Generation of aorta-gonad-mesonephroid hematopoietic cells from human pluripotent stem cells under defined conditions

Abstract

The present invention relates generally to methods of producing hematopoietic stem and progenitor cells for therapeutic use through a two-step process of manipulating the canonical Wnt signaling pathway. Starting with human pluripotent stem cells, the canonical Wnt signaling pathway of those stem cells is activated, followed by downregulation of the Wnt signaling pathway through various methods, including TGF-beta inhibition. Pharmaceutical compositions and methods of treating patients with hematopoietic disorders by administering a therapeutically effective amount of the stem or progenitor cells, alone or with other therapeutic agents, are within the scope of the present disclosure.

Description

[0001] Cross Reference to Related Applications

[0002] This patent application is related to and claims the priority benefit of U.S. Provisional Application Serial No. 62 / 982,992, filed February 28, 2020, the contents of which are incorporated by reference in their entirety.

[0003] Declaration of Sequence Listing

[0004] The computer readable form (CRF) of the sequence listing is filed with the application. The file having the title 68927-02_Seq_Listing_ST25_txt was generated on February 15, 2021. Applicant hereby states that the content of the computer readable form is identical to the written sequence listing and that the information recorded in the computer readable form is the same as the written sequence listing. TECHNICAL FIELD

[0005] The present invention relates generally to effective methods of manufacturing stem cells for therapeutic and medical uses, and in particular to methods of generating hematopoietic stem and progenitor cells from human pluripotent stem cells under defined conditions. Also described herein are pharmaceutical compositions and methods of treating patients by administering a therapeutically effective amount of such stem cells so prepared, either alone, or with other therapeutic agents, or in a pharmaceutical composition.

[0006] BACKGROUND

[0007] This section introduces aspects that can be helpful to better understand the aspects of the present disclosure. Accordingly, these statements should be read in light of this objective and not as admissions of what is or is not prior art.

[0008] Hematopoietic stem cells (HSCs) underpin hematopoietic function to generate all functional myeloid and lymphoid cells, including red blood cells, white blood cells, platelets, immune T cells, and natural killer (NK) cells [1, 2]. Disorders of the hematopoietic system have led to a variety of diseases, such as anemia, leukemia, and thrombocytopenia [1, 3]. Currently, HSC transplantation and hematopoietic cell infusion are widely used as the main treatment for these hematological diseases [2, 4]. However, the inability to obtain reliable sources of HSC cells limits the application of such treatments, as the number of transplantable cells from umbilical cord blood, bone marrow, and peripheral blood is traditionally insufficient, and there remains a lack of robust cell expansion strategies [5, 6]. Furthermore, issues such as shortage of human leukocyte antigen-matched donors, risk of graft-versus-host disease, viral contamination, and immune responses further hinder the utility of off-the-shelf HSCs [2, 7]. Thus, there is an urgent need for alternative cell sources of transplantable HSCs.

[0009] Human pluripotent stem cells (hPSCs) represent one of the potential sources of transplantable HSCs and, due to their unique properties of unlimited self-renewal and pluripotency, can serve as in vitro models to elucidate the underlying mechanisms of human hematopoiesis [2, 8]. The past decade has witnessed rapid development of de novo hematopoietic cell generation methods [9], although most of them resemble yolk sac stage hematopoietic cells, which lack long-term repopulating ability after transplantation

[10] , in part due to the complex nature of the embryonic hematopoietic system, which is composed of multiple stage-specific hematopoietic progenitors with different potentials

[11] . In mouse embryos, the earliest long-term repopulating HSCs are generated in the aorta-gonad-mesonephros (AGM) region at embryonic day 11 [9]. The AGM also generates pre-HSCs that will home to the fetal liver and mature into repopulating HSCs

[12] , highlighting the importance of the AGM for definitive hematopoiesis and the need for a reproducible method to differentiate hPSCs into AGM-like HSCs. Recently, Ng et al. first generated AGM-like hematopoietic cells from hPSCs by stage-specific utilization of cytokines and morphogens

[10] . However, the resulting 3D differentiation cultures contain heterogeneous SOX17+ and SOX17- vasculature and CD34- and CD34+ hematopoietic cells, pointing to a complex environment for further investigation of molecular mechanisms. The utilization of various expensive growth factors, such as Activin A, BMP4, etc., further hinders the lucrative, scalable production of hematopoietic cells to meet the clinical transfusion of 2 x 10 8 / kg of nucleated cell dose

[13] , limiting their more widespread application.

[0010] BRIEF DESCRIPTION OF DRAWINGS

[0011] The above and other objects, features and advantages of the present application will become more apparent from the following description when taken in conjunction with the accompanying drawings, in which:

[0012] FIG. 1A-1G : Typical Wnt signaling specifies homogenous aorta-like CD34+SOX17+ endothelium. FIG. 1A, schematic of protocol for differentiating hPSCs toward hematovascular endothelium. FIG. IB-1D, flow cytometric analysis for CD34 / CD31 (FIG. IB) and CD34 / SOX17 (FIG. 1C), and immunostaining analysis for SOX17 and VEcad (FIG. ID) of 19-9-11 iPSC-derived day 5 cultures. Scale bar, 100 µm. CHIR, CHIR99021; VEcad, VE-cadherin. Using a multi-inducible Cas13d-mediated gene knockdown system (FIG. IE), we confirmed SOX17 knockdown (FIG. IF) significantly blocked hematovascular endothelium (HE) formation (FIG. 1G), consistent with previous studies.

[0013] FIG. 2A-2E Wnt and TGF inhibitors significantly induce hematopoietic function of hemogenic endothelium. (Fig. 2A) Schematic of protocol for differentiation of CD34+SOX17+ hPSC-derived hemogenic endothelium towards hematopoietic cells. (Fig. 2B-2D) Flow cytometry analysis for CD45 was performed on 19-9-11 iPSC-derived cultures differentiated with the indicated molecular signaling modulators as shown in (Fig. 2A) (Fig. 2B), and representative flow plots are shown in (Fig. 2C), and immunostaining images are shown in (Fig. 2D). Data are represented as mean ± standard error (s.e.m) of five independent replicates. (Fig. 2E) CD45 flow cytometry analysis was performed on day 12 differentiation cultures with indicated Wnt and TGF signaling modulators using H9 and 6-9-9 hPSC lines. CHIR, CHIR99021; SB, SB431542; Ctrl, control; PVA, polyvinyl alcohol; TPO, thrombopoietin; CSF, colony stimulating factor 3.

[0014] FIG. 3A-3E Wnt inhibition is sufficient for AGM-like hematopoiesis. (Fig. 3A) RT-PCR analysis for AXIN2 , WNT3A and GAPDH expression was performed on 19-9-11 iPSC-derived day 6 cells and quantified. (Fig. 3B-3C) H9 7TGP Wnt reporter hPSC (Fig. 3B) were differentiated with the indicated signaling modulators as exemplified in FIG. 8A , and flow cytometry analysis of eGFP expression was performed on day 6 differentiation cultures (Fig. 3B). Representative flow plots are shown in (Fig. 3C). (Fig. 3D-3G) 19-9-11 inducible shRNA CTNNB1 (β-catenin) knockdown (ishcat) iPSC were cultured from day 4 to day 6 with or without doxycycline (dox) treatment as exemplified in FIG. 8A . At day 6, cells were subjected to RT-PCR analysis and quantified in (Fig. 3D). At day 12, cells were analyzed for CD45 expression by flow cytometry (Fig. 3E).

[0015] FIG. 4A-4H Chemically defined conditions for robust AGM-like hematopoiesis. (Fig. 4A) Schematic of optimized protocol for hPSC differentiation into hematopoietic cells. (Fig. 4B-4F) 19-9-11 iPSC were differentiated as exemplified in (Fig. 4A). At different time points, CD45 (Fig. 4B) and CD34 / SOX17 (Fig. 4C) expression was evaluated by flow cytometry. Representative flow plots of CD45 expression are shown in (Fig. 4D). At the indicated days,RUNX1 and GAPDH RT-PCR analysis was performed and quantified in (Fig. 4E). Representative flow plots of CD45 expression are shown in (Fig. 4F). Scale bar, 200 µm. (Fig. 4G-4H) 19-9-11 iPSCs were cultured as exemplified in (Fig. 4A) with or without the addition of SCF and FLT3L, flow cytometry analysis for CD45 was performed on day 15 cultures (Fig. 4G) and the yield of CD45+ cells is shown in (Fig. 4H).

[0016] Figures 5A-5H: Transcriptomic analysis of hPSC-derived definitive hematopoietic cells. (Fig. 5A) 3D score plot of the first three principal components (PC) from principal component analysis of RNA-seq data from hPSCs, hPSC-derived mesoderm (Mes), day 18 hematopoietic stem cell-like cells (hPSC-HSCs), primary neonatal cord blood HSCs (CB-HSCs), 5-week aorta-gonad-mesonephros (AGM) endothelial cells, stem / progenitor cells, and progenitor cells. Each data point corresponds to a different biological sample. RNA-seq data for primary CB-HSCs

[35] and AGM cells

[10] were obtained from previous publications. (Fig. 5B) Heatmap showing similar expression patterns of gene clusters between hPSC-derived, CB, and AGM hematopoietic cells. (Fig. 5C) UMAP embedding of day 18 scRNA-seq data colored by meta-clusters to simplify visualization. Mono: monocytes; Mye: myeloid cells; Granulo: granulocytes; Ery: erythrocytes; Mega: megakaryocytes. Violin plots of RNA counts for two hematopoietic progenitor markers HOXA and HOXB and one primitive hematopoietic cell marker are shown in (Fig. 5D) and (Fig. 5E). (Fig. 5F-5G) Violin plots along different clusters for T-cell progenitor marker IL7R and hematopoietic cell marker PTPRC and RUNX1 are shown in (Fig. 5F) and (Fig. 5G). (Fig. 5H) VEcad-eGFP HOXB5-mCherry dual reporter H9 PSCs were differentiated as exemplified in Fig. 4A. HOXB5-mCherry expression was evaluated by flow cytometry at different time points. HOXB5 and NEO1

[0017] FIG. 6A-6F ​In vitro and in vivo characterization of hPSC-derived AGM-like hematopoietic cells. (Figures 6A-6B) Day 12 hPSC-derived hematopoietic cells were co-cultured with OP9-DLL4 for immune T cell and natural killer (NK) cell differentiation. At different time points, CD4 / CD8 (Figure 6A) and CD45 / CD56 (Figure 6B) expression were evaluated by flow cytometry. (Figures 6C-6D) Day 18 mCherry+CD45+ hPSC-derived hematopoietic stem cell-like cells (HSCs) and neurons were transplanted into zebrafish and mCherry+ cells homing to caudal hematopoietic tissue (CHT) were quantified 5 hours post-transplantation (hpt) (Figure 6C). Representative live cell image analysis of mCherry+ cells is shown in (Figure 6D). (Figures 6E-6F) Day 15 hPSC-derived mCherry+CD45+ hematopoietic cells were evaluated for homing and rescue capacity using 3-5 hpf embryos of c-myb knockout (KO) anemic zebrafish. (Figure 6E) Representative images of wild-type (WT) and c-myb KO anemic zebrafish after Sudan black staining are shown. Scale bar, 200 µm. The percentage of survival of anemic zebrafish after cell transplantation was recorded at the indicated days post-transplantation (dpt) and quantified in (Figure 6F).

