SSR molecular marker E201 for identifying hybrids of Chinese pumpkin 'Zhongshuzhen No. 1' and its primers, kit and method

Abstract

The present invention "A SSR primer and identification method for identifying Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid" belongs to the field of biotechnology-assisted breeding. The primer pair used for PCR amplification of molecular markers is E201-F and E201-R, the nucleotide sequence of E201-F is shown in SEQ ID No. 3, and the nucleotide sequence of E201-R is shown in SEQ ID No. 4. Based on the PCR amplification reaction, the SSR molecular marker can quickly complete the purity identification of the Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid in a short time, with high stability, simple and fast method, accurate results, and solves the problems of long identification cycle and inaccurate identification in the existing Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid variety identification, and can be applied to molecular marker-assisted breeding screening of the purity of Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid seeds.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology-assisted breeding, and particularly relates to an SSR molecular marker E201 for identifying Chinese pumpkin 'Zhongshuzhen No. 1' hybrid and primers, a kit and a method thereof. Background Art

[0002] Chinese pumpkin (Cucurbita moschataD.), an annual vine herb, is widely cultivated and planted as an important vegetable crop in the world. Due to the existence of hybrid vigor, the hybrid first generation is significantly superior to the two parents in terms of disease resistance, stress resistance and fruit quality. However, during the hybrid seed production process of Chinese pumpkin, due to the incomplete or untimely removal of the male flowers of the female parent during pollination, pollen falls on the female flower stigma of the female parent to produce self-fertilized seeds, thereby producing false hybrids, resulting in a decrease in seed genetic purity, causing huge economic losses to production. Therefore, the rapid and accurate identification of the purity of the first generation hybrid has become one of the most urgent problems to be solved in the production of Chinese pumpkin.

[0003] Common methods for seed purity identification include field morphological identification, isozyme identification, and molecular marker identification. Field morphological identification is costly and time-consuming, and the identification results are also affected by environmental factors; isozyme identification is highly accurate, but its application is often limited due to its tissue and organ specificity. Molecular marker technology can reveal tiny genetic differences between offspring and parents at the DNA level, is not affected by growing seasons, environmental conditions, and cultivation measures, and can greatly shorten the identification time. SSR markers have the advantages of high polymorphism, large number, good stability, and easy detection, and are widely used in purity identification and molecular marker-assisted breeding.

[0004] In recent years, Chinese pumpkin 'Zhongshuzhen No. 1' is often used as a rootstock to improve the stress resistance of Cucurbitaceae crops such as cucumbers and watermelons due to its vigorous growth, strong disease resistance and strong root system. The promotion area is expanding day by day, and the demand for seeds is increasing accordingly. In order to prevent the phenomenon of false hybrids formed by self-pollination of the female parent during artificial seed production, it is urgent to determine the purity identification method of hybrid seeds of Chinese pumpkin 'Zhongshuzhen No. 1' to provide technical support for the purity identification of Chinese pumpkin. Summary of the invention

[0005] Based on the gap in the above-mentioned field, the present invention aims to provide an SSR molecular marker for identifying the seed purity of the hybrid of Chinese pumpkin 'Zhong Shuzhen No. 1'; provide a PCR detection kit for identifying the seed purity of the hybrid of Chinese pumpkin 'Zhong Shuzhen No. 1'; apply the SSR marker to identify the authenticity or seed purity of the hybrid of Chinese pumpkin 'Zhong Shuzhen No. 1', so that there is no need to wait for the pumpkin plant to grow to the fruit maturity stage and then observe the morphological characteristics. DNA can be extracted in the seedling stage, and true and false hybrids can be distinguished according to the amplified fragments, thereby effectively identifying the purity of the hybrid.

[0006] The above object of the present invention is achieved through the following technical solutions:

[0007] The SSR molecular marker E201 used to identify the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1' is characterized in that the sequence of the upstream primer E201-F for detecting the SSR molecular marker E201 is shown in SEQ ID NO.3, and the sequence of the downstream primer E201-R is shown in SEQ ID NO.4.

[0008] The characteristic band sequence of the SSR molecular marker in the genome of the female parent '823' of the Chinese pumpkin 'Zhongshuzhen No. 1' hybrid is shown in SEQ ID NO.1.

