A new coronavirus (SARS-CoV-2) recombinant antigen and its application

Abstract

The present invention discloses a recombinant antigen of a novel coronavirus (SARS-CoV-2) and its application, which belongs to the field of bioengineering technology. The antigen is a fusion protein of the nucleocapsid protein and the spike protein of the novel coronavirus BA.2.12.1 mutant strain expressed by a genetic engineering method, and the recombinant antigen has an amino acid sequence as shown in SEQ ID NO: 1. Experimental results show that the use of the fusion protein of the nucleocapsid protein and the spike protein as a marker antigen has a higher detection rate in the detection of novel coronavirus IgM antibodies than the use of the nucleocapsid protein alone or the spike protein alone; the use of the fusion protein of the nucleocapsid protein and the spike protein as a marker antigen has a higher detection rate in the detection of novel coronavirus IgG antibodies than the use of the nucleocapsid protein alone or the spike protein alone; the detection rate of the recombinant antigen using the novel coronavirus BA.2.12.1 mutant strain as a template is higher than that using the early non-mutated strain Wuhan-Hu-1 as a template in the detection of samples collected recently.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and specifically relates to a novel coronavirus recombinant antigen, gene, plasmid containing the same, host cell and application. Background Art

[0002] The coronavirus family belongs to the order Virales and the family Coronaviridae, and is further divided into four genera: α, β, γ, and δ. SARS-CoV-2 belongs to the β genus and has a continuous linear single-stranded RNA genome of 29,891 nucleotides. It can cause COVID-19, a novel coronavirus disease. Symptoms include fever, cough, fatigue, chest tightness, headache, muscle aches, sore throat, and diarrhea.

[0003] Currently, there is no specific treatment for novel coronavirus pneumonia. Early diagnosis, isolation, and treatment are key to preventing the spread of the disease and increasing the cure rate. However, the initial symptoms of the disease are mainly fever, dry cough, and fatigue, which are difficult to distinguish from common influenza. In addition, some patients only have a low-to-moderate fever or even no obvious fever symptoms. The lack of obvious specific clinical manifestations increases the difficulty of clinical diagnosis and the speed of virus transmission. In addition, the novel coronavirus has an incubation period after infecting the human body (median time 3.0 days, up to more than 3 weeks), and is highly contagious during the incubation period. Therefore, rapid and accurate diagnosis of novel coronavirus infection is crucial to promptly interrupt the spread of the virus.

[0004] Laboratory testing for the novel coronavirus includes nucleic acid testing, serum antibody testing, and antigen testing. Nucleic acid testing, with its advantages of early diagnosis, high sensitivity, and specificity, is the gold standard for laboratory diagnosis of COVID-19. Currently, the most widely used method is real-time fluorescence quantitative RT-PCR. Samples for nucleic acid testing typically include nasal swabs, throat swabs, nasopharyngeal swabs, sputum, bronchial lavage fluid, and alveolar lavage fluid. However, nucleic acid testing also presents several challenges: 1. Improper sampling, improper specimen storage, the use of different specimen types, and the use of reagents from different manufacturers can all result in false negative results and missed diagnoses. 2. Highly sensitive nucleic acid detectors are expensive and require high laboratory cleanliness and operator skills, making them difficult to scale up in small and medium-sized hospitals and at the grassroots level. 3. Nucleic acid testing is time-consuming; a single RT-PCR test typically takes 2-3 hours to complete. However, given sample transportation and the large sample backlog, reporting results often takes even longer.

[0005] Therefore, when the nucleic acid test is negative, adding serum IgM and IgG antibody tests can make up for the shortcomings of nucleic acid testing that easily lead to missed diagnoses. 3-6 days after the onset of novel coronavirus pneumonia, the first thing that appears is immunoglobulin IgM antibodies, and then IgG antibodies appear 10-18 days later. Therefore, an increase in IgM antibodies indicates a recent acute infection, and an increase in IgG antibodies indicates a past infection. Moreover, the dynamic monitoring of serum IgM and IgG antibody levels plays a positive role in judging the progression of the patient's condition and treatment. The biggest advantage of serological testing is that it is convenient and fast, with a short testing time. It can effectively break through the limitations of existing testing technologies on personnel and places, shorten the testing time, and has been written into the "Diagnostic Protocol for New Coronavirus Pneumonia (Trial Seventh Edition)".

