An insecticidal protein mutant GNIP1Aa-D420L and its encoding gene and application

Abstract

The present invention discloses an insecticidal protein mutant GNIP1Aa‑D420L, its encoding gene and application. The present invention first discloses that the insecticidal protein mutant GNIP1Aa‑D420L is a wild-type insecticidal protein GNIP1Aa shown in SEQ ID No.1, wherein the Asp at position 420 is mutated to Leu. The present invention further discloses the application of the above-mentioned insecticidal protein mutant GNIP1Aa‑D420L in killing insects. The present invention mutates the Asp at position 420 of the wild-type insecticidal protein GNIP1Aa to Leu to obtain the insecticidal protein mutant GNIP1Aa‑D420L, which has higher thermal stability than the wild-type insecticidal protein GNIP1Aa, and the insecticidal effect is also slightly improved, which provides important clues for the application of insecticidal proteins in agriculture, grain storage, feed and other industries.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and more specifically, to an insecticidal protein mutant GNIP1Aa-D420L and its encoding gene and application. Background Art

[0002] Insecticidal proteins are a class of protein substances with insecticidal effects. Insecticidal proteins were first identified in 1953, when Hannay et al. found through research that the substance that enables Bacillus thuringiensis (Bt) to exert its insecticidal effect is mainly the parasporal crystals it produces, and confirmed that the essence of this parasporal crystal is protein, thus insecticidal proteins came into the public eye. With the continuous development of molecular biology, in 1981, Schnepf and Whiteley successfully isolated the first insecticidal protein gene cry from Bt, opening a new era of research on insecticidal proteins at the molecular level. Since then, more and more insecticidal protein genes have been discovered, and the existence of insecticidal proteins has been confirmed in plants, animals, and microorganisms.

[0003] GNIP1Aa is a Gram-negative insecticidal protein discovered in Chromobacterium piscinae in 2016. It not only exhibits specific insecticidal activity against western corn rootworm, but also has no homology with any known insecticidal protein after sequence analysis, indicating that the protein may kill WCR in a new way, providing more possibilities for the future application of insecticidal proteins.

[0004] As a high-quality biological control agent, insecticidal protein has the advantages of high safety, environmental friendliness, and low resistance to pesticides compared with chemical pesticides. Compared with other biological pesticides such as insect pheromones, botanical insecticides and microbial agents, it has the characteristics of wide sources, unique action sites, and low cost of recombinant protein acquisition. It has gradually become a new technical reserve and a powerful supplement to other pesticides in pest control. However, due to the disadvantage of protein substances in structural stability compared with compound agents, their application in open environments is limited. At present, their pest control function is mainly realized in the form of genetically modified crops. With the development of modern molecular biology technology, molecular modification of existing insecticidal proteins and improvement of their stability can provide the possibility for the application of biological agents, and can also lay a solid foundation for compounding with other biological agents in the future to eliminate pests at multiple targets, and ultimately achieve comprehensive control.

[0005] Site-directed mutagenesis is based on known or predicted structural information and catalytic mechanisms, analyzes the relationship between structure and function, infers the main sites that affect protein stability, catalytic activity, etc., and then modifies or replaces the key sites. Site-directed mutagenesis has advantages over traditional mutagenesis, such as high mutation rate and good repeatability, and has been widely used to improve protein performance.

[0006] Therefore, obtaining a new insecticidal protein mutant through site-directed mutagenesis is of great significance in pest control. Summary of the invention

[0007] The purpose of the present invention is to provide an insecticidal protein mutant GNIP1Aa-D420L with improved thermal stability, a coding gene thereof and an application thereof.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention first provides an insecticidal protein mutant GNIP1Aa-D420L, wherein the insecticidal protein mutant GNIP1Aa-D420L is obtained by mutating the Asp at position 420 of the wild-type insecticidal protein GNIP1Aa shown in SEQ ID No. 1 to Leu.

[0010] Further, the insecticidal protein mutant GNIP1Aa-D420L is shown in A1) or A2):

[0011] A1) the amino acid sequence of the protein shown in SEQ ID No. 2;

[0012] A2) A fusion protein obtained by connecting a protein tag to the N-terminus or C-terminus of the amino acid sequence shown in SEQ ID No. 2.

[0013] The present invention further provides a gene encoding the above insecticidal protein mutant GNIP1Aa-D420L.

[0014] In a specific embodiment of the present invention, the nucleotide sequence of the gene encoding the insecticidal protein mutant GNIP1Aa-D420L is shown in SEQ ID NO. 3. It should be noted that, since the same amino acid may be determined by multiple different codons, the gene encoding the insecticidal protein mutant GNIP1Aa-D420L can also be a nucleotide sequence of a gene encoding the insecticidal protein mutant GNIP1Aa-D420L of the present invention obtained by mutating one or more nucleotides of the gene encoding the wild-type insecticidal protein GNIP1Aa shown in SEQ ID NO.4 to form a synonymous mutation, or it can be a synonymous sequence of SEQ ID NO.3.

[0015] The recombinant vector comprising the gene encoding the above insecticidal protein mutant GNIP1Aa-D420L is also within the protection scope of the present invention.

