Application of MN1 in diagnosis and treatment of osteosarcoma

By detecting and inhibiting METTL14, MN1, and/or IGF2BP2, the problems of chemotherapy resistance and poor prognosis in osteosarcoma have been solved, enabling accurate diagnosis and effective treatment of osteosarcoma, inhibiting osteosarcoma cell growth and metastasis, and improving sensitivity to ATRA.

CN115161397BActive Publication Date: 2026-08-25THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210615705.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-01
Publication Date
2026-08-25
Estimated Expiration
2042-06-01

AI Technical Summary

Technical Problem

Current technologies have failed to effectively utilize targeted therapy targets to improve the prognosis of osteosarcoma patients. Chemotherapy resistance is a prominent problem, there is a lack of characteristic targetable mutation sites, and existing targeted drug trials have yielded poor results.

Method used

METTL14, MN1, and/or IGF2BP2 were used as biomarkers for the diagnosis and prognostic assessment of osteosarcoma. Diagnosis and prognostic assessment were performed by detecting the levels of these substances, and their inhibitors were used to prepare osteosarcoma-related products to inhibit osteosarcoma cell proliferation, migration, invasion, and improve sensitivity to ATRA.

Benefits of technology

By detecting the levels of METTL14, MN1, and/or IGF2BP2, accurate diagnosis and prognostic assessment of osteosarcoma can be achieved, osteosarcoma cell growth, metastasis, and invasion can be inhibited, cell stemness can be reduced, sensitivity to ATRA can be increased, and the treatment effect of osteosarcoma patients can be improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115161397B_ABST
    Figure CN115161397B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to application of MN1 in diagnosis and treatment of osteosarcoma. The application discloses, for the first time, application of METTL14, MN1 and / or IGF2BP2 in osteosarcoma diagnosis or prognosis evaluation. It can be known from METTL14, MN1 and / or IGF2BP2 and total survival rate, lung metastasis-free survival curve diagram and / or 5-year survival rate ROC curve diagram of METTL14, MN1 and / or IGF2BP2 that METTL14, MN1 and / or IGF2BP2 can be used as a marker for osteosarcoma diagnosis or prognosis evaluation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of MN1 in the diagnosis and treatment of osteosarcoma. Background Technology

[0002] Osteosarcoma is the most common primary malignant bone tumor in children and young adults. Although it accounts for only about 5% of childhood and adolescent cancers, it has a significant impact on childhood cancer mortality: it grows rapidly, is highly malignant, and is prone to metastasis and recurrence, resulting in a poor prognosis. Osteosarcoma commonly occurs in the metaphysis of the long bones of the limbs, most frequently in the distal femur (approximately 43%), with about 23% occurring in the proximal tibia and 10% in the humerus. Osteosarcoma is prone to metastasis, with lung metastases detectable in about 15% of patients at initial diagnosis. Lung metastasis is the most common mode of metastasis for osteosarcoma, occurring in the lungs in over 85% of osteosarcoma patients. The presence of metastatic lesions is a significant prognostic indicator.

[0003] In the 1970s and 1980s, the advent of neoadjuvant chemotherapy and advancements in limb-sparing surgery greatly improved the prognosis of osteosarcoma patients. The overall survival rate for osteosarcoma patients without metastatic lesions increased to 60%–70%, supporting the view that controlling micrometastases at diagnosis is essential for long-term survival. Neoadjuvant chemotherapy became the standard of care for osteosarcoma patients. However, for patients with metastatic lesions, despite aggressive resection and intensive systemic chemotherapy, the 5-year event-free survival (EFS) rate was only 20%. Relapsed patients also fared poorly, with a 10-year overall survival rate of only 20% or lower. Furthermore, approximately 40–50% of patients were insensitive to current chemotherapy regimens. In the last two or three decades, numerous studies on the pathogenesis of osteosarcoma, clinical trials of several new drugs, and studies employing intensified dosage strategies for standard chemotherapy have failed to successfully improve the prognosis of osteosarcoma patients.

[0004] The expression of pathogenic genes in malignant tumors determines their occurrence, development, and prognosis. However, the pathogenesis of osteosarcoma is highly complex and remains unclear, with a highly unstable genome. Although studies have found that gene deletions, rearrangements, and abnormal mutations, such as those in Rb, MDM2, p53, PTEN, and c-fos genes, play important roles in the malignant progression of osteosarcoma and patient survival, providing a theoretical basis for finding new treatments, osteosarcoma has almost no characteristic targetable mutation sites, and trials of targeted drugs have generally been disappointing. In recent years, the continuous development of molecular biology and molecular genetics of tumors has provided favorable conditions for exploring the pathogenesis of osteosarcoma. Therefore, in order to minimize the development of chemotherapy resistance in osteosarcoma, find suitable targeted therapeutic targets, and maximize patient survival, in-depth research into the molecular genetic mechanisms of osteosarcoma is particularly important, potentially providing new treatment strategies for improving the prognosis of osteosarcoma patients.

[0005] MN1 is a TEL fusion protein that is overexpressed in AML leukemia. High MN1 expression is indicative of a poor prognosis in AML patients. MN1 is a highly efficient hematopoietic oncogene, and its overexpression can induce AML in mice. MN1 is a stem gene crucial for leukemia development; its overexpression promotes proliferation / self-renewal and inhibits differentiation. However, there are no reports of MN1's application in the diagnosis and treatment of osteosarcoma. Summary of the Invention

[0006] A first aspect of the present invention aims to provide the use of substances for detecting METTL14, MN1, and / or IGF2BP2 in the preparation of products for the diagnosis or prognostic assessment of osteosarcoma.

[0007] A second aspect of the present invention is to provide a combination of markers.

[0008] A third aspect of the present invention is to provide a diagnostic product.

[0009] A fourth aspect of the present invention aims to provide the application of METTL14, MN1 and / or IGF2BP2 inhibitors.

[0010] A fifth aspect of the present invention is to provide an RNA.

[0011] A sixth aspect of the present invention is to provide a nucleic acid molecule encoding the RNA of the fifth aspect of the present invention.

[0012] A seventh aspect of the present invention is to provide an expression cassette, vector, or transgenic cell line comprising the nucleic acid molecule of the sixth aspect of the present invention.

[0013] An eighth aspect of the present invention is to provide a product.

[0014] The ninth aspect of the present invention aims to provide the use of METTL14, MN1 and / or IGF2BP2 as targets in the development of osteosarcoma-related products.

[0015] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0016] The first aspect of the present invention provides the use of at least one, at least two, or at least three of (a1) to (a3) ​​in the preparation of products for the diagnosis or prognostic assessment of osteosarcoma;

[0017] (a1) Substances that can be detected by METTL14;

[0018] (a2) Substances that detect MN1;

[0019] (a3) Detection of IGF2BP2 substances.

[0020] Preferably, any one of (a1) to (a3) ​​is used in the preparation of products for the diagnosis or prognostic assessment of osteosarcoma.

[0021] Preferably, (a1), (a2), and (a3) ​​are used in the preparation of products for the diagnosis or prognostic assessment of osteosarcoma.

[0022] Preferably, the product comprises reagents, kits, test strips, or chips.

[0023] Preferably, the test sample for the product is selected from at least one of blood, tissue, cell samples, urine, and feces.

[0024] Preferably, the level of the detected substance is positively correlated with the diagnosis and prognostic assessment of osteosarcoma.

[0025] A second aspect of the present invention provides a combination of markers comprising at least two or at least three of (b1) to (b3);

[0026] (b1)METTL14;

[0027] (b2)MN1;

[0028] (b3)IGF2BP2.

[0029] Preferably, the marker combination includes METTL14, MN1, and IGF2BP2.

[0030] Preferably, the combination of biomarkers is used for the diagnosis or prognostic assessment of osteosarcoma.

[0031] Preferably, the levels of the detected biomarker combination are positively correlated with the diagnosis and prognostic assessment of osteosarcoma.

[0032] A third aspect of the present invention provides a diagnostic product comprising: (n1) or (n2):

[0033] (n1): at least two or at least three of (a1) to (a3);

[0034] (a1) Substances that can be detected by METTL14;

[0035] (a2) Substances that detect MN1;

[0036] (a3) Substances for detecting IGF2BP2;

[0037] (n2): METTL14-specific PCR primers, the sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4; and / or

[0038] MN1-specific PCR primers, the sequences of which are shown in SEQ ID NO.25 and SEQ ID NO.26; and / or

[0039] IGF2BP2-specific PCR primers, the sequences of which are shown in SEQ ID NO.27 and SEQ ID NO.28.

[0040] Preferably, (n1) comprises (a1), (a2), and (a3).

[0041] Preferably, the diagnostic product comprises: reagents, kits, test strips, or chips.

[0042] Preferably, the test sample for the diagnostic product is selected from at least one of blood, tissue, cell samples, urine, and feces.

[0043] Preferably, the level of the detected substance is positively correlated with the diagnosis and prognostic assessment of osteosarcoma.

[0044] A fourth aspect of the invention provides the application of at least one of (c1) to (c3) in (d1) to (d7);

[0045] (c1) METTL14 inhibitor;

[0046] (c2) MN1 inhibitor;

[0047] (c3) IGF2BP2 inhibitor;

[0048] (d1) Preparation of drugs for the prevention and treatment of osteosarcoma;

[0049] (d2) Preparation of reagents to inhibit osteosarcoma cell proliferation;

[0050] (d3) Preparation of reagents to inhibit osteosarcoma cell migration;

[0051] (d4) Preparation of reagents to inhibit osteosarcoma cell invasion;

[0052] (d5) Preparation of reagents to inhibit the growth of osteosarcoma cells;

[0053] (d6) Preparation of reagents to reduce the stemness of osteosarcoma cells;

[0054] (d7) Prepare drugs to improve the sensitivity of osteosarcoma to ATRA.

[0055] Preferably, the osteosarcoma cells include at least one of U2OS, U2OS / MTX300, MNNG / HOS, 143B, and SJSA-1.