[0006] The novel coronavirus antigen test can directly detect whether a human sample contains the novel coronavirus. It is fast, accurate, and requires minimal equipment and personnel. However, the virus is present in lower quantities in upper respiratory tract samples, making it easy to miss a test.

[0007] The nucleic acid / antibody / antigen tests for the new coronavirus each have their own focus and cannot replace each other. Multiple detection methods are used in combination to complement each other, combining molecular biology and immune level detection to give full play to their respective advantages, improve sensitivity and specificity, effectively shorten the detection window period, increase the positive detection rate, and provide detection protection for various possible risk groups.

[0008] In the antibody detection of the new coronavirus, the nucleocapsid protein encoded by the N gene is mainly used as the diagnostic antigen, but the use of nucleocapsid protein alone cannot achieve high sensitivity and detection rate. After supplementing with the spike protein, the sensitivity and detection rate can be improved.

[0009] The novel coronavirus has been circulating for two and a half years, with over 1,000 variants detected. As mutations increase, existing antibody detection methods have begun to miss detections to varying degrees. The currently prevalent variant is the BA.2.12.1 mutant. Using this as a template, we have recombinantly expressed a fusion protein of the nucleocapsid and spike proteins, which improves the detection rate of novel coronavirus antibodies. Summary of the Invention

[0010] 1. Problems to be solved

[0011] In response to the technical problems raised in the background technology, the present application provides a fusion protein of the nucleocapsid protein and spike protein of the new coronavirus BA.2.12.1 mutant strain, a gene, a plasmid containing the same, a host cell and its application. This protein can be used as a target antigen for antibody detection of the new coronavirus to improve the sensitivity and detection rate.

[0012] 2. Technical solution

[0013] To solve the above problems, the present invention adopts the following technical solutions.

[0014] A recombinant antigen of a novel coronavirus (SARS-CoV-2),

[0015] The fragment of the recombinant antigen is a fusion protein of amino acids 1 to 213 of the nucleocapsid protein of the new coronavirus BA.2.12.1 mutant strain and amino acids 319 to 537 of the spike protein.

[0016] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0017] The recombinant antigens include the following:

[0018] (a) a protein consisting of the amino acid sequence shown in SEQ ID No. 1; or

[0019] (b) A protein derived from (a) having the recombinant antigen activity, wherein one or more amino acids are substituted, deleted or added in the amino acid sequence shown in SEQ ID No. 1.

[0020] The above-mentioned novel coronavirus (SARS-CoV-2) recombinant antigen,

[0021] The recombinant antigens include the following:

[0022] (a) a protein encoded by the nucleotide sequence shown in SEQ ID No. 2; or

[0023] (b) One or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID No. 2 and can encode a protein derived from (a) having the recombinant antigen activity.

[0024] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0025] Also included is an expression gene, which is used to encode the novel coronavirus recombinant antigen;

[0026] The expressed genes include the following:

[0027] (a) the nucleotide sequence shown in SEQ ID No. 2; or

[0028] (b) A nucleotide sequence having the recombinant antigen activity is encoded by substituting, deleting or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 2.

[0029] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0030] The expression gene expresses a fusion protein of amino acids 1 to 213 of the nucleocapsid protein of the new coronavirus BA.2.12.1 mutant strain and amino acids 319 to 537 of the spike protein.

[0031] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0032] The expression gene also uses a flexible linker (GGGGS) 3 as a linker for the fusion protein.

[0033] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0034] The expression gene is connected with 6 histidines at the C-terminus of the protein.

[0035] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0036] Also included is a recombinant plasmid containing the expression gene.

[0037] The novel coronavirus (SARS-CoV-2) recombinant antigen described above,

[0038] Also included are host expression cells, which are used to express the recombinant antigen.

[0039] An application of the novel coronavirus recombinant antigen as described above, wherein the novel coronavirus recombinant antigen is used to prepare a novel coronavirus antibody detection reagent.

