containing amino acid m-TetN3F

[0112]

[0113] (1) Synthesis of 4-azidobutanenitrile (2)

[0114] Weigh 4-bromobutyronitrile (10 g, 68.0 mmol) and dissolve it in 150 mL DMF. Add NaN3 (5.71 g, 87.8 mmol) at room temperature and react at 80 °C for 12 h. After the reaction, add water and ether to extract three times, 150 mL each time. Wash three times with saturated brine and dry with anhydrous sodium sulfate. Filter, spin dry the filtrate, wash three times with petroleum ether, and characterize the synthetic product according to the literature (J.Med.Chem.2010,53,2,616–623).

[0115] Reagents: 4-Bromobutyronitrile was purchased from Bidex Pharmaceuticals, product number: BD95224. DMF, ether, petroleum ether, anhydrous sodium sulfate and sodium chloride were purchased from Beijing Tongguang Fine Chemicals Company.

[0116] (2) Synthesis of m-TetN3F-Boc

[0117] (S)-2-((tert-butyloxycarbonyl)amino)-3-(3-cyanophenyl)propionic acid (5) (1 g, 3.5 mmol) was placed in a 100 mL flask, 4-azidobutyronitrile (3 g, 27.3 mmol) and 3-mercaptopropionic acid (0.36 g, 3.4 mmol) were added, and the mixture was cooled to 0°C in an ice bath. Hydrazine hydrate (2.72 g, 54.4 mmol) was added dropwise, and then argon was protected and the mixture was reacted at 40°C overnight. The reaction solution was cooled to 0°C, an excess of sodium nitrite solution was added and stirred, and 2 mol / L dilute hydrochloric acid was slowly added to adjust the pH to 3-4. The mixture was extracted three times with ethyl acetate and dried over anhydrous sodium sulfate overnight. The mixture was filtered, dried by spin drying, and separated by silica gel column chromatography (DCM:MeOH=80:1) to obtain (6).

[0118] Reagents: (S)-2-((tert-butyloxycarbonyl)amino)-3-(3-cyanophenyl)propionic acid was purchased from Bidex Pharmaceuticals, product number: BD16024. 3-Mercaptopropionic acid was purchased from Bidex Pharmaceuticals, product number: BD41154. Hydrazine hydrate was purchased from Aladdin, product number: H104517. Sodium nitrite was purchased from Beijing Tongguang Fine Chemicals Co., Ltd., product number: 106007. Hydrochloric acid, ethyl acetate, dichloromethane, methanol and silica gel were purchased from Beijing Tongguang Fine Chemicals Co., Ltd.

[0119] (3) Deprotection

[0120] The product from the previous step was dissolved in a TFA / DCM = 1:1 (v / v) mixture, stirred at room temperature for 4 h, and the solvent was dried under vacuum. 50 mL of ether was added, stirred overnight, and filtered to obtain a purple-red solid m-TetN3F.

[0121] Construction of aminoacyl-tRNA synthetase (RS / tRNA) that inserts p-TetN3F and m-TetN3F into green fluorescent protein

[0122] Based on Tet2.0RS (J.Am.Chem.Soc.2015,137,10044-10047), we made the following mutations: 65S, 158G, 162G; the constructed mutant successfully inserted p-TetN3F into sfGFP and was named p-TetN3FRS; at the same time, referring to the latest work of RyanA.Mehl's group (J.Am.Chem.Soc.2020,142,7245-7249), referring to the Tet-v3.0-RS / tRNA inserted into Tet-v3.0Bu, we successfully inserted m-TetN3F into sfGFP. The purified protein was characterized by SDS gel electrophoresis and protein spectrum.

[0123] The method for preparing a recombinant protein with site-specific insertion of a bifunctional amino acid p-TetN3F comprises the following steps:

[0124] Example 3: Preparation of helper plasmid pUltra-tet2.0RS / tRNA

[0125] According to the reference: J.Am.Chem.Soc.2015,137,10044-10047, the gene of Tet2.0RS, the aminoacyl tRNA synthetase of Tet2.0, was designed and synthesized by the company. The CNF fragment in the pUltra-CNF expression vector was replaced by the Tet2.0RS gene to obtain the plasmid pUltra-tet2.0RS / tRNA. Then, the Q at position 65 of Tet2.0RS was mutated to S, the S at position 158 was mutated to G, and the N at position 162 was mutated to G by quikchange site-directed mutagenesis, thereby obtaining the auxiliary plasmid pUltra-p-TetN3FRS / tRNA.

[0126] The specific process is:

[0127] 1: Use Tet2.0 RS-F and Tet2.0 RS-R primers to PCR amplify the Tet2.0 RS gene fragment from the plasmid carrying the Tet2.0 RS gene, wherein the sequence of the Tet2.0 RS-F primer is: atggacgaatttgaaatgataaaga, and the sequence of the p-TetN3FRS-R primer is: ttataatctctttctaattggctctaaaatc.

[0128] The PCR reaction system is shown in Table 1.

[0129] Table 1

[0130] <![CDATA[ddH2O]]> 20μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL Tet2.0RS-F (10 μM) 2μL Tet2.0RS-R (10μM) 2μL Plasmid containing Tet2.0RS gene (50ng / μL) 1μL Total volume 50μL

[0131] The PCR reaction conditions were: 98°C for 10 s, 54°C for 5 s, 68°C for 20 s, 30 cycles, and stored at 4°C. The PCR product was electrophoresed, purified, and recovered to obtain the Tet2.0 RS gene fragment.

[0132] 2: Then the pUltra-CNF vector was linearized by PCR and cloned by Gibson assembly to obtain the pUltra-Tet2.0RS / tRNA plasmid.

[0133] The specific method for PCR linearization of the pUltra-CNF vector is as follows: pUltra-F and pUltra-R primers are used to amplify the pUltra-CNF vector as a template. The PCR reaction system for linearization of the pUltra-CNF vector is shown in Table 2.

[0134] Among them, the sequence of the pUltra-F primer is: caattagaaagagattataagcggccgcgtttaaacgg; the sequence of the pUltra-R primer is: atcatttcaaattcgtccatgcggccgcacctcctttgtg.

[0135] PCR reaction system for linearization of pUltra-CNF vector:

[0136] Table 2

[0137] <![CDATA[ddH2O]]> 20μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL pUltra-F (10 μM) 2μL pUltra-R (10 μM) 2μL pUltra-CNF plasmid (50ng / μL) 1μL Total volume 50μL

[0138] The PCR reaction conditions were as follows: 98°C for 10 s, 54°C for 5 s, and 68°C for 60 s for 30 cycles; the mixture was stored at 4°C. The PCR product was subjected to electrophoresis, purification, and recovery to obtain linearized pUltra-CNF.

[0139] The Gibson reaction system is: Tet2.0RS gene fragment (20 ng / μL): 1.5 μL, linearized pUltra-CNF (50 ng / μL): 1 μL, Gibson reaction solution: 2.5 μL, and the total system is 5 μL.

[0140] The Gibson reaction conditions were: 50°C for 1 hour.

[0141] The Gibson reaction solution was used to transform Escherichia coli DH10B, which was spread on an LB plate containing 50 μg / ml spectinomycin. The next day, a single colony was picked and placed in 5 mL 2YT liquid culture medium. 50 μg / ml spectinomycin was added to the culture medium and cultured at 37°C and 220 rpm in a shaking incubator for 12 hours. The plasmid was extracted (according to the instructions of the kit). The plasmid was confirmed to be pUltra-Tet2.0RS plasmid by sequencing.

[0142] Example 4: Preparation of pUltra-p-TetN3FRS / tRNA plasmid

[0143] Then, the Q at position 65 of Tet2.0RS was mutated to S, the S at position 158 was mutated to G, and the N at position 162 was mutated to G by quikchange site-directed mutagenesis, thereby obtaining the auxiliary plasmid pUltra-p-TetN3FRS / tRNA (see Figure 1 ).