[0018] FIG. 7 Schematic model highlighting specification of hPSCs to AGM-like hematopoietic cells by stage-specific modulation of Wnt, VEGF, and TGFβ signaling.

[0019] FIG. 8A-8C Chemically defined, xeno-free, and serum-free conditions for generation of CD45+ hematopoietic cells. FIG. 8A 19-9-11 iPSCs were cultured with SB431542 (SB) treatment at the indicated days as exemplified in Figure 2A. At day 12, cells were analyzed for CD45 expression by flow cytometry. FIG. 8B-8C 19-9-11 iPSCs were cultured under the indicated conditions as exemplified in FIG. 8B At day 12, cells were analyzed for CD45 expression by flow cytometry and quantified in FIG. 8C CHIR, CHIR99021; SB, SB431542; HS, human serum.

[0020] FIG. 9A-9D Robust AGM-like hematopoietic cell differentiation from various hPSC lines. FIG. 9A-9D 19-9-11 iPSCs were cultured as exemplified in Figure 4A. Dynamic morphological changes were recorded at the indicated days FIG. 9A and representative 3D merged images of brightfield, CD45, VEcad, and DAPI staining are shown inFIG. 9B ) in (FIG. 4B). FIG. 9C ) Cell viability before and after freezing was evaluated by flow cytometry with TO-PRO-3 staining. FIG. 9D ) AGM-like hematopoietic cells were generated from the following 8 additional hPSC lines as described in FIG. 4A: H1, H9, H13, RUES2, 6-9-9, 19-9-7, Kolf2, and CT2. Scale bar, 200 µm.

[0021] FIG. 10A-10D : Transcriptional similarity between hPSC-derived, AGM, and CB hematopoietic cells. FIG. 10A ) Hierarchical clustering analysis of RNA-seq expression data of hPSCs, hPSC-derived mesoderm (Mes), day 18 hematopoietic stem cell-like cells (699- and H9-HSCs), primary neonatal cord blood HSCs (CB-HSCs), 5-week aorta-gonad-mesonephros (AGM) endothelial cells (AGM-En), stem / progenitor cells (AGM-S / P), and progenitor 1 (AGM-Pr1) cells. Heatmap shows hematopoietic cell-associated surface markers (FIG. 4C), transcription factors (FIG. 4D), and gene ontology (GO) enrichment scores (FIG. 4E) compared to hPSCs. RNA-seq data of primary CB-HSCs (FIG. 4F) and AGM cells (FIG. 4G) were obtained from previous publications. FIG. 10B FIG. 10C FIG. 10D 4 5

[0022] FIGS. 11A-11D: Gene expression and trajectory analysis of day 8 endothelial and hematopoietic cells using single-cell RNA-seq (scRNA-seq). (FIG. 11A) Quality control (QC) images showing features, RNA counts, and % mitochondria (mito). (FIG. 11B) Clustering and UMAP embedding of scRNA-seq data colored by metacluster for simplified visuality. (FIG. 11C) Heatmap showing top 10 marker genes for each cluster. (FIG. 11D-11E) Violin plots of six genes to illustrate the transition of cells from CDH5+CLDN5+ endothelial cells (FIG. 11D) to RUNX1+MLLT3+ hematopoietic progenitor cells (FIG. 11E). Gene expression plots of two definitive and one primitive hematopoietic cell markers are shown in (FIG. 11F). (FIG. 11G) Violin plots of genes expressed only in one cell type. (FIG. 11H) Pseudotime trajectory analysis using Monocle 3 of day 8 cells identified a developmental trajectory of hematopoietic progenitor cells from hemogenic endothelial cells. GYPA

[0023] FIG. 12A-12D ​​​​​​: Construction of VEcad-eGFP HOXB5-mCherry dual reporter H9 hPSC lines using Cas9 nuclease. (Figure 12A) VEcad-eGFP knock-in into H9 hPSCs HOXB5 Schematic of knock-in strategy at the stop codon of the locus (6). Vertical arrows indicate sgRNA1 and sgRNA2 targeting sites. Red and blue horizontal arrows are PCR primers for assay HOXB5 - Locus targeting and homozygosity PCR primers. (Figure 12B) Representative PCR genotyping of hPSC clones after puromycin selection is shown, and the expected PCR product of ~1.6 kbp for the correctly targeted HOXB5 locus is indicated by the red arrow, with an efficiency of 1 out of a total of 17 clones. Homozygosity assay was performed on targeted knock-in clone 6 (C6), and it was homozygous (blue arrow). (Figures 12C-12D) Phase contrast images and corresponding mCherry fluorescence images (Figure 12C) and live cell flow analysis of mCherry (Figure 12D) at days 0, 5, 10, 15, and 20 after initial CHIR treatment of HOXB5-mCherry knock-in H9 are shown. BF, bright field. Scale bar, 100 µm.

[0024] FIG. 13A-13GIn vitro and in vivo functional characterization of hPSC-derived AGM-like hematopoietic cells. (FIGs. 13A-13C) Bone marrow potential of day 15 hPSC-derived hematopoietic cells was evaluated by colony-forming unit (CFU) assay in methylcellulose medium. Two weeks later, CFU of hematopoietic colonies were scored based on cell morphology (FIG. 13A): erythroid (CFU-E), granulocyte / macrophage (CFU-GM), macrophage (CFU-M), and multi-lineage progenitor (CFU-GEMM) colonies. Scale bar, 200 µm. CFU scoring quantification is in (FIG. 13B). Bone marrow cells differentiated from hematopoietic cells were stained with modified Wright-Giemsa stain solution (FIG. 13C). Scale bar, 50 µm. (FIGs. 13D-13E) Day 15 hPSC-derived mCherry+CD45+ hematopoietic cells were evaluated for homing capacity in zebrafish. Day 15 hPSC-derived neurons were used as control (7). (FIG. 13D) Schematic of the transplantation strategy of intracardiac injection of hematopoietic cells in 48-52 h old zebrafish. Homing to caudal hematopoietic tissue (CHT) of HSCs and neurons was recorded at the indicated hours post transplantation (hpt) (FIG. 13E). Scale bar, 100 µm. (FIGs. 13F-13G) Day 15 hPSC-derived mCherry+CD45+ HSCs were evaluated for homing and rescue capacity using 48-52 h old embryos of c-myb knockout (KO) anemic zebrafish. Day 15 hPSC-derived neurons were used as control (7). Homing to CHT of HSCs and neurons was recorded at the indicated days post transplantation (dpt) and quantified in (FIG. 13F). Representative fluorescence and bright field images of homing HSCs at 3 dpt are shown in (FIG. 13G). Scale bar, 200 µm.

[0025] DETAILED DESCRIPTION

[0026] To facilitate an understanding of the principles of the present disclosure, reference will now be made to the embodiments illustrated in the drawings, and specific language will be used to describe the same. It will, nevertheless, be understood that no limitation of the scope of the disclosure is intended by

[0027] As used herein, the following terms and phrases shall have the meanings set forth below. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art.

[0028] In the present disclosure, the term "about" can allow a degree of variation to a value or range, for example, within 10%, within 5%, or within 1% of a specified limit of a specified value or range. In the present disclosure, the term "substantially" can allow a degree of variation to a value or range, for example, within 90%, within 95%, or within 99% of a specified limit of a specified value or range.

[0029] In the present document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used in the inclusive sense of "and / or" unless the context clearly dictates otherwise. Furthermore, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading the document and is not to be interpreted as limiting. Further, information relevant to a section heading can occur within or outside adjacent sections. Furthermore, all publications, patents and patent documents mentioned in this document are incorporated by reference herein in their entirety as if each were individually incorporated by reference. In the event of inconsistent usages between this document and those documents so incorporated by reference, the

[0030] The term "pharmaceutically acceptable carrier" is art-recognized, and refers to a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting any subject composition or component thereof. Each carrier must be "acceptable" in the sense of being compatible with the subject composition and its components and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laureate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances used in pharmaceutical formulations.

[0031] As used herein, the term "administration" includes all means of introducing the compounds and compositions described herein into a patient, including, but not limited to, oral (po), intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal, and the like. The compounds and compositions described herein can be administered in unit dosage form and / or formulation including conventional non-toxic pharmaceutically-acceptable carriers, adjuvants and vehicles.

[0032] Liquid pharmaceutical forms can be sterilized and / or, if appropriate, contain auxiliary substances such as preservatives, stabilizers, wetting agents, permeation agents, emulsifiers, spreading agents, solubilizers, salts, sugars or sugar alcohols for adjusting the osmotic pressure or buffering, and / or viscosity regulators. Examples of such additives are tartrate and citrate buffers, ethanol and chelating agents such as ethylenediaminetetraacetic acid and its nontoxic salts. High-molecular-weight polymers such as liquid polyethylene oxide, microcrystalline cellulose, carboxymethylcellulose, polyvinylpyrrolidone, dextran or gelatin are suitable for regulating the viscosity. Examples of solid carrier substances are starch, lactose, mannitol, methylcellulose, talc, highly dispersed silicic acid, high-molecular-weight fatty acids such as stearic acid, gelatin, agar, calcium phosphate, magnesium stearate, animal and vegetable fats, and solid high-molecular-weight polymers such as polyethylene glycol.

[0033] Formulations for parenteral administration can exist in unit dosage form, such as ampoules or vials. Preferably, solutions of the active compound, preferably aqueous solutions, especially isotonic solutions, and suspensions are used. These injection forms can be provided as ready-to-use preparations, or only directly before use by mixing the active compound, for example a lyophilizate, with the desired solvent or suspension agent.

[0034] It will be appreciated that the actual daily dosage level of the compounds and compositions described herein will be determined by the attending physician in light of the relevant circumstances, including the condition to be treated, the severity of the condition, the activity of the particular compound used, the previous or concurrent treatment of the patient, and the patient's general state of health. The specific therapeutic effective dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health condition, sex, diet, time of administration, rate of excretion, drug combination, and the severity of the particular disease being treated. The effective amount of the compound to be administered will thus be determined by the practitioner, in light of the relevant circumstances.