[0040] 3. Beneficial effects

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] In the present invention, the term novel coronavirus nucleocapsid protein refers to the protein encoded by the novel coronavirus N gene, and the term novel coronavirus spike protein refers to the protein encoded by the novel coronavirus S gene; in order to improve the detection rate, the currently prevalent variant strain BA.2.12.1 mutant was selected as a template; in order to improve the expression yield and diagnostic specificity, the 1st to 213th amino acids of the novel coronavirus nucleocapsid protein were truncated, and the 319th to 537th amino acids of the novel coronavirus spike protein were truncated; a flexible linker (GGGGS) 3 was used as a linker for the fusion protein; in order to have better activity, a eukaryotic expression system was selected to express the target protein; in order to facilitate purification, 6 histidines were added to the C-terminus of the protein. At the same time, the experimental results showed that the use of a fusion protein of nucleocapsid protein and spike protein as a marker antigen has a higher detection rate in the detection of new coronavirus IgM antibodies than using nucleocapsid protein alone or spike protein alone; the experimental results showed that the use of a fusion protein of nucleocapsid protein and spike protein as a marker antigen has a higher detection rate in the detection of new coronavirus IgG antibodies than using nucleocapsid protein alone or spike protein alone; the experimental results showed that the recombinant antigen using the new coronavirus BA.2.12.1 mutant strain as a template has a higher detection rate in the detection of recently collected samples than using the early non-mutated strain Wuhan-Hu-1 as a template. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the agarose electrophoresis diagram of the target gene PCR amplification, where "1" is the PCR product and "M" is the DNA molecular weight standard Marker F.

[0044] Figure 2 This is the SDS-PAGE electrophoresis diagram after purification of the recombinant antigen, where "1" is the loading sample, "2" is the run-through, "3" is the 10mM imidazole elution peak, "4" is the 100mM imidazole elution peak, "5" is the 300mM imidazole elution peak, "6" is the filler, and "M" is the low molecular weight protein marker (14.4-97.4kDa). DETAILED DESCRIPTION

[0045] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0046] Unless otherwise defined, terms used herein have the meanings commonly understood by one of ordinary skill in the art to which the present invention relates.

[0047] Example 1

[0048] Design and expression plasmid construction of NP+SP fusion protein of novel coronavirus BA.2.12.1 mutant strain

[0049] (1) Selection of amino acid sequence for the nucleocapsid protein expression region: select amino acids 1 to 213 of the nucleocapsid protein; selection of amino acid sequence for the spike protein expression region: select amino acids 319 to 537 of the spike protein; selection of linker: select (GGGGS)3 as the linker for the two proteins; selection of purification tag: add 6 histidines to the C-terminus of the fusion protein as a purification tag. The amino acid sequence is shown in SEQ ID No. 1.

[0050] (2) Codon optimization: The codons of the expressed protein were optimized according to the codon preference of human cells, and the Kpn I restriction site GGTACC was added at the 5' end, and the stop codon TGA and Xba I restriction site TCTAGA were added at the 3' end. After optimization, the gene sequence is as shown in SEQ ID NO: 2.

[0051] (3) Gene synthesis: Entrust GENEWIZ to synthesize the optimized gene sequence and connect it to the pUC57 plasmid.

[0052] (4) PCR Amplification: Primer sequences P1 and P2 were designed. Using the synthesized plasmid as a template, the antigen DNA fragment was obtained by PCR. The estimated PCR product size was 1379 bp. The primer sequences are shown in Table 1 and were synthesized by Genewise.

[0053] Table 1: Amplification primers

[0054] Primer name sequence Restriction site P1 GAGGTACCATGAGCGACAATG KpN P2 GTTCTAGACTCAATGGTGATGGTG XB

[0055] The PCR reaction system is 50 μl, as shown in Table 2:

[0056] Table 2

[0057] Synthetic plasmid 1 μl 2.5 mM dNTPs 4 μl 10xPfuBuffer 5μl PfuDNA polymerase 0.5 μl Primer P1 0.5 μl Primer P2 0.5 μl <![CDATA[ddH2O]]> 38.5μl

[0058] The reaction conditions were: 3 min denaturation at 95°C; 30 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 40 s; and 5 min extension at 72°C. Electrophoresis was performed on a 1% agarose gel at 160 volts. Specific bands appeared between 1000 and 1500 bp, such as Figure 1 shown.