[0144] The steps of quikchange site-directed mutagenesis are as follows: PCR amplification is performed using 65S-F, 65S-R primers, 158G162G-F, 158G162G-R with pUltra-Tet2.0RS plasmid as template, the PCR product is digested with DpnI endonuclease, the digested product is transformed into Escherichia coli, a single clone is picked to extract the plasmid, and sequencing is performed to verify the pUltra-p-TetN3FRS / tRNA plasmid.

[0145] Among them, the sequence of the 65S-F primer is:

[0146] gattgatttacaaaatgctggatttgatataattatagcattggctgatttacacgcctatttaaacc;

[0147] The sequence of the 65S-R primer is:

[0148] ggtttaaataggcgtgtaaatcagccaatgctataattatatcaaatccagcattttgtaaatcaatc;

[0149] The sequence of the 158G162G-F primer is:

[0150] gctgaagttatctatccaataatgcaggttaatggaattcattatggaggcgttgatgttgcagttgg;

[0151] The sequence of the 158G162G-R primer is:

[0152] ccaactgcaacatcaacgcctccataatgaattccattaacctgcattattggatagataacttcagc.

[0153] The PCR reaction system is shown in Table 3.

[0154] Table 3 PCR reaction system

[0155] <![CDATA[ddH2O]]> 16μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL 65S-F(10μM) 2μL 65S-R(10μM) 2μL 158G162G-F(10μM) 2μL 158G162G-R(10μM) 2μL pUltra-Tet2.0RS plasmid (50 ng / μL) 1μL Total volume 50μL

[0156] The PCR reaction conditions were: 98°C for 10 s, 54°C for 5 s, 68°C for 80 s, for 15 cycles; and stored at 4°C.

[0157] The DpnI endonuclease digestion reaction system is: 50 μL PCR reaction solution, 1 μL DpnI endonuclease.

[0158] The conditions for the DpnI endonuclease digestion reaction were: 37°C for 2 hours.

[0159] The steps of E. coli transformation are as follows: add 5 μL DpnI digestion product to E. coli DH10B competent cells, ice bath for 30 minutes, heat shock at 42°C for 45 seconds, ice bath for 3 minutes, add 2YT medium and incubate at 37°C for 1 hour, plate, pick single clones, extract plasmids, and sequence verification.

[0160] like Figure 1 Shown is the plasmid map of the pUltra-p-TetN3FRS / tRNA plasmid, which has spectinomycin resistance. Sequencing confirmed that the pUltra-p-TetN3FRS / tRNA plasmid differs from the pUltra-Tet2.0RS plasmid only at sites 65, 158 and 162 (65CAG mutated to GCA, 158AGT mutated to GGA, and 162AAT mutated to GGA).

[0161] Example 5: Preparation of plasmid containing Y151TAG mutant sfGFP - pET22b-sfGFP-Y151TAG

[0162] The plasmid with sfGFP gene was obtained by gene synthesis, the pET22b vector was linearized by PCR, and the sfGFP gene was cloned into the pET22b vector by Gibson assembly to obtain the pET22b-sfGFP plasmid. The Y at position 151 of sfGFP was mutated to TAG by quikchange site-directed mutagenesis to obtain the pET22b-sfGFP-Y151TAG plasmid (see Figure 2 ).

[0163] The specific process is: use sfGFP-F and sfGFP-R primers to amplify the sfGFP gene fragment from the plasmid carrying the sfGFP gene, where the sequence of the sfGFP-F primer is: CACACAGAATTCATTAAAGAGGAGAAATTACATATGAGCAAAGGAGAAGA ACTTTTCACT; the sequence of the sfGFP-R primer is: GTCCAAGCTCAGCTAATTAAGCTTTTA GTGGTGGTGGT GGTGGTG GGATC, the underlined part is 6xHis tag. The PCR reaction system for amplifying the sfGFP gene fragment is shown in Table 4.

[0164] Table 4 PCR reaction system for amplifying sfGFP gene fragment

[0165] <![CDATA[ddH2O]]> 20μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL sfGFP-F (10 μM) 2μL sfGFP-R (10 μM) 2μL sfGFP gene synthesis plasmid (50ng / μL) 1μL Total volume 50μL

[0166] The PCR reaction conditions were as follows: 98°C for 10 s, 54°C for 5 s, and 68°C for 15 s for 30 cycles; the reaction was stored at 4°C. The PCR product was purified by electrophoresis and the sfGFP gene fragment was recovered.

[0167] The pET22b plasmid was linearized by PCR. The specific process was: using pET22b-sfGFP-F and pET22b-sfGFP-R primers, amplifying with the pET22b plasmid as a template. The pET22b plasmid PCR reaction system is shown in Table 5.

[0168] Among them, the primer sequence of pET22b-sfGFP-F is: AAGCTTAATTAGCTGAGCTTGGAC; the primer sequence of pET22b-sfGFP-R is: ATGTAATTTCTCCTCTTTAATGAATTCTGTGTG.

[0169] Table 5 pET22b plasmid PCR reaction system

[0170]

[0171]

[0172] The PCR reaction conditions were: 98°C for 10 s, 54°C for 5 s, 68°C for 60 s, 30 cycles, and stored at 4°C. The PCR product was electrophoresed, purified, and recovered to obtain the linearized pET22b plasmid.

[0173] The Gibson reaction system was: sfGFP gene fragment (20 ng / μL): 1.5 μL, linearized pET22b plasmid (50 ng / μL): 1 μL, Gibson reaction solution: 2.5 μL, and the total system was 5 μL.

[0174] The Gibson reaction conditions were: 50°C for 1 hour.

[0175] The Gibson reaction solution was used to transform Escherichia coli DH10B, which was then spread on an LB plate containing 50 μg / ml ampicillin. The next day, a single colony was picked and placed in 5 mL 2YT liquid culture medium. Ampicillin at a concentration of 50 μg / ml was added to the culture medium, and the culture was placed at 37°C and shaken at 220 rpm for 12 hours. The plasmid was extracted (according to the instructions of the kit). The plasmid was confirmed to be pET22b-sfGFP plasmid by sequencing.

[0176] The steps of quikchange site-directed mutagenesis are as follows: PCR amplification is performed using primers sfGFP-151-F and sfGFP-151-R, with pET22b-sfGFP plasmid as template; the PCR product is digested with DpnI endonuclease, the digested product is transformed into Escherichia coli, a single clone is picked to extract the plasmid, and sequencing is performed to verify the pET22b-sfGFP-Y151TAG plasmid.

[0177] Among them, the sequence of the sfGFP-151-F primer is:

[0178] TTTAACTCACACAATGTA TAG ATCACGGCAGACAAACAAAAGAATG;

[0179] The sequence of the sfGFP-151-R primer is:

[0180] GTTTGTCTGCCGTGATCTATACATTGTGTGAGTTAAAGTTGTACTCGA G; the PCR reaction system is shown in Table 9.

[0181] The underlined part is the mutation site, which mutates the codon TAC encoding tyrosine (Y) into the stop codon TAG.

[0182] Table 6 PCR reaction system

[0183]

[0184]

[0185] The PCR reaction conditions were: 98°C for 10 s, 54°C for 5 s, 68°C for 80 s, for 15 cycles; and stored at 4°C.

[0186] The DpnI endonuclease digestion reaction system is: 50 μL PCR reaction solution, 1 μL DpnI endonuclease.

[0187] The conditions for the DpnI endonuclease digestion reaction were: 37°C for 2 hours.

[0188] The steps of E. coli transformation are as follows: add 5 μL DpnI digestion product to E. coli DH10B competent cells, ice bath for 30 minutes, heat shock at 42°C for 45 seconds, ice bath for 3 minutes, add 2YT medium and incubate at 37°C for 1 hour, plate, pick single clones, extract plasmids, and sequence verification.

[0189] like Figure 2Shown is the plasmid map of the pET22b-sfGFP-Y151TAG plasmid, which has ampicillin resistance. Sequencing confirmed that the pET22b-sfGFP-Y151TAG plasmid differs from the pET22b-sfGFP plasmid only at the Y151TAG site (TAC mutated to TAG).