[0035] A wide range of dosages is contemplated depending on the route of administration, including dosages falling within the range of about 1 μg / kg to about 1 g / kg. The dosages can be single or divided and can be administered according to a variety of dosing schedules, including q.d., b.i.d., t.i.d., or even every other day, once a week, once a month, etc. In each case, the therapeutically effective amount described herein corresponds to the amount administered, or to the total daily, weekly or monthly dosage.

[0036] The term "therapeutically effective amount" as used herein refers to the amount of an active compound or pharmaceutical agent that elicits the biological or medicinal response that is being sought in a tissue system, animal, or human by a researcher, veterinarian, medical doctor, or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated. In one aspect, a therapeutically effective amount is that amount which can be suitable for any medical treatment at a reasonable benefit / risk ratio treatment or alleviation of a disease or symptoms of a disease.

[0037] The term "therapeutically effective amount" as used herein refers to the amount administered to a patient and can be based on body surface area, patient body weight, and / or disease condition. Moreover, it is understood that there is a correlation between dosages determined in humans and dosages determined in animals (illustrated on a mg per square meter of body surface basis), as set forth in Freireich, E. J., et al., Cancer Chemother. Rep. 1966, 50 (4), 219, the disclosure of which is incorporated herein by reference. Body surface area can be approximated from the patient's height and weight (see, e.g., Scientific Tables, Geigy Pharmaceuticals, Ardley, New York, pp. 537-538 (1970)). A therapeutically effective amount of a compound described herein can be defined as any amount that can be used to inhibit (or kill) the growth of a population of malignant cells or a population of cancer cells, such as can be present in a patient in need of relief from such cancer or malignancy. Typically, such effective amounts are in the range of about 5 mg / kg to about 500 mg / kg, about 5 mg / kg to about 250 mg / kg, and / or about 5 mg / kg to about 150 mg / kg of compound per patient body weight. It will be appreciated that effective doses will also vary depending on route of administration, optional excipient usage, and possibility of cousage of the compound with other conventional and unconventional treatments, including other anti-neoplastic agents, radiotherapy, etc.

[0038] The term "patient" as used herein includes both human and non-human animals, such as companion animals (dogs, cats, etc.) and livestock animals. Livestock animals are animals raised for food production. The patient to be treated is preferably a mammal, particularly a human.

[0039] As used herein, stem cell therapy generally refers to the use of stem cells or stem cell derived cells to treat or prevent a disease or condition. Stem cell products are also useful for basic research. Generally, any clinical application of stem cells should reach transplantable numbers and warrant high batch-to-batch consistency and reproducible potency, presumably at low cost and high standardization. In other words, the protocol to generate stem cell products should comply with good manufacturing practice (GMP): xeno-free, chemically defined, reproducible, cost-effective, scalable, and potential for automation. This patent is about a chemically defined, cost-effective, reproducible, and scalable protocol for hematopoietic stem cell differentiation. With further optimization and automation, the current protocol can be integrated with a GMP platform to manufacture transplantable AGM-like hematopoietic stem cells for patients.

[0040] Some related prior art can be found in the following publications, which are incorporated herein by reference:

[0041]

[0042] U.S. Patent Nos. 9,290,741 B2, 9,765,299 B2, and 10,131,878 B2.

[0043] The following abbreviations are used herein throughout the specification:

[0044] HSPC: hematopoietic stem and progenitor cells; AGM: aorta-gonad-mesonephros

[0045] NK cell: natural killer cell; HSC: hematopoietic stem cell; EHT: endothelial to hematopoietic transition; HE: hemogenic endothelium; hESC: human embryonic stem cell; hPSC: human pluripotent stem cell; BMP4: bone morphogenetic protein 4

[0046] VEGF: vascular endothelial growth factor; EPO: erythropoietin; FGF2: fibroblast growth factor 2; CSF3: colony-stimulating factor 3; IL-6: interleukin 6; TPO: thrombopoietin

[0047] PVA: polyvinyl alcohol; SCF: stem cell factor; Flt3l: FMS-like tyrosine kinase 3 ligand

[0048] HEP: hemogenic endothelial progenitor cell; VE-cadherin: vascular endothelial cadherin

[0049] OP9-DLL4: OP9-Notch ligand delta-like 4; CFU-E: colony-forming erythroid; CFU-GM: granulocyte / macrophage; CFU-M: macrophage; CFU-GEMM: multi-lineage progenitor cell.

[0050] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem and progenitor cells from human pluripotent stem cells, as well as products and their uses.

[0051] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs), comprising the steps of:

[0052] a. preparing human pluripotent stem cells (hPSCs);

[0053] b. preparing a culture medium comprising vascular endothelial growth factor (VEGF) and a glycogen synthase kinase-3 (GSK3) inhibitor, wherein the GSK3 inhibitor is used to activate the canonical Wnt signaling pathway of the hPSCs;

[0054] c. culturing the hPSCs in the culture medium for a period of time; and

[0055] d. then downregulating the activated canonical Wnt signaling pathway or transforming growth factor beta (TGF-b) signaling pathway for a period of time to induce and generate the hematopoietic stem cells (HSCs).

[0056] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the methods further comprise adding stem cell factor (SCF) or Flt3-ligand in the culture medium of step d for improving consistency of the operation between batches.

[0057] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the human pluripotent cells comprise human embryonic stem cell (hESC) lines selected from the group consisting of H9, H1 and H13; and human induced pluripotent cell lines selected from the group consisting of 19-9-11, 6-9-9 and Kolf2.

[0058] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the downregulating the activated canonical Wnt signaling pathway is achieved by a Wnt inhibitor, heparin, SB431542, beta-catenin shRNA, beta-catenin targeted Cas13d or Cas9 gRNA.

[0059] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the Wnt inhibitor comprises Wnt-C59 and IWP2.

[0060] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the functional concentration range of the Wnt inhibitor is about 0.2 µM to about 20 µM.

[0061] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the Wbt-C59 has the following formula, or a pharmaceutically acceptable salt thereof,

[0062] .

[0063] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the IWP-2 has the following formula, or a pharmaceutically acceptable salt thereof,

[0064] .

[0065] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the concentration of the heparin ranges from about 0.2 to 20 μg / mL.

[0066] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the downregulation of transforming growth factor beta (TGF-β) signaling pathway is achieved by a TGF-β inhibitor, SB431542, A83-01, ALK5 inhibitor, thrombopoietin (TPO), heparin, polyvinyl alcohol (PVA), TGF-β shRNA, TGF-β targeted Cas13d, or Cas9 gRNA.

[0067] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the functional concentration range of the SB431542 is about 0.2 µM to about 20 µM.

[0068] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the SB431542 has the following formula, or a pharmaceutically acceptable salt thereof,

[0069] wherein x is any number.

[0070] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the A83-01 has the following formula, or a pharmaceutically acceptable salt thereof,

[0071] .

[0072] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the concentration of the A83-01 ranges from about 0.2 µM to about 20 µM.

[0073] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the concentration of the heparin ranges from about 0.2 µg / mL to about 20 µg / mL.

[0074] ranges from about 0.2 µM to about 20 µM.

[0075] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the GSK3 inhibitor comprises CHIR99021, CHIR98014, BIO, MeBIO, LY2090314, lithium chloride, and indirubin.

[0076] ranges from about 0.2 µM to about 20 µM.

[0077] In some illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the CHIR99021 has the following formula, or a salt thereof,

[0078] .

[0079] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the CHIR98014 has the following formula, or a salt thereof,

[0080]

[0081] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the heparin has a concentration ranging from about 0.2 pg / mL to about 20 pg / mL.

[0082] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the CHIR99021 or CHIR98014 has a concentration ranging from about 0.2 pM to about 20 pM.

[0083] In some illustrative embodiments, the present disclosure relates to methods for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs) as disclosed herein, wherein the hematopoietic stem cells are aortic-gonad-mesonephric-like SOX17 + CD34 + hematopoietic stem cells or progenitor cells, and common CD34 + CD45 + / CD43 + hematopoietic progenitor cells.

[0084] In some other illustrative embodiments, the present disclosure relates to macrophages, neutrophils, and blood and immune cells, including NK cells, T cells, manufactured by using the resulting hematopoietic stem cells prepared according to the methods as disclosed herein.

[0085] In some illustrative embodiments, the present disclosure relates to a pharmaceutical product comprising hematopoietic stem cells manufactured according to the methods as disclosed herein.

[0086] Also in some other illustrative embodiments, the present disclosure relates to a pharmaceutical product comprising hematopoietic stem cells manufactured according to the methods as disclosed herein, together with one or more diluents, excipients or carriers, for use as a medicament for a patient having a hematological disease.

[0087] In some other illustrative embodiments, the present disclosure relates to a method for treating a patient having a hematological disease,

[0088] It includes the step of administering to a patient in need of relief from said disease a therapeutically effective amount of a product manufactured according to claims 23-24 together with one or more carriers, diluents or excipients.

[0089] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells comprising a defined medium comprising human pluripotent stem cells, a GSK3 inhibitor, a TGF-β inhibitor, and VEGF.

[0090] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the TGF-β inhibitor comprises SB431542, A83-01, heparin, thrombopoietin (TPO), and polyvinyl alcohol (PVA).

[0091] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the concentration of the SB431542 ranges from about 0.2 µM to about 20 µM.

[0092] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the SB431542 has the following formula, or a pharmaceutically acceptable salt thereof,

[0093] wherein x is a number.

[0094] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the concentration of the A83-01 has the following formula, or a pharmaceutically acceptable salt thereof,

[0095] .

[0096] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the human pluripotent cells comprise a human embryonic stem cell (hESC) line selected from the group consisting of H9, H1, and H13; and a human induced pluripotent cell line selected from the group consisting of 19-9-11, 6-9-9, and IMR90-C4.

[0097] In some illustrative embodiments, the present disclosure relates to a kit for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein, wherein the hematopoietic stem cells are aorta-gonad-mesonephros-like SOX17 + CD34+ hematopoietic stem or progenitor cells, and common CD34 + CD45 + / CD43 + hematopoietic progenitor cells.

[0098] In some illustrative embodiments, the present disclosure relates to a product of hematopoietic stem or progenitor cells manufactured using the kits for differentiating and manufacturing hematopoietic stem and progenitor cells from human pluripotent stem cells as disclosed herein.