[0059] (5) Double enzyme digestion: DNA fragments were recovered using a PCR product recovery kit (purchased from Shanghai Biotech), and then double enzyme digestion was performed using restriction endonucleases Kpn I and Xba I (purchased from NEB). The digestion products were recovered using a gel recovery kit (purchased from Shanghai Biotech).

[0060] (6) Ligation and transformation: The double-digested fragment was ligated with T4 DNA ligase (purchased from Shanghai Bioengineering) to the pCB2 eukaryotic expression plasmid constructed by our company and similarly digested with double enzymes to obtain the expression plasmid pCB2 / SARS-CoV-2. The expression plasmid was transformed into DH5α competent cells and plated on ampicillin-resistant agar plates for culture.

[0061] (7) Identification and sequencing: PCR identification was performed on the single-spot colonies grown on the plate, and the positive colonies were sent to GeneWeiZhi for sequencing. The sequencing sequence was consistent with the expected sequence:

[0062]

[0063] Example 2

[0064] Expression of NP+SP fusion protein

[0065] (1) Plasmid extraction: The strain with the correct sequencing result was amplified and cultured, and the plasmid was extracted using a large extraction kit (purchased from Shanghai Biotechnology Co., Ltd.) for later use.

[0066] (2) Cell culture: HEK293 cells (from Zhuhai Kairui) were placed in a 5% CO2 constant temperature shaker at 37°C and 100 rpm for constant shaking culture.

[0067] (3) Transient transfection: When the density of HEK293 cells reaches 2.0×10 6 / mL, the expression plasmid and transfection reagent TA293 (purchased from Zhuhai Kairui) were added at a ratio of 1 mg / L, and the nutrient additive KT-Feed (purchased from Zhuhai Kairui) was added 24 hours after transfection.

[0068] (4) Harvest: Harvest 6 days after transient transfection by centrifugation at 300 g for 10 min and collect the supernatant.

[0069] Example 3

[0070] Purification of NP+SP fusion protein

[0071] (1) Base solution preparation: 20 mM Tris-HCl, 200 mM NaCl, pH 8.0.

[0072] (2) Column packing: Ni-Smart filler (purchased from Changzhou Tiandi Renhe Biotechnology Co., Ltd.) was added to the chromatographic column, eluted with base solution for equilibrium, and the baseline was adjusted.

[0073] (3) Sample loading: Centrifuge the harvested supernatant at 15,000 g for 10 min, and pump the supernatant into the chromatographic column using a peristaltic pump.

[0074] (4) Elution: Use base solution and different concentrations of imidazole (10mM, 100mM, 300mM) for elution, and collect the elution peak. Figure 2 .

[0075] Example 4

[0076] Dialysis and post-processing of NP+SP fusion protein

[0077] (1) Dialyze the eluted peak twice with 100 mM imidazole using 80 volumes of dialysate (20 mM Tris-HCl, pH 8.0) at 4°C.

[0078] (2) The dialyzed sample was collected, centrifuged at 15,000 g for 10 min, and concentrated using an ultrafiltration concentrator (purchased from Millipore, with a protein molecular weight cutoff of 10 kD). The concentrated sample was collected, which was the recombinant fusion protein.

[0079] (3) Determine the protein concentration and store at -20℃ for later use.

[0080] Example 5

[0081] Preparation of a novel coronavirus IgM antibody test strip (lateral flow immunochromatographic capture method)

[0082] (1) Mouse anti-human IgM monoclonal antibody was streaked onto the detection line (T line) of the lateral flow immunochromatography strip NC membrane at a concentration of 1.0 mg / ml using a streaking instrument (Hangzhou Glen Kun Technology Co., Ltd.).

[0083] (2) Use a membrane stripper to streak goat anti-rabbit IgG antibody at a concentration of 1.0 mg / ml on the quality control line (C line) of the NC membrane.

[0084] (3) NP+SP recombinant fusion protein labeled colloidal gold particles:

[0085] Take 4 ml of gold particles with a diameter of 45 nm, add 0.2 M K2CO3 solution at a ratio of about 25 μl / ml, and adjust the pH to 8.0.