[0056] A fifth aspect of the present invention provides an RNA comprising at least one of (k1) to (k6);

[0057] (k1)shMETTL14#32, the sequence of the positive chain of shMETTL14#32 is shown in SEQ ID NO.31, and the sequence of the negative chain of shMETTL14#32 is shown in SEQ ID NO.32;

[0058] (k2)shMETTL14#33, the sequence of the positive chain of shMETTL14#33 is shown in SEQ ID NO.33, and the sequence of the negative chain of shMETTL14#33 is shown in SEQ ID NO.34;

[0059] (k3)shMN1#a, the sequence of the sense chain of shMN1#a is shown in SEQ ID NO.35, and the sequence of the antisense chain of shMN1#a is shown in SEQ ID NO.36;

[0060] (k4)shMN1#b, the sequence of the sense chain of shMN1#b is shown in SEQ ID NO.37, and the sequence of the antisense chain of shMN1#b is shown in SEQ ID NO.38;

[0061] (k5)siIGF2BP2#1, wherein siIGF2BP2#1 is a reverse complementary double-stranded RNA, the sequence of one strand of which is shown in SEQ ID NO.39;

[0062] (k6)siIGF2BP2#2, wherein siIGF2BP2#2 is a reverse complementary double-stranded RNA, the sequence of one strand of which is shown in SEQ ID NO.40.

[0063] A sixth aspect of the invention is to provide a nucleic acid molecule encoding RNA of the fifth aspect of the invention.

[0064] A seventh aspect of the invention is to provide an expression cassette, vector, or transgenic cell line comprising a nucleic acid molecule of the sixth aspect of the invention.

[0065] Preferably, the transgenic cell line does not contain propagation material.

[0066] An eighth aspect of the present invention is to provide a product comprising: any one of (l1) to (l2):

[0067] At least two, at least three, or at least four of (l1)(c1) to (c4):

[0068] (c1) METTL14 inhibitor;

[0069] (c2) MN1 inhibitor;

[0070] (c3) IGF2BP2 inhibitor;

[0071] (c4) Retinoic acid;

[0072] (l2) At least one of the RNA of the fifth aspect of the present invention, the nucleic acid molecule of the sixth aspect, the expression cassette, the vector or the transgenic cell line of the seventh aspect.

[0073] Preferably, (l1) comprises: retinoic acid and at least one, at least two, or at least three of (c1) to (c3):

[0074] (c1) METTL14 inhibitor;

[0075] (c2) MN1 inhibitor;

[0076] (c3) IGF2BP2 inhibitor.

[0077] Preferably, the product has at least one function among (m1) to (m7):

[0078] (m1) Prevention and treatment of osteosarcoma;

[0079] (m2) inhibits osteosarcoma cell proliferation;

[0080] (m3) inhibits osteosarcoma cell migration;

[0081] (m4) inhibits osteosarcoma cell invasion;

[0082] (m5) inhibits the growth of osteosarcoma cells;

[0083] (m6) reduces osteosarcoma cell stemness;

[0084] (m7) Improves the sensitivity of osteosarcoma to ATRA.

[0085] Preferably, the osteosarcoma cells include at least one of U2OS, U2OS / MTX300, MNNG / HOS, 143B, and SJSA-1.

[0086] Preferably, the product is a drug or reagent.

[0087] A ninth aspect of the present invention provides the use of at least one, at least two, or at least three of (b1) to (b3) as targets in the development of osteosarcoma-related products;

[0088] (b1)METTL14;

[0089] (b2)MN1;

[0090] (b3)IGF2BP2.

[0091] Preferably, the product is:

[0092] Reagents, kits, test strips, or chips used for the diagnosis or prognostic assessment of osteosarcoma; or

[0093] Drugs for the prevention and treatment of osteosarcoma.

[0094] Preferably, according to the first and third aspects of the present invention, the substance for detecting METTL14 is a substance for quantitative detection of METTL14.

[0095] Preferably, the substance for detecting METTL14 includes a substance for detecting METTL14 at the gene level and / or protein level.

[0096] Preferably, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarrays.

[0097] Preferably, the immunohistochemical method is selected from at least one of the following: immunofluorescence analysis, reverse enzyme-linked immunosorbent assay (ELISA), and immunogold assay.

[0098] Preferably, the substance for detecting METTL14 is selected from at least one of the following groups: substances specific to METTL14, such as its antibody (preferably a monoclonal antibody); METTL14-specific probes, gene chips, PCR primers, etc.

[0099] Preferably, the substance used to detect METTL14 is selected from: METTL14 antibody; and / or

[0100] METTL14-specific PCR primers.

[0101] Preferably, the sequences of the METTL14-specific PCR primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0102] Preferably, the substance for detecting MN1 includes a substance for quantitative detection of MN1.

[0103] Preferably, the substance for detecting MN1 includes substances that detect MN1 at the gene level and / or protein level.

[0104] Preferably, the substance is a substance used in one or more detection techniques or methods selected from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarrays.

[0105] Preferably, the immunohistochemical method is selected from at least one of the following: immunofluorescence analysis, reverse enzyme-linked immunosorbent assay (ELISA), and immunogold assay.

[0106] Preferably, the substance for detecting MN1 is selected from at least one of the following: substances specific to MN1, such as antibodies (preferably monoclonal antibodies); MN1-specific probes, gene chips, PCR primers, etc.

[0107] Preferably, the substance used to detect MN1 is selected from: MN1 antibody; and / or

[0108] MN1-specific PCR primers.

[0109] Preferably, the sequences of the MN1-specific PCR primers are shown in SEQ ID NO.25 and SEQ ID NO.26.

[0110] Preferably, the substance for detecting IGF2BP2 includes a substance for quantitative detection of IGF2BP2.

[0111] Preferably, the substance for detecting IGF2BP2 includes a substance for detecting IGF2BP2 at the gene level and / or protein level.

[0112] Preferably, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarrays.

[0113] Preferably, the immunohistochemical method is selected from at least one of the following: immunofluorescence analysis, reverse enzyme-linked immunosorbent assay (ELISA), and immunogold assay.

[0114] Preferably, the substance for detecting IGF2BP2 is selected from at least one of the following groups: substances specific to IGF2BP2, such as its antibody (preferably a monoclonal antibody); IGF2BP2 specific probes, gene chips, PCR primers, etc.

[0115] Preferably, the substance used to detect IGF2BP2 is selected from: IGF2BP2 antibody; and / or

[0116] IGF2BP2-specific PCR primers.

[0117] Preferably, the sequences of the IGF2BP2-specific PCR primers are shown in SEQ ID NO.27 and SEQ ID NO.28.

[0118] Preferably, according to the fourth and eighth aspects of the present invention, the METTL14 inhibitor comprises at least one of a substance that inhibits METTL14 activity, a substance that degrades METTL14, and a substance that reduces the expression level of METTL14; further comprising a substance that reduces the expression level of METTL14.

[0119] Preferably, the substance that reduces METTL14 expression levels comprises at least one of (e1) to (e3):

[0120] (e1) siRNA, dsRNA, miRNA, ribozyme, or shRNA that target METTL14;

[0121] (e2) encodes the nucleic acid molecule of (e1);

[0122] (e3) Expression cassettes, vectors, or transgenic cell lines containing (e2).

[0123] Preferably, the METTL14 inhibitor comprises at least one of (f1) to (f3):

[0124] (f1) shRNA targeting METTL14;

[0125] (f2) encodes the nucleic acid molecule of (f1);

[0126] (f3) contains an expression cassette, vector, or transgenic cell line of (f2).

[0127] Preferably, the shRNA targeting METTL14 comprises shMETTL14#32 and / or shMETTL14#33:

[0128] The sequence of the positive chain of shMETTL14#32 is shown in SEQ ID NO.31, and the sequence of the negative chain of shMETTL14#32 is shown in SEQ ID NO.32;

[0129] The sequence of the positive chain of shMETTL14#33 is shown in SEQ ID NO.33, and the sequence of the negative chain of shMETTL14#33 is shown in SEQ ID NO.34.

[0130] Preferably, the MN1 inhibitor comprises at least one of a substance that inhibits MN1 activity, a substance that degrades MN1, and a substance that reduces MN1 expression levels; further comprising a substance that reduces MN1 expression levels.

[0131] Preferably, the substance that reduces MN1 expression levels comprises at least one of (g1) to (g3):

[0132] (g1) siRNA, dsRNA, miRNA, ribozyme, or shRNA that target MN1;

[0133] (g2) encodes the nucleic acid molecule (g1);

[0134] (g3) contains an expression cassette, vector, or transgenic cell line containing (g2).

[0135] Preferably, the MN1 inhibitor comprises at least one of (h1) to (h3):

[0136] (h1) shRNA targeting MN1;

[0137] (h2) encodes the nucleic acid molecule of (h1);

[0138] (h3) contains expression cassettes, vectors, or transgenic cell lines containing (h2).

[0139] Preferably, the shRNA targeting MN1 comprises shMN1#a and / or shMN1#b:

[0140] The sequence of the sense strand of shMN1#a is shown in SEQ ID NO.35, and the sequence of the antisense strand of shMN1#a is shown in SEQ ID NO.36;

[0141] The sequence of the sense chain of shMN1#b is shown in SEQ ID NO.37, and the sequence of the antisense chain of shMN1#b is shown in SEQ ID NO.38.

[0142] Preferably, the IGF2BP2 inhibitor comprises at least one of a substance that inhibits IGF2BP2 activity, a substance that degrades IGF2BP2, and a substance that reduces the expression level of IGF2BP2; further comprising a substance that reduces the expression level of IGF2BP2.

[0143] Preferably, the substance that reduces IGF2BP2 expression level includes at least one of (i1) to (i3):

[0144] (i1) siRNA, dsRNA, miRNA, ribozyme, or shRNA that target IGF2BP2;

[0145] (i2) encodes the nucleic acid molecule of (i1);

[0146] (i3) contains an expression cassette, vector, or transgenic cell line of (i2).

[0147] Preferably, the IGF2BP2 inhibitor comprises at least one of (j1) to (j3):

[0148] (j1) siRNA targeting IGF2BP2;

[0149] (j2) encodes the nucleic acid molecule of (j1);

[0150] (j3) contains an expression cassette, vector, or transgenic cell line of (j2).

[0151] Preferably, the siRNA targeting IGF2BP2 comprises siIGF2BP2#1 and / or siIGF2BP2#2:

[0152] The siIGF2BP2#1 is a reverse complementary double-stranded RNA, and the sequence of one strand is shown in SEQ ID NO.39;

[0153] The siIGF2BP2#2 is a reverse complementary double-stranded RNA, one strand of which has the sequence shown in SEQ ID NO.40.