[0016] In a specific embodiment of the present invention, the recombinant vector is a recombinant vector pET-24a(+)-GNIP1Aa-D420L obtained by connecting the coding gene of the above-mentioned insecticidal protein mutant GNIP1Aa-D420L to the NotⅠ and NdeⅠ restriction sites of pET-24a(+), while keeping the other sequences of pET-24a(+) unchanged.

[0017] The present invention further provides a recombinant bacterium comprising the above recombinant vector, wherein the host cell of the recombinant bacterium is a competent cell of Escherichia coli BL21 (DE3).

[0018] The present invention further provides a method for preparing the above-mentioned insecticidal protein mutant GNIP1Aa-D420L, comprising the following steps:

[0019] (1) Designing primers carrying mutation sites for the mutation sites of the insecticidal protein mutant GNIP1Aa-D420L, and performing site-directed mutagenesis PCR using a plasmid containing the gene encoding the wild-type insecticidal protein GNIP1Aa as a template to obtain a recombinant vector containing the gene encoding the insecticidal protein mutant GNIP1Aa-D420L;

[0020] (2) transforming host cells with the recombinant vector to obtain recombinant bacteria;

[0021] (3) Cultivating recombinant bacteria and inducing protein expression;

[0022] (4) Recovering and purifying to obtain the insecticidal protein mutant GNIP1Aa-D420L.

[0023] In a specific embodiment of the present invention, before step (1), three online analysis softwares, PopMuSiC, HotMuSiC and I-Mutant, are used to comprehensively predict mutation sites with improved stability, thereby obtaining the mutation sites of the insecticidal protein mutant GNIP1Aa-D420L.

[0024] In a specific embodiment of the present invention, the sequences of the primers are shown as SEQ ID NO.7 and SEQ ID NO.8.

[0025] The present invention quantitatively detects the protein degradation amount of the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L before and after high-temperature incubation by fluorescent immunoblotting, and characterizes the change of the thermal stability of the protein: the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L are incubated at 60°C for 4 hours, and the protein degradation amount of the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L before and after high-temperature incubation is quantitatively detected by fluorescent immunoblotting. The remaining rate of the wild-type insecticidal protein GNIP1Aa after degradation is 42.89%, while the remaining rate of the insecticidal protein mutant GNIP1Aa-D420L after degradation is 59.56%, which is 1.38 times that of the wild-type, indicating that the mutation at the 420th position improves the thermal stability of the insecticidal protein by 38%.

[0026] The present invention further provides the use of the insecticidal protein mutant GNIP1Aa-D420L in insecticide or in the preparation of insecticidal products.

[0027] In a specific embodiment of the present invention, the insects are stored-grain pests, specifically tobacco beetles and red flour beetles.

[0028] The specific application of the present invention is to feed insects after mixing the insecticidal protein mutant GNIP1Aa-D420L with feed.

[0029] The beneficial effects of the present invention are as follows:

[0030] The present invention mutates the 420th Asp of the wild-type insecticidal protein GNIP1Aa to Leu to obtain the insecticidal protein mutant GNIP1Aa-D420L. Compared with the wild-type insecticidal protein GNIP1Aa, the insecticidal protein mutant GNIP1Aa-D420L has higher thermal stability and slightly improved insecticidal effect, which provides important clues for the application of insecticidal proteins in agriculture, grain storage, feed and other industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The specific implementation modes of the present invention will be further described in detail below in conjunction with the accompanying drawings.

[0032] Figure 1 This is the SDS-PAGE protein expression electrophoresis diagram of the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L, with a size of 58.9 kDu; among them, 1 is GNIP1Aa and 2 is GNIP1Aa-D420L.

[0033] Figure 2These are fluorescent protein immunoblot detection images of the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L before and after high-temperature incubation; among them, 1 is GNIP1Aa and 2 is GNIP1Aa-D420L. DETAILED DESCRIPTION

[0034] In order to more clearly illustrate the present invention, the present invention is further described below in conjunction with preferred embodiments and accompanying drawings. Similar components in the accompanying drawings are represented by the same reference numerals. It should be understood by those skilled in the art that the content specifically described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0035] Example 1 Construction of wild-type insecticidal protein GNIP1Aa recombinant vector (pET-24a(+)-GNIP1Aa) plasmid

[0036] The insecticidal protein GNIP1Aa is derived from Chromobacterium piscinae, and the amino acid sequence is shown in GenBank accession number: AML23188.1 (the amino acid sequence is shown in SEQ ID NO.1). The wild-type insecticidal protein gene sequence (before mutation) was codon-optimized in Escherichia coli, and gene synthesis was performed by Sangon Biotechnology (Shanghai) Co., Ltd. to obtain the target gene gnip1Aa (the nucleotide sequence is shown in SEQ ID NO.4).

[0037] By PCR reaction, the homologous fragment of pET-24a(+) plasmid was added to the end of the target gene gnip1Aa to obtain gnip1Aa containing the homologous fragment;

[0038] The primers used in the PCR reaction were designed using the bioinformatics software SnapGene, and the specific sequences are as follows:

[0039] GNIP1Aa-F: tttaactttaagaaggagatatacaATGGCAAGCGCAGCAAATG (SEQ ID No. 5)

[0040] GNIP1Aa-R: tggtggtggtgctcgagtgcCAGTTTGCTCATCATTGCTTCCATACC (SEQ ID No. 6)

[0041] The PCR reaction system was: gnip1Aa 50 ng, GNIP1Aa-F (10 uM) 1.5 μL, GNIP1Aa-R (10 uM) 1.5 μL, KOD One PCR Master Mix 25 μL, ddH 2 Add 0.1% HO to make up to 50 μL.