[0099] Also in some other illustrative embodiments, the present disclosure relates to a method for generating hematopoietic stem and progenitor cells from human pluripotent stem cells, comprising the following steps:

[0100] a. Preparing human pluripotent stem cells: testing multiple human pluripotent cell lines, including human embryonic stem cell (hESC) lines H9, H1, H13 and human induced pluripotent cell lines 19-9-11, 6-9-9, Kolf2;

[0101] b. Hemogenic endothelial differentiation of hPSCs (Day 0 to Day 4 or 5), with the best differentiation conditions as follows:

[0102] Day 0, DMEM / Vc with 6 uM CHIR99021 (Gsk3 inhibitor or Wnt activator, other similar chemicals such as CHIR98014, BIO, GSK3 beta inhibitor VIII, etc., or RNAi against GSK3 can also be used to replace CHIR99021). The concentration can be any other value ranging from about 0.5 to about 20 uM; DMEM / Vc can also be replaced with LaSR basal, Stemline II or other similar culture media;

[0103] Day 1, LaSR basal, Stemline II, StemSpan H3000, DMEM / Vc or similar culture media without any other chemicals or cytokines; for more resistant H1 cell lines (or some other similar untested cell lines), 6 uM CHIR99021 (or within the concentration range) is also added to the above-mentioned culture medium on Day 1;

[0104] Day 2-4, LaSR basal, Stemline II, StemSpan H3000, DMEM / Vc or similar culture media with (for female cell lines) or without (for male cell lines, similar to the effect of adding VEGF without VEGF) 50 ng / mL VEGF, with daily medium replacement (i.e. medium replacement on Day 2 and Day 3); the concentration range of VEGF can be any value ranging from about 5 to about 200 ng / mL;

[0105] c. Hemogenic specification, where differentiation conditions are optimized as follows:

[0106] Days 4-6, Stemline II media with 10 uM SB431542, with or without 50 ng / mL SCF and 50 ng / mL FLT3L; SB431542 concentration ranges from 2 uM, 4 uM, 6 uM, 8 uM, 12 uM, or other values from 1 to 20 uM. In some cases, SB431542 can be replaced by 50 ng / ml thrombopoietin (TPO protein, which can range from about 1 to 200 ng / mL) or 1 ug / mL heparin (which can range in concentration from about 0.5 to 20 ug / mL), or 5 uM A83-01 (which can range from 0.5 to 20 uM), etc. To generate comparable AGM-like hemogenic stem cells, CSF, PVA, and IL-16 can also be used, in which case lower efficiency is typically obtained. In some other cases, 50 ng / mL VEGF is added to the media to increase the total yield of hemogenic cells;

[0107] Days 6-20, Stemline II media with 50 ng / mL SCF, 50 ng / mL FLT3L, media changed every 2 or 3 days;

[0108] For the hemogenic specification phase (days 4 to 20), Stemline II media can be replaced by LaSR basal media, StemSpan H3000, DMEM / Vc media with 5% to 30% human serum, or other similar media. SCF and FLT3L concentrations can range from 5 to 100 ng / mL. And in some cases, SCF and FLT3L are optional; and

[0109] d. Harvesting hemogenic stem cells;

[0110] AGM-like hemogenic stem cells can be harvested from day 7 to day 20 (or longer), with purity exceeding 85% starting from day 15.

[0111] In some illustrative embodiments, different differentiation factors provide substantially different resulting stem cell yields, e.g., SB431542 provides a yield of 40.9% at day 12, while most other factors act at lower yields, 20.6% for heparin; and 30.4% for TPO.

[0112] As disclosed herein, the method is applicable to aortic-like hemogenic endothelium, hemangioblasts, endothelial cells, or Sox17 + CD31 +Cell population (day 4 to day 8 cells), and common CD34 + CD45 + / CD43 + CD44 + Definitive hematopoietic progenitor cells, which can differentiate into NK cells and T cells. Furthermore, the use of the resulting hematopoietic stem cells to make subsequent macrophages, neutrophils, other blood and immune cells, such as NK, T cells, are within the scope of the present disclosure.

[0113] In some other illustrative embodiments, the present disclosure relates to a kit for differentiating human pluripotent stem cells into hematopoietic stem cells, which is not only for potential therapeutic applications, but also for basic research in research laboratories. The method also has valuable applications, such as scalable, inexpensive, and reproducible generation of human aortic-like endothelial cells and CD34+ hematopoietic cells. The proportion of endothelial cells or hematopoietic cells can be further enriched using cell separation or enrichment methods (e.g., FACS, MACS, or laser-targeted ablation of non-endothelial or non-hematopoietic cells). Cells can be enriched with surface markers of CD31, CD34, CD45, CD43, CD44 (e.g., by MACS) or transcriptional markers SOX17, RUNX1C (e.g., by FACS). After sorting, endothelial cells or hematopoietic cells can be expanded more than 20 times in any of a variety of known media that can be used for human endothelial cell or hematopoietic cell proliferation, including but not limited to human endothelial serum-free medium (ThermoFisher, 11111-004), EGM-2 (Lonza, CC-3162), Endothelial Cell Medium (BD Bioscience, 355054), Stemline II Hematopoietic Stem Cell Expansion Medium (Sigma, S0192), StemSpan H3000 (StemCell Technologies, 09850), and homemade medium containing human serum.

[0114] It should be noted that the effect of Wnt signaling activation or inhibition is stage-dependent during hematopoietic production. To make hematopoietic cells, the initial human pluripotent stem cells need to go through mesoderm and hematopoietic endothelial stages (or progenitor stages). It is well known that GSK3 inhibitors, or particularly CHIR99021 / CHIR98014 (and the like), are effective in convincing human pluripotent stem cells to enter mesoderm (stage 1 of hematopoietic cells), which will then be in the presence or absence of VEGF (human pluripotent stem cells from female donors will require VEGF).

[0115] Thereafter, Wnt inhibitors or TGF-b inhibitors are needed to effectively promote hemogenic endothelium (Stage 2) to hemogenic cells. And TGFb inhibitors can also inhibit Wnt signaling. However, it is not yet clearly understood why TGFb inhibitors are better here to promote hemogenic cell production.

[0116] Even though we found that heparin, thrombopoietin (TPO), and polyvinyl alcohol (PVA) also promote hemogenic cell production well, none of them are technically GSK3 inhibitors or TGF-b inhibitors.

[0117] Furthermore, GSK3 inhibitors are also Wnt activators. It is known that Wnt activation (by using GSK3b inhibitors, Wnt ligand proteins such as Wnt3a, or optogenetics, etc.) effectively converts human pluripotent stem cells to mesoderm cells expressing brachyury (Bao et al., 2015, 2016a, 2016b, 2017; Lian et al., 2013, 2014, 2015; Qian et al., 2017; Randolph et al., 2019; Repina et al., 2019). Two commonly used GSK3b inhibitors are CHIR99021 and CHIR98014.

[0118] Self-renewing hematopoietic stem cells (HSCs) derived from the aorta-gonad-mesonephros (AGM) can regenerate the blood system after transplantation, serving as a curative therapy for a variety of blood diseases. Despite the tremendous efforts made to generate de novo HSC-like cells from human pluripotent stem cells (hPSCs), the detailed cellular and molecular mechanisms regulating human AGM-like hematopoiesis remain elusive. Here, we show that temporal manipulation of canonical Wnt signaling, in which GSK3 inhibitors are used to activate Wnt signaling followed by Wnt inhibition, is sufficient to induce AGM-like hematopoiesis from 11 hPSC lines. We also found that Wnt inhibition is required for hemogenic endothelial cells to undergo hematopoiesis, and that TGFb inhibition, which downregulates Wnt signaling, generates a chemically defined, feeder-free monolayer culture platform for robust generation of homogeneous AGM-like hematopoietic cells that, through intermediate aorta-like SOX17 + CD235a - Hemogenic endothelium. The resulting definitive hematopoietic cells are very similar to primary cord blood HSCs at the global transcriptional level via RNA sequencing, and contain distinct hierarchically primed progenitor populations via single-cell RNA sequencing analysis. Importantly, these definitive cells exhibit lymphoid and myeloid potential in vitro and home to caudal hematopoietic tissues (CHTs) in vivo and rescue anemic zebrafish after transplantation. Our robust protocol for AGM-like hematopoietic cell generation offers great promise for scalable production of multiple blood and immune cells to treat a variety of blood diseases and cancers.

[0119] Here, we sought to construct a simplified and robust differentiation platform by recapitulating AGM hematopoiesis in vivo as homogenous AGM-like hematopoietic cells. It is well known that repopulating HSCs develop from hematovascular endothelium (HE) in the arterial vasculature via the endothelial-to-hematopoietic transition (EHT) process [14-16]. Previously, we reported robust generation of homogenous HE via GSK3 inhibition treatment in the absence of cytokines [17, 18], and here we further demonstrate their AGM-like identity, as marked by SOX17, a transcription factor expressed in the vascular structures of AGM and required for HSC generation from AGM [10, 19, 20]. We also designed a multi-in-one inducible Cas13d-mediated SOX17 knockdown platform, and found that SOX17 knockdown significantly blocked Wnt activation-induced hematovascular endothelium formation. TGFp inhibition treatment significantly promoted the EHT process to generate homogenous CD45+ hematopoietic cells that co-express SOX17 and RUNX1, hallmarks of AGM-like hematopoietic cells [10, 21]. Using the inducible shRNA CTNNB1 knockdown system, we demonstrated that Wnt inhibition was sufficient to induce hematopoiesis from HE. The resulting cells were very similar to primary cord blood HSCs at the global transcriptional level, exhibited lymphoid and myeloid potential in vitro, and homed to the caudal hematopoietic tissue (CHT) in vivo after transplantation, mimicking various aspects of human AGM hematopoiesis. In our hPSC-derived hematopoietic cells, single-cell RNA-seq (scRNA-seq) analysis identified discrete subpopulations that were enriched in erythroid, myeloid, monocyte, granulocyte, and megakaryocyte markers, and trajectory analysis revealed their hierarchical structure. Importantly, transplanted AGM-like hematopoietic cells also delayed the death of c-myb knockout anemic zebrafish. Our findings provide significant progress in defining key components of in vitro induction of homogenous hematopoiesis, and the simplified platform will provide a robust model for human hematopoiesis studies and facilitate scalable production of hematopoietic and immune cells for potential clinical applications.

[0120] Results. Canonical Wnt signaling specifies homogenous aortic-like CD34 + SOX17 + Endothelium

[0121] Generation of hematovascular endothelium (HE) from hPSCs, marked by expression of canonical endothelial markers VE-cadherin, CD31 and CD34, is an important step towards hematopoietic cell generation. We have previously developed a robust protocol to generate homogenous CD34 + CD31 +HE (Figures 1A-B) [17, 18]. The simultaneous modulation of Wnt and Activin signaling in the AGM generates aortic-like SOX17 + Vessels, which generate hematopoietic cells

[10] , we hypothesized that our small molecule-induced CD34 + CD31 + Cells are also SOX17 + This was confirmed by flow cytometry and immunostaining analysis of SOX17 expression (Figures 1C-D). Interestingly, in contrast to Activin and later Wnt modulation-induced heterogeneous CD34 + SOX17 + and CD34 + SOX17 - populations [10, 22], consistent with previous studies that utilized Activin A during mesoderm induction to favor primitive hematopoiesis [8, 23]. Importantly, the resultant CD34 + SOX17 + populations [10, 22], consistent with previous studies that utilized Activin A during mesoderm induction to favor primitive hematopoiesis [8, 23]. Importantly, the resultant CD34 + SOX17 + AGM-like HEs do not express CD235a, a marker of primitive hematopoiesis

[24] . Using a multi-inducible Cas13d-mediated gene knockdown system (Figure 1E), we showed SOX17 knockdown (Figure 1F) significantly blocked the formation of hematovascular endothelium (HE) (Figure 1G), consistent with previous studies [25, 26].