[0154] Preferably, according to the first, second, third, fourth, eighth, and ninth aspects of the present invention, the METTL14 registry number is NCBI ID:57721.

[0155] Preferably, the MN1 login number is NCBI ID:4330.

[0156] Preferably, the IGF2BP2 accession number is NCBI ID:10644.

[0157] The beneficial effects of this invention are:

[0158] This invention discloses for the first time the application of METTL14, MN1, and / or IGF2BP2 in the diagnosis or prognostic assessment of osteosarcoma. Through the comparison of METTL14, MN1, and / or IGF2BP2 with overall survival, lung metastasis-free survival curves, and / or the 5-year survival ROC curve of METTL14, MN1, and / or IGF2BP2, it can be seen that METTL14, MN1, and / or IGF2BP2 can serve as biomarkers for the diagnosis or prognostic assessment of osteosarcoma.

[0159] This invention discloses for the first time the application of METTL14, MN1, and / or IGF2BP2 inhibitors in the prevention and treatment of osteosarcoma. By targeting and downregulating METTL14, MN1, and / or IGF2BP2 (inhibiting the expression of METTL14, MN1, and / or IGF2BP2), degrading METTL14, MN1, and / or IGF2BP2, and inhibiting the activity of METTL14, MN1, and / or IGF2BP2, it is possible to inhibit the growth, proliferation, metastasis, and invasion of osteosarcoma cells, reduce the stemness of osteosarcoma cells, and improve the sensitivity of osteosarcoma to ATRA, ultimately improving or treating osteosarcoma. Attached Figure Description

[0160] Figure 1 m in osteosarcoma tissue specimen 6 The results of modification level A: Where A represents the total mRNA levels in human osteosarcoma tumor tissue and adjacent normal tissue detected by liquid chromatography-tandem mass spectrometry (LC-MS / MS). 6 Level A (m) 6 The result graph of A / A)(n=5); B is m 6 A colorimetric ELISA kit was used to detect RNA N in 50 pairs of osteosarcoma tissues. 6 -Methyladenosine (m 6 A) Results graph for levels (n=50); C is RNA m 6 A dot hybridization and resistance to m 6 Antibody A detection in total m in human osteosarcoma samples 6 A shows the mRNA levels (methylene blue (MB) staining as a load control (n=3)); D represents mRNA levels in osteosarcoma tumor tissues from patients with lung metastases (LM, n=29) and patients without lung metastases (NLM, n=21). 6 A level map of RNA.

[0161] Figure 2 This is a diagram showing the expression of METTL14 in osteosarcoma tissue specimens and cells: A represents the expression of mETTL14 in OS and paired normal tissues detected by qPCR. 6A shows the expression levels of key regulatory enzymes (n=50); B shows the results of Western blotting analysis of METTL14 protein levels in osteosarcoma tissue and paired normal tissue (n=7); C shows the results of Western blotting analysis of METTL14 protein levels in bone marrow stem cells (BMSCs) and nine osteosarcoma cell lines.

[0162] Figure 3 These are graphs showing the relationship between METTL14 and overall survival, and survival without lung metastases: A is the graph of METTL14 versus overall survival; B is the graph of METTL14 versus survival without lung metastases.

[0163] Figure 4 This is a graph showing the relationship between METTL14, MN1, IGF2BP2 and osteosarcoma: a) is a representative graph of high or low expression of METTL14, MN1, and IGF2BP2 in osteosarcoma tissue (scale bar = 100 μm); b) is a correlation graph of MN1 with METTL14 or IGF2BP2 in osteosarcoma tissue; c) is a curve showing MN1 versus overall survival and lung metastasis-free survival; d) is a Kaplan-Meier analysis (log-rank test) of overall survival in OS patients with upregulated molecular markers (n = 70); e) is a recipient operating characteristic (ROC) curve for 5-year survival analysis of METTL14, MN1, and / or IGF2BP2; f) is the correlation graph of METTL14 expression with m... 6 A schematic diagram illustrating how A-IGF2BP2-dependent posttranscriptional modification of MN1 promotes osteosarcoma (OS) progression and retinoic acid (ATRA) resistance.

[0164] Figure 5 It is METTL14 knockdown against m 6 The effect of modification A: A represents the results of Western blotting analysis of METTL14 protein levels in U2OS and 143B cells after METTL14 knockdown; B represents the effect of modification B. 6 A antibody dot blot assay was used to detect RNA m in cells after METTL14 knockdown and U2OS and 143B. 6 A is the overall result diagram (MB staining as a load control); C is the m 6 A colorimetric ELISA kit was used to detect RNA methylation in cells after METTL14 knockdown and U2OS and 143B. 6 A. Overall level results (n=3).

[0165] Figure 6The graph shows the effect of METTL14 on the growth and proliferation of osteosarcoma cells: A is the result of CCK-8 assay on the effect of METTL14 knockdown on the proliferation of osteosarcoma U2OS and 143B cells; B is the result of clonogenic assay on the effect of METTL14 knockdown on the proliferation of osteosarcoma U2OS and 143B cells (n=3).

[0166] Figure 7 The following diagram illustrates the effect of METTL14 on the proliferation of osteosarcoma xenografts in nude mice: A is a monitoring curve (n=6) showing the effect of METTL14 knockout on the growth of 143B osteosarcoma cell tumors in nude mice; B is a visual diagram showing the effect of METTL14 knockout on the growth of 143B osteosarcoma cell tumors in nude mice; C is a diagram showing the effect of METTL14 knockout on the weight of 143B osteosarcoma cell tumors in nude mice; and D is a diagram showing the results of hematoxylin and eosin (HE), anti-METTL14, and anti-Ki-67 antibody immunohistochemical staining (scale bar = 100 μm) on the effect of METTL14 knockout on 143B osteosarcoma cell tumors in nude mice.

[0167] Figure 8 The graph shows the effect of METTL14 on the migration and invasion abilities of osteosarcoma cells: A is the effect of scratch assay on the migration ability of osteosarcoma U2OS and 143B cells; B is the effect of Transwell migration and invasion assay on the migration and invasion abilities of osteosarcoma U2OS and 143B cells (n=3).

[0168] Figure 9 This is a graph showing the effect of METTL14 on the in vivo metastatic ability of osteosarcoma cells (n=6).

[0169] Figure 10 This is a graph showing the effect of METTL14 overexpression on the proliferation and metastasis of osteosarcoma cells: A shows the results of Western blotting analysis of METTL14 expression in wild-type and R298P mutant cells; B shows the m... 6 A is the result of the modification level; C is the result of the CCK-8 assay detecting the proliferation of U2OS and 143B cells after overexpression of wild-type and R298P mutant METTL14; D is the result of the migration assay detecting the migration of U2OS and 143B cells after overexpression of wild-type and R298P mutant METTL14 (scale bar = 100 μm).

[0170] Figure 11It is a stem cell marker in osteosarcoma stem cells, m 6 Figure A shows the expression of mRNA and METTL14: A is a representative image of tumor stem cells (CSCs) isolated from U2OS and 143B cells, and a graph showing the expression of stem cell markers in CSCs detected by qPCR (scale bar = 100 μm); B is a graph showing the expression of m6A RNA in CSCs detected by colorimetric ELISA using a m6A RNA methylation quantitative kit. 6 A shows the overall mRNA level (n=3); C shows the expression of METTL14 in CSCs detected by qPCR and western blotting (n=3).

[0171] Figure 12 The graphs show the effects of METTL14 on the stemness characteristics of osteosarcoma cells: A shows the effect of qPCR detection of METTL14 knockdown on the expression of stemness markers in U2OS and 143B cells; B shows the effect of METTL14 knockdown on the size and number of stem spheres in osteosarcoma cells as detected by a spheroidization assay (n=3, scale bar=100μm); C shows the effect of ALDH fluorescence activity detection of METTL14 knockdown on ALDH activity in U2OS and 143B cells.

[0172] Figure 13 MeRIP-seq and RNA-seq analyses were used to analyze METTL14-mediated m 6 The results of downstream target modification A: where A represents the m value of U2OS and 143B cells after METTL14 knockdown compared to control cells. 6 Volcano plot showing significant changes in genes related to peak A (fold change > 1.5, P < 0.05); B represents m in U2OS and 143B cells. 6 A peak enrichment motif diagram; C is m in U2OS and 143B cells. 6 A shows the distribution of mRNA transcript length along the site; D shows the results of RNA-seq and MeRIP-seq identifying differentially expressed genes (compared to corresponding control cells) after stable METTL14 knockdown; E shows the expression of 8 candidate genes in cells after stable METTL14 knockdown (X-axis: fold change in candidate mRNA transcript expression analyzed by RNA-seq; Y-axis: MeRIP-seq analysis of enrichment of candidate mRNA transcripts; both axes are the average fold change of U2OS and 143B cells relative to shNC cells after stable METTL14 knockdown); F shows the mRNA expression in METTL14 knockdown and control U2OS and 143B cells detected by MeRIP-seq. 6A shows the abundance of MN1 mRNA transcript modified by qPCR; G shows the effect of METTL14 knockdown on MN1 expression in U2OS and 143B cells (n=3); H shows the effect of METTL14 knockdown on MN1 expression in U2OS and 143B cells detected by western blot; I shows the specific mRNA expression level. 6 A-qPCR detection of the effect of METTL14 knockdown on specific regions of the MN1 transcript 6 A. Effect diagram of the level of modification (n=3).

[0173] Figure 14 The graphs show the effects of MN1 on the proliferation and metastasis of osteosarcoma cells: A is the effect of MN1 knockdown on MN1 protein levels in U2OS and 143B cells detected by Western blotting; B is the effect of MN1 knockdown on the proliferation of U2OS and 143B cells detected by CCK-8 assay; C is the effect of MN1 knockdown on the proliferation of U2OS and 143B cells detected by clonogenic assay (n=3); and D is the effect of MN1 knockdown on the migration and invasion of U2OS and 143B cells detected by transwell assay (scale bar = 100 μm) (n=3).