[0009] The characteristic band sequence of the SSR molecular marker in the genome of the male parent '824' of the Chinese pumpkin 'Zhongshuzhen No. 1' hybrid is as shown in SEQ ID NO. 2;

[0010] Preferably, the characteristic band sequences of the SSR molecular markers in the genome of the Chinese pumpkin 'Zhongshuzhen No. 1' hybrid are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0011] A primer for detecting SSR molecular marker E201 for identifying Chinese pumpkin 'Zhongshuzhen No. 1' hybrid, characterized in that the upstream primer E201-F sequence is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0012] A primer for molecular identification of Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid, characterized by comprising: a primer for detecting the SSR molecular marker E201 used to identify the Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0013] A kit for identifying the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1' is characterized by comprising: a primer for detecting the SSR molecular marker E201 used to identify the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1'; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0014] The kit for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1' also includes: PCR reagent and / or electrophoresis reagent.

[0015] A method for molecular identification of Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid, characterized in that PCR is performed on candidate pumpkin materials using primers for detecting SSR molecular marker E201 used for identifying Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid.

[0016] The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0017] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μl;

[0018] Preferably, the PCR procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes;

[0019] Preferably, the DNA template refers to the DNA of a candidate pumpkin material.

[0020] Determine the identification result according to the electrophoresis result or sequencing result of the PCR product;

[0021] The candidate pumpkin material with two characteristic bands shown in the electrophoresis results or two sequences shown in SEQ ID NO.1 and SEQ ID NO.2 simultaneously detected in the sequencing results is the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1';

[0022] Preferably, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0023] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining is performed after electrophoresis.

[0024] The invention provides an SSR molecular marker E201 and a primer pair E201-F and E201-R thereof, which are mainly used in pumpkin hybrid seed purity identification and auxiliary identification, pumpkin hybrid seed purity screening and pumpkin molecular marker-assisted breeding.

[0025] Another aspect of the present invention is to provide a PCR detection kit for the authenticity of the hybrid of the Chinese pumpkin variety 'Zhong Shuzhen No. 1' or the purity of the hybrid seeds of 'Zhong Shuzhen No. 1'. The PCR detection kit comprises: dNTPs, Taq enzyme, a PCR primer pair consisting of a forward primer and a reverse primer, an amplification buffer and sterile water; wherein the PCR primer is the SSR molecular marker E201 described above.

[0026] Another aspect of the present invention is to provide a method for identifying the authenticity or seed purity of the Chinese pumpkin variety 'Zhong Shu Zhen No. 1': using the SSR marker, through PCR amplification, and 6% non-denaturing polyacrylamide gel electrophoresis detection, the polymorphism between different individuals can be displayed, thereby achieving the purpose of identification.

[0027] Specifically, the present invention provides a method for identifying the seed purity of the Chinese pumpkin variety 'Zhongshuzhen No. 1' based on SSR markers, and the identification method comprises:

[0028] (1) extracting genomic DNA from a pumpkin seed sample to be tested;

[0029] (2) using the extracted sample genomic DNA as a template, performing PCR amplification reaction using the upstream and downstream primers E201-F and E201-R shown in SEQ ID No. 3 and SEQ ID No. 4 to obtain a PCR product;

[0030] (3) performing polyacrylamide gel electrophoresis on the PCR amplification product of step (2);

[0031] (4) Analyze the electrophoresis results of step (3). If the band pattern of each amplified product has the band pattern of the parent of the hybrid "Zhong Shu Zhen No. 1", then the pumpkin variety to be tested is the hybrid "Zhong Shu Zhen No. 1"; if the band pattern of any amplified product does not have the band pattern of the parent of the hybrid "Zhong Shu Zhen No. 1", then the pumpkin variety to be tested is not the hybrid "Zhong Shu Zhen No. 1";

[0032] (5) Calculate the ratio of the number of true 'Zhong Shu Zhen No. 1' hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'Zhong Shu Zhen No. 1' hybrid seeds.