[0190] Example 6: Preparation of site-directed mutagenesis sfGFP expression strain

[0191] The auxiliary plasmid pUltra-p-TetN3FRS / tRNA plasmid (spectinomycin resistance) prepared in Example 4 and the expression plasmid pET22b-sfGFP-Y151TAG (ampicillin resistance) obtained in Example 5 were co-transformed into Escherichia coli BL21 (DE3) strain, and the positive strains transformed with both plasmids were screened by double resistance plates (spectinomycin and ampicillin resistance) and named as expression strain BL21-pET22b-sfGFP-Y151TAG-pUltra-p-TetN3FRS / tRNA.

[0192] Example 7: Site-directed insertion of unnatural amino acids sfGFP-p-TetN3F expression, purification and mass spectrometry verification

[0193] A single colony of the BL21-pET22b-sfGFP-Y151TAG-pUltra-p-TetN3FRS / tRNA in Example 6 was picked and cultured overnight in 5 mL of 2YT medium containing spectinomycin and ampicillin. The next day, it was transferred to fresh 50 mL of 2YT medium containing spectinomycin and ampicillin at a volume ratio of 1:100. When the culture reached the early exponential growth stage, 1 mM p-TetN3F was added to the medium. IPTG was added for induction when the OD was about 0.6-0.8, and the bacteria were collected after expression at 37°C for 8-10 hours.

[0194] The above-collected expression bacteria were resuspended in PBS and ultrasonically disrupted at 0-4°C for 1-2 min. The disrupted product was centrifuged at high speed (12000 rpm, 30 minutes at 4°C), and the supernatant was aspirated. The supernatant sample was incubated with the Ni affinity column at 4°C for 30 minutes, and then washed with 25mM imidazole for 5-10 column volumes, 40mM imidazole for 3 column volumes, 250mM imidazole for elution and concentration, and the purity and approximate molecular weight of the purified protein were determined by SDS-PAGE protein electrophoresis after concentration.

[0195] The purified green fluorescent protein containing the unnatural amino acid was used to verify the site-specific insertion of the unnatural amino acid by mass spectrometry (Electrospray Ionization Mass Spectroscopy), and then the insertion of the unnatural amino acid was confirmed by protein spectrum. Figure 3 to Figure 4 The SDS gel electrophoresis analysis and mass spectrometry characterization of the non-natural amino acids inserted into sfGFP are shown in turn. The mass spectrometry results show that the non-natural amino acids are indeed inserted into the sfGFP protein. The Escherichia coli engineered strain prepared by the method provided by the present invention can indeed express green fluorescent protein with non-natural amino acids.

[0196] Example 8: Determination of the reaction rate constants of sfGFP-p-TetN3F and sfGFP-p-TetN3F-DBCO-Amine with sTCO

[0197] We took the unnatural amino acid p-TetN3F as an example to determine whether the reaction rate of tetrazine inserted into sfGFP and TCO would be affected by azide or specific molecules after reacting with azide. Tetrazine and azide molecular groups are relatively close. Since the azide group is extended through a flexible fatty chain, the default rate is not greatly affected. Therefore, we verified whether the reaction rate of TCO and tetrazine was affected after the azide molecule reacted with DBCO-amino. sfGFP can emit strong green fluorescence (528nm) under specific excitation light (488nm), and the fluorescence at 528nm will be greatly weakened after the tyrosine at position 151 in sfGFP is replaced by tetrazine amino acid. At the same time, when the tetrazine amino acid at position 151 reacts with sTCO, sfGFP can restore the strong green fluorescence at 528nm. According to this principle, sfGFP and sTCO were mixed in a 1:1 ratio in PBS at 25°C and the corresponding rate constant was calculated by using an enzyme marker to detect the change in the fluorescence intensity at 528nm in the system under the excitation light of 488nm.

[0198] 1. Solution preparation

[0199] The purified sfGFP solution was diluted into a 2 mM PBS solution, and the 20 mM sTCO DMSO solution was diluted into a 2 mM PBS solution. At the same time, DBCO-NH2 was used to react with 1 mM sfGFP mother solution for 24 h and then ultrafiltered and concentrated to prepare a 2 mM sfGFP-DBCO solution in PBS.

[0200] 2. Establishment of fluorescence standard curve

[0201] The sfGFP mother solution was prepared into 200uL PBS solutions of 200nM, 400nM, and 800nM, respectively, and the fluorescence intensity at 528nm was measured under 488nm excitation light, and then 1uL of 20mM sTCO DMSO solution was added to react for one hour, and then the fluorescence value was measured. The determination of sfGFP-DBCO was the same as above.

[0202] 3. Determination of rate constants

[0203] 400nM, 800nM, 1600nM sfGFP solution and sTCO solution were mixed in PBS at a ratio of 1:1 to form a reaction solution with a final concentration of 200nM, 400nM, 800nM and a final volume of 200uL. After mixing for ten seconds, the fluorescence intensity change at 528nm under 488nm excitation light at 25°C was immediately detected using an ELISA instrument. The curve of fluorescence intensity change over time is shown in the figure. Figure 6 shown.

[0204] Through the fluorescence standard curve obtained above, the fluorescence intensity at each moment can be converted into (1 / c-1 / c0) (where c represents the concentration of sfGFP-Tet at a certain moment, and c0 represents the initial concentration of sfGFP-Tet). According to the rate equation of the secondary reaction when the reactant concentration is the same, 1 / c-1 / c0=kt, the slope obtained by plotting 1 / c-1 / c0 against t is the corresponding rate constant. It should be noted that due to human operational errors, the reaction system is not a standard secondary reaction system with the same concentration in the subsequent time, so when taking points for plotting, try to use the points at the beginning of the reaction. The final result is as follows. Figure 7 As shown:

[0205] Finally, the rate constants obtained in different systems at different concentrations are averaged to obtain the final secondary reaction rate constant, see Figure 7 :

[0206] Example 9: Construction of wild-type J591 antibody fragment plasmid - PET22b-J591-Fab and mutant plasmid

[0207] This study uses prostate cancer as a tumor model. Prostate cancer is the most common malignant tumor of the male urogenital system. Early prostate cancer can be cured by surgery if it is accurately staged. Effective adjuvant methods for staging prostate cancer have important clinical value. Prostate-specific membrane antigen (PSMA) was found to be overexpressed in almost all prostate cancer patient samples, while protein expression in normal tissues is limited to the kidneys, salivary glands and central nervous system. Therefore, PSMA can be used to specifically guide signal molecules to achieve molecular imaging of prostate cancer. Monoclonal antibody J591 has high sensitivity and specificity to it (Current radiopharmaceuticals 9, 44-53 (2016)). This study intends to introduce the non-natural amino acid p-TetN3F into its Fab non-antigen binding region using gene codon expansion technology to achieve labeling.

[0208] The variable region (VL and VH) sequence of J591 was obtained from patent WO 2011 / 069019A2, and was combined into the J591 Fab gene based on the Herceptin fragment (CL and CH) sequence. Gene Script performed full synthesis to obtain a pUC vector plasmid containing this sequence.

[0209] The light chain sequence is:

[0210] ATGAAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAACGCGTACGC TGACATCGTGATGACCCAGTCCCCCTCCTCCCTGTCTGCCTCCGTGGGCGACAGAGTGACCATCACATGCAAGGCCTCCCAGGATGTGGGCACCGCCGTGGACTGGTATCAGCAGAAGCCTGGCAAGGCCCCTAAGCTGCTGATCTACTGGGCCTCCACCAGACACACCGGCGTGCCTGACAGATTCACCGGCTCCGGCTCTGGCACCGACTTCACCCTGACCATCTCCAGCCTGCAGCCTGAGGACTTCGCCGACTACTTCTGCCAGCAGTACAACTCCTACCCTCTGACCTTCGGCGGAGGCACCAAGCTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTCGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCTAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGTCCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT(SEQ ID NO:1).

[0211] The heavy chain sequence is:

[0212] ATGAAAAGAATATCGCATTTCTTCTTGCATCTATGTTCGTTTTTTCTATTGCTACAAACGCGTACGC T(SEQ ID NO: 2).