[0122] Screening developmental signaling pathways revealed the contribution of Wnt and TGF inhibition to the hematopoietic effect of hematovascular endothelium.

[0123] Many signaling pathways, including Wnt [10, 24], TGF

[27] , BMP [28, 29], retinoic acid

[30] , Notch

[31] , and others, and their cross-talk have been shown to modulate hematopoietic cell specification at multiple stages, which can play important roles during in vitro hematopoiesis. Although OP9-DLL4 stromal cells have been used to efficiently induce hematopoietic and immune cells from our small molecule-induced HEs

[32] , the uncertain nature of feeder cells can lead to inaccurate studies of signaling pathways during hematopoiesis. Therefore, to develop a chemically defined platform for hematopoietic specification, we performed a screening of known chemicals and cytokines on our hPSC-derived AGM-like HEs under feeder-free conditions (Figure 2A). SB431542 (SB) treatment outperformed all other screened modulators and significantly enhanced CD45 +Hematopoietic cell generation (Fig. 2B-D). Interestingly, the Wnt inhibitor Wnt-C59 also significantly induced the emergence of hematopoietic cells, while activation of Wnt signaling by CHIR blocked SB-induced hematopoiesis. Wnt-C59 and SB-induced hematopoiesis also applied to H9 and 6-9-9 hPSCs (Fig. 2E). Notably, higher hematopoietic specification efficiency was observed under SB treatment, suggesting potential crosstalk between TGFp and other signaling pathways, such as retinoic acid signaling

[30] , in addition to Wnt inhibition for SB-induced hematopoiesis. Overall, our results indicate that TGFp and Wnt inhibition significantly enhance the hematopoietic function of hPSC-derived HEs, providing an easy-to-access simple platform for further detailed studies of signaling pathways involved in human hematopoiesis.

[0124] Wnt inhibition is sufficient to induce AGM-like hematovascular hematopoiesis

[0125] To further investigate the role of Wnt signaling during hematopoiesis, we performed RT-PCR analysis on day 6 HE samples under different conditions, and observed low expression of Wnt3A and AXIN2 (Fig. 3A) (downstream targets of Wnt signaling) and low transcriptional activity of endogenous Wnt signaling in 7TGP Wnt reporter lines (Fig. 3B-C), indicating the important role of Wnt inhibition at this stage. Knockdown of CTNNB1 further confirmed the sufficiency of Wnt inhibition for HE hematopoiesis (Fig. 3D-E). These findings are consistent with previous reports that genes antagonizing canonical Wnt signaling are enriched in human AGM cells

[10] and Wnt inhibition is required for hematopoietic transition from mouse AGM

[30] .

[0126] Chemically defined conditions induce robust generation of AGM-like hematovascular hematopoietic cells. Since the window of SB treatment is important for deterministic hematopoiesis [8], we optimized the culture conditions for SB at the early hematopoietic induction stage, and found that treatment from day 4 to 6 most induced hematopoiesis FIG. 8A ), which resulted in more than 40% CD45+ hematopoietic cells at day 12. We also tested the effect of basal medium on hematovascular differentiation at different stages in four cell culture media: Stemline II, LaSR basal medium

[17] , and DMEM medium plus 100 pg / mL ascorbic acid (DMEM / Vc

[18] ) with or without 20% human AB serum FIG. 8B ) Our small molecule-based hematovascular differentiation protocol worked well in most of the tested media, and serum-containing medium outperformed all other conditions FIG. 8C). While human serum (HS) significantly increased the purity of hematopoietic cells at day 12, the use of undefined serum can increase complexity and reduce reproducibility. Therefore, we adopted a chemically defined serum-free cocktail as the differentiation medium (Fig. 4A), which we termed the GiTi (Gsk3 inhibitor, TGF inhibitor) protocol for generating hematopoietic cells from hPSCs. Dynamic morphological changes were observed during GiTi differentiation, as well as the appearance of hematopoietic clusters from day 6 onwards ( FIG. 9A-9B ). Flow cytometry analysis also revealed dynamic changes in CD45, CD34, and SOX17 expression (Fig. 4B-D), with an increase in hematopoietic cells co-expressing CD34 and SOX17, as well as CD34 and CD45. The resulting cells were also positive for RUNX1 (Fig. 4E-F), which is expressed in AGM-derived repopulating HSCs

[34] , confirming the definitive identity of our hematopoietic cells. The extraction of SCF and FLT3L from the differentiation medium reduced the yield and purity of CD45+ hematopoietic cells (Fig. 4G-H). Importantly, the resulting hematopoietic cells had high viability after the freeze-thaw process ( FIG. 9C ), suggesting their potential for long-term storage and off-the-shelf application. Overall, we developed a chemically defined, feeder-free monolayer culture platform for generating homogeneous AGM-like hematopoietic cells from 11 (9 normal and 2 genetically modified) hPSC lines ( FIG. 9D ), highlighting their reproducibility and robustness.

[0127] Transcriptomic analysis reveals global similarity between hPSC-derived hematopoietic cells and human AGM / umbilical cord blood HSCs

[0128] To further confirm the identity of hPSC-derived hematopoietic cells, RNA sequencing (RNA-seq) analysis was performed on RNA from day 18 CD45+ hematopoietic cells differentiated from 6-9-9 and H9. Hierarchical clustering analysis of RNA-seq expression data for hPSCs, hPSC-derived mesoderm (Mes), hematopoietic stem cell-like cells (HSCs), primary human neonatal umbilical cord blood hematopoietic stem cells (CB-HSCs) revealed a high degree of similarity between hPSC-derived hematopoietic cells and human AGM / umbilical cord blood HSCs ( FIG. 10A)

[35] 5-week AGM endothelial (AGM-En), stem / progenitor (AGM-S / P), and progenitor 1 (AGM-Pr1) cells

[10] showed that our hPSC-derived hematopoietic cells are closely related to primary cord blood HSCs, indicating a more mature stage than isolated AGM cells

[10] . Principal component analysis (PCA) of RNA-seq data also confirmed the close relationship of transcriptional signatures between hPSC-derived hematopoietic cells and CB-HSCs (Figure 5A). In the 3D score plot of the first three principal components (PCs), hPSC-derived hematopoietic cells clustered relatively closer to CB-HSCs and were distinct from other cell populations, including hPSCs and hPSC-derived mesoderm from which they originated, as well as AGM cells.

[0129] To further refine the distinct transcriptional programs active during hematopoiesis, we examined specific hematopoietic genes in different hematopoietic cell populations. As expected, day 18 hPSC-derived cells shared expression of many hematopoietic transcription factors ( FIG. 10B ) and cell surface markers ( FIG. 10C ) with AGM and CB cells, although mostly at lower expression levels. Gene set enrichment analysis (GSEA) of hPSCs identified enriched hematopoiesis-related gene ontologies (GOs), including “aortic arch development,” “cell migration,” “hematopoietic stem cell proliferation,” “Notch signaling regulation,” which further confirmed transcriptional similarity between hPSC-derived cells and AGM cells ( FIG. 10D ). Importantly, expression patterns of HOXA (a marker of AGM hematopoiesis)

[10] and HOXB genes were very similar in day 18 hPSC-derived cells and AGM hematopoietic cells (Figure 5B). Overall, our data indicate transcriptional similarity between our hPSC-derived cells and CB-HSCs, highlighting the clear trajectory of our GiTi hematopoietic differentiation [7].

[0130] Single-cell RNA-seq analysis identifies discrete subpopulations in hPSC-derived hematopoietic cells

[0131] To investigate the kinetics and heterogeneity of hematopoietic cells generated from hPSC-derived homogeneous SOX17 + CD34 + HE, we performed scRNA-seq analysis on day 8 (Figures 11A-11D) and day 18 (Figure 5) suspension cells. UMAP embedding of scRNA-seq data revealed 4 distinct cell clusters and 11 distinct cell clusters at day 8 (Figure 11A) and day 18 (Figure 5C), respectively. As expected, day 18 cells expressed much stronger hematopoietic cell markers PTPRC ( CD45) and RUNX1 Figure 5D). Cell identities in different clusters were assigned based on their enriched markers (Figures 11B-11D): clusters expressing high levels of lineage markers were annotated as primed progenitors, while clusters annotated as progenitors were enriched only for progenitor-associated genes. Day 8 cells included clusters of endothelial cells ( CLDN5 / CDH5 ), early ( CAV1 / RUNX1 ) hematopoietic cells, hematopoietic cells ( MTTL3 )

[10] , and lineage-primed hematopoietic progenitors enriched for mitochondrial genes

[36] (Figures 11B-11D). Day 18 cells contained clusters of stromal ( IGF2 / COL1A1 ), endothelial, and hematopoietic cells, as well as clusters primed towards megakaryocytes ( GP9 / PF4 ), monocytes ( SPP1 / CCL3 and CD74 / MMP9 ), granulocytes ( AZU1 / PRTN3 ), myeloid ( MPO / LYZ ), and erythroid ( KLF1 / HBE1 ) cells

[10] . Interestingly, hematopoietic cells under current culture conditions were biased towards granulocytic rather than erythroid lineages, as cells enriched for HBE1 or KLF1 expression were detected much less frequently

[37] , indicating their definitive identity

[38] . Both day 8 and day 18 cells exhibited high levels of expression of definitive AGM hematopoietic markers LMO4 and CD44 [39, 40] (Figures 5E, 11E), while only a few cells in both samples were positive for primitive markers GYPA ( CD235a )

[24] (Figure 11F), further supporting their definitive identity. The observed downregulation of LMO4 and upregulation of CD44 after EHT are consistent with the emergence of hematopoietic cells from the aortic endothelium in mice AGM in vivo

[39] . In addition to its role in regulating EHT, CD44 is a marker of adult HSCs

[41] and is involved in fetal HSC homing and long-term engraftment

[42] , suggesting a potentially high homing capacity of our hPSC-derived hematopoietic cells.