[0042] The conditions for the PCR reaction were:

[0043]

[0044] The pET-24a(+) plasmid was double-digested with NotⅠ and NdeⅠ to obtain the large fragment of the pET-24a(+) plasmid, pET-24a(+)DNA, which was subjected to Gibson assembly with gnip1Aa containing the homologous fragment to obtain a ligation product; wherein, the system and conditions of the Gibson assembly were: Gibson mix 10μL, pET-24a(+)DNA 50ng, gnip1Aa containing the homologous fragment 47ng (3×pET-24a(+)mol, i.e., 3 times the molar amount of pET-24a(+)DNA), ddH 2 Add 0.1% HO to 20 μL and connect at 50°C for 1 h.

[0045] The ligation product was transformed into E. coli TOP10 competent cells to obtain a transformation solution; the transformation solution was evenly spread on an LB screening plate (kan + Concentration: 50 μg / mL), cultured overnight at 37°C, picked transformants, cultured in LB liquid medium, extracted plasmids, and obtained recombinant plasmid pET-24a(+)-GNIP1Aa by restriction digestion and PCR verification. Then, the recombinant plasmid pET-24a(+)-GNIP1Aa was transformed into E. coli BL21(DE3) competent cells to obtain recombinant bacteria E. coli BL21(DE3), named BL21(DE3) / pET-24a(+)-GNIP1Aa.

[0046] Example 2 Construction of the insecticidal protein mutant GNIP1Aa-D420L recombinant vector (pET-24a(+)-GNIP1Aa-D420L) plasmid

[0047] 1. Selection of mutation sites for improved thermal stability

[0048] The protein GNIP1Aa data file (PDB ID: 6FBM) was obtained from the PDB protein database. First, the two online analysis softwares PoPMuSiC and HotMuSiC were used to calculate the unfolding free energy change (ΔΔG) and melting temperature change (ΔTm) of each amino acid mutation of GNIP1Aa to another 19 amino acids, and the amino acid sites with ΔΔG<0, ΔTm>0 and significant changes were selected; then the software I-Mutant was used to verify them one by one. The thermal stability change of the protein was evaluated based on the comprehensive prediction results, and finally the single mutation site of the 420th Asp mutation to Leu in the amino acid sequence of the wild-type insecticidal protein GNIP1Aa was selected.

[0049] 2. Construction of the insecticidal protein mutant GNIP1Aa-D420L recombinant vector (pET-24a(+)-GNIP1Aa-D420L) plasmid

[0050] In order to mutate Asp at position 420 in the amino acid sequence of the wild-type insecticidal protein GNIP1Aa to Leu, the primers carrying the mutation site were designed using the bioinformatics software SnapGene. The sequences are as follows:

[0051] D420L-F: CCTCAGGGTTTATCGTGCACTGGGT CTG GTTATGATGCTG (SEQ ID No. 7)

[0052] D420L-R:CTGGTTGCCAGCATCATAAC CAG ACCCAGTGCACG (SEQ ID No. 8)

[0053] Among them, the underlined part represents the codon corresponding to the 420th Leu mutation site.

[0054] The primers are used to perform site-directed mutagenesis PCR to obtain PCR products, wherein the template is the recombinant plasmid pET-24a(+)-GNIP1Aa, and the system and conditions of the PCR reaction are the same as those in Example 1.

[0055] The PCR product was recovered by gel, and then restriction endonuclease Dpn I was added, incubated at 37°C for 1h to remove the template, incubated at 70°C for 30min to inactivate, and DNA was purified again after the reaction to obtain a purified product (GNIP1Aa-D420L, the nucleotide sequence is shown in SEQ ID NO.3). The purified product (gnip1Aa) was used as a template, and GNIP1Aa-F and GNIP1Aa-R primers in Example 1 were used for PCR reaction. The system and conditions of the PCR reaction were the same as those in Example 1, and the homologous fragment of the pET-24a(+) plasmid was added to the end of the gene fragment, and then Gibson assembly was performed with the large fragment of the pET24a(+) plasmid that had been double-digested with Not I and Nde I (the system and conditions of Gibson assembly were the same as those in Example 1) to obtain a ligation product.

[0056] The ligation product was transformed into E. coli TOP10 competent cells, and the transformed bacterial solution was evenly spread on the LB screening plate (kan +Concentration: 50 μg / mL), cultured overnight at 37°C, picked transformants, cultured in LB liquid medium, extracted plasmids, and obtained recombinant plasmid pET24a(+)-GNIP1Aa-D420L by restriction digestion, PCR and sequencing verification. Then, the recombinant plasmid pET24a(+)-GNIP1Aa-D420L was transformed into E. coli BL21(DE3) competent cells to obtain recombinant bacteria E. coli BL21(DE3), named BL21(DE3) / pET24a(+)-GNIP1Aa-D420L.