[0213] Since the J591 Fab structure has a disulfide bond and is unstable in the cytoplasm, we added a StII signal peptide with the sequence: KKNIAFLLASMFVFSIATNAYA to the N-terminus of the target protein, which was secreted into the extracellular matrix during expression, and the Fab was folded correctly by specific extracellular chaperones; then, a 6×His affinity tag was added to the C-terminus using molecular cloning technology, which was subsequently used for nickel column purification. We commonly use pET22B as an expression vector in E. coli, T7 promoter, and express in DE3 strain. The specific cloning steps are as follows:

[0214] (a) Design primers J591-FW: gaaaaagaatatcgcatttcttcttgctagcatgttcg and Gib-J591-RV: ggtggtggtgctcgagtgcggccgctgtgtgagttttgtcacaagatttgggctc. Amplify the J591-Fab gene fragment from the J591-Fab plasmid with the StII signal peptide. The PCR product was electrophoresed, purified, and recovered to obtain the J591-Fab gene fragment containing the 6xHis gene tag and the StII signal peptide. The PCR conditions and procedures for the construction of the Herceptin-Fab (StII) fragment are shown in Table 7:

[0215] Table 7

[0216]

[0217] (b) The pET22b plasmid was linearized by PCR. Primers pET22b-Fab-F: gatccggctgctaacaaagc and pET22b-Fab-R: aaaatcacctcaacctctagataccc were designed. PCR amplification was performed using the plasmid pET22b as a template. The PCR product was electrophoresed, purified, and recovered to obtain the vector. The PCR conditions and procedures for the construction of the pET22b vector are shown in Table 8.

[0218] Table 8

[0219]

[0220] (c) The J591-Fab gene fragment was cloned into the pET22b vector by Gibson assembly to obtain the pET22b-J591-Fab plasmid. The PCR conditions and procedures for the construction of the pET22b-J591-Fab plasmid are shown in Table 9.

[0221] Table 9

[0222]

[0223] (d) The Gibson reaction solution was used to transform Escherichia coli DH10B, which was then spread on an LB plate containing 50 μg / ml ampicillin. The next day, a single colony was picked and plated in 5 mL 2YT liquid culture medium. Ampicillin at a concentration of 50 μg / ml was added to the culture medium, and the culture medium was incubated at 37°C and 220 rpm for 12 h. The plasmid was extracted (according to the instructions of the kit). The plasmid was confirmed to be PET22b-J591-Fab plasmid by sequencing.

[0224] Example 10: Construction of mutant J591 antibody fragment plasmids pET22b-J591-Fab-A121TAG, pET22b-J591-Fab-K169TAG and pET22b-J591-Fab-S202TAG

[0225] The obtained PET22b-J591-Fab plasmid was mutated into A121TAG at the A121 site. Primers 121TAG-F: gggcaccacagtgacagtctcgagctgatccaccaagggcccatcggtc. and 121TAG-R: gaccgatgggcccttggtggatcagctcgagactgtcactgtggtgccc (the K169 site can also be mutated into K169TAG. Primers 169TAG-F: gtgtcacagagcaggacagctaggacagcacctacagcctcagc. and 169TAG-R: gctgaggctgtaggtgctgtcctagctgtcctgctctgtgacac were designed; The S202 site was mutated to S202TAG. Primers S202-F: gcgaagtcacccatcagggcctgtcctcgcccgtcacaaagagc and S202-R: gctctttgtgacgggcgaggacaggccctgatgggtgacttcgc were designed to perform PCR amplification using the PET22b-J591-Fab plasmid as a template. The PCR product was digested with DpnI endonuclease at 37°C for 4h, and the digested product was transformed into the DH10B strain: The specific transformation steps were as follows: 5μL DpnI digested product was added to the E. coli DH10B competent cell, ice bathed for 30min, heat shocked at 42°C for 45s, ice bathed for 3min, and 1ml After incubation at 37°C for 1 hour in 2YT medium, the plate was spread on an ampicillin-resistant plate, and a single clone was picked for sequencing the next day to obtain the mutant plasmid pET22b-J591-Fab-A121TAG (pET22b-J591-Fab-K169TAG and pET22b-J591-Fab-S202TAG mutant plasmids were also obtained in this way). The PCR conditions and procedures for the pET22b-J591-Fab-A121TAG mutation are shown in Table 10:

[0226] Table 10

[0227]

[0228]

[0229] Example 11: Preparation of site-directed mutagenesis J591-Fab expression strain

[0230] The auxiliary plasmid pUltra-p-TetN3FRS / tRNA plasmid (spectinomycin resistance) prepared in Example 4 and the expression plasmid pET22b-J591-Fab-A121TAG (ampicillin resistance) obtained in Example 9 were co-transformed into Escherichia coli BL21 (DE3) strain, and the positive strains transformed with both plasmids were screened by double resistance plates (spectinomycin and ampicillin resistance) and named as expression strain BL21-pET22b-J591-Fab-A121TAG-pUltra-p-TetN3FRS / tRNA.

[0231] Example 12: Preparation of J591-Fab containing unnatural amino acid p-TetN3F

[0232] The BL21-pET22b-J591-Fab-A121TAG-pUltra-p-TetN3FRS in Example 10 was

[0233] / tRNA picked a single colony and cultured it overnight in 5mL of 2YT medium containing spectinomycin and ampicillin. The next day, it was transferred to a fresh 50mL 2YT medium containing spectinomycin and ampicillin at a volume ratio of 1:100. When the culture reached the early exponential growth stage, 1mM p-TetN3F was added to the medium. When the OD was about 0.6-0.8, IPTG was added for induction. After 8-10 hours of extracellular expression at 37°C, the bacteria were collected. The above-collected expression bacteria were resuspended in PBS and ultrasonically disrupted at 0-4°C for 1-2min. The broken product was centrifuged at high speed (12000rpm, 4°C for 30 minutes), and the supernatant was aspirated. The supernatant sample was incubated with the Ni affinity column at 4°C for 30 minutes, and then washed with 25mM imidazole for 5-10 column volumes, 40mM imidazole for 3 column volumes, 250mM imidazole for elution and concentration. After concentration, the purity and approximate molecular weight of the purified protein were determined by SDS-PAGE protein electrophoresis. Figure 8 As shown, the mass spectrometry results show that the non-natural amino acid is indeed inserted into the J591-Fab protein. The E. coli engineered strain prepared by the method provided by the present invention can indeed express the J591-Fab protein with non-natural amino acids - J591-Fab-121-p-TetN3F.

[0234] Example 13: Verification that J591-Fab-121-p-TetN3F does not affect receptor binding

[0235] Similarly, in order to verify that the J591-Fab-121-p-TetN3F obtained in Example 11 does not affect the function of the targeted receptor, we used NHS-Fluorescein to randomly modify the fluorescent molecules on the amino groups of the Fab wild type and its mutants, and stained the cells PC3 (low expression) and LNCaP (high expression) with different PSMA expression levels. The flow cytometry analysis results proved that the J591 Fab wild type has PSMA targeting ( Fig. 9 ), and the insertion of unnatural amino acids does not affect this property.

[0236] The specific method is as follows:

[0237] 1) Fab fluorescence labeling: 80 μM NHS-Fluorescein (4 equiv.) and 20 μM Fab (1 equiv.) were mixed in 5 μL 100 mM NaHCO3 and reacted for 4 hours. Fab was labeled with FITC fluorescent molecules. After labeling, desalting was performed using the SpinDesalt Column desalting column. For details, please refer to the instructions.