[0132] To investigate the stratification of our hematopoietic cell populations, trajectory analysis was performed using the Monocle software package

[43] . Single-cell trajectory analysis of day 8 cells clearly indicated the emergence and development of hematopoietic cells from the hemogenic endothelium (Figure 11G). For day 18 cells, hematopoietic progenitors branched from a central core into three different trajectories towards monocyte-, granulocyte-, and erythrocyte / megakaryocyte-primed lineages. Additional clusters of endothelial ( CAV1 ), hematopoietic ( RUNX1 ), erythroid ( KLF1 / HBE1 ), and T-cell progenitors (IL7R )

[44] was also localized to the trajectory plot and represented by a different branch (Fig. 5F). HOXB The high expression of the cluster (Fig. 5B) can indicate the presence of potential long-term (LT) HSCs in hPSC-derived cells, as HOXB cluster genes are mainly enriched in murine LT HSCs

[45] . Specifically, HOXB5

[46] and NEO1

[47] were recently reported as markers of murine LT-HSCs. The expression of HOXB5 and NEO1 was detected in different early or lineage-committed hematopoietic cells by scRNA-seq analysis (Fig. 5G). To better monitor the dynamic expression of HOXB5 during hematopoietic cell differentiation, we knocked in the mCherry fluorescent protein into the endogenous HOXB5 locus of the H9 VE-cad-eGFP reporter line by CRISPR / Cas9-mediated homology- directed repair (HDR)

[48] (Fig. 12A). After puromycin (Puro) selection, PCR genotyping and sequencing showed that one out of 17 picked clones was successfully targeted in both alleles (Fig. 12B). The homozygous clone was then applied to GiTi hematopoietic differentiation, and mCherry signal was first detected at day 5 and elevated at day 20 (Fig. 5H, 12C-12D), indicating the presence of potential long-term repopulating HOXB5+ hematopoietic cells. Overall, our data reveal the heterogeneity and stratification of seemingly homogeneous AGM-like cells, highlighting the clear trajectory of our GiTi hematopoietic differentiation [7].

[0133] In vitro and in vivo characterization of hPSC-derived AGM-like hematopoietic cells

[0134] To further evaluate their hematopoietic potential, we performed lymphoid and myeloid assays on day 15 hPSC-derived cells. Methylcellulose-based colony-forming unit assays led to the formation of erythroid (CFU-E), granulocyte / macrophage (CFU-GM), macrophage (CFU-M), and multi-lineage progenitor (CFU-GEMM) colonies (Fig. 13A-13C), confirming the erythroid and myeloid potential of our hPSC-derived cells. We next evaluated their potential to generate T cells and natural killer (NK) cells on OP9-DLL4 feeder cells

[49] , as the ability to produce lymphocytes is a hallmark of definitive hematopoiesis

[24] . After 4 weeks, we obtained over 15% of CD4 + CD8 + T (Fig. 6A) and 85% of CD45 + CD56 +NK cells (Figure 6B), indicating that our hPSC-derived hematopoietic cells are capable of generating immune cells for both research and clinical applications.

[0135] LT-HSCs

[50] and hPSC-derived AGM-like cells

[10] can home to the bone marrow after tail vein injection. To examine their homing ability, about 200 purified mCherry+CD45+ hPSC-derived hematopoietic cells were injected into the common cardinal vein of 48-hour-old zebrafish (Figure 13D) [51, 52]. mCherry+ hematopoietic cells were observed in the caudal hematopoietic tissue (CHT) of zebrafish as early as 1 hour post-transplantation (hpt) (Figure 13E). More hematopoietic cells homed to the CHT at 5 hpt compared to hPSC-derived neuronal cells (Figures 6C-6D). We also injected mCherry+CD45+ hematopoietic cells directly into the germ layers of c-myo knockout (Figure 6E) anemic zebrafish embryos at 3-5 hours post-fertilization (hpf), and observed mCherry+ hematopoietic cells, but not neurons, in the CHT area up to 4 days post-transplantation (dpt) (Figures 13F-13G). Importantly, hPSC-derived hematopoietic cells significantly rescued anemic fish up to 4 days post-transplantation (Figure 6F), highlighting their homing and rescue abilities. Overall, our results demonstrate the functionality of hPSC-derived AGM-like cells, although further studies are needed to investigate their long-term repopulating ability.

[0136] Although attempts have been made to develop human hematopoietic cell differentiation protocols from hPSCs by recapitulating in vivo hematopoiesis with stage-specific utilization of morphogens, it remains unknown which developmental signaling pathways are sufficient and necessary for specifying human AGM-like hematopoietic cells (first wave of LT-HSCs). Moreover, there remains a lack of strategies to efficiently and cost-effectively generate homogeneous AGM-like cells, limiting their large-scale production for both clinical and research applications. This study demonstrates the robust and efficient generation of homogeneous AGM-like hematopoietic cells from multiple hPSC lines by sequential manipulation of Wnt and TGF signaling in chemically defined and xeno-free conditions FIG. 7 ), which is important for the generation of AGM-like cells for clinical and research applications. Importantly, we also show that stage-specific manipulation of Wnt signaling alone is sufficient to induce homogeneous AGM-like SOX17+ hematendothelial and hematopoietic cells from hPSCs, further demonstrating the important role of Wnt signaling during multiple stages of definitive hematopoiesis [10, 24, 30].

[0137] The study also revealed transcriptional and functional similarities between hPSC-derived primary AGM and CB hematopoietic cells. At the global level, hPSC-derived hematopoietic cells were more closely clustered to CB-HSCs than AGM cells, reflecting the different developmental stages of hPSC-derived and AGM cells collected. Further examination of specific hematopoietic genes and ontologies confirmed transcriptional similarities between hPSC-derived cells and AGM cells. Notably, very similar HOXA cluster gene expression patterns were observed between them, highlighting their potential in de novo HSC generation

[10] . Moreover, our hPSC-derived AGM-like hematopoietic cells exhibited lymphoid and myeloid potential in vitro and homed to caudal hematopoietic tissue (CHT) in vivo and rescued anemic zebrafish after transplantation. It would also be interesting to study whether our hPSC-derived hematopoietic cells can home and repopulate the bone marrow in murine models. Recent work successfully demonstrated the homing ability of hPSC-derived AGM-like cells but failed to show evidence of their long-term repopulating ability, which can be due to HOXA incorrect expression patterns of genes

[10] . Although similar patterns were observed, HOXA expression of genes did not reach AGM cell expression levels in our hPSC-derived cells. hPSC-derived AGM-like cells can require additional maturation strategies, such as co-culture with OP9 feeder cells [53-55] and RA patterning

[10] , to achieve long-term repopulating ability.

[0138] In summary, our data established a simplified, novel in vitro model of human definitive hematopoiesis FIG. 7 in which exogenous modulation of Wnt signaling by small molecules (with or without TGF interference) was sufficient to specify hematopoietic cells from hPSCs. This finding is consistent with previous reports that retinoic acid signaling-mediated Wnt inhibition is essential for the development of HSCs from hemogenic endothelium in mice

[30] . This fully defined, xeno-free hematopoietic differentiation platform can be used to generate hematopoietic lineages, including blood and immune cells, from hPSCs with high efficiency and in large quantities and provides insights into the molecular mechanisms of hematopoietic development and accessible cell sources for the treatment of hematological diseases and cancers.

[0139] Materials and Methods

[0140] Maintenance and differentiation of hPSCs. 19-9-11, 19-9-7, 6-9-9, H1, H9, and H13 were obtained from WiCell and maintained on Matrigel- or iMatrix 511-coated plates in mTeSR plus or mTeSR1 medium according to previously published methods

[56] . RUES2 was kindly provided by Dr. Ali H. Brivanlou at Rockefeller University. Kolf2 and CT2 data were obtained in the laboratory of Dr. Yang Yang and Dr. Ourania Andrisani at Purdue University. H9 7TGFP Wnt reporter and 19-9-11 ischcat-1 and ischcat-2 lines

[33] were kindly provided by Dr. Sean Palecek at University of Wisconsin-Madison. To generate hematopoietic cells, hPSCs were dissociated with 1 mM EDTA and plated onto iMatrix 511 or Matrigel-coated 6-, 12-, or 24-well plates in mTeSR plus or mTeSR1 medium (with 5 μΜ Y27632) at a cell density between 10,000 and 80,000 cells / cm2for 24 hours (day -1). On day 0, cells were treated with 6 μΜ CHIR99021 (CHIR) in DMEM medium supplemented with 100 μg / ml ascorbic acid (DMEM / Vc)

[18] followed by medium change with LasR basal medium on days 1, 2, and 3. For female hPSC lines

[57] , 50 ng / mL VEGF was added to the medium from day 2 to day 4. On day 4, the medium was changed to Stemline II medium (Sigma) supplemented with 10 μΜ SB431542. Two days later, the medium containing SB431542 was aspirated and cells were maintained in Stemline II medium with or without 50 ng / mL SCF and FLT3L. On day 9 and every 2 to 3 days thereafter, half of the medium was aspirated and fresh Stemline II medium with or without SCF / FLT3L was added until analysis. Other media for inducing hematopoietic cells are exemplified in 2 FIG. 8B

[0141] Genome editing of hPSCs. Targeting HOXB5 ​​Two Cas9 sgRNAs near the stop codon (1: GGCTCCTCTGGGCGGGCTCAGGG (SEQ ID NO: 1) and 2: ATCGTAACACAAGGCGAGGC AGG (SEQ ID NO: 2), with a G added at the beginning). To generate the HOXB5-2A-mCherry donor plasmid, in HOXB5 A DNA fragment of approximately 800 bp in length was amplified from genomic DNA before and after the stop codon and cloned into the VE-cad-2A-eGFP (Addgene #92309) and VE-cad-2A-mCherry (Addgene #31938) donor plasmids, replacing the VEcad homologous arms. 3 μg gRNA1, 3 μg gRNA2, and 6 μg VEcad-2A-mCherry donor plasmids were prepared in 100 μl stem cell nuclear transfection solution (Lonza, #VAPH-5012) and then co-transfected into 2.5–3 million single H9 hPSCs pretreated overnight with 5 μM Y27632 using program B-015 in Nucleofector 2b. Subsequently, the nuclear-transfected cells were plated into one well of a 6-well plate coated with Matrigel in 3 mL of preheated mTeSR and 10 μM Y27632. 24 hours later and daily thereafter, the medium was replaced with fresh mTeSRplus. Once the cells had confluenced, 1 μg / ml puromycin was added to mTeSRplus for selection for approximately 2 weeks. Single-cell clones were then picked into the wells of Matrigel-coated 96-well plates and PCR genotyping was performed after 4–7 days. To generate an inducible gene knockout system in hPSCs, RfxCas13d[58,59] (Addgene #138147) was PCR amplified and cloned into our all-in-one PiggyBac (PB) backbone by replacing the SARS-CoV2N gene (Addgene #154399)

[60] . A U6-driven construct containing a 5' direct repeat 30 (DR30) and a BbsI-based single guide RNA (sgRNA) cloning site was then cloned before the 3' PB sequence (Fig. 1E) to generate an all-in-one PB-inducible Cas13d-mediated gene knockdown plasmid (Addgene #155184). Design targeting sgRNA1 and sgRNA2 using the online tool (https: / / cas13design.nygenome.org / ). SOX17 And cloned into the Cas13d backbone to prepare SOX17Targeting plasmids (Addgene #155187 and #155188). To generate inducible β-catenin overexpression plasmids, the eGFP gene (Addgene #96930) was replaced with the E[β]P gene

[61] (Addgene #24313) and XLone-BSD β-catenin plasmid was generated. Then, the hyPBase plasmid was transfected with the β-catenin overexpression plasmid by Lipofectamine Stem (ThermoFisher) using the manufacturer’s instructions. SOX17 Knockdown or β-catenin overexpression plasmids were transfected with the hyPBase plasmid into H9 hPSCs. Once transfected cells were confluent, resistant hPSCs were selected for 1 or 2 days using 5 pg / ml puromycin or 20 pg / ml blasticidin (BSD) and once the surviving cells recovered and persisted, the drug was reapplied to the surviving cells to maintain the engineered H9 hPSCs to avoid gene silencing during differentiation.