[0174] Figure 15 The graph shows the effect of MN1 on the stem characteristics of osteosarcoma cells: A is the effect of MN1 knockdown on the size and number of stem spheres in osteosarcoma cells as detected by the spheroidization assay (n=3, scale bar=100μm); B is the effect of MN1 knockdown on the expression of stem markers in U2OS and 143B cells as detected by qPCR (n=3).

[0175] Figure 16 The graphs show the effects of METTL14 and MN1 on the malignant progression of osteosarcoma cells: A is the Western blotting graph showing the protein expression level of MN1 overexpression after METTL14 knockdown; B is the CCK-8 assay showing the effect of MN1 overexpression after METTL14 knockdown on the proliferation of osteosarcoma cells; and C is the clonogenic assay showing the effect of MN1 overexpression after METTL14 knockdown on the proliferation of osteosarcoma cells (n=3).

[0176] Figure 17The following are graphs showing the effects of METTL14 and MN1 on the malignant progression of osteosarcoma in vivo: A is a monitoring graph of the effect of METTL14 knockdown followed by MN1 overexpression on tumor volume in nude mice (n=6); B is a visual graph of the effect of METTL14 knockdown followed by MN1 overexpression on tumor size in nude mice (n=6); C is a graph of the effect of METTL14 knockdown followed by MN1 overexpression on tumor weight in nude mice (n=6); D is a graph of the results of hematoxylin and eosin (HE), anti-MN1, anti-METTL14, and anti-Ki-67 antibody immunohistochemical staining on the effect of METTL14 knockdown followed by MN1 overexpression on tumors in nude mice (scale bar = 100 μm).

[0177] Figure 18 The following graphs illustrate the effects of ATRA on the growth and proliferation of osteosarcoma cells: A shows the expression levels of MN1 in U2OS, 143B, and HL60 cells detected by qPCR (n=3); B shows the expression levels of MN1 in U2OS, 143B, and HL60 cells detected by Western blot; C shows the results of CCK-8 assays to assess the sensitivity of HL60 cells to ATRA; D shows the results of CCK-8 assays to assess the sensitivity of U2OS cells in the NC group, METTL14 knockdown group, MN1 knockdown group, METTL14 knockdown overexpression MN1 group, and MN1 overexpression group to ATRA; E shows the results of CCK-8 assays to assess the sensitivity of 143B cells in the NC group, METTL14 knockdown group, MN1 knockdown group, METTL14 knockdown overexpression MN1 group, and MN1 overexpression group to ATRA; F shows the IC50 values ​​of ATRA on U2OS, 143B, and HL60 cells. 50 The results are shown in Figure G; G is the colony formation assay showing the effect of ATRA on osteosarcoma cells in the NC group, METTL14 knockdown group, MN1 knockdown group, METTL14 knockdown overexpression MN1 group, and MN1 overexpression group (the number and size of colonies were observed after treatment with 40 μM ATRA for 10 days) (n=3).

[0178] Figure 19 The following are graphs showing the effects of ATRA on osteosarcoma growth in a nude mouse tibial in situ tumor model: A is a monitoring graph of the effect of ATRA on osteosarcoma volume in a nude mouse tibial in situ tumor model under different treatments (n=6); B is a visual graph of the effect of ATRA on osteosarcoma growth in a nude mouse tibial in situ tumor model under different treatments (n=6); C is a graph of the effect of ATRA on osteosarcoma weight in a nude mouse tibial in situ tumor model under different treatments (n=6); D is a graph showing the results of immunohistochemical staining with hematoxylin and eosin (HE), anti-MN1, anti-METTL14, and anti-Ki-67 antibodies on the effect of ATRA on osteosarcoma weight in a nude mouse tibial in situ tumor model under different treatments (scale bar = 100 μm).

[0179] Figure 20 The following is a graph showing the effect of METTL14 on the stability and translation of MN1 mRNA: A is the result of qPCR analysis of the half-life of MN1 mRNA in U2OS and 143B cells after METTL14 knockdown following actinomycin D treatment (n=3); B is the effect of polysome analysis on the translation efficiency of METTL14 on MN1 (n=3).

[0180] Figure 21 It is m 6 The results of the interaction between A-modified MN1 and IGF2BP2 are shown in the figure: where A is the result of pull-down and Western blotting experiments detecting m 6 A-modified MN1 and m 6 Figure A shows the results of IGF2BP2 recognition and binding; Figure B shows the effect of RIP-qPCR detection on the binding of IGF2BP2 and MN1 after METTL14 knockdown (n=3).

[0181] Figure 22 It is METTL14 via IGF2BP2 with m 6 Figure A shows the results of A-dependent regulation of MN1 mRNA stability and translation: A is the expression level of IGF2BP2 in osteosarcoma and paired normal tissues detected by qPCR (n=24); B is the effect of knockdown of IGF2BP2 on MN1 protein levels in U2OS and 143B cells; C is the result of qPCR analysis of the half-life of MN1 mRNA in U2OS and 143B cells after Act D treatment following IGF2BP2 knockdown (n=3); D is the effect of polysome analysis of METTL14 on MN1 translation efficiency (n=3). Detailed Implementation

[0182] The present invention will be further described in detail below through specific embodiments.

[0183] Unless otherwise specified, the materials and reagents used in this embodiment are commercially available.

[0184] The materials and reagents used in this embodiment are as follows:

[0185] 1. Cell lines: Human osteosarcoma cell lines U2OS, SJSA-1, U2OS, HOS, MNNG / HOS, 143B, and MG-63 were purchased from the American Type Culture Collection (ATCC). U2OS / MTX300, a methotrexate-resistant human osteosarcoma U2OS-derived cell line, was kindly provided by Dr. M. Serra (Ortopedici Rizzoli Institute, Bologna, Italy). Human homologous ZOS and ZOS-M osteosarcoma cell lines, derived from the primary tumor and metastatic lesions of the same patient at the First Affiliated Hospital of Sun Yat-sen University, have been published in the following literature: Yin JQ, Shen JN, Su WW, Wang J, Huang G, Jin S, Guo QC, Zou CY, Li HM, LiFB. Bufalin induces apoptosis in human osteosarcoma U-2OS and U-2OSmethotrexate300-resistant cell lines. Acta Pharmacol Sin. 2007 May; 28(5):712-20. doi:10.1111 / j.1745-7254.2007.00559.x.PMID:17439728. Zou CY, Wang J, Shen JN, Huang G, Jin S, Yin JQ, Guo QC, Li HM, Luo L, Zhang M, Zhang LJ. Establishment and characteristics of two syngeneic human osteosarcoma cell lines from primary tumor and skip metastases. Acta Pharmacol Sin. 2008 Mar; 29(3):325-32. doi:10.1111 / j.1745-7254.2008.00756.x.PMID:18298897. All cells were tested and found to be free from cross-contamination and microbial contamination. All cell lines were cultured according to ATCC guidelines.

[0186] 2. Major experimental reagents: Fetal bovine serum (Gibco, USA), DMDM ​​medium (Thermo Fish Scientific, USA), Opti-MEM (Gibco, USA), penicillin-streptomycin (Gibco, USA), PBS buffer (Gibco, USA), 0.25% trypsin (Gibco, USA), dimethyl sulfoxide (DMSO) (Sigma, USA), programmed cooling cryoprotectant (Corning, USA), 6cm / 10cm cell culture dishes, 6-well / 96-well plates and cell cryopreservation tubes, etc. (Wuxi NiceBio Co., Ltd.), Lipofectamine 2000 (Invitrogen, USA), Lipofectamine 3000 (Invitrogen, USA), Lipofectamine RNAiMAX (Invitrogen, USA), TRIzol reagent (15596026, Invitrogen, USA), reverse transcription kit (RR036, Takara, Japan), SYBR... Green fluorescent dye (1725120, Bio-Rad, USA), BSA (bovine serum albumin) (Sigma, USA), blocked goat serum (S9070, Beijing Solarbio), hematoxylin staining solution (H-H0301, Shanghai Hongzi), EDTA antigen retrieval solution (ZLI-9066, pH 8.0, Beijing Zhongshan Jinqiao), DAB colorimetric reagent kit (Dako REAL) TMDAB (USA), RIPA lysis buffer (Thermo Fish Scientific, USA), protease and phosphorylase inhibitors (Roche, USA), BCA protein quantification kit (Thermo Fish Scientific, USA), 30% acrylamide (Tianjun Biotechnology, China), glycine (Sigma-Aldrich, USA), SDS sodium lauryl sulfate (AMERSCO, USA), SDS loading buffer (Shanghai Beyotime Biotechnology, China), Tris-base (Sigma-Aldrich, USA), APS ammonium persulfate (Sigma-Aldrich, USA), TEMED (Regan Biotechnology, China), skim milk powder (BD, USA), PVDF membrane (Roche, USA), ECL chemiluminescence colorimetric reagent kit (Shanghai Tianneng, China), 4% paraformaldehyde (Tianjun Biotechnology, China), Triton X-100 (Shanghai Beyotime Biotechnology, China), crystal violet aqueous solution (Regan Biotechnology, China), 8μm Transwell chamber (Falcon, USA), 8μm Matrigel invasion chamber (Becton Dickinson, USA), Matrigel matrix (BD Biosciences (USA), Transwell 24-well plates (Corning (USA), and 0.45μm microporous membranes (Millipore (USA)).

[0187] 3. Antibodies: METTL14 (Sigma, HPA038002), MN1 (Sigma, SAB4501908), IGF2BP2 (Proteintech, 11601-1-AP), IGF2BP1 (Proteintech, 22803-1-AP), IGF2BP3 (Prot eintech, 14642-1-AP), YTHDF1 (Proteintech, 17479-1-AP), YTHDF2 (Proteintech, 24744-1-AP), GAPDH (Proteintech, 10494-1-AP), Ki-67 (CST, #9449).

[0188] The method used in this embodiment is as follows:

[0189] 1. Case and tissue samples

[0190] This study used 50 pairs of fresh frozen tissue specimens and 70 paraffin-embedded tissue specimens, all from the Department of Bone Oncology, First Affiliated Hospital of Sun Yat-sen University. All tissue specimens used in this study were approved by the Ethics Committee of the First Affiliated Hospital of Sun Yat-sen University, and informed consent was obtained from the patients. The 50 pairs of fresh frozen tissue specimens were divided into two parts. RNA was extracted from one part, reverse transcribed into cDNA, and then detected by real-time quantitative PCR. Proteins were extracted from the other part, and the expression of relevant proteins was detected by Western blot.