[0238] 2) PC3, 22rv1 and LNCaP are three types of cells with different levels of PSMA expression. The culture medium required for culture is RPMI-1640, containing 10% FBS, 2mM L-glutamine and 1% dual antibiotics. When the cell density reaches about 90%, the supernatant culture medium is aspirated. Gently add sterile PBS along the wall to moisten the cells and wash twice; then add 0.25% Trypsin-EDTA and digest in a 37°C incubator until the cells become round; add more than 2 times the volume of Trypsin culture medium (containing 10% FBS) to neutralize, use a sterile dropper to blow down the cells at the bottom of the dish, blow them into single cells, and transfer them to a 15mL centrifuge tube; draw 10μl into an EP tube, add an equal volume of trypan blue dye, blow and mix, and count with a cell counter; according to the number of cells counted, draw an appropriate amount of cells and dispense them into sterile EP tubes, about 1.2×10 6Cells. Wash cells: centrifuge at 500g for 5min at 4℃, discard the supernatant medium. Add 200μl PBS to resuspend cells, gently blow to mix, then centrifuge at 500g for about 5min at 4℃, discard PBS, repeat once; Block: resuspend cells in 1mL PBS containing 1% FBS and incubate on ice for about 1h; Wash cells: centrifuge at 500g for 5min at 4℃, wash off the blocking solution. Add 200μl PBS to resuspend cells, gently blow to mix, then centrifuge at 500g for about 5min at 4℃, discard PBS, repeat once; Incubate: dilute Fab to 10μg / mL with PBS, take 200μl to resuspend cells, incubate on ice in the dark for 1h. PBS, wild-type Fab, Fab with unnatural amino acids introduced were incubated with PC3 and LNCaP respectively. Wash cells: centrifuge at 500g for 5min at 4℃, discard supernatant. Add 200 μl PBS to resuspend the cells, gently pipette to mix, centrifuge at 500g, 4℃ for 5 min, discard PBS, repeat twice; resuspend the cells in 200 μl PBS, place on ice, and store in the dark; perform fluorescence analysis using Beckman flow cytometer. Fig. 9 shown.

[0239] Example 14: J591-Fab-121-p-TetN3F antibody site-specific dual modification of fluorescence and radionuclide to achieve integrated tumor diagnosis and treatment

[0240] Early and accurate diagnosis and treatment of cancer have always been a hot and difficult issue in medical research. Early and accurate diagnosis, staging and classification are of great significance for the choice of cancer treatment methods. Finding highly sensitive and highly specific imaging diagnostic methods is crucial to solving clinical problems. It is also the key to basic scientific research to assist in solving major clinical needs and transforming products and technologies. For early prostate cancer, surgery is still the most effective treatment method. Accurate removal of diseased tissue during surgery is particularly critical and directly affects the patient's prognosis. Specific marking and identification technology for diseased tissue during surgery can achieve effective surgical assistance and navigation. Aiming at assisting clinical medicine, combined with superior antibody engineering technology, a novel bio-orthogonal reaction-mediated antibody site-specific dual labeling technology based on tetrazine and azide was developed. With prostate cancer as the research target, based on the above examples, the antibody fragment J591-Fab targeting the prostate cancer-specific membrane antigen PSMA was analyzed, the J591 antibody sequence was selected, the Fab part was selected for antibody engineering, and the modification design was performed at 2-4 sites away from the antigen binding site (A121, K169 and S202), the conditions were optimized, and the tetrazine and azide bifunctional unnatural amino acid p-TetN3F was efficiently introduced into the antibody fragment by using the aminoacyl tRNA synthetase / tRNA pair that is orthogonal to the host cell, and then the nuclide (TCO-NOTA-Cu) was introduced into the antibody fragment in vitro.64 ) and near-infrared molecules (DBCO-Cy5) are simultaneously coupled to the antibody ( Fig.10 As shown in the figure, the cells are then injected into mice inoculated with prostate cancer, and the lesions are detected through radionuclide imaging. Subsequently, with the assistance of near-infrared light (NIRF) imaging, the tumor boundaries are delineated to achieve precise resection of prostate cancer, ultimately achieving the goal of integrated tumor diagnosis and treatment. The specific steps are as follows:

[0241] (1) Establishment of prostate cancer cell lines and mouse models

[0242] LNCaP, 22Rv1 and PC3 human prostate cancer cell lines were purchased from Chinese Academy of Sciences Typical Culture Collection (Shanghai, China). LNCaP cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% GlutaMAX- and 1% sodium pyruvate. 22Rv1 and PC3 cells were maintained in RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. All cells were cultured at 37°C in an atmosphere of 5% CO2 in air. All animal experiments were performed in accordance with the regulations for laboratory animals in Beijing. All procedures and protocols were approved by the Animal Ethics Committee of Peking University First Hospital (Beijing, China), approval number: J201987. BALB / c nude mice were obtained from the Animal Center of Peking University First Hospital. Mice were group-housed (maximum 5 per cage) and maintained in a room at 20-25°C and humidity controlled with a 12-hour light / dark cycle. All mice were acclimated for at least 7 days before further experiments. 5 × 10 6 Cell suspension induced PSMA production in BALB / c male nude mice + 22RV1 and PSMA-PC3 tumors. When xenografts reached approximately 500 mm 3 These mice were used for in vivo imaging.

[0243] (2) TCO-PEG3-NOTA preparation (customized and synthesized by Xi'an Ruixi Biological Co., Ltd.) can be used to couple radionuclide molecules.

[0244]

[0245] (3) Conjugation of DBCO-Cy5 and TCO-NOTA with J591Fab to achieve high-resolution near-infrared imaging of tumors

[0246] 20 μM J591-Fab-121-p-TetN3F protein was mixed with 80 μM DBCO-Cy5 (4 equiv.) and 200 μM TCO-PEG3-NOTA (10 equiv.), and reacted in a PBS buffer with a pH of 7.4 at room temperature overnight. After the above reaction and labeling, desalting was performed using a SpinDesalt Column desalting column, with specific reference to the instructions, to obtain J591-121-Cy5-NOTA.

[0247] (4) 64 Cu labeling

[0248] 64 Cu was produced at Peking University Cancer Hospital using the HM-20 medical cyclotron (20 MeV, Sumitomo, Japan). 64 Cu labeling experiments were performed using 80 μL of [ 64 Cu]CuCl2, 65 μL 0.1 M sodium acetate and 600 μg (12 nmol) of J591-121-Cy5-NOTA were incubated at 37°C and pH 4.0-5.0 for 30 min. PD-10 column was used for purification of radioactive tracer. Radioactive thin layer chromatography determined that the radiochemical yield was more than 90% (n=3).

[0249] (5) 64 Cu-labeled J591-121-Cy5-NOTA immunoPET imaging

[0250] 22Rv1 tumor-bearing mice were intravenously injected with 3.96-4.07MBq[ 64 Cu]J591-121-Cy5-NOTA 100 μL PBS buffer. Before the corresponding imaging time, the mice were anesthetized with 2.5 L / min of isoflurane and placed in the PET scanner ( PINGSHENG, Shanghai, China). PET / CT imaging was performed at 1h, 6h, 12h, 24h and 36h after injection. The images were reconstructed using the ordered subset expectation maximization (OSEM) method, and the attenuation-corrected images were processed using MMWKS software.

[0251] (6) 64 Biodistribution of Cu-labeled J591-121-Cy5-NOTA.

[0252] 22Rv1 and PC3 tumor-bearing mice were intravenously injected with 148 kbq 64Cu-labeled J591-121-Cy5-NOTA 100 μL PBS buffer. Mice were sacrificed 12 h after injection. Organs of interest (kidney, liver, spleen, intestine, lung, stomach, muscle, blood, brain and tumor) were dissected and weighed. Radioactivity was measured using a γ counter (Packard, Meriden, CT) and expressed as the percentage of absorbed activity per gram of tissue (%IA / g).

[0253] (7) Tumor resection based on PSMA immunofluorescence

[0254] After IVIS imaging, 22Rv1 tumors were dissected and optimal cutting temperature embedding medium (OCT) was added. Tumor tissues were cut into 20 μm thick sections and fixed with acetone at 4°C for 20 min. After being blocked with BSA for 1 h at room temperature, the slides were incubated with anti-PSMA primary antibody (ab19071; Abcam, Cambridge, UK; 1:300 dilution) at 4°C overnight and with FITC-labeled secondary antibody (ZF-0312; ZSGB-Bio, Beijing, China; 1:150 dilution) at room temperature for 1 h. Finally, Hochest 33342 was used for counterstaining. The stained slides were scanned with a FluoView1000 confocal microscope (Olympus, Japan).

[0255] (8) Results

[0256] Results Fig.11 .