[0057] Example 3 Inducible expression and purification of wild-type insecticidal protein GNIP1Aa and insecticidal protein mutant GNIP1Aa-D420L

[0058] The BL21(DE3) / pET-24a(+)-GNIP1Aa obtained in Example 1 and the BL21(DE3) / pET24a(+)-GNIP1Aa-D420L obtained in Example 2 were inoculated into 5 mL LB liquid medium (kan + Concentration: 50 μg / mL) and cultured at 37°C, 180 r / min for 16 h for activation. Transferred to 500 mL LB liquid medium containing the same resistance at a ratio of 1% and cultured at 37°C, 180 r / min until OD 600 =0.6-0.8, add IPTG to a final concentration of 0.4 mM, and induce insecticidal protein expression at 25°C, 180 r / min, for 24 h.

[0059] After 24 h, the cells were collected by centrifugation at 5000 r / min and washed with Binding Buffer (20 mM NaH 2 PO 4 , 0.5M NaCl, 40mM Imidazole; pH = 7.4) for 2 times, and then resuspend the bacteria in 20mL Binding Buffer and ultrasonically disrupt them on ice (400W, 15min, 5s disruption, 5s pause). The fully disrupted bacterial solution was centrifuged at 4℃, 12000r / min for 30min to remove cell debris, and the obtained supernatant was the crude insecticidal protein enzyme solution.

[0060] The crude enzyme solution of insecticidal protein was filtered through a 0.22 μm filter membrane and then purified using a Ni-NTA pre-packed gravity column: first, the purification column was equilibrated with 5 column volumes of Binding Buffer, and then with Elution Buffer (20 mM NaH 2 PO 4, 0.5M NaCl, 500mM Imidazole; pH=7.4) gravity elution of the target protein. The high concentration of imidazole in the Elution Buffer can bind to the nickel sulfate in the Ni-NTA column, thereby forming a competitive relationship with the protein with the His tag, eluting the target protein to obtain an eluate.

[0061] The eluate was poured into an ultrafiltration centrifuge tube (Millipore, 15 mL) with a molecular weight cutoff of 10 kDu or more, and centrifuged at 4 ° C, 4500 g for 2 h to concentrate the target protein solution to about 0.5 mL. 15 mL of pre-cooled 20 mM Tris-HCl (pH = 7.4) was added to resuspend, and the target protein solution was concentrated to about 0.5 ml by centrifugation again. 8 mL of storage buffer (20 mM Tris-HCl, 50% glycerol; pH = 7.4) was added to resuspend to obtain a pure protein solution.

[0062] The protein concentration was measured using nanodrop, and the protein purity was detected by SDS-PAGE gel electrophoresis. The test results were as follows: Figure 1 , showing a band consistent with the theoretical molecular weight between 45-66.2 kDu, that is, the wild-type insecticidal protein GNIP1Aa (amino acid sequence as shown in SEQ ID NO.1) and the insecticidal protein mutant GNIP1Aa-D420L (amino acid sequence as shown in SEQ ID NO.2, i.e., the Asp at position 420 of the wild-type insecticidal protein GNIP1Aa shown in SEQ ID No.1 was mutated to Leu). The remaining protein solution was packaged in 500 μL / tube, quickly frozen and stored at -80°C for later use.

[0063] Example 4 Comparison of thermal stability of wild-type insecticidal protein GNIP1Aa and insecticidal protein mutant GNIP1Aa-D420L

[0064] In order to compare the changes in the thermal stability of the insecticidal protein mutant GNIP1Aa-D420L compared with the wild-type insecticidal protein GNIP1Aa, the two protein solutions were incubated at 60°C for 4 hours. The protein degradation of the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L before and after incubation was quantitatively detected by fluorescent immunoblotting. The area analysis of the immunoblot fluorescence signal was performed using Image lab, and the amount of protein degradation was calculated to characterize the thermal stability of the protein.

[0065] Fluorescent immunoblotting method:

[0066] 1. Preprocessing:

[0067] Before transfer, cut the PVDF membrane to the same size as the gel and soak it in methanol for about 1 minute. Carefully take out the membrane and continue soaking it in distilled water for 2 minutes. At the same time, place the PVDF membrane, 1mm electrotransfer filter paper (7.5×10cm) and sponge in a small tank filled with transfer buffer for 15 minutes.

[0068] 2. Transfer (wet electroblotting):

[0069] Open the electrotransfer clamp and install it according to (-) clamp plate-sponge-filter paper-gel-PVDF membrane-filter paper-sponge-clamp plate (+). Remove all bubbles during the process and clamp the electrotransfer clamp. Fill the electrophoresis tank (put ice cubes on one side of the tank to cool it down) with pre-cooled transfer buffer, insert the electrotransfer clamp, connect the electrodes, turn on the current, and transfer the membrane at 300mV constant current for 45min.

[0070] 3. Membrane Closure

[0071] After the transfer is completed, immediately place the PVDF membrane in the washing solution for 3 times, 1-2 minutes each time, to wash off the transfer solution on the membrane. Add the blocking solution to the incubation box, shake slowly on a shaker, and block at room temperature for 60 minutes.

[0072] 4. Primary Antibody Incubation

[0073] Anti-6×His Tag mouse monoclonal antibody was used as the primary antibody and diluted 3000 times with blocking buffer. The PVDF membrane was incubated overnight at 4°C with slow shaking on a side-to-side shaker. The membrane was rinsed 5 times with washing buffer, 3-5 minutes each time.