[0142] Hematopoietic colony formation assay and Wright-Giemsa staining. Approximately 10 4 day 15 hPSC-derived hematopoietic cells were grown in 1.5 ml of MethoCult H4434 medium (StemCell Technologies, Vancouver) containing cytokines at 37°C. After 14 days, the colony forming units (CFU) of hematopoietic colonies were scored according to cell morphology. Hematopoietic cells were also seeded onto glass slides and stained with modified Wright-Giemsa staining solution.

[0143] NK and T cells were differentiated from hematopoietic cells. NK

[49] and T

[62] cell differentiation was performed on OP9-DLL4 feeder layers (courtesy of Dr. Igor Slukvin, University of Wisconsin-Madison) in a-MEM medium supplemented with 20% FBS and 1% GlutaMAX. To initiate NK cell induction, day 15 hematopoietic cells were cultured on OP9-DLL4 with 100 ng / mL FLT3L, 5 ng / mL IL-7, 40 ng / mL SCF, and 35 nM UM171. After 7 days and every 7 days thereafter, cells were transferred to fresh OP9-DLL4. After 14 to 21 days, floating cells were collected and subjected to flow cytometry analysis. A similar approach was used to induce T cell differentiation on OP9-DLL4, except different cytokines were used: 10 ng / ml SCF, 5 ng / mL IL-7, and Flt3L.

[0144] Flow cytometry analysis. Floating hematopoietic cells were gently pipetted and filtered through a 70 or 100 pm filter located on a 50 ml tube. Cells were then pelleted by centrifugation and washed once in PBS- / - solution containing 1% bovine serum albumin (BSA). Cells were stained with appropriate conjugated antibodies (Table 1) for 25 minutes at room temperature in the dark and analyzed in an Accuri C6 plus flow cytometer (Beckton Dickinson) after one wash with BSA-containing PBS- / - solution. FlowJo software was used to process collected flow data.

[0145] Bulk RNA sequencing and data analysis. Total RNA of day 18 hPSC-derived CD45+ hematopoietic cells was prepared with Direct-zol RNA MiniPrep Plus kit (Zymo Research) according to manufacturer’s instructions. Samples were run at GENEWIZ in an Illumina HiSeq 2500. HISAT2 program

[63] was used to map the resulting 2x150 sequencing reads to the human genome (hg 19) and python script rpkmforgenes.py

[64] was used to quantify RefSeq transcript levels (RPKM). Raw fastq files and processed RPKM text files were submitted to NCBI GEO (GSE155196). RNA-seq data for human primary AGM and neonatal cord blood HSC samples were retrieved from NCBI (SRR3475781, 3475782, 3475783

[10] , 3039602 and 3039608

[35] ). Hierarchical clustering of all transcripts and heatmaps of hematopoietic-specific genes were then plotted using Morpheus (Broad Institute). Principal component analysis (PCA) was processed in the R program and 3D score plots of the first three principal components (PC) were plotted in MATLAB. Gene ontology (GO) enrichment analysis was performed using GSEA software (Broad Institute) and GO heatmaps were plotted in Morpheus using the values of the normalized enrichment score (NES).

[0146] Single-cell RNA sequencing (scRNA-seq) analysis. scRNA-seq was performed using the 10X Genomics 3' v3 kit as previously described

[65] following their protocol for recovery of 10,000 cells. Libraries were constructed according to the manufacturer's instructions and sequenced at the Indiana University Medical Genomics Center using Illumina's NovaSeq 6000 platform. The average read depth across samples was 43,000 reads / cell. Read counts were then aligned to the human genome GRCh38 / hg38 using the CellRanger 2.1.0 software. Filtered barcode and count matrices generated using CellRanger were used for subsequent analysis in R. Seurat 3.1.0 was used for analysis of single-cell data

[66] . All time points were initially combined together and filtered for quality control parameters. Seurat's SCTransform function was used to normalize and scale the data to minimize batch effects. Following Seurat's tutorial, dimensionality reduction was performed by principal component analysis (PCA) as assessed by elbow plot. UMAP embedding parameters were based on the top 30 PCs and embedded in two dimensions for visualization. Seurat's FindAllMarkers function was used to identify differentially expressed genes (DEGs) for each cluster and then manually annotated based on enriched gene expression. All genes considered for cell type classification had P-values less than 0.0001 using Mann-Whitney Wilcoxon test. Monocle versions 2 and 3 were used for pseudotime analysis and trajectory inference

[43] . The resulting scRNA-seq raw and processed data are accessible through GEO with Accession Number: GSE155196.

[0147] RT-PCR analysis. Cells cultured on 24-well plates were collected and lysed in 500 μL TRIzol TM Reagent (Invitrogen). Total RNA was then prepared with Direct-zol RNA MiniPrep Kit (Zymo) and column-in DNase treatment was performed following the manufacturer's instructions. cDNA was reverse transcribed from 1 μg RNA with ProtoScript First Strand cDNA Synthesis Kit (NEB) and RT-PCR was performed with GoTaq Green Master Mix (Promega). GAPDH was used as an endogenous control and primer pairs for targeted genes are listed in Table 2.

[0148] Table 1. Antibodies used in this study

[0149] Antibody Source / isotype / clone / catalogue number Concentration CD43-APC BD Biosciences / mouse IgGl / 1G10 / 560198 1:50 CD45-PE BD Biosciences / mouse IgGl / HI30 / 555483 1:50 CD45-APC BD Biosciences / mouse IgGl / HI30 / 555485 1:50 CD45-FITC Biolegend / mouse IgGl / HI30 / 304006 1:50 CD34-FITC Miltenyi Biotec / mouse IgG2a / AC136 / 130-113-178 1:50 CD34-APC Miltenyi Biotec / mouse IgG2a / AC136 / 130-113-176 1:50 SOX17-APC R&D Systems / goat IgG / IC1924A 1:50 CD4-APC-Cy7 BD Biosciences / mouse IgGl / RPA-T4 / 561839 1:50 CD8-PE BD Biosciences / mouse IgGl / RPA-T8 / 555367 1:50 CD56-APC BioLegend / mouse IgGl / 5.1H11 / 362503 1:50 VE-cadherin Santa Cruz / mouse IgGl / F-8 / sc9989 1:200 CD31-FITC Miltenyi Biotec / mouse IgGl / AC128 / 130-117-539 1:50 CD31-APC Miltenyi Biotec / mouse IgGl / AC128 / 130-119-976 1:50 CD31-APC eBioscience / mouse IgGl / WM-59 / 17-0319-42 1:100 CD235a-FITC BD Biosciences / mouse IgG2b / GA-R2 / 561017 1:50 RUNX1-Alexa 488 Abcam / rabbit IgG / EPR3099 / ab199221 1:200 Secondary antibody Alexa 488 goat anti-Ms IgGl / A-21121 1:1,000 Secondary antibody Alexa 488 goat anti-Rb IgG / A-11008 1:1,000 Secondary antibody Alexa 594 goat anti-Ms IgG2b / A-21145 1:1,000 Secondary antibody Alexa 594 goat anti-Ms IgG / A-21145 1:1,000 Secondary antibody Alexa 594 goat anti-Rb IgG / A-11012 1:1,000 Secondary antibody Alexa 647 goat anti-Rb IgG / A-21244 1:1,000

[0150] Table 2. Oligonucleotide primers used in this study

[0151] SEQ ID NOs Gene Sequence (5’ - 3’) Size (bp) / Tm (°C) / Number of cycles 3 F: CTCCCCACCTTGAATGAAGA 211 / 60 / 35 4 F: GCCCCACTCGGATACTTCT 189 / 58 / 40 5 F: GAATGAGACTGCTGATCTTGGAC 250 / 58 / 30 6 F: GCAACCCCTACTATGCCAAC 212 / 60 / 40 7 F: AAATGCGTTTCTCGTTGCTT 136 / 60 / 35 8 F: GCACAGAATCCTTGGTGAACAG 101 / 61.8 / 35 9 F: CCCCTTCATTGACCTCAACTACA 342 / 58 / 30 10 F: CGGCTCTTACGGCTACAATTA 1646 / 60 / 42 11 F: CCCCTTCATTGACCTCAACTACA 342 / 58 / 30 12 Cas9 gRNA1 F: CACCGGCTCCTCTGGGCGGGCTCA annealed oligonucleotides 13 Cas9 gRNA2 F: CACCGATCGTAACACAAGGCGAGGC annealed oligonucleotides 14 Cas13d gRNA F: AAACGGGTCTTCGAGAAGACCT annealed oligonucleotides 15 Cas13d gRNA1 F: AAACACCATAAATTATATGCCAACACA annealed oligonucleotides 16 Cas13d gRNA2 F: AAACTAAGATTACTTGAAGTAGGCTCA annealed oligonucleotides

[0152] hPSC-derived hematopoietic cells were transplanted into zebrafish. About 200 mCherry+CD45+ hPSC-derived hematopoietic cells were injected into the common hepatic duct of 48-hour-old zebrafish [51, 52]. The homing of mCherry+ cells to the CHT was recorded and quantified under a fluorescence microscope 1, 3, and 5 hours post-transplantation (hpt) mCherry+ hematopoietic cells. hPSC-derived neuronal cells were used as a negative control. For embryo injection into c-myb anemic zebrafish

[67] , about 2,000 cells were directly microinjected into the blastoderm of 3- to 5-hpf zebrafish blastula. The homing of mCherry+ cells to the CHT was recorded under a fluorescence microscope at 1, 5, 48, 72, and 96 hpf, and the surviving zebrafish were counted.