[0257] Example 15: J591-Fab-121-p-TetN3F antibody site-directed dual modification with fluorescence and PEG to achieve high signal-to-noise ratio imaging of mouse tumors

[0258] Although the above experiment can achieve dual-modal imaging of tumors, the signal-to-noise ratio is relatively weak compared to the whole antibody. Considering that the molecular size filtered by the kidney is about 60kd, the smaller molecular weight of the antibody fragment will also lead to the problem of too short half-life in vivo, causing the antibody fragment molecules to be quickly cleared by the kidneys, shortening the circulation time in the blood, and further affecting its enrichment effect at the tumor site. Additional site-specific coupling of PEG on proteins is a common method to achieve a long half-life of Fab. To address the above problems, we also used the bifunctional non-natural amino acid p-TetN3F containing tetrazine functional groups and azide functional groups. We obtained site-specifically modified J591Fab-Cy5 and site-specifically coupled PEG-modified J591Fab-Cy5 proteins ( Fig.12), which proved that the imaging effect of PEG-modified J591Fab-Cy5 protein was better than that of unPEG-modified J591Fab-Cy5 protein. It was speculated that the half-life of J591-Fab was increased by coupling with PEG, thereby increasing the enrichment in tumors, and then developing an economical, long half-life, and high signal-to-noise ratio antibody fragment Fab small animal imaging system, which reflects the advantages of bifunctional amino acids in the field of pharmaceutical proteins and the potential for producing homogeneous dual-modified therapeutic proteins.

[0259] The specific steps are as follows:

[0260] (1) Establishment of prostate cancer cell lines and mouse models

[0261] LNCaP, 22Rv1 and PC3 human prostate cancer cell lines were purchased from Chinese Academy of Sciences Typical Culture Collection (Shanghai, China). LNCaP cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% GlutaMAX- and 1% sodium pyruvate. 22Rv1 and PC3 cells were maintained in RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. All cells were cultured at 37°C in an atmosphere of 5% CO2 in air. All animal experiments were performed in accordance with the regulations for laboratory animals in Beijing. All procedures and protocols were approved by the Animal Ethics Committee of Peking University First Hospital (Beijing, China), approval number: J201987. BALB / c nude mice were obtained from the Animal Center of Peking University First Hospital. Mice were group-housed (maximum 5 per cage) and maintained in a room at 20-25°C and humidity controlled with a 12-hour light / dark cycle. All mice were acclimated for at least 7 days before further experiments. 5 × 10 6 Cell suspension induced PSMA production in BALB / c male nude mice + 22RV1 and PSMA - PC3 tumors. When xenografts reach approximately 500 mm 3 These mice were used for in vivo imaging.

[0262] (2) Preparation of J591Fab coupled to DBCO-Cy5

[0263] 20 μM J591-Fab-121-p-TetN3F protein and 80 μM DBCO-Cy5 (4 equiv.) were reacted in a PBS buffer with a pH of 7.4 at room temperature overnight. After the above reaction, unreacted DBCO-Cy5 was removed by separation using AKTA to obtain J591Fab-Cy5 protein (such as Fig.13 The fluorescence labeling rate was calculated to be 80% using nanodrop.

[0264] The J591Fab-Cy5 AKTA purification general procedure was obtained by AKTA separation. Superdex 75 molecular sieve was selected to separate and purify the reaction system. The specific operation steps are as follows:

[0265] 1) Preparation of buffer: All solutions used in the AKTA purification system must be prepared with ddH2O, Buffer: PBS. And it needs to be filtered through a 0.2μm filter membrane to remove excess insoluble impurities.

[0266] 2) Purification process:

[0267] a) Check the instrument and turn it on. The software is UNICORN 6.3. Before use, use the Pump Wash and System Wash functions to flush pump A with ddH2O and set the flow rate to 0.5 ml / min.

[0268] b) Rinse pump A with PBS to fill the pump channel with buffer in advance

[0269] c) Install the Superdex 75 molecular sieve column on the AKTA protein purifier without introducing bubbles and check for leakage.

[0270] d) Wash the purification column with water: through the A pump channel, set the flow rate to 2 ml / min, the alarm system pressure to 1.5 MPa, and use ddH2O to wash the purification column for about 1 column volume, i.e. 24 ml;

[0271] e) Wash the purification column with PBS: rinse 1 column volume;

[0272] f) Sample loading: protein is centrifuged at high speed, and the sample peak solution is collected;

[0273] g) After all sample peaks are collected, the remaining components on the purification column are eluted with PBS until the UV absorption is close to the baseline;

[0274] h) Clean the column: insert pump A into ddH2O and flush 10 column volumes; if it will not be used within three days, flush 10 column volumes with 20% ethanol to preserve the column and passage;

[0275] i) Disassemble the column, rinse A1, A2, and B1 with ddH2O, then rinse again with 20% ethanol, and shut down the machine; the pump head needs to be stored in 20% ethanol.

[0276] (3) Protein preparation of J591Fab coupled with DBCO-Cy5 and TCO-mPEG20K

[0277] 20 μM J591-Fab-121-p-TetN3F protein was mixed with 80 μM DBCO-Cy5 (4 equiv.) and 80 μM TCO-mPEG20K (4 equiv.), and reacted in a PBS buffer with a pH of 7.4 at room temperature overnight. After the above reaction, the unreacted J591-Fab-121-p-TetN3F protein, the J591-Fab-121-p-TetN3F protein not labeled with PEG, free PEG and DBCO-Cy5 were removed by separation using AKTA to obtain a relatively pure J591Fab-Cy5-PEG20K protein (such as J591Fab-Cy5-mPEG20K) modified with both PEG and Cy5 coupled. Fig.14 The labeling rate was calculated to be 80% using nanodrop.

[0278] (4) In vivo fluorescence imaging of 22RV1 and PC3 prostate tumors in mice

[0279] Mice were intravenously injected with 30ug J591 Fab-Cy5 or J591Fab-Cy5-PEG20K in 100μL PBS buffer, and then images were acquired using the IVIS Spectrum Imaging System (Caliper Life Sciences, Hopkinton, MA) at 2h, 4h, 6h, 10h, 24h, and 36h. The bright field depicted the tumor area and the fluorescence intensity was quantified. The ipsilateral auricle was also depicted and used as the background. The tumor imaging effects of mice with the two proteins were compared.

[0280] (5) Results

[0281] Results Fig.15 The results showed that the imaging effect of the PEG-modified J591Fab-Cy5 protein was better than that of the unPEG-modified J591Fab-Cy5 protein, proving that the enrichment of J591Fab-Cy5 in the tumor was increased by coupling with PEG, thereby achieving high-resolution near-infrared mouse tumor imaging.

[0282] Example 16: Preparation of pUltra-m-TetN3FRS / tRNA plasmid.

[0283] According to the reference: J.Am.Chem.Soc.2020,142,16,7245–7249, the mutation sites of Tet-v3.0 RS were mapped to Methanosarcina flavescens (Mf) PylRS, and the 268th L of Tet-v3.0 RS was mutated to G, the 309th N was mutated to G, and the 311th C was mutated to S by qucikchange site-directed mutagenesis. In addition, the 347th Y was mutated to F based on experience, thereby obtaining the plasmid pUltra-m-TetN3FRS / tRNA (see Fig.16 ).

[0284] The steps of quikchange site-directed mutagenesis are as follows: PCR amplification is performed using primers 268G-F, 268G-R, 309G311S-F, 309G311S-R, 347F-F, and 347F-R with the pUltra-MfPylRS plasmid as a template. The PCR product is digested with DpnI endonuclease, and the digested product is transformed into Escherichia coli. A single clone is picked to extract the plasmid, and sequencing is performed to verify the pUltra-m-TetN3FRS / tRNA plasmid.