[0086] NP+SP fusion protein was added at a concentration of 12 μg / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 15 minutes.

[0087] 10% BSA was added as a blocking agent at a ratio of 50 μl / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 20 minutes.

[0088] Centrifuge at 12000g for 30 min at 4°C and discard the supernatant as much as possible.

[0089] (4) Rabbit IgG antibody labeled colloidal gold particles:

[0090] Take 4 ml of gold particles with a diameter of 45 nm, add 0.2 M K2CO3 solution at a ratio of about 25 μl / ml, and adjust the pH to 8.0.

[0091] Rabbit IgG antibody was added at a concentration of 12 μg / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 15 minutes.

[0092] 10% BSA was added as a blocking agent at a ratio of 50 μl / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 20 minutes.

[0093] Centrifuge at 12000g for 30 min at 4°C and discard the supernatant as much as possible.

[0094] (5) Preparation of gold pad:

[0095] Use a pipette to draw 2 ml of suspension (50 mM Tris-Cl, pH 8.0) to disperse and evenly distribute the centrifugal precipitates from steps (3) and (4), and adjust the volume to 4 ml.

[0096] The solution was sprayed onto a 0.5 cm*30 cm (width*length) glass fiber gold pad at a ratio of 650 μl / strip, and placed in an oven at 42° C. and baked overnight.

[0097] (6) Assembling and cutting strips: Assemble the four components, namely, absorbent paper, NC membrane coated with mouse anti-human IgM and goat anti-rabbit IgG, gold pad containing gold-labeled NP+SP fusion protein and gold-labeled rabbit IgG antibody, and sample pad, in order from top to bottom. Divide and cut the assembled colloidal gold plate into strips to make test cards.

[0098] (7) Detection: Add 35 μl of the sample to be tested and 70 μl of sample diluent to the sample well of the test card, and observe the test results after 15 minutes.

[0099] Example 6

[0100] Preparation of a novel coronavirus IgG antibody detection reagent strip (lateral flow immunochromatographic capture method)

[0101] (1) Mouse anti-human IgG monoclonal antibody was streaked onto the detection line (T line) of the lateral flow immunochromatography strip NC membrane at a concentration of 1.0 mg / ml using a streaking instrument (Hangzhou Glen Kun Technology Co., Ltd.).

[0102] (2) Use a membrane stripper to streak goat anti-rabbit IgG antibody at a concentration of 1.0 mg / ml on the quality control line (C line) of the NC membrane.

[0103] (3) NP+SP recombinant fusion protein labeled colloidal gold particles:

[0104] Take 4 ml of gold particles with a diameter of 45 nm, add 0.2 M K2CO3 solution at a ratio of about 25 μl / ml, and adjust the pH to 8.0.

[0105] NP+SP fusion protein was added at a concentration of 12 μg / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 15 minutes.

[0106] 10% BSA was added as a blocking agent at a ratio of 50 μl / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 20 minutes.

[0107] Centrifuge at 12000g for 30 min at 4°C and discard the supernatant as much as possible.

[0108] (4) Rabbit IgG antibody labeled colloidal gold particles:

[0109] Take 4 ml of gold particles with a diameter of 45 nm, add 0.2 M K2CO3 solution at a ratio of about 25 μl / ml, and adjust the pH to 8.0.

[0110] Rabbit IgG antibody was added at a concentration of 12 μg / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 15 minutes.

[0111] 10% BSA was added as a blocking agent at a ratio of 50 μl / ml, and the mixture was stirred at 500 rpm in a magnetic stirrer at room temperature for 20 minutes.

[0112] Centrifuge at 12000g for 30 min at 4°C and discard the supernatant as much as possible.

[0113] (5) Preparation of gold pad:

[0114] Use a pipette to draw 2 ml of suspension (50 mM Tris-Cl, pH 8.0) to disperse and evenly distribute the centrifugal precipitates from steps (3) and (4), and adjust the volume to 4 ml.

[0115] The solution was sprayed onto a 0.5 cm*30 cm (width*length) glass fiber gold pad at a ratio of 650 μl / strip, and placed in an oven at 42° C. and baked overnight.