[0191] The steps for tissue RNA extraction are as follows:

[0192] (1) Place approximately 50 mg of tissue block into a tissue grinding tube containing grinding beads and add 1 mL of TRIzol;

[0193] (2) Turn on the tissue homogenizer, add liquid nitrogen to pre-cool it, and let the temperature drop to 4℃; set the homogenization parameters: 6000rpm for 15s, pause for 15s, repeat 3 times; before starting the homogenization, remember to tighten the cap to prevent the cap from coming loose during the homogenization process; after the homogenization, observe the tissue homogenization process and ensure that the homogenization is thorough.

[0194] (3) After grinding, let stand for 5 minutes, centrifuge at low speed of 500×g for 3 minutes at 4℃, and transfer the supernatant trizol to a new EP tube;

[0195] (4) Add 200 μL of chloroform to each tube, shake vigorously for 15 seconds to mix thoroughly, and let stand at room temperature for 10 minutes.

[0196] (5) Centrifuge at 12000×g for 15 min at 4℃, carefully remove the EP tube, transfer the upper aqueous phase after separation to a new EP tube, erring on the side of less rather than more, to avoid mixing in protein or other impurities from the lower organic phase; add 500μL isopropanol to the supernatant, invert and mix repeatedly 10 times, let stand at room temperature for 10 min, or precipitate at -20℃ for 30 min to precipitate RNA;

[0197] (6) Centrifuge at 12000×g for 10 min at 4℃; white precipitate will be visible at the bottom of the tube, discard the supernatant;

[0198] (7) Add 1 mL of pre-cooled 75% ethanol to the centrifuge tube; centrifuge at 8000×g for 5 minutes to precipitate RNA again, and carefully discard the supernatant;

[0199] (8) Open the tube to dry the RNA. When the RNA is dried to a semi-transparent state, add about 50 μL of enzyme-free water and repeatedly blow and stir to dissolve the RNA.

[0200] (9) The purified RNA was quantitatively measured using a Nano Drop instrument. First, the NanoDrop probe was cleaned with enzyme-free water, and then 1 μL of DEPC water was added for zeroing. After wiping off the DEPC water, 1 μL of RNA was applied to the probe for each sample. After each sample was measured, the residual liquid was wiped off before measuring the next sample. RNA samples with OD260 / 280 and OD260 / 230 close to 2.0 were considered to be of good quality. After the RNA concentration was measured, it was reverse transcribed into cDNA or stored in a -80℃ freezer for later use.

[0201] The steps for extracting tissue protein are as follows:

[0202] (1) Place about 50 mg of frozen fresh specimen into a tissue grinding tube pre-filled with an appropriate amount of grinding beads, and add about 500 μL of RIPA lysis buffer (Themo) containing protease inhibitor and phosphorylase inhibitor (Roche);

[0203] (2) Add an appropriate amount of liquid nitrogen to the tissue homogenizer for pre-cooling until the temperature drops to 4℃; set the homogenization parameters: 6000rpm for 15s, pause for 15s, repeat 3 times. Tighten the lid to prevent it from coming loose during homogenization; observe the tissue homogenization after homogenization to ensure it is fully homogenized;

[0204] (3) After grinding, let stand for 5 minutes, centrifuge at low speed of 500×g for 3 minutes at 4℃, and transfer the supernatant lysate to a new EP tube;

[0205] (4) Centrifuge at 12,000 rpm for 20 min at 4 °C, then carefully transfer the supernatant to a new 1.5 mL EP tube. Perform protein quantification using the BCA method or store in a -80 °C freezer for short-term use.

[0206] 2. Cell Culture

[0207] Cell culture mainly includes cell resuscitation, cell cryopreservation, and cell culture. The specific operational steps are as follows:

[0208] (1) Cell resuscitation: Take out the frozen cells that have been stored in liquid nitrogen tank or -80°C freezer for a long time, and quickly transfer them to a 37°C constant temperature water bath to heat and thaw them. During the process, shake and mix them continuously to make them thaw quickly. Then transfer the cell suspension to a 15mL centrifuge tube, add 5mL of DMEM complete medium, centrifuge at 1000rpm for 5 minutes at room temperature, discard the supernatant, add 1mL of DMEM complete medium to resuspend the cells, then transfer the cells to a culture dish, add 10mL of DMEM complete medium, shake in a cross-shaped manner to make them evenly distributed, and then place the cells in a constant temperature cell culture incubator at 37°C and 5% CO2 for continued culture. Replace with fresh DMEM complete medium the next day.

[0209] (2) Cell cryopreservation: Observe the cells under an inverted microscope. The cells are in good growth condition. When the cell density reaches 80-90%, they can be cryopreserved. First, remove the culture medium, wash twice with sterile 1×PBS buffer, add 1mL of trypsin to rinse once, and then remove the trypsin. Place the cells in a 37℃ cell culture incubator for digestion. Wait until the cells in the slabs are dispersed, and the individual cells are digested into round shapes, or the slabs of cells fall off. Then add 2mL of DMEM complete culture medium to stop the digestion. Pipe the cells and collect them in a 15mL centrifuge tube. Centrifuge at 1000rpm for 5 minutes at room temperature, remove the supernatant, and leave the cell pellet. Add an appropriate amount of the prepared cell cryopreservation solution (DMSO: serum = 1:9) to the centrifuge tube to resuspend the cells. Transfer the cell suspension to cryovials and label them with information such as cell type, cell passage number, and cryopreservation time. Place the cryovials in a programmed cooling cell cryopreservation box pre-filled with isopropanol (the isopropanol needs to be replaced every 5 uses), and then place them in a -80°C freezer overnight. The next day, quickly remove the cells and place them in a liquid nitrogen tank for long-term preservation. The cryopreserved cells should be thawed, cultured, and re-frozen every six months to ensure good cryopreservation status.

[0210] (3) Cell culture: All osteosarcoma cells were cultured according to the ATCC recommendations. DMEM high glucose medium contained 10% fetal bovine serum, with 100 U / mL penicillin and 100 U / mL streptomycin added. Cell growth was observed under a microscope once a day, and fresh DMEM high glucose complete medium was replaced every 1-2 days. The cells were cultured in a 37℃, 5% CO2 constant temperature cell culture incubator (Themo).

[0211] 3. Immunohistochemistry (IHC)

[0212] The steps for paraffin sectioning are as follows:

[0213] (1) Fixation: The tissue to be prepared into paraffin sections is fixed with 4% paraformaldehyde fixative to denature its proteins, prevent the cells of the tissue from autolyzing, and maintain the original structural morphology as much as possible.

[0214] (2) Dehydration and clearing: A graded dehydration method is used, proceeding in the following order: 70% ethanol (1 hour) - 75% ethanol (1 hour) - 80% ethanol (1 hour) - 90% ethanol (1 hour) - 95% ethanol (2 hours) - 95% ethanol (2 hours) - 100% ethanol I (15 minutes) - 100% ethanol (15 minutes) - 100% ethanol III (15 minutes) xylene ethanol 1:1 (15 minutes) - xylene stock solution I (25 minutes) - xylene stock solution II (25 minutes) - xylene stock solution III (15 minutes). The ethanol concentration is gradually increased from low to high to remove water from the tissue. Then xylene is used for clearing to replace the alcohol inside.

[0215] (3) Paraffin embedding: After the paraffin melts, the above-mentioned dehydrated and transparent tissue is fully immersed in paraffin I, II and III solutions for 1 hour each. Then, the tissue block that has been soaked in paraffin is taken out and allowed to solidify into a block.

[0216] (4) Sectioning: Place the paraffin-embedded wax block into a microtome and carefully cut it into thin slices. Take a complete tissue slice and flatten it in hot water at 37°C. Then, attach the complete tissue slice to a glass slide and bake it in a constant temperature oven at 60°C for 6 hours.

[0217] The specific steps for H&E staining are as follows:

[0218] (1) Place the previously prepared paraffin slices in the oven and bake them;

[0219] (2) The sections were first dewaxed with xylene, and then hydrated with ethanol solutions of decreasing concentrations. The specific process is as follows: xylene I (10 minutes) - xylene II (10 minutes) - xylene III (10 minutes), then 100% ethanol I (5 minutes) - 100% ethanol II (5 minutes) - 95% ethanol (5 minutes) - 85% ethanol (5 minutes) - 75% ethanol (5 minutes), followed by ddH2O I (5 minutes) - ddH2O II (5 minutes);

[0220] (3) Stain with hematoxylin for 3-5 minutes, rinse under tap water for 10 minutes, then differentiate with hydrochloric acid alcohol for 1-3 seconds, and wash with PBS once for 5 minutes.

[0221] (4) Place the section in eosin dye and stain for 1-3 minutes;

[0222] (5) Dehydration: The process is as follows: 85% ethanol for 3 minutes, 95% ethanol for 3 minutes, 100% ethanol for 5 minutes, 100% ethanol for 5 minutes, xylene for 15 minutes, xylene for 15 minutes;

[0223] (6) Mount the slide with neutral resin, observe it under a microscope, take pictures and record the results.

[0224] The specific steps of immunohistochemistry are as follows:

[0225] (1) Dewaxing the slices: Place the slices in a constant temperature oven and bake at 65°C for 2 hours to dewax them;

[0226] (2) Gradient hydration: Referring to the above HE staining steps, first place the dewaxed sections into three jars containing fresh xylene, soaking each for 10 minutes; then place the sections into alcohol solutions of decreasing concentrations for hydration: 100% ethanol I (5 minutes) - 100% ethanol II (5 minutes) - 95% ethanol (5 minutes) - 85% ethanol (5 minutes) - 75% ethanol (5 minutes), followed by ddH2O I (5 minutes) - ddH2O II (5 minutes);

[0227] (3) Antigen retrieval: Select appropriate antigen retrieval conditions according to different immunohistochemical indicators. In this experiment, EDTA pH8.0 antigen retrieval solution and high-pressure retrieval were used. Prepare the antigen retrieval solution according to the instructions, then immerse the slides in the antigen retrieval solution and put them into a pressure cooker containing water and cover it. Heat the pressure cooker until it boils, then start timing. Boil for 2 minutes and 30 seconds and then turn off the heat. After the pressure is released naturally, open the pressure cooker lid and then put it into cold water to cool. Take out the slides and wash them 3 times in 1×PBST buffer for 5 minutes each time.