[0285] Among them, the sequence of the 268G-F primer is:

[0286] GCGTCCGATGCTGGCGCCGAACGGCTACAACTATCTGCGTAAACTGGACC GTG;

[0287] The sequence of the 268G-R primer is:

[0288] CACGGTCCAGTTTACGCAGATAGTTGTAGCCGTTCGGCGCCAGCATCGGA CGC;

[0289] The sequence of the 309G311S-F primer is:

[0290] GAGCACCTGGAGGAATTCACCATGCTGGGCTTTAGCCAGATGGGTAGCGG CTGCACCC;

[0291] The sequence of the 309G311S-R primer is:

[0292] GGGTGCAGCCGCTACCCATCTGGCTAAAGCCCAGCATGGTGAATTCCTCC AGGTGCTC;

[0293] The sequence of the 347F-F primer is:

[0294] GTGGGTGACAGCTGCATGGTTTTTGGCGACACCCTGGATGTGATG;

[0295] The sequence of the 347F-R primer is:

[0296] CATCACATCCAGGGTGTCGCCAAAAACCATGCAGCTGTCACCCAC

[0297] The PCR reaction system is shown in Table 11.

[0298] Table 11 PCR reaction system

[0299] <![CDATA[ddH2O]]> 12μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL 268G-F(10μM) 2μL 268G-R(10μM) 2μL 309G311S-F(10μM) 2μL 309G311S-R(10μM) 2μL 347F-F(10μM) 2μL 347F-R(10μM) 2μL pUltra-MfPylRS plasmid (50 ng / μL) 1μL Total volume 50μL

[0300] The PCR reaction conditions were: 98°C for 10 s, 58°C for 5 s, 68°C for 60 s, for 15 cycles; and stored at 4°C.

[0301] The DpnI endonuclease digestion reaction system is: 50 μL PCR reaction solution, 1 μL DpnI endonuclease.

[0302] The conditions for the DpnI endonuclease digestion reaction were: 37°C for 2 hours.

[0303] The steps of E. coli transformation are as follows: add 5 μL DpnI digestion product to E. coli DH10B competent cells, ice bath for 30 minutes, heat shock at 42°C for 45 seconds, ice bath for 3 minutes, add 2YT medium and incubate at 37°C for 1 hour, plate, pick single clones, extract plasmids, and sequence verification.

[0304] like Fig.16 Shown is the plasmid map of the pUltra-m-TetN3FRS / tRNA plasmid, which has spectinomycin resistance. Sequencing confirmed that the pUltra-m-TetN3FRS / tRNA plasmid differs from the pUltra-MfPylRS plasmid only at sites 268, 309, 311 and 347 (268CTG mutated to GGC, 309AAC mutated to GGC, 311TGC mutated to AGC, and 347TAT mutated to TTT).

[0305] Example 17: Preparation of site-directed mutagenesis sfGFP expression strain

[0306] The auxiliary plasmid pUltra-m-TetN3FRS / tRNA plasmid (spectinomycin resistance) prepared in Example 14 and the expression plasmid pET22b-sfGFP-Y151TAG (ampicillin resistance) obtained in Example 5 were co-transformed into Escherichia coli BL21 (DE3) strain, and the positive strains transformed with both plasmids were screened by double resistance plates (spectinomycin and ampicillin resistance) and named as expression strain BL21-pET22b-sfGFP-Y151TAG-pUltra-m-TetN3FRS / tRNA.

[0307] Example 18: Site-directed insertion of unnatural amino acids sfGFP-m-TetN3F expression and purification

[0308] The BL21-pET22b-sfGFP-Y151TAG-pUltra-m-TetN3FRS in Example 15 was

[0309] / tRNA picked a single colony and cultured it in 5mL 2YT medium containing spectinomycin and ampicillin overnight. The next day, it was transferred to 50mL fresh 2YT medium containing spectinomycin and ampicillin at a volume ratio of 1:100. When the culture reached the early exponential growth stage, 1mM m-TetN3F was added to the medium. IPTG was added for induction when the OD was about 0.6-0.8. The bacteria were collected after expression at 37℃ for 8-10 hours.

[0310] The above-collected expression bacteria were resuspended in PBS and ultrasonically disrupted at 0-4°C for 1-2 min. The disrupted product was centrifuged at high speed (12000 rpm, 30 minutes at 4°C), and the supernatant was aspirated. The supernatant sample was incubated with the Ni affinity column at 4°C for 30 minutes, and then washed with 25mM imidazole for 5-10 column volumes, 40mM imidazole for 3 column volumes, 250mM imidazole for elution and concentration, and the purity and approximate molecular weight of the purified protein were determined by SDS-PAGE protein electrophoresis after concentration.

[0311] Fig.17 The SDS gel electrophoresis analysis of sfGFP with the insertion of unnatural amino acids. The E. coli engineered strain prepared by the method provided by the present invention can indeed express green fluorescent protein with unnatural amino acids.

[0312] Example 19: Preparation of pCMV-MfPylRS-m-TetN3FRS / tRNA plasmid.

[0313] The m-TetN3FRS gene fragment was PCR amplified from the pUltra-m-TetN3FRS / tRNA plasmid using HindⅢ-gib-FW and BamHⅠ-gib-RV primers, wherein the sequence of the HindⅢ-gib-FW primer was: cccatcccaggtccaactgcacggAAGCTTGCCACCATGGACAAGAAACCGCTGGATG TGC, and the sequence of the BamHⅠ-gib-RV primer was: cagtcgaggctgatcagcgggtGGATCCTCACAGGCTGGTGCTAATGCCG.

[0314] The PCR reaction system is shown in Table 12.

[0315] Table 12

[0316] <![CDATA[ddH2O]]> 20μL <![CDATA[KODOne TM PCRMasterMix]]> 25μL HindⅢ-gib-FW (10μM) 2μL BamHI-gib-RV (10μM) 2μL <![CDATA[pUltra-m-TetN3FRS / tRNA(50ng / μL)]]> 1μL Total volume 50μL

[0317] The PCR reaction conditions were: 98°C for 10 s, 58°C for 5 s, 68°C for 20 s, 30 cycles, and stored at 4°C. The PCR product was electrophoresed, purified, and recovered to obtain the m-TetN3FRS gene fragment.

[0318] Then pCMV-MbPylRS was cut by restriction endonucleases HindⅢ and BamHI, and the cut product was purified by electrophoresis and recovered to obtain the pCMV vector fragment. The cut system is shown in Table 13.

[0319] Table 13

[0320] <![CDATA[ddH2O]]> 18μL Cutsmart 5μL HindⅢ 1μL Bm 1μL pCMV-MbPylRS (200 ng / μL) 25μL Total volume 50μL

[0321] The m-TetN3FRS gene fragment and the pCMV vector fragment were assembled by Gibson to obtain the pCMV-MfPylRS-m-TetN3FRS / tRNA plasmid.

[0322] The Gibson reaction system is: m-TetN3FRS gene fragment (20 ng / μL): 1.5 μL, pCMV vector fragment (50 ng / μL): 1 μL, Gibson reaction solution: 2.5 μL, and the total system is 5 μL.

[0323] The Gibson reaction conditions were: 50°C for 1 hour.

[0324] The Gibson reaction solution was used to transform Escherichia coli DH10B, which was then spread on an LB plate containing 50 μg / ml ampicillin. The next day, a single colony was picked and placed in 5 mL 2YT liquid medium. Ampicillin at a concentration of 50 μg / ml was added to the medium and cultured at 37°C with a shaking incubator at 220 rpm for 12 hours. The plasmid was extracted (according to the instructions of the kit). The plasmid was confirmed to be pCMV-MfPylRS-m-TetN3FRS / tRNA plasmid by sequencing. Fig.18 Shown is the plasmid map of the pCMV-MfPylRS-m-TetN3FRS / tRNA plasmid.

[0325] Example 20: Verification of insertion of m-TetN3F in eukaryotic system

[0326] The day before transfection, seed 1.3×10^5 HEK293T cells in 500μL DMEM+10% FBS medium in a 24-well plate. The next day, transfection was performed when the cell density covered 80-90% of the culture dish. The amount of plasmid added to each well was 0.8ug, pcDNA3.1-EGFP-Y39TAG:pCMV-MfPylRS-m-TetN3FRS / tRNA:PEI=1:1:6. Take 0.4μg of each plasmid, dilute to 25μL with Opti-mem reduced serum medium, and let stand for 5 minutes. Take another tube and add 2.4μg PEI, dilute to 25μL with Opti-mem reduced serum medium, and let stand for 5 minutes. Then add the diluted PEI to the plasmid, mix well, let stand for 15min, and then slowly add it to the 24-well plate after it adheres to the wall, and incubate it in an incubator at 37℃ and 5% CO2 for 4h. The old culture medium was discarded and replaced with DMEM + 10% FBS culture medium containing 0.25 mM m-TetN3F, and the cells were placed in an incubator. After 2 days, the cells were observed under a fluorescence microscope. Fig.19 Shown is the successful introduction of m-TetN3F into eukaryotic cells.