[0074] 5. Secondary Antibody Incubation

[0075] According to the type of primary antibody, select the appropriate secondary antibody with fluorescent signal group (Alexa Fluor488-conjugated Goat anti-mouse IgG) and dilute it 200 times with washing buffer. Slowly shake on a side-swing shaker and incubate the PVDF membrane at room temperature for 1 hour. Rinse the membrane with washing buffer 5 times, 3-5 minutes each time. At the beginning of this process, pay attention to avoid light throughout the process.

[0076] 6. Imaging

[0077] Image the membrane immediately while it is still wet, choosing Smart Exposure Imaging BIO-RAD ChemiDoc MP.

[0078] The results are as follows Figure 2As shown, after incubation at 60°C for 4 hours, the remaining rate of the wild-type insecticidal protein GNIP1Aa after degradation was 42.89%, and the remaining rate of the insecticidal protein mutant GNIP1Aa-D420L after degradation was 59.56%, which was 1.38 times that of the wild-type insecticidal protein GNIP1Aa, indicating that the amino acid mutation at position 420 increased the thermal stability of the insecticidal protein by 38%.

[0079] Example 5 Determination of the stomach poisoning effect of wild-type insecticidal protein GNIP1Aa and insecticidal protein mutant GNIP1Aa-D420L on stored-grain pests

[0080] Three Coleopteran stored-grain pests, including 3-5 day-old larvae of tobacco beetle (Lasioderma serricorne), 3-5 day-old larvae of red flour beetle (Tribolium castaneum), 3-5 day-old larvae of yellow mealworm (Tenebrio molitor), and 3-5 day-old larvae of a Lepidoptera stored-grain pest, Indian meal borer (Plodia interpunctella), were selected for the determination of the stomach poison effect.

[0081] Before the gastric toxicity test, the storage buffer of the insecticidal protein stored at -80°C was replaced with ultrapure water using an ultrafiltration centrifuge tube (Millipore, 1.5 mL), and the wild-type insecticidal protein GNIP1Aa and the insecticidal protein mutant GNIP1Aa-D420L were adjusted to the same concentration according to the nanodrop test results. The insecticidal protein solution was mixed evenly with the feed to make the final protein concentration reach 1000 ng / mg to obtain a mixed protein solution feed. The negative control group was ultrapure water, and the positive control group was referred to Table 1.

[0082] The bioassay of tobacco beetles, red flour beetles, and mealworms was carried out in 12-well plates. 0.15 g of mixed protein liquid feed was placed in each well, and the well was sealed with filter paper. After being placed under natural conditions for 2 hours, the test insects were introduced into each well, with one insect in each well. The bioassay of Indian meal moth was carried out in 2 mL centrifuge tubes. 0.15 g of mixed protein liquid feed was placed in each well. After being opened and placed under natural conditions for 2 hours, the test insects were introduced into each well, with one insect in each well, and aeration was performed for 10 minutes in the morning, noon, and evening every day. All test insects were placed in a constant temperature and humidity incubator (27℃±1℃, 75%±5%RH, 16:8(L:D)h) for breeding. The death of the test insects was observed every day (death standard: death was considered as death if the feet and the head and tail were not moved when touched by a brush), and fresh mixed feed was added every 3-4 days, and the death situation for 14 days was recorded. The experiment was repeated three times.

[0083] The results are shown in Table 2, indicating that GNIP1Aa and GNIP1Aa-D420L have a certain lethal effect on tobacco beetles and red flour beetles among the four stored grain pests, with a mortality rate of about 27%, and the insecticidal effect of the insecticidal protein mutant GNIP1Aa-D420L is slightly improved compared with the wild-type insecticidal protein GNIP1Aa.

[0084] Table 1 Biological activity assay information

[0085]

[0086] Table 2 Stomach toxicity results of GNIP1Aa and GNIP1Aa-D420L on stored-grain pests

[0087]

[0088] Note: * indicates that the value is significantly different from the negative control group, P ≤ 0.05