[0228] (4) Remove endogenous peroxidase: Shake off the water on the slide slightly, then mark the slide with an immunohistochemical pen to circle the area of ​​the tissue section; add the pre-prepared 0.3% hydrogen peroxide solution to the surface of the tissue section and incubate at room temperature for 15 min; then wash 3 times with 1×PBST buffer, 5 min each time;

[0229] (5) Blocking: Prepare 5% goat serum blocking solution in advance, add the blocking solution to the tissue section, and block at room temperature for 30 minutes to block non-specific binding sites;

[0230] (6) Primary antibody incubation: After blocking, add about 100 μL of the pre-prepared target antibody dilution solution, and then place the slide in a humidified chamber and incubate overnight at 4°C.

[0231] (7) Secondary antibody incubation: After overnight incubation with primary antibody, remove the humidified chamber from the cold storage and allow it to warm to room temperature for 30 minutes; then wash three times with 1×PBST buffer, 5 minutes each time. Finally, add Dako REAL to the tissue sections. TM EnVision TM HRP RABBIT / MOUSE secondary antibody was incubated in a 37°C incubator for 30 minutes.

[0232] (8) DAB staining: After incubation with the secondary antibody, remove the slides and wash them three times with 1×PBST buffer for 5 minutes each time; prepare the DAB staining working solution by mixing the DAB staining solution and DAB dilution solution at a ratio of 1:50 according to the formula; add the DAB staining solution to the slide tissue for staining, observe carefully after adding, and rinse with tap water immediately after the slide tissue turns brown to stop the reaction;

[0233] (9) Place the slices in hematoxylin dye and stain for 1 minute;

[0234] (10) Place the slide in an alcohol-hydrochloric acid solution with a ratio of 95% ethanol: hydrochloric acid = 99:1 for differentiation for 2-5 seconds; during this time, the staining effect can be observed under a microscope. Steps (9) and (10) can be repeated until a satisfactory staining effect is obtained; then rinse with tap water for 10 minutes, then dry in an oven and seal with resin; observe the effect under a microscope, score it, take pictures and save them.

[0235] Immunohistochemical scoring: The comprehensive immunohistochemical score mainly relies on the percentage of positive cells and the intensity of positive staining in the tissue section. Tumor cells appearing as pale yellow to brownish-red are considered positive. Staining intensity is scored based on the staining characteristics of the majority of cells (note that the staining depth must be compared with the background staining): no staining is 0 points, pale yellow is 1 point, brownish-yellow is 2 points, and brownish-red is 3 points. The percentage of positive cells is the average number of positive cells in three 200× fields of view: 0-5% is 0 points, 6%-25% is 1 point, 26%-50% is 2 points, 51%-75% is 3 points, and >75% is 4 points. At 200x magnification, three fields of view were randomly selected from each tissue section. Each field of view underwent staining intensity scoring and positive cell percentage scoring. The product of staining intensity and positive cell percentage represents the final pathological score of the section, with the following meanings: 0 points - negative, 1-4 points weakly positive (+), 5-8 points moderately positive (++), and 9-12 points strongly positive (+++). All pathological results were performed independently by two experienced pathologists in a double-blind manner. In case of discrepancies, the results were reassessed by two experts to obtain the final evaluation.

[0236] 4. Protein extraction

[0237] (1) Take cells in good growth condition, remove the supernatant, and wash twice with pre-cooled PBS;

[0238] (2) Place the culture dish on ice, add an appropriate amount of RIPA lysis buffer (Themo) containing protease inhibitor and phosphorylase inhibitor (Roche) to the culture dish, and lyse on ice for about 10 minutes;

[0239] (3) Collect the lysed cells with a cell scraper, transfer them to a 1.5 mL EP tube, and continue to lyse on ice for 20 min;

[0240] (4) Pre-cool the centrifuge, centrifuge at 12000 rpm for 20 min at 4℃, and then transfer the supernatant after centrifugation to a new 1.5 mL EP tube for protein quantification or short-term storage in a -80℃ freezer for later use.

[0241] (5) Protein concentration determination using the BCA method: The protein concentration of the sample was determined according to the instructions of the BCA Protein Assay protein quantification kit. Protein standards and the protein sample to be tested were added to a 96-well plate with a certain concentration gradient, followed by 200 μL of working reaction liquid. The plate was incubated at 37°C for 30 min. The absorbance of the standard samples and each sample was then measured at 562 nm using a microplate reader. A standard curve was plotted based on the standard protein concentration gradient and the corresponding OD values. The concentration of the protein sample to be tested was then calculated.

[0242] (6) Take an appropriate amount of protein sample and add a certain amount of 5× protein loading buffer (250mM Tris-HCl pH 6.8, 50% glycerol, 10% SDS, 5% β-mercaptoethanol, 0.5% BPB);

[0243] (7) Boil in a metal bath at 100°C for 10 minutes, then immediately place on ice. The sample can be subjected to protein gel electrophoresis or stored at -80°C for a short period of time.

[0244] 5. Western blot

[0245] (1) Gel preparation: Wash the glass plates with single-distilled water in advance and dry them in the oven; according to the required protein molecular weight, prepare a 10-15% separating gel according to the protein gel electrophoresis formula, pour it into the glass plate, and then seal it with isopropanol; let it stand for about 30 minutes until the separating gel solidifies, carefully pour off the isopropanol, wash it with ddH2O, and blot dry; then, prepare the upper stacking gel according to the formula, mix it well, add it to the glass plate, and insert the corresponding 10 / 15 well comb in time, being careful not to leave any air bubbles, and let it stand at room temperature for about 20 minutes until it solidifies;

[0246] (2) Electrophoresis: Assemble the acrylamide gel prepared in the previous step into the electrophoresis tank, add an appropriate amount of electrophoresis buffer, and carefully pull out the comb slowly and parallel upwards; spot the prepared protein sample into each gel lane, and add protein markers (Themo) of the appropriate size on both sides, and then add electrophoresis buffer to the appropriate position; first, electrophoresis at a constant voltage of 60V for 30 minutes to concentrate the sample; after the protein marker lane bands separate, adjust the voltage to 120V and continue electrophoresis for about 1 hour. Stop electrophoresis when the target protein is separated to the appropriate position.

[0247] (3) Transfer: After electrophoresis, remove the gel, cut off the useless gel and stacking gel, and place it in the transfer buffer; nitrocellulose membrane is activated in methanol for 3 minutes in advance, and the transfer module is installed in the order of the transfer "sandwich" - black plate (negative electrode) - sponge - three layers of filter paper - protein gel - PVDF membrane - three layers of filter paper - sponge - white plate (positive electrode), ensuring that there are no air bubbles between each layer, and insert it into the transfer tank, pour in an appropriate amount of pre-cooled transfer buffer, place ice cubes, and electrotransfer at a constant current of 250mA for about 2 hours. The transfer time is determined according to the molecular weight of the protein.

[0248] (4) Sealing: Prepare TBST containing 5% skim milk in advance. After the transfer is completed, rinse the PVDF membrane in the TBST solution for 3 minutes, then add TBST containing 5% skim milk and place it on a low-speed shaker at room temperature for 1 hour.

[0249] (5) Incubation with primary antibody: After blocking, place the PVDF membrane in TBST and rinse it quickly 3 times, 5 min each time. Then add an appropriate amount of target protein antibody dilution solution and incubate on a low speed shaker at room temperature for 1 h or at 4°C overnight.

[0250] (6) Incubation of secondary antibody: The next day, take out the PVDF membrane and place it on a TBST shaker to rinse it three times quickly, 5 min each time; then add an appropriate amount of HRP-containing secondary antibody dilution solution and incubate it on a low-speed shaker at room temperature for 1 h.

[0251] (7) Development: Discard the secondary antibody diluent, place the PVDF membrane in TBST and rinse it quickly 3 times on a shaker for 5 minutes each time; prepare ECL luminescence solution according to the formula of A and B solutions 1:1, place the PVDF membrane to be developed in a bio-rad luminometer, add ECL luminescence solution, select appropriate parameters for development, and collect and save images.

[0252] 6. Dot blot experiment

[0253] Total RNA was extracted from fresh osteosarcoma tissue and osteosarcoma cells using TRIzol (Invitrogen), and then Poly(A)+ RNAs were enriched and purified using the GenElute™ mRNA Miniprep Kit (Sigma-Aldrich). A certain amount of Poly(A)+ RNAs was serially diluted twice, and a certain amount of loading buffer was added and the mixture was denatured at 65°C for 5 min, followed by RNA mRNA extraction. 6 The specific steps for dot hybridization experiment A are as follows:

[0254] (1) Dilute 20×SSC buffer to 6× with enzyme-free water, cut NE nylon membrane to an appropriate size, soak and activate it in 6×SSC buffer, and then air dry; spot the aforementioned denatured 400ng Poly(A)+RNAs and serially diluted 200ng and 100ng Poly(A)+RNAs onto the nylon membrane using a Bio-Rad spotter, connect a negative pressure aspirator, and aspirate for about 30 minutes;

[0255] (2) After the nylon membrane is properly dried, remove the nylon membrane and wash it once with 1×SSC buffer prepared with enzyme-free water.

[0256] (3) Then place the nylon film under a UV crosslinker, select the optimal mode set by the instrument for crosslinking twice, and then place it in a 0.1% PBST blocking solution containing 5% skim milk for 1 hour at room temperature.

[0257] (4) Discard the blocking solution, add 0.1% PBST and wash once for 3 min. Then rabbit m 6 Antibody A (SySy) was diluted at a ratio of 1:2000 and incubated overnight on a nylon membrane at 4°C on a low-speed shaker.

[0258] (5) The next day, the nylon membrane was placed in 0.1% PBST and washed 3 times on a high-speed shaker for 5 minutes each time; then HRP-conjugated anti-rabbit IgG diluted at 1:5000 was added and the membrane was incubated at room temperature on a low-speed shaker for 1 hour.