[0033] The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0034] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL;

[0035] The DNA templates are genomic DNA of individual seedlings of the female parent '823', the male parent '824' and 'Zhongshuzhen No. 1';

[0036] Preferably, the PCR program is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes;

[0037] Preferably, the detection further comprises: performing electrophoresis on the PCR product;

[0038] The electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0039] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining after electrophoresis;

[0040] Preferably, if the band pattern of each amplified product has the band pattern of the hybrid parent of 'Zhong Shuzhen No. 1' at the same time, the pumpkin variety to be tested is a hybrid of 'Zhong Shuzhen No. 1'; if the band pattern of any amplified product does not have the band pattern of the hybrid parent of 'Zhong Shuzhen No. 1' at the same time, the pumpkin variety to be tested is not a hybrid of 'Zhong Shuzhen No. 1'.

[0041] Preferably, purity calculation refers to the percentage of hybrid seeds to the number of seeds in the test sample;

[0042] The female parent of the pumpkin hybrid 'Zhong Shu Zhen No. 1' is '823', the male parent of the pumpkin hybrid 'Zhong Shu Zhen No. 1' is '824', and the hybrid F1 individual plants all refer to individual plants of the 'Zhong Shu Zhen No. 1' hybrid.

[0043] Beneficial effects of the present invention:

[0044] 1. The present invention has developed a pair of molecular markers and primers that can be used to identify the purity of hybrid seeds of Chinese pumpkin 'Zhong Shuzhen No. 1'. The molecular markers can quickly distinguish true and false hybrids, have strong specificity, and are genetically stable. They can be quickly applied to molecular marker-assisted breeding screening for pumpkin purity.

[0045] 2. Through the primers and methods of the present invention, it is only necessary to extract the genomic DNA of pumpkin leaves at the seedling stage, and then perform PCR amplification and polyacrylamide gel electrophoresis to quickly and effectively identify the purity of the hybrid seeds of 'Zhongshuzhen No. 1' without field observation. It is fast, accurate, low-cost and has high commercial value.

[0046] 3. The method of the present invention has good specificity and high accuracy in identifying the purity of pumpkin hybrid seeds, which is consistent with the field seed survey results, and the identification accuracy rate is as high as 100%. Through the E201 molecular marker and primer provided by the present invention, the hybrid seeds of 'Zhongshuzhen No. 1' and their parent seeds can be quickly and accurately detected in the seedling stage according to the identification method provided by the present invention. The molecular marker developed by the present invention can be applied to the field production and seed production practice of Chinese pumpkin 'Zhongshuzhen No. 1' hybrid seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The electrophoresis patterns of the samples of the parents and 'Zhongshuzhen No. 1' (Marker, 750bp; P1, female parent '823', P2, male parent '824'; the remaining bands are hybrid bands of 'Zhongshuzhen No. 1'; the band shown in P1 is SEQ ID No. 1; the band shown in P2 is SEQ ID No. 2). DETAILED DESCRIPTION

[0048] The present invention is further described in detail below in conjunction with specific embodiments, but the scope of the present invention is not limited thereto. Unless otherwise specified, the operations used in the following examples are all conventional methods, and the reagents used can all be commercially available.

[0049] Sources of biological materials

[0050] The experimental materials used in the experimental examples of the present invention are: the female parent '823' and the male parent '824' are pumpkin strains owned by the applicant's laboratory. The applicant promises to distribute seeds of the above pumpkin strains to the public within 20 years from the date of application for verifying the effects of the present invention;

[0051] The hybrid 'Zhongshuzhen No. 1' is a well-known and commonly used pumpkin variety and can be purchased commercially.

[0052] Main reagents

[0053] PCR experiments used 2×3G Taq Master Mix for PAGE (Red Dye) from Vazyme, and gel electrophoresis used 40% non-denaturing polyacrylamide from Beijing Coolbo Technology Co., Ltd., which was diluted to 6%. Sequencing was performed at Beijing Bioengineering Co., Ltd.

[0054] The first group of examples, SSR molecular marker E201 of the present invention

[0055] This group of embodiments provides an SSR molecular marker E201 for identifying the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1'. All embodiments in this group have the following common features: the sequence of the upstream primer E201-F for detecting the SSR molecular marker E201 is shown in SEQ ID NO.3, and the sequence of the downstream primer E201-R is shown in SEQ ID NO.4.