[0089] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention. SEQUENCE LISTING <110> National Grain and Material Reserves Administration Scientific Research Institute <120> An insecticidal protein mutant GNIP1Aa-D420L and its encoding gene and application <130> JLP22I0632 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 536 <212> PRT <213> Artificial Sequence <400> 1 Met Ala Ser Ala Ala Asn Ala Gly Gln Leu Gly Asn Leu Pro Gly Val 1 5 10 15 Thr Ser Met Gly Met Gly Tyr Asp Val Asn Gly Leu Tyr Ala Ser Pro 20 25 30 Glu Ser Leu Leu Gly Gln Pro Leu Phe Asp Phe Gly Gly Glu Leu Asp 35 40 45 Ser Ile Glu Ile Glu Gly Arg Ser Tyr Thr Phe Pro Arg Ser Met His 50 55 60 Val His Thr Tyr Phe His Ser Asp Phe Lys Gln Asp Val Ser Lys Glu 65 70 75 80 Ile Glu Glu Tyr Arg Glu Lys Met Ser Gln His Val Gly Val Ser Gly 85 90 95 Arg Tyr Lys Leu Phe Ser Ala Ser Leu Ser Val Asp Phe Thr Thr Thr 100 105 110 Asp Gln Gln Leu Thr Glu Ile Thr Tyr Ser Ser Thr Arg Glu Ala His 115 120 125 Val Leu Trp Tyr Ile Ser Leu Pro Gly Ala Ala Thr Leu Arg Ser Met 130 135 140 Leu Arg Arg Asp Phe Arg Asp Asp Leu Asn Asn Pro Asn Met Pro Ala 145 150 155 160 Met Glu Leu Phe Lys Arg Tyr Gly Pro Tyr Tyr Ile Ser Glu Ala Ala 165 170 175 Val Gly Gly Arg Leu Asp Tyr Ser Ala Ala Ser Lys Thr Leu Lys Met 180 185 190 Asp Ser Ser Gln Ser Leu Ser Thr Thr Ala Glu Met Ser Tyr Lys Ala 195 200 205 Leu Val Gly Glu Ile Lys Ile Glu His Gly Ser Glu Met Glu Lys Gln 210 215 220 Val Asn Ser Phe Arg Ser Asn Ser Thr Ile Arg Leu Thr Ala Thr Gly 225 230 235 240 Gly Lys Pro Gly Met Thr Asp Arg Ile Leu His Gly Pro Asp Ser Gln 245 250 255 Gln Ala Phe Ser Gln Trp Ala Glu Ser Leu Leu Asp Tyr Ala Thr Leu 260 265 270 Met Asp Phe Ser Thr Glu Ser Leu Gln Pro Ile Trp Ala Leu Ala Asp 275 280 285 Lys Pro Glu Arg Arg Val Glu Leu Glu Asp Ala Phe Pro Glu Phe Met 290 295 300 Lys Gln Ser Gln Gln Ser Ile Pro Lys Val Asp Lys Val Leu Leu Met 305 310 315 320 Asp Ala Arg Pro Pro Met Val Lys Ala Gly Glu Asp Ser Gly Ser Gly 325 330 335 Ala Ser Glu Asp Leu Ala Val Phe Asn Pro Ser Thr Ser Asn Gly Tyr 340 345 350 Lys Met Val Gly Gln Phe Gly Gln Arg Asn His Ala Ser Val Ala Asp 355 360 365 Gly His Ala Pro Ile Phe Lys Asp Leu Phe Asp Leu Gly Val Leu Lys 370 375 380 Ala Pro Val Gly Trp Gln Arg Val Trp Asp Asp Ala Gly Ser Gly Lys 385 390 395 400 Ser Lys Asp Tyr Ala Cys Trp Arg Ala Ile Pro Pro Gln Gly Tyr Arg 405 410 415 Ala Leu Gly Asp Val Met Met Leu Ala Thr Ser Gly Tyr Asn Pro Pro 420 425 430 Asn Leu Pro Asp Tyr Val Cys Val His Gln Ser Leu Cys Ala Asp Val 435 440 445 Gln Thr Leu Gln Asn Arg Val Trp Trp Asp Lys Gly Thr Gly Ala Arg 450 455 460 Lys Asp Val Ser Leu Trp Gln Pro Gly Ala Ala Gly Ala Val Ala Ser 465 470 475 480 Ser Cys Phe Ala Gly Val Pro Asn Tyr Asn Asn Pro Pro Asn Ser Gly 485 490 495 Asp Ile Glu Arg Leu Arg Gly Ser Ile Ala Cys Val Lys Thr Ser Ala 500 505 510 Ile Ala Ser Met Gln Glu Met Lys Ser Met Leu Ser Gln His Gln Gly 515 520 525 Met Glu Ala Met Met Ser Lys Leu 530 535 <210> 2 <211> 490 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Ser Ala Ala Asn Ala Gly Gln Leu Gly Asn Leu Pro Gly Val 1 5 10 15 Thr Ser Met Gly Met Gly Tyr Asp Val Asn Gly Leu Tyr Ala Ser Pro 20 25 30 Glu Ser Leu Leu Gly Gln Pro Leu Phe Asp Phe Gly Gly Glu Leu Asp 35 40 45 Ser Ile Glu Ile Glu Gly Arg Ser Tyr Thr Phe Pro Arg Ser Met His 50 55 60 Val His Thr Tyr Phe His Ser Asp Phe Lys Gln Asp Val Ser Lys Glu 65 70 75 80 Ile Glu Glu Tyr Arg Glu Lys Met Ser Gln His Val Gly Val Ser Gly 85 90 95 Arg Tyr Lys Leu Phe Ser Ala Ser Leu Ser Val Asp Phe Thr Thr Thr 100 105 110 Asp Gln Gln Leu Thr Glu Ile Thr Tyr Ser Ser Thr Arg Glu Ala His 115 120 125 Val Leu Trp Tyr Ile Ser Leu Pro Gly Ala Ala Thr Leu Arg Ser Met 130 135 140 Leu Arg Arg Asp Phe Arg Asp Asp Leu Asn Asn Pro Asn Met Pro Ala 145 150 155 160 Met Glu Leu Phe Lys Arg Tyr Gly Pro Tyr Tyr Ile Ser Glu Ala Ala 165 170 175 Val Gly Gly Arg Leu Asp Tyr Ser Ala Ala Ser Lys Thr Leu Lys Met 180 185 190 Asp Ser Ser Gln Ser Leu Ser Thr Thr Ala Glu Met Ser Tyr Lys Ala 195 200 205 Leu Val Gly Glu Ile Lys Ile Glu His Gly Ser Glu Met Glu Lys Gln 210 215 220 Val Asn Ser Phe Arg Ser Asn Ser Thr Ile Arg Leu Thr Ala Thr Gly 225 230 235 240 Gly Lys Pro Gly Met Thr Asp Arg Ile Leu His Gly Pro Asp Ser Gln 245 250 255 Gln Ala Phe Ser Gln Trp Ala Glu Ser Leu Leu Asp Tyr Ala Thr Leu 260 265 270 Met Asp Phe Ser Thr Glu Ser Leu Gln Pro Ile Trp Ala Leu Ala Asp 275 280 285 Lys Pro Glu Arg Arg Val Glu Leu Glu Asp Ala Phe Pro Glu Phe Met 290 295 300 Lys Gln Ser Gln Gln Ser Ile Pro Lys Val Asp Lys Val Leu Leu Met 305 310 315 320 Asp Ala Arg Pro Pro Met Val Lys Ala Gly Glu Asp Ser Gly Ser Gly 325 330 335 Ala Ser Glu Asp Leu Ala Val Phe Asn Pro Ser Thr Ser Asn Gly Tyr 340 345 350 Lys Met Val Gly Gln Phe Gly Gln Arg Asn His Ala Ser Val Ala Asp 355 360 365 Gly His Ala Pro Ile Phe Lys Asp Leu Phe Asp Leu Gly Val Leu Lys 370 375 