[0259] (6) Discard the secondary antibody and wash the nylon membrane three times in 0.1% PBST buffer for 5 minutes each time. Prepare ECL luminescence solution according to the 1:1 ratio of solutions A and B. Place the nylon membrane to be developed in a bio-rad luminometer, add the ECL luminescence solution, select appropriate parameters for development, and collect and save the image.

[0260] (7) After exposure, the nylon film is stained in methylene blue (0.02% methylene blue) for 2 hours, and the image is photographed and saved.

[0261] 7. Liquid Chromatography-Mass Spectrometry (LC-MS)

[0262] (1) Poly(A)+ mRNA was added to 25 mL of buffer containing 20 mM NH4OAc (pH = 5.3) and digested with nuclease P1 (1 U, Sigma) beforehand at 37 °C for 1 h.

[0263] (2) Subsequently, freshly prepared NH4HCO3 (1M, 3mL) and alkaline phosphatase (1U, Sigma) were added, and the mixture was incubated at 37°C for an additional 4 hours.

[0264] (3) Dilute the sample to 50 mL and then filter it using (0.22-μm pore size, 4 mm pore size, Millipore);

[0265] (4) Take 5 mL of the above sample for LC-MS / MS analysis;

[0266] (5) Nucleosides were separated by reversed-phase ultra-high performance liquid chromatography using a C18 column, and detected by online electrospray ionization mode using an Agilent 6410QQQ triple quadrupole mass spectrometer. The standard curves were compared with those of pure nucleoside standards from the same batch of samples. Based on the corrected concentration, the results were expressed in m... 6 Calculation of the ratio of A to Am 6 Level A.

[0267] 8.m 6 A RNA ELISA experiment

[0268] m 6 A quantitative ELISA method for RNA methylation detection in experimental samples. 6 A modification level, using Abcam's m 6 An RNA methylation quantification kit (ab185912, Abcam) was used to determine the total RNA content of the sample. 6 For the A content, prepare the qualified RNA to be measured in advance according to the above method. The specific experimental steps are as follows:

[0269] (1) Add 80 μL of Binding Solution to each well of the measurement plate, and then add 200 ng of total RNA of the sample to be tested (the optimal volume is 2 μL), 2 μL of negative control RNA and 2 μL of positive control RNA to the well of the 96-well measurement plate.

[0270] (2) Cover the above plate with a protective film and incubate it in a 37°C incubator for 90 min; discard the Binding Solution and wash the well three times with 150 μL of diluted 1×washing buffer.

[0271] (3) Add 50 μL of the prepared capture antibody solution to each well of the plate, cover with a protective film, and incubate at room temperature for 1 h; then discard the capture antibody solution and add 150 μL of 1×washing buffer to each well, and wash thoroughly three times.

[0272] (4) Add 50 μL of detection antibody solution to each well in the plate, cover with a protective film, incubate at room temperature for 30 min, then discard the detection antibody solution, and add 150 μL of 1×washing buffer to each well and wash thoroughly four times.

[0273] (5) Add 50 μL of enhancer solution to the plate, cover with a protective film, incubate at room temperature for 30 min, discard the enhancer solution, and add 150 μL of 1×washing buffer to each well, wash thoroughly five times to ensure that all residual liquid is discarded;

[0274] (6) Add 100 μL of developer solution to the plate, cover with a protective film, and incubate at room temperature in the dark for 5 minutes. When the solution in the plate turns blue, add 100 μL of stop solution.

[0275] (7) After about 10 minutes, when the solution in the plate turns yellow, the absorbance of the plate at 450 nm wavelength can be measured using an ELISA reader, and the RNA m of each sample can be calculated according to the standard curve. 6 A. Standard content. The calculation formula is as follows: m 6 A% = [(SampleOD–NCOD) / S] / [(PCOD–NCOD) / P]*100%; where S is the ng amount of RNA added to each sample, P is the ng amount of RNA in the positive control; SampleOD is the OD value of the sample; NCOD is the OD value of the negative control; PCOD is the OD value of the positive control.

[0276] 9. CCK-8 Experiment

[0277] (1) Take cells in good growth condition, wash them twice with PBS, digest them with 0.25% trypsin and make a cell suspension;

[0278] (2) Count the cells, then adjust the cell concentration, and evenly spread the cells into a 96-well plate with a system of 2000 cells per well and 200 μL volume per well, with 3 replicates per group.

[0279] (3) Continue culturing the 96-well plate in a 37°C, 5% CO2 cell culture incubator:

[0280] (4) At the corresponding time points, remove the culture medium from the test wells and add 100 μL of serum-free culture medium containing 10 μL of CCK-8 to the wells. Then place the 96-well plate in a cell culture incubator and continue to incubate for 2 hours.

[0281] (5) The OD value of each well was detected at a wavelength of 450 nm using an ELISA reader (SpectraMax Plus 384, Molecular Devices, USA).

[0282] (6) Repeat steps (4) and (5) at the corresponding time points and record their OD values;

[0283] (7) After continuous measurement for 4 days, the cell growth curve was plotted based on the measured OD value and statistical analysis was performed.

[0284] 10. Plate Cloning Experiment

[0285] (1) Take cells in good growth condition, digest them with 0.25% trypsin and prepare a cell suspension;

[0286] (2) Count the cells, dilute and adjust the cell concentration to a suitable density;

[0287] (3) Seed the diluted cells into 6-well plates, with 500 cells and 2 mL of complete culture medium in each well. Set up 3 replicates per group, gently shake to distribute the cells evenly.

[0288] (4) Change the culture medium after about 7 days of culture, and continue to culture for about 7 days until the cell clones grow to a suitable size;

[0289] (5) After removing the culture medium, wash once with PBS, then add methanol to fix for 30 min, remove the methanol, wash with PBS and air dry, then add 0.1% crystal violet to stain the colonies for more than 30 min, and air dry.

[0290] (6) Take pictures of the clones and count them, compare the number of clones formed in each group and the differences in the number, and conduct statistical analysis.

[0291] 11. Scratch test

[0292] The differences in cell migration ability among different treatment groups were detected using a cell scratch assay. The specific experimental steps are as follows:

[0293] (1) Take cells in good growth condition, digest them with 0.25% trypsin and prepare a cell suspension;

[0294] (2) Use a cell counter to count the cells, dilute and adjust the cell concentration to a suitable density;

[0295] (3) Take 5×10 5 One cell and 2 mL of complete culture medium per well were evenly spread on a 6-well plate and cultured.

[0296] (4) When the cells reach 100% confluence, use a 10μL pipette tip to draw 2-3 straight lines in the six-well plate, ensuring that the width of the lines is uniform; then wash with PBS 3 times to remove floating dead cells, and then take pictures of 5 fields of view under an inverted microscope (200×, Nikon, Japan) and record the picture positions.

[0297] (5) After taking the photos, wash the cells again with PBS, replace the serum-free culture medium, and place them in a 37°C cell culture incubator to continue culturing.

[0298] (6) The cells were washed with PBS at 12h, 24h, 36h and 48h, and then photographed under an inverted microscope (200×, Nikon, Japan) in five identical fields of view. ImageJ software was then used to measure the images and calculate the migration rate to compare the scratch repair speed of different groups of cells. All experiments were performed in three independent replicates.

[0299] 12. Transwell cell migration and invasion assay

[0300] The migration and invasion abilities of cells from different treatment groups were detected using Transwell cell migration and invasion assays. The specific experimental steps are as follows:

[0301] (1) U2OS and 143B osteosarcoma cells in good growth condition were digested with 0.25% trypsin and centrifuged to make a cell suspension.

[0302] (2) Centrifuge at 1000 rpm for 5 minutes, wash once with PBS, and then resuspend the cells in serum-free culture medium;

[0303] (3) Cells were counted using a cell counter, and the cell concentration was diluted and adjusted to a suitable density of approximately 5 × 10⁻⁶. 4 1 cell / 200μL;

[0304] (4) Migration experiment: The Transwell migration chamber (BD Biosciences, USA, 8μm pore size) was carefully placed in a Coning 24-well plate pre-filled with 700μL of complete culture medium, avoiding the formation of air bubbles; Invasion experiment: The pre-embedded Transwell chamber (BD Biosciences, USA, 8μm, pre-embedded) was first taken out of the -20℃ freezer and allowed to warm to room temperature. Serum-free culture medium was added to the upper chamber of the chamber and incubated in a 37℃ cell culture incubator for 2 hours. Then, the upper culture medium was carefully aspirated, taking care to avoid touching the solidified Matrigel layer inside the chamber; the chamber was then carefully placed in a Coning 24-well plate pre-filled with 700μL of complete DMEM culture medium, again avoiding the formation of air bubbles in the lower chamber;

[0305] (5) Add 200 μL of the prepared cell suspension to the upper chamber of each small chamber and place it in a 37°C cell culture incubator to continue culturing;

[0306] (6) The cells were collected 24 hours and 48 hours after inoculation of the migration and invasion chambers, respectively. The chambers were carefully removed, the culture medium in the upper chamber was aspirated, washed once with 1×PBS buffer, fixed with methanol for 15 min, and air-dried. The chambers were then stained with 0.1% crystal violet aqueous solution for 20 min, washed slowly 3 times with 1×PBS buffer, air-dried, and then the cells that had not penetrated the chamber were wiped off the inside of the chamber with a cotton swab. The chambers were then observed and photographed under a microscope.

[0307] (7) Take pictures of 5 fields of view in each chamber and save the pictures. Then use ImageJ software to count the number of migrating cells in the pictures and use statistical tests to analyze the number of migrating cells between different groups to compare their migration ability differences.

[0308] 13. In situ tumor formation experiment of tibia in nude mice

[0309] All animal experiments conducted in this study were performed at the Animal Experiment Center of the First Affiliated Hospital of Sun Yat-sen University, and all experiments were approved by the Ethics Review Committee of the First Affiliated Hospital of Sun Yat-sen University. The nude mice used in this experiment were all female BALB / c strain mice, aged 4–6 weeks, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. They underwent inspection and quarantine for one week in the SPF-grade animal facility of the Animal Experiment Center of the First Affiliated Hospital of Sun Yat-sen University before the experiments began.