[0056] In some embodiments, the characteristic band sequence of the SSR molecular marker in the genome of the female parent '823' of the Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid is as shown in SEQ ID NO.1;

[0057] In other embodiments, the characteristic band sequence of the SSR molecular marker in the genome of the male parent '824' of the Chinese pumpkin 'Zhong Shuzhen No. 1' hybrid is as SEQ ID NO. 2;

[0058] Preferably, the characteristic band sequences of the SSR molecular markers in the genome of the Chinese pumpkin 'Zhongshuzhen No. 1' hybrid are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0059] The second group of examples, primers for the SSR molecular marker E201 of the present invention

[0060] This group of embodiments provides a primer for detecting the SSR molecular marker E201 for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1'. All embodiments in this group have the following common features: the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0061] The third group of embodiments, hybrid identification primers of the present invention

[0062] This group of embodiments provides a primer for molecular identification of Chinese pumpkin 'Zhong Shu Zhen No. 1' hybrid. All embodiments in this group have the following common features: the primers include: a primer for detecting the SSR molecular marker E201 used to identify the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1'; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0063] Fourth group of embodiments, hybrid identification kit of the present invention

[0064] This group of embodiments provides a kit for identifying Chinese pumpkin 'Zhong Shu Zhen No. 1' hybrid. All embodiments in this group have the following common features: the kit includes: a primer for detecting the SSR molecular marker E201 used to identify Chinese pumpkin 'Zhong Shu Zhen No. 1' hybrid; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0065] In a further embodiment, the kit for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1' further comprises: PCR reagents and / or electrophoresis reagents.

[0066] In a specific embodiment, the PCR reagents include: dNTP, Taq enzyme, buffer, double distilled water;

[0067] Preferably, the electrophoresis reagent comprises: electrophoresis buffer, Tris-HCl, SDS, acrylamide, ammonium persulfate, TEMED, double distilled water, and silver staining reagent.

[0068] The fifth group of embodiments, the hybrid identification method of the present invention

[0069] This group of embodiments provides a method for molecular identification of Chinese pumpkin 'Zhong Shu Zhen No. 1' hybrid. All embodiments in this group have the following common features: PCR is performed on candidate pumpkin materials using primers that detect the SSR molecular marker E201 used to identify Chinese pumpkin 'Zhong Shu Zhen No. 1' hybrid; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.4.

[0070] In some embodiments, the PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0071] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL;

[0072] The PCR procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; and heat preservation at 72°C for 5 minutes.

[0073] In a further embodiment, the identification result is determined based on the electrophoresis result or sequencing result of the PCR product;

[0074] The candidate pumpkin material with two characteristic bands shown in the electrophoresis results or two sequences shown in SEQ ID NO.1 and SEQ ID NO.2 simultaneously detected in the sequencing results is the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1';

[0075] If only one band or no band appears or the sequencing result detects only one of SEQ ID NO.1 and SEQ ID NO.2, the candidate pumpkin material is not the Chinese pumpkin 'Zhongshuzhen No. 1' hybrid.

[0076] Preferably, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0077] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining is performed after electrophoresis.

[0078] Experimental Example 1: Screening of specific molecular markers

[0079] Based on pumpkin SSR primers, the whole genome DNA of the maternal parent '823' and the paternal parent '824' was used as a template to screen for polymorphic primers between the parents, and finally a co-dominant difference marker between the parents was determined, named E201, and the sequence is as follows:

[0080] E201-F:ACCCTTCATTTCCGCAAAC(SEQ ID NO.3)

[0081] E201-R: TACGGTGACTTTCCTTTCCG (SEQ ID NO.4);

[0082] The marker has a clear band pattern and good reproducibility. Primer E201 can amplify a 197-nucleotide maternal '823' specific amplified fragment and a 202-nucleotide paternal '824' specific fragment (see Figure 1 ).

[0083] Experimental Example 2: Purity Identification of Chinese Pumpkin Hybrid 'Zhongshuzhen No. 1'

[0084] 1. Identification method

[0085] 1.1 Extraction of leaf genomic DNA

[0086] The seeds of the parents (female parent '823' and male parent '824') and the sample seeds were sown in a 72-hole tray at the same time and watered regularly until two true leaves grew; the leaves of the male parent, female parent and 145 hybrid sample seeds were sampled individually, and the genomic DNA was extracted according to the conventional CTAB method.