[0116] (6) Assembling and cutting strips: Assemble the four components, namely, absorbent paper, NC membrane coated with mouse anti-human IgG and goat anti-rabbit IgG, gold pad containing gold-labeled NP+SP fusion protein and gold-labeled rabbit IgG antibody, and sample pad, in order from top to bottom. Divide and cut the assembled colloidal gold plate into strips to make test cards.

[0117] (7) Detection: Add 35 μl of the sample to be tested and 70 μl of sample diluent to the sample well of the test card, and observe the test results after 15 minutes.

[0118] Example 7

[0119] Prepared test strips are used to test clinical samples collected by partners

[0120] (1) The novel coronavirus IgM antibody detection reagent strip was prepared using the method in Example 5. The labeled antigens were NP+SP fusion protein and separately expressed nucleocapsid protein (NP) and spike protein (SP), respectively. 83 clinical serum samples from patients diagnosed with novel coronavirus pneumonia were collected by the testing partners from April 15 to May 20, 2022. The results are shown in Table 3. The detection rate of NP+SP fusion protein was higher.

[0121] Table 3 Results of novel coronavirus IgM antibody test

[0122] Labeled antigen Number of positive tests Negative test results Detection rate Nucleocapsid protein (NP) 43 40 51.8％ Spike protein (SP) 31 52 37.3％ NP+SP fusion protein 50 33 60.2％

[0123] (2) The novel coronavirus IgG antibody detection reagent strip was prepared using the method in Example 6. The labeled antigens were NP+SP fusion protein and separately expressed nucleocapsid protein (NP) and spike protein (SP), respectively. 83 clinical serum samples from patients diagnosed with novel coronavirus pneumonia were collected by the testing partners from April 15 to May 20, 2022. The results are shown in Table 4. The detection rate of NP+SP fusion protein was higher.

[0124] Table 4 Novel Coronavirus IgG Antibody Test Results

[0125] Labeled antigen Number of positive tests Negative test results Detection rate Nucleocapsid protein (NP) 32 51 38.6％ Spike protein (SP) 24 59 28.9％ NP+SP fusion protein 36 47 43.4％

[0126] (3) The method in Example 5 was used to prepare a new coronavirus IgM antibody detection reagent strip, and the labeled antigens were NP+SP fusion protein using the new coronavirus BA.2.12.1 mutant strain as a template and NP+SP fusion protein using the early non-mutated strain Wuhan-Hu-1 as a template. 83 clinical serum samples of patients diagnosed with new coronavirus pneumonia were collected by the testing partners from April 15 to May 20, 2022. The results are shown in Table 5. The detection rate using the BA.2.12.1 mutant strain as a template was higher.

[0127] Table 5 Results of novel coronavirus IgM antibody test

[0128] Template strain Number of positive tests Negative test results Detection rate Wuhan-Hu-1 46 37 55.4％ BA.2.12.1 50 33 60.2％

[0129] The above content is a further detailed description of the present invention in conjunction with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the concept of the present invention, which should be regarded as falling within the scope of protection determined by the claims submitted for the present invention.

[0130]

[0131]

[0132]

[0133]

Claims

1. A recombinant antigen of a novel coronavirus (SARS-CoV-2), characterized by: The amino acid sequence of the recombinant antigen is shown in SEQ ID No. 1; The fragment of the recombinant antigen is a fusion protein of amino acids 1 to 213 of the nucleocapsid protein of the new coronavirus BA.2.12.1 mutant strain and amino acids 319 to 537 of the spike protein.

2. A nucleotide sequence encoding a recombinant antigen of the novel coronavirus (SARS-CoV-2) according to claim 1, characterized in that: The nucleotide sequence is shown in SEQ ID No.

2.

3. A recombinant granulation, characterized in that: The recombinant plasmid contains the nucleotide sequence according to claim 2.

4. A host expression cell, characterized in that: The host expression cell is used to express the recombinant antigen according to claim 1.

5. A use of a recombinant antigen of the novel coronavirus (SARS-CoV-2) as claimed in claim 1, characterized in that: The novel coronavirus recombinant antigen is used to prepare a novel coronavirus antibody detection reagent.

Images