380 Ala Pro Val Gly Trp Gln Arg Val Trp Asp Asp Ala Gly Ser Gly Lys 385 390 395 400 Ser Lys Asp Tyr Ala Cys Trp Arg Ala Ile Pro Pro Gln Gly Tyr Arg 405 410 415 Ala Leu Gly Leu Val Met Met Leu Ala Thr Ser Gly Tyr Asn Pro Pro 420 425 430 Asn Leu Pro Asp Tyr Val Cys Val His Gln Ser Leu Cys Ala Asp Val 435 440 445 Gln Thr Leu Gln Asn Arg Val Trp Trp Asp Lys Gly Thr Gly Ala Arg 450 455 460 Lys Asp Val Ser Leu Trp Gln Pro Gly Ala Ala Gly Ala Val Ala Ser 465 470 475 480 Ser Cys Phe Ala Gly Val Pro Asn Tyr Asn 485 490 <210> 3 <211> 1608 <212> DNA <213> Artificial Sequence <400> 3 atggcatccg cagcaaatgc aggtcagctt ggcaacctcc ccggcgttac ttccatgggc 60 atgggctatg acgtgaatgg tttgtacgcc agcccggaaa gcctgcttgg ccaacccttg 120 ttcgatttcg gcggcgagct ggacagcatc gaaatcgagg gccgcagcta cacctttccc 180 cgcagcatgc atgtacacac ctatttccat tccgacttca aacaggatgt cagcaaggaa 240 atcgaagagt atcggggagaa aatgagccag cacgtggggcg tgtccggccg ctacaagttg ttcagcgctt cgctgagcgt ggatttcacc accacggacc agcaactgac cgagattacc 360 420. tacagctcca cccgcgaagc ccatgtgctg tggtacatca gcctgcctgg cgcggccacg ctgcgttcga tgctgcgccg cgatttccgc gacgacctga acaacccca tatgccggcc atggagctgt tcaagcgcta tggtccctac tacatatcgg aagcggcggt gggcggccgg 540 ctggactaca gcgcggccag caagaccttg aagatggaca gcagccagtc gctgtccacc accgccgaaa tgtcctacaa ggcgctggtg ggcgagatca agatcgagca tggctcggag 660 720. atggaaaagc aggtcaacag cttccgcagc aactccacca tccgtctcac cgccaccggc ggcaagccgg gcatgaccga tcgcatactg cacggtccgg attcgcagca ggcgttctcg 780 caatgggcgg aatcgctgct cgactatgcg acgctgatgg acttttccac cgaaagcctg caaccgatct gggcgctggc cgacaagccc gagcgccgcg tcgagcttga ggacgccttc cccgaattca tgaagcagtc gcagcagtcc atccccaagg tggacaaggt gctgctgatg gacgcgcggc cgcctatggt gaaggctggg gaggatagcg gctccggcgc gtcggaggat 1020 ctggctgtgt tcaatcccag cacctccaat ggctacaaga tggttggcca gttcggtcag 1080 cgcaaccatg ccagcgtggc ggatggccat gcgccgattt tcaaggatct gttcgatctg 1140 ggcgtgctga aggcgccggt gggttggcag cgggtgtggg acgacgccgg ctccggcaag 1200 tccaaggact acgcgtgctg gcgcgcgatt ccgccgcagg gctaccgcgc gctgggcctg 1260 gtgatgatgc tggccaccag cggctataac ccgccgaatc tgccggacta tgtttgcgtg 1320 catcaaagcc tgtgcgcgga tgtgcagacg ctgcaaaacc gggtgtggtg ggacaagggc 1380 accggcgcgc gcaaggatgt cagcctgtgg caaccgggcg cggccggcgc ggtggcgtcc 1440 tcttgcttcg ccggcgtgcc taattacaac aacccgccca attccggcga catcgagcgc 1500 ttgcgcggca gcatcgcatg cgtgaagacc agcgcgatcg cgtccatgca ggaaatgaag 1560 tccatgctca gccagcacca aggcatggaa gcgatgatgt ccaagctg 1608 <210> 4 <211> 1608 <212> DNA <213> Artificial Sequence <400> 4 atggcatccg cagcaaatgc aggtcagctt ggcaacctcc ccggcgttac ttccatgggc atgggctatg acgtgaatgg tttgtacgcc agcccggaa gcctgcttgg ccaacccttg ttcgatttcg gcggcgagct ggacagcatc gaaatcgagg gccgcagcta cacctttccc 180 cgcagcatgc atgtacacac ctattccat tccgacttca aacaggatgt cagcaagga atcgaagagt atcggggagaa aatgagccag cacgtggggcg tgtccggccg ctacaagttg ttcagcgctt cgctgagcgt ggatttcacc accacggacc agcaactgac cgagattacc 360 420. tacagctcca cccgcgaagc ccatgtgctg tggtacatca gcctgcctgg cgcggccacg ctgcgttcga tgctgcgccg cgatttccgc gacgacctga acaacccca tatgccggcc atggagctgt tcaagcgcta tggtccctac tacatatcgg aagcggcggt gggcggccgg 540 ctggactaca gcgcggccag caagaccttg aagatggaca gcagccagtc gctgtccacc accgccgaaa tgtcctacaa ggcgctggtg ggcgagatca agatcgagca tggctcggag 660 720. atggaaaagc aggtcaacag cttccgcagc aactccacca tccgtctcac cgccaccggc ggcaagccgg gcatgaccga tcgcatactg cacggtccgg attcgcagca ggcgttctcg 780 caatgggcgg aatcgctgct cgactatgcg acgctgatgg acttttccac cgaaagcctg 840 caaccgatct gggcgctggc cgacaagccc gagcgccgcg tcgagcttga ggacgccttc 900 cccgaattca tgaagcagtc gcagcagtcc atccccaagg tggacaaggt gctgctgatg 960 gacgcgcggc cgcctatggt gaaggctggg gaggatagcg gctccggcgc gtcggaggat 1020 ctggctgtgt tcaatcccag cacctccaat ggctacaaga tggttggcca gttcggtcag 1080 cgcaaccatg ccagcgtggc ggatggccat gcgccgattt tcaaggatct gttcgatctg 1140 ggcgtgctga aggcgccggt gggttggcag cgggtgtggg acgacgccgg ctccggcaag 1200 tccaaggact acgcgtgctg gcgcgcgatt ccgccgcagg gctaccgcgc gctgggcgat 1260 gtgatgatgc tggccaccag cggctataac ccgccgaatc tgccggacta tgtttgcgtg 1320 catcaaagcc tgtgcgcgga tgtgcagacg ctgcaaaacc gggtgtggtg ggacaagggc 1380 accggcgcgc gcaaggatgt cagcctgtgg caaccgggcg cggccggcgc ggtggcgtcc 1440 tcttgcttcg ccggcgtgcc taattacaac aacccgccca attccggcga catcgagcgc 1500 ttgcgcggca gcatcgcatg cgtgaagacc agcgcgatcg cgtccatgca ggaaatgaag 1560 tccatgctca gccagcacca aggcatggaa gcgatgatgt ccaagctg 1608 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <400> 5 tttaacttta agaaggagat atacaatggc aagcgcagca aatg 44 <210> 6 <211> 47 <212> DNA <213> Artificial Sequence <400> 6 tggtggtggt gctcgagtgc cagtttgctc atcattgctt ccatacc 47 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <400> 7 cctcagggtt atcgtgcact gggtctggtt atgatgctg 39 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <400> 8 ctggttgcca gcatcataac cagacccagt gcacg 35