[0087] (1) Take about 0.2 g of fresh leaves and place them in a 2 ml centrifuge tube, put it in liquid nitrogen, and then quickly grind it into powder with a glass rod;

[0088] (2) Add 800 μl of 2% CTAB preheated buffer;

[0089] (3) 65°C water bath for 1.0 h (during which the centrifuge tube was slowly shaken up and down every 10 min to fully mix the dry powder sample and CTAB);

[0090] (4) After cooling to below 15°C, add an equal volume (800 μl) of 24:1 chloroform / isoamyl alcohol, mix up and down for 10 min to ensure that the sample and chloroform are fully mixed, and centrifuge for 10 min (13000 rpm / min);

[0091] (5) Pipette 600 μl of supernatant into a new 1.5 ml centrifuge tube and repeat step (4);

[0092] (6) Pipette 400 μl of the supernatant into another 1.5 ml centrifuge tube, add 800 μl of pre-cooled anhydrous ethanol, mix well, and place in a -20 °C refrigerator for 30 min;

[0093] (7) Centrifuge at 13000 rpm for 10 min, discard the supernatant, and collect the precipitate;

[0094] (8) Add 500 μl of 70% ethanol, wash twice, and leave at room temperature for 5 to 10 minutes;

[0095] (9) Centrifuge at 7500 rpm for 5 min, discard the supernatant, and place the opening in a clean bench to dry;

[0096] (10) Add 100 μl ddH2O to dissolve the DNA.

[0097] 1.2 PCR amplification and detection analysis

[0098] Using the genomic DNA described in 1.1 as a template and E201 as a primer, PCR amplification was performed respectively;

[0099] The PCR reaction system was: 10 μL reaction system, 3 μL DNA (5.0 ng·μL-1), 1 μL each of forward and reverse primers (50 ng·μL-1), and 5 μL 2×3G Taq Master Mix for PAGE (Red Dye) (product of Vazyme).

[0100] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; incubation at 72°C for 5 minutes, and storage at 10°C.

[0101] The PCR products were separated by 6% non-denaturing polyacrylamide gel electrophoresis buffer of 0.5×TBE at 150V constant power for 1h30min. After electrophoresis, the products were silver stained and the band types were counted.

[0102] If the band pattern of each amplified product has the band patterns of both parents of the 'Zhong Shu Zhen No. 1' hybrid, then the pumpkin variety to be tested is a 'Zhong Shu Zhen No. 1' hybrid. Those that lack any characteristic band of the two parents or have non-parent-specific bands are all false hybrids.

[0103] 2. Results Analysis

[0104] The hybrid of 'Zhongshuzhen No. 1' was amplified by PCR and electrophoresed using SSR primer E201 to complete the purity identification. The results are shown in Figure 1 ,from Figure 1 It can be clearly seen that a specific band of 197bp was amplified in the female parent '823', and a specific band of 202bp was amplified in the male parent '824'. Among the tested seeds, 135 lanes were consistent with the hybrid map of 'Zhongshuzhen No. 1', and 10 lanes were inconsistent with the standard map of 'Zhongshuzhen No. 1' hybrid, indicating that these 10 plants were hybrids. The calculated purity of pumpkin hybrids was 93.1%, which was consistent with the results of the field seed purity survey, with an accuracy rate of 100%. The sample electrophoresis map of 145 'Zhongshuzhen No. 1' seeds is shown in the figure below. Figure 1 shown.