[0153] Some basic materials for stem cell culture and differentiation are provided below. Part A: Cell Culture Media. Human pluripotent stem cell (hPSCs) culture and maintenance media: Media for general culture and expansion of hPSCs prior to differentiation, as well as any of the following 6 media (or any other similar commercial media) can be used to maintain hPSCs used in the present disclosure. mTeSR1: StemCell Technologies, 85850; mTeSR Plus: StemCell Technologies, 05825; Essential 8 media: ThermoFisher, A1517001; StemFlex media: ThermoFisher, A3349401; NutriStem hPSC XF media: Biological Industries, 05-100-1A; Homemade LaSR media (patented by our collaborator): Advanced DMEM / F12 (ThermoFisher cat# 12634-028), 305 μΐ L-Ascorbic acid 2-phosphate (Sigma cat# A8960, 100 mg / ml stock), 6.5 ml GlutMax (ThermoFisher cat# 35050-079), 50 ng / ml bFGF (Peprotech, cat# 100-18B), and 1.5 ng / ml TGFβ-I (Peprotech, cat# 100-21C). (2) DMEM / Vc: can be used as day 0-1, day 0-2, day 0-5, etc. differentiation media DMEM basal media (ThermoFisher, cat# 11965-092) with 60 μg / ml L-Ascorbic acid acid (Sigma, A8960); (3) LaSR basal media: can be used as day 1-4, day 0-4, day 1-5, day 0-5, day 0-16, etc. differentiation media.

[0154] Advanced DMEM / F12 (Thermo Cat# 12634-028), 305 μΐ L-Ascorbic acid 2-phosphate (Sigma Cat# A8960, 100 mg / ml stock), 6.5 ml GlutMax (Thermo Cat# 35050-079). Stemline II medium (Sigma, S0192): can be used as differentiation medium for day 0-4, day 0-6, day 5-16, day 6-16, day 0-16, etc. StemSpan H3000 (Stemcell Technologies, 09850): can be used as differentiation medium for day 0-4, day 0-6, day 5-16, day 6-16, day 0-16, etc. DMEM / Vc + 15% or 20% human AB-serum: can be used as differentiation medium for day 5-16, day 6-16, day 0-16, etc. DMEM basal medium (ThermoFisher, Cat# 11965-092) + 60 μg / ml L-Ascorbic acid (Sigma, A8960) + 15% or 20% human AB-serum (Valley Biomedical, HP1022HI or Sigma, H4522).

[0155] Part B: Stem cell culture and differentiation substrates: hESC-qualified Matrigel, Corning, 354277; iMatrix-511, Iwai North Amercia Inc, N-892021 or N-892011; Nacalai USA Inc, 892021 or 892011; Synthemax II-SC substrate, Corning, 3535; Vitronectin substrate, Stemcell Technologies, 07180; Mebiol gel for 3D culture and differentiation, Cosmo, MBG-PMW20-1001.

[0156] Part C: Small molecules and growth factors: Y27632 (~5 mM~): Human pluripotent stem cell culture, Cayman Chem, 10005583; CHIR99021 (~6 mM~), depending on the culture medium and cell line used, can range from 1 to 20 mM; Gsk3 inhibitor; Cayman Chem, 13122; SB431542 (~10 mM~). TGF inhibitor; Cayman Chem, 13031; A83-01 (~5 mM~); TGF inhibitor; Cayman Chem, 9001799; Recombinant Human VEGF165 (~50 ng / mL~), Peprotech #100-20; Recombinant Human SCF (~50 ng / mL~), Peprotech #300-07; Recombinant Human Flt3-ligand (~50 ng / mL~), Peprotech #300-19.

[0157] Statistical analysis. Data are expressed as mean ± standard error of the mean (s.e.m). Statistical significance was determined by Student's t - test (two-tailed) between two groups, and by one-way analysis of variance (ANOVA) for three or more groups. P < 0.05 was considered statistically significant.

[0158] Those skilled in the art will realize that many modifications can be made to the specific implementations described above. The implementations should not be limited to the particular limitations described. Other implementations are possible.

[0159] While the application has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only certain embodiments have been shown and described and that all changes and modifications that come within the spirit of the application are desired to be protected. The scope of the present method and apparatus is to be limited only by the claims. However, it must be understood that the disclosure might be practiced in different ways without departing from the spirit or scope of the present application.

[0160] Cited references:

[0161]

[0162]

[0163] SEQUENCE LISTING <110> Purdue Research Foundation <120> Generation of aorta-gonad-mesonephroid hematopoietic cells from human pluripotent stem cells under defined conditions <130> 68927-02 <150> US 62 / 982,992 <151> 2020-02-28 <160> 16 <170> PatentIn version 3.5 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Case9 sgRNA targeting HOXB5 seq1 <400> 1 ggctcctctg ggcgggctca ggg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Case9 sgRNA targeting HOXB5 seq2 <400> 2 atcgtaacac aaggcgaggc agg 23 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer AXIN2 <400> 3 ctccccacct tgaatgaaga 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer WNT3A <400> 4 gccccactcg gatacttct 19 <210> 5 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Forward primer CTNNB1 <400> 5 gaatgagact gctgatcttg gac 23 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer GATA2 <400> 6 gcaaccccta ctatgccaac 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer AFP <400> 7 aaatgcgttt ctcgttgctt 20 <210> 8 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Forward primer ALB <400> 8 gcacagaatc cttggtgaac ag 22 <210> 9 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Forward primer GAPDH <400> 9 ccccttcatt gacctcaact aca 23 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer HOXB5 KI (red) <400> 10 cggctcttac ggctacaatt a 21 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer HOXB5 KI (blue) <400> 11 ccccttcatt gacctcaact aca 23 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer HOXB5 Cas9 gRNA1 <400> 12 caccggctcc tctgggcggg ctca 24 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer HOXB5 Cas9 gRNA2 <400> 13 caccgatcgt aacacaaggc gaggc 25 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer is scramble Cas13d gRNA <400> 14 aaacgggtct tcgagaagac ct 22 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer SOX17 Cas13d gRNA1 <400> 15 aaacaccata aattatatgc caacaca 27 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer SOX17 Cas13d gRNA2 <400> 16 aaactaagat tacttgaagt aggctca 27

Claims

1. A method for generating hematopoietic stem cells (HSCs) and progenitor cells from human pluripotent stem cells (hPSCs), comprising the following steps: a. Preparation of human pluripotent stem cells (hPSCs); b. Prepare a culture medium containing vascular endothelial growth factor (VEGF) and a glycogen synthase kinase-3 (GSK3) inhibitor, wherein the GSK3 inhibitor is used to activate the classical Wnt signaling pathway of the hPSC; c. Incubate the hPSCs in the culture medium for a period of time; and d. Then, the activated canonical Wnt signaling pathway or transforming growth factor β (TGF-β) signaling pathway is downregulated for a period of time to induce and generate the hematopoietic stem cells (HSCs), wherein the downregulation of the transforming growth factor β (TGF-β) signaling pathway is achieved by a TGF-β inhibitor, including ALK5 inhibitors, polyvinyl alcohol (PVA), TGF-β shRNA, TGF-β-targeted Cas13d or Cas9 gRNA, or wherein the downregulation of the activated canonical Wnt signaling pathway is achieved by a Wnt inhibitor, including Wnt-C59, IWP-2, β-catenin shRNA, β-catenin-targeted Cas13d or Cas9 gRNA.

2. The method of claim 1, further comprising adding stem cell factor (SCF) or Flt3-ligand to the culture medium in step d to improve batch-to-batch consistency.

3. The method according to claim 1, wherein the hPSC comprises human embryonic stem cell (hESC) lines selected from H9, H1 and H13; and human induced pluripotent cell lines selected from 19-9-11, 6-9-9 and Kolf2.

4. The method according to claim 1, wherein the ALK5 inhibitor comprises SB431542 and A83-01.

5. The method according to claim 1, wherein the functional concentration range of the Wnt inhibitor is from about 0.2 µM to about 20 µM.

6. The method of claim 1, wherein the Wnt-C59 has the following formula, or a pharmaceutically acceptable salt thereof, 。 7. The method of claim 1, wherein the IWP-2 has the following formula, or a pharmaceutically acceptable salt thereof, 。 8. The method of claim 4, wherein the functional concentration range of SB431542 is from about 0.2 µM to about 20 µM.

9. The method according to claim 4, wherein the SB431542 has the following formula, or a pharmaceutically acceptable salt thereof, ， Where x is any number.

10. The method according to claim 4, wherein the A83-01 has the following formula, or a pharmaceutically acceptable salt thereof, 。 11. The method of claim 4, wherein the concentration range of A83-01 is from about 0.2 μM to about 20 µM.

12. The method according to claim 1, wherein the GSK3 inhibitor comprises CHIR99021, CHIR98014, BIO, MeBIO, LY2090314, lithium chloride, and indirubin.

13. The method of claim 12, wherein the CHIR99021 has the following formula, or a salt thereof, 。 14. The method of claim 12, wherein the CHIR98014 has the following formula, or a salt thereof, 。 15. The method according to claim 13 or 14, wherein the concentration range of CHIR99021 or CHIR98014 is from about 0.2 μM to about 20 µM.

16. The method of claim 1, wherein the hematopoietic stem cells are aorta-gonad-mesonephric-like SOX17. + CD34 + Hematopoietic stem cells or progenitor cells, and ordinary CD34 + CD45 + / CD43 + Hematopoietic progenitor cells.

17. A kit for differentiating and producing hematopoietic stem cells and progenitor cells from human pluripotent stem cells, comprising a defined culture medium containing human pluripotent stem cells, a GSK3 inhibitor, a TGF-β inhibitor, and VEGF, wherein the TGF-β inhibitor comprises SB431542, A83-01, and polyvinyl alcohol (PVA).

18. The kit according to claim 17, wherein the concentration range of SB431542 is from about 0.2 µM to about 20 µM.

19. The kit according to claim 17, wherein the SB431542 has the following formula, or a pharmaceutically acceptable salt thereof. ， Where x is a number.

20. The kit according to claim 17, wherein the A83-01 has the following formula, or a pharmaceutically acceptable salt thereof. 。 21. The kit of claim 17, wherein the human pluripotent stem cells comprise human embryonic stem cell (hESC) lines selected from H9, H1, and H13; and human induced pluripotent cell lines selected from 19-9-11, 6-9-9, and IMR90-C4.

22. The kit according to claim 17, wherein the hematopoietic stem cells are aorta-gonad-mesonephric-like SOX17. + CD34 + Hematopoietic stem cells or progenitor cells, and ordinary CD34 + CD45 + / CD43 + Hematopoietic progenitor cells.

23. A product of hematopoietic stem cells or progenitor cells, manufactured using a kit according to any one of claims 17-22.

Images