Claims

1. An insecticidal protein mutant GNIP1Aa-D420L, characterized in that: The insecticidal protein mutant GNIP1Aa-D420L is obtained by mutating the Asp at position 420 of the wild-type insecticidal protein GNIP1Aa shown in SEQ ID No. 1 to Leu.

2. The gene encoding the insecticidal protein mutant GNIP1Aa-D420L as claimed in claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A recombinant vector comprising the coding gene according to claim 2 or 3.

5. The recombinant vector according to claim 4, characterized in that The recombinant vector is a recombinant vector pET-24a(+)-GNIP1Aa-D420L obtained by connecting the coding gene of claim 2 or 3 between the Not Ⅰ and Nde Ⅰ restriction sites of pET-24a(+) and keeping other sequences of pET-24a(+) unchanged.

6. A recombinant bacterium comprising the recombinant vector according to claim 4 or 5.

7. The method for preparing the insecticidal protein mutant GNIP1Aa-D420L according to claim 1, characterized in that: The following steps are involved: (1) Design primers carrying mutation sites for the mutation site of the insecticidal protein mutant GNIP1Aa-D420L described in claim 1, perform site-directed mutagenesis PCR using a plasmid containing the gene encoding the wild-type insecticidal protein GNIP1Aa as a template, and connect to a vector to obtain a recombinant vector containing the gene encoding the insecticidal protein mutant GNIP1Aa-D420L; (2) The recombinant vector transforms the host cell to obtain the recombinant bacteria; (3) Cultivate recombinant bacteria and induce protein expression; (4) Recovering and purifying to obtain the insecticidal protein mutant GNIP1Aa-D420L.

8. Use of the insecticidal protein mutant GNIP1Aa-D420L according to claim 1 in killing stored-grain pests or in preparing products for killing stored-grain pests, wherein: The stored-grain pests are tobacco beetles or red flour beetles.

Images