[0105] The field seed purity survey refers to distinguishing the seed purity corresponding to a specific plant based on the field morphology of the pumpkin plant (mainly the trait of fruit shape). The seeds corresponding to the plant with a pear-shaped fruit (thin at the top and thick at the bottom) are "Zhongshuzhen No. 1" seeds, while the seeds corresponding to the plant with a cylindrical fruit (the thickness is the same at the top and bottom) are not "Zhongshuzhen No. 1" seeds. This field seed purity survey method is a common method for identifying the purity of "Zhongshuzhen No. 1" seeds in this field. SEQUENCE LISTING <110> Institute of Vegetable and Flower Research, Chinese Academy of Agricultural Sciences <120> SSR molecular marker E201 for identifying hybrids of Chinese pumpkin 'Zhongshuzhen No. 1' and its primers, kit and method <130> P220551 / SCH <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 195 <212> DNA <213> Artificial Sequence <220> <223> Chinese pumpkin (Cucurbita moschata D.) Characteristic band sequence of SSR marker E201 of the female parent '823' of 'Zhongshuzhen No. 1' <400> 1 acccttcatt tccgcaaaac cctttttctt cttcttcttc tctttctcgg tttcgtccgt 60 gttcttctac gtggaacaat gaaggcctca cttctcagat ccgttcgttc tgccgtttcg 120 aggtcctcag cgtcgaatca cctcttgaga cgtagctttg ggaccgaatc ggtgccggaa 180 aggaaagtca ccgta 195 <210> 2 <211> 202 <212> DNA <213> Artificial Sequence <220> <223> '824', the male parent of 'Zhongshuzhen No. 1', a Chinese pumpkin (Cucurbita moschata D.) Characteristic band sequence of SSR molecular marker E201 <400> 2 acccttcatt tccgcaaaac cctttcttct tcttcttctt cttcttctct ttctcggttt 60 cgtcggtgtt cttctacgtg gaacaatgaa ggcctcactt ctcagatccg ttcgttctgc 120 cgtttcgagg tcctcagcgt cgaatcacct cttgagacgt agctttgggga ccgaatcggt gccggaagg aaagtcaccg ta <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Number E201-F <400> 3 acccttcatt tccgcaaaac <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Number E201-R <400> 4 20. tacggtgact ttccttccg

Claims

1. The SSR molecular marker E201 used to identify the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1' is characterized by: The sequence of the upstream primer E201-F for detecting the SSR molecular marker E201 is shown in SEQ ID NO.3, and the sequence of the downstream primer E201-R is shown in SEQ ID NO.4; the characteristic band sequence of the SSR molecular marker in the genome of the female parent '823' of the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1' is shown in SEQ ID NO.1; the characteristic band sequence of the SSR molecular marker in the genome of the male parent '824' of the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1' is shown in SEQ ID NO.2; the characteristic band sequences of the SSR molecular marker in the genome of the hybrid of Chinese pumpkin 'Zhong Shu Zhen No. 1' are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

2. A primer for detecting the SSR molecular marker E201 for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1', characterized in that: The sequence of the upstream primer E201-F is shown in SEQ ID NO.3, and the sequence of the downstream primer E201-R is shown in SEQ ID NO.

4.

3. A primer for molecular identification of Chinese pumpkin 'Zhongshuzhen No. 1' hybrid, characterized in that: include: A primer for detecting SSR molecular marker E201 for identifying Chinese pumpkin 'Zhongshuzhen No. 1' hybrid; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.

4.

4. A kit for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1', characterized in that: include: A primer for detecting SSR molecular marker E201 for identifying Chinese pumpkin 'Zhongshuzhen No. 1' hybrid; the upstream primer E201-F sequence of the primer is shown in SEQ ID NO.3, and the downstream primer E201-R sequence is shown in SEQ ID NO.

4.

5. The kit for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1' according to claim 4, characterized in that: Also includes: PCR reagents and / or electrophoresis reagents.

6. A method for molecular identification of Chinese pumpkin 'Zhongshuzhen No. 1' hybrid, characterized in that: The primers of SSR molecular marker E201 for identifying the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1' as claimed in claim 1 are used to perform PCR on candidate pumpkin materials.

7. The method for molecular identification of Chinese pumpkin 'Zhongshuzhen No. 1' hybrid according to claim 6, characterized in that: The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3GTaq Master Mix for PAGE Red Dye; And / or, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE Red Dye, and double distilled water to 10 μl; And / or, the PCR program includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes; And / or, the DNA template refers to the DNA of a candidate pumpkin material.

8. A method for molecular identification of Chinese pumpkin 'Zhongshuzhen No. 1' hybrid according to claim 6 or 7, characterized in that: Determine the identification result according to the electrophoresis result or sequencing result of the PCR product; The candidate pumpkin material with two characteristic bands shown in the electrophoresis results or two sequences shown in SEQ ID NO.1 and SEQ ID NO.2 simultaneously detected in the sequencing results is the hybrid of Chinese pumpkin 'Zhongshuzhen No. 1'; And / or, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel; and / or, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining after electrophoresis.

Images