[0327] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. <110> Beijing University <120> A bi / multifunctional non-natural amino acid and its conjugate and application <130> MP21037413 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 711 <212> DNA <213> Artificial Sequence <400> 1 atgaaaaaga atatcgcatt tcttcttgca tctatgttcg ttttttctat tgctacaaac 60 gcgtacgctg acatcgtgat gacccagtcc ccctcctccc tgtctgcctc cgtgggcgac 120 agagtgacca tcacatgcaa ggcctcccag gatgtgggca ccgccgtgga ctggtatcag 180 cagaagcctg gcaaggcccc taagctgctg atctactggg cctccaccag acacaccggc 240 gtgcctgaca gattcaccgg ctccggctct ggcaccgact tcaccctgac catctccagc 300 ctgcagcctg aggacttcgc cgactacttc tgccagcagt acaactccta ccctctgacc 360 ttcggcggag gcaccaagct ggaaatcaaa cgaactgtgg ctgcaccatc tgtcttcatc 420 ttcccgccat ctgatgagca gttgaaatct ggaactgcct ctgtcgtgtg cctgctgaat 480 aacttctatc ccagagaggc caaagtacag tggaaggtgg ataacgccct ccaatcgggt 540 aactcccagg agagtgtcac agagcaggac agctaggaca gcacctacag cctcagcagc 600 accctgacgc tgagcaaagc agactacgag aaacacaaag tctacgcctg cgaagtcacc 660 catcagggcc tgtcctcgcc cgtcacaaag agcttcaaca ggggagagtg t 711 <210> 2 <211> 738 <212> DNA <213> Artificial Sequence <400> 2 atgaaaaaga atatcgcatt tcttcttgca tctatgttcg ttttttctat tgctacaaac 60 gcgtacgctg aagtgcagct ggtgcagtct ggcgccgaag tgaagaaacc tggcgcctcc 120 gtgaagatct cctgcaagac ctccggctac accttcaccg agtacaccat ccactgggtg 180 aaacaggcct ccggcaaggg cctggaatgg atcggcaaca tcaaccctaa caacggcggc 240 accacctaca accagaagtt cgaggaccgg gccaccctga ccgtggacaa gtccacctcc 300 accgcctaca tggaactgtc ctccctgcgg tctgaggaca ccgccgtgta ctactgcgcc 360 gctggctgga acttcgacta ctggggccag ggcaccacag tgacagtctc gagctgatcc 420 accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 480 gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 540 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 600 tactccctca gcagcgtggt gactgtgccc tctagcagct tgggcaccca gacctacatc 660 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaagttga gcccaaatct 720 tgtgacaaaa ctcacaca 738

Claims

1. A non-natural amino acid having a structure shown in Formula I; or a pharmaceutically acceptable salt thereof: The Rb or Re is The non-natural amino acid has a structure shown in Formula I-1 or Formula I-2: The R1 is selected from -(CH2) X N3, -(CH2CH2O) X N3, (CH2) X CO-(CH2) X N3 or -(CH2CH2O) X CO-(CH2CH2O) X N3; x = 1-10; The remaining substituents on the benzene ring are independently selected from hydrogen, halogen, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3 alkoxy, azido, alkanoyl or alkynyl.

2. The unnatural amino acid according to claim 1, characterized in that The non-natural amino acid has any of the following structures:

3. The unnatural amino acid according to any one of claims 1 to 2, characterized in that The non-natural amino acid is an L-type amino acid, a D-type amino acid or a combination of the two.

4. Use of the non-natural amino acid according to any one of claims 1 to 3 in the preparation of a recombinant protein or a recombinant protein conjugate.

5. A recombinant protein, characterized in that The amino acid at at least one position in the sequence of the wild-type protein is mutated to the non-natural amino acid according to any one of claims 1 to 4; The wild-type protein is selected from α-1 antitrypsin, angiostatin, antihemolytic factor, antibody, apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide, atrial peptide, CXC chemokine, T39765, NAP-2, ENA-78, gro-a, gro-b, gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, C-kit ligand, cytokine, CC chemokine, monocyte chemoattractant protein-1, monocyte chemoattractant protein 2, monocyte chemoattractant protein-3, monocyte inflammatory protein-1α, mono Nuclear cell inflammatory protein-1β, RANTES, I309, R83915, R91733, HCC1, T58847, D31065, T64262, CD40, CD40 ligand, C-kit ligand, collagen, colony stimulating factor, complement factor 5a, complement inhibitor, complement receptor 1, cytokine, epithelial neutrophil activation peptide-78, MIP-16, MIP-1, epidermal growth factor, epithelial neutrophil activation peptide, erythropoietin, exfoliating toxin, factor IX, factor VII, factor VIII, factor X, fibroblast growth factor , fibrinogen, fibronectin, four-helix bundle protein, G-CSF, glp-1, GM-CSF, glucocerebrosidase, gonadotropin, growth factor, growth factor receptor, hedgehog protein, hemoglobin, hepatocyte growth factor, hirudin, human growth hormone, human serum albumin, ICAM-1, ICAM-1 receptor, LFA-1, LFA-1 receptor, insulin, insulin-like growth factor, IGFI, IGF-II, interferon, IFN-α, IFN-β, IFN-γ, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL- 7. IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor, lactoferrin, leukemia inhibitory factor, luciferase, nerve growth factor, neutrophil inhibitory factor, oncostatin M, osteogenic protein, oncogene products, paracitonin, parathyroid hormone, PD-ECSF, PDGF, peptide hormones, pleiotropic growth factor, protein A, protein G, pth, pyrogenic exotoxin A, pyrogenic exotoxin B and pyrogenic exotoxin C, pyy, relaxin, renin, SCF, small biosynthetic protein, soluble complement receptor I, soluble I-CAM1. At least one of soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, growth hormone, streptokinase, superantigen, staphylococcal enterotoxin, SEA, SEB, SECT, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase, toxic shock syndrome toxin, thymosin α1, tissue plasminogen activator, tumor growth factor, tumor necrosis factor, tumor necrosis factor α, tumor necrosis factor β, tumor necrosis factor receptor, VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor, urokinase, mos, ras, raf, met, p53, tat, fos, myc, jun, myb, rel, estrogen receptor, progesterone receptor, testosterone receptor, aldosterone receptor, LDL receptor, and corticosterone.

6. The recombinant protein according to claim 5, characterized in that The non-natural amino acid is site-specifically introduced into the wild-type protein using gene codon expansion technology.

7. The recombinant protein according to claim 5, characterized in that The antibody or antibody fragment thereof includes at least one of a whole antibody, scFv, Fab, Fab', F(ab')2, scFv-Fc, Triabody, Diabody, Minibody, Nanobody, DARPins or affibody.

8. A recombinant protein conjugate, characterized in that: Obtained by coupling the recombinant protein according to any one of claims 5 to 7 with two or more effector molecules; The effector molecules are selected from at least two of fluorescent groups, nuclides, polyethylene glycol, small molecule chemical drugs, polypeptides, proteins, enzymes, and nucleic acids.

9. Use of the recombinant protein according to any one of claims 5 to 7 or the recombinant protein conjugate according to claim 8 in the preparation of cell imaging and / or disease diagnosis imaging products.

10. Use of the recombinant protein according to any one of claims 5 to 7 or the recombinant protein conjugate according to claim 8 in the preparation of a drug for treating tumors and / or preventing tumor recurrence, or in the preparation of a tumor detection reagent.

11. A composition, characterized in that It comprises the recombinant protein according to any one of claims 5 to 7 or the recombinant protein conjugate according to claim 8.

Images