[0310] (1) Cell preparation: 143B cells in good growth condition from different treatment groups were washed twice with PBS, then digested with 0.25% trypsin and centrifuged (1000 rpm, 5 min) to remove the complete culture medium. The cells were then washed twice with 1×PBS buffer and resuspended in serum-free culture medium. Cells were counted using a cell counter, and the cell concentration was diluted and adjusted to 1×10⁶ cells per 20 μL of liquid. 6 One osteosarcoma 143B cell was placed on ice in preparation for inoculation.

[0311] (2) Cell inoculation: Under sterile conditions, nude mice were anesthetized with isoflurane. Using an insulin syringe, 20 μL of cells from different treatment groups were slowly injected into the proximal tibia of the nude mice through the tibial plateau. After cell inoculation, the nude mice were closely observed and left to recover their normal vitality after the anesthesia wore off. Two weeks after cell inoculation, the weight of the nude mice was measured every three days, the size of the tumor was measured, and their physical condition was monitored. This monitoring was continued for three weeks and recorded. After reaching the experimental endpoint, the mice were euthanized by cervical dislocation under anesthesia. The tumor tissue and lung tissue of the nude mice were dissected and collected. The tumor tissue was weighed, and its size in two vertical dimensions was recorded with calipers. It was then fixed with 4% paraformaldehyde.

[0312] (3) Statistical Analysis: Since the tumor grows to be almost a spherical ellipsoid, its size is measured in two vertical dimensions (D1, D2). The tumor volume is calculated using the following formula: V = 4 / 3π[1 / 4(D1+D2)] 2 The weight and size of tumor tissue in nude mice were statistically analyzed among different groups, and tumor volume growth curves were plotted. Statistical analysis, HE staining, and immunohistochemical staining were then performed.

[0313] 14. Nude mouse tail vein lung metastasis model experiment

[0314] The nude mouse tail vein lung transfer model used female BALB / c strain mice, aged 4–6 weeks, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. The specific experimental procedures are as follows:

[0315] (1) Cell preparation: Expand cell culture by taking 143B cells in good growth condition from different treatment groups, washing them twice with PBS, then digesting them with 0.25% trypsin and centrifuging (1000 rpm, 5 min) to remove the complete culture medium, and washing them twice with 1×PBS buffer. The cells were then resuspended in serum-free culture medium. Cells were counted using a cell counter, and the cell concentration was diluted and adjusted to 1×10⁶ cells per 100 μL of liquid. 6 One osteosarcoma 143B cell was prepared and placed on ice, ready for inoculation.

[0316] (2) Cell inoculation: Under aseptic conditions, fix the nude mouse in the tail vein injection device, exposing the tail for easy needle insertion. Use two fingers of your left hand to clamp the mouse's tail, pulling it straight and taut. Use a 75% alcohol cotton ball in your right hand to repeatedly wipe the mouse's tail to dilate the tail vein. Fix the tail vein with your left hand fingers, and use your right hand to hold the syringe, selecting the appropriate location on both sides of the tail vein for needle insertion. Observe for blood return; if blood return is observed, the vein has been successfully punctured and injection can proceed. Inject 100 μL of cell suspension into each nude mouse. After injection, apply pressure with a sterile medical cotton ball for 30 seconds to stop bleeding. Once there is no more bleeding, return the mouse to its cage.

[0317] (3) Observation: Regularly observe the growth status of nude mice, weigh them, and keep records.

[0318] (4) Specimen collection: Six weeks after cell inoculation, mice were euthanized by cervical dislocation under anesthesia, and lung tissue of nude mice was collected by dissection, photographed and recorded, and then fixed in 10% formalin solution.

[0319] (5) The lung tissue of nude mice was embedded in paraffin and sectioned. HE staining was performed to count the number and size of lung tumor metastases and to conduct statistical analysis.

[0320] 15. RNA half-life experiment

[0321] (1) Seed U2OS and 143B cells in good growth condition into 6-well plates;

[0322] (2) The following day, U2OS and 143B cells were treated with Act D (HY-17559, MCE) at a final concentration of 5 μg / mL for 0, 3 or 6 h.

[0323] (3) At different time points, total RNA was extracted from cells using the Trizol method (Invitrogen), reverse transcribed into cDNA, and then analyzed by real-time fluorescence quantitative analysis.

[0324] 16. Polysome Analysis

[0325] Polysome analysis was performed primarily according to the methods provided in the references. The specific steps are as follows:

[0326] (1) Infect or transfect 143B cells with lentiviral shRNA targeting METTL14 or IGF2BP2 short interfering (siRNA) and then expand culture in 15cm dish.

[0327] (2) Before collecting the cells, add 100 μg / mL of actinomycin (CHX) to the culture medium, and then put the cells back into the cell culture incubator to continue culturing for 7 min.

[0328] (3) Prepare the lysis buffer formula: 20mM HEPES pH 7.6, 5mM MgCl2, 100mM KCl, 100μg / mL CHX, 1% Triton X-100, add a 1:100 ratio of protease inhibitor (Roche) and 40U / mL SUPERasin (Ambion).

[0329] (4) Wash the cells twice with pre-cooled PBS buffer containing 100 μg / mL CHX, then add 5 mL of the above PBS, carefully scrape off the cells, transfer them to a new 15 mL centrifuge tube, and centrifuge at 1000 × g for 5 min at 4 °C. Wash once with 1 mL of PBS, transfer to a new 1.5 mL EP tube, and centrifuge again at 1000 × g for 5 min at 4 °C.

[0330] (5) Add 500 μL of lysis buffer to the precipitate and resuspend it. Repeat the pipetting and swishing process 5 times. Immediately add 4 μL of RNase OUT, vortex, and then immediately place it on ice for lysis. The lysis process takes 10 min in total, with vortexing every 2-3 times.

[0331] (6) The pyrolysis product in step (5) is first centrifuged at 2000×g for 5 min at 4° to remove large fragments and clumps, and the supernatant is transferred to a new EP tube.

[0332] (7) Place the supernatant EP tube from step (6) in a centrifuge, centrifuge at 4°C and 16000×g for 7 min to remove small cell debris, and then transfer the supernatant to a new 1.5 mL EP tube;

[0333] (8) Prepare a 5% to 50% gradient sucrose solution, add the sample from step (7) to the top of the sucrose solution, and balance it under a balance (with the error controlled within 0.01g);

[0334] (9) First use slow acceleration to increase the speed to 36,000 rpm and centrifuge for 2 hours;

[0335] (10) Two hours later, the samples were divided into 24 fractions (0.5 mL each) and analyzed using a Gilson FC203B fraction collector (Mandel Scientific, Guelph, Canada) and a gradient station equipped with an ECONOUV monitor (BioRad, Hercules, CA). RNA was purified from fractions 5–18 and analyzed by qPCR. The expression of MN1 in each fraction was normalized using GAPDH as a reference, and its changes were analyzed.

[0336] 17. Pelletization Experiment

[0337] The spheroidization assay was used to enrich osteosarcoma stem spheroids and to detect the spheroidization ability of osteosarcoma cells. The specific experimental steps are as follows:

[0338] (1) Wash the cells in good condition twice with PBS, then digest them with 0.25% trypsin and centrifuge (1000 rpm, 5 min), and prepare a cell suspension using serum-free culture medium.

[0339] (2) Count the cells, dilute and adjust the cell concentration to a suitable density;

[0340] (3) 2×10 3 One cell was placed in a 6-well ultra-low adhesion plate (Corning Corporation) and 2 mL of serum-free DMEM-F12 medium containing 20 ng / mL epidermal growth factor (EGF) (236-EG, RD), 20 ng / mL fibroblast growth factor (bFGF) (233-FB, RD) and 20 ng / mL N2 (2229-N2, RD).

[0341] (4) Seven days later, observe and count the spherical particles with a diameter greater than 50 μm in each well under a microscope, and take pictures for preservation;

[0342] (5) Statistical analysis was performed on the number of cells in each group to compare the stem cell cell formation ability among different treatment groups.

[0343] 18. ALDH Activity Assay

[0344] ALDEFLUOR assays were performed using an ALDEFLUOR kit (Stem Cell Technologies, Vancouver, BC, Canada). ALDH activity in osteosarcoma cells was determined by flow cytometry sorting according to the kit instructions, and the results were compared.

[0345] 19. RIP Experiment

[0346] The RIP experiment was performed primarily according to the instructions of the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700, Millipore). The specific method is as follows:

[0347] (1) 5 μg of specific antibody was bound to protein-conjugated A / G magnetic beads and then mixed with lysis buffer of U2OS and 143B at 4 °C overnight;

[0348] (2) The immune complexes were washed 6 times with washing buffer and then incubated with proteinase K digestion buffer.

[0349] (3) Total RNA was extracted and detected by real-time quantitative PCR, and the results were compared with the normalized Input.

[0350] 20. RNA pull-down experiment

[0351] The RNA pull-down experiment was performed primarily according to the Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, 2016). The specific method is as follows:

[0352] (1) Use the T7 Transcription Kit (Thermo Fisher Scientific) to label the RNA probe with biotin;

[0353] (2) Add 50 pmol of biotinylated RNA and 50 μL of magnetic beads to each sample;

[0354] (3) After incubation and three washes, the proteins in the RNA-protein complex were identified by Western blotting and silver staining.

[0355] 21. Transient transfection of cells

[0356] (1) Plating: Take cells in good logarithmic growth phase, wash twice with sterile 1×PBS buffer, digest with 0.25% trypsin and centrifuge (1000 rpm, 5 min), take an appropriate amount of cells and seed them in a 6-well plate, shake well in a cross-shaped manner, and then place the 6-well plate in a cell culture incubator to continue culturing.

[0357] (2) Transfection: Transfection was initiated when the cell density reached 60-70%. Two new 1.5 mL EP tubes were used. 250 μL of serum-free Opti-MEM transfection medium was added to each tube. One tube contained 5 μL of lipofectamine iMAX, and the other contained 5 μL of siRNA solution (all siRNA used in this experiment was provided by Guangzhou Ruibo Biotechnology Co., Ltd.). The mixture was thoroughly combined and incubated at room temperature for 5 min. The two EP tubes were then mixed by pipetting and incubated at room temperature for 15 min. Subsequently, the cell culture medium in the 6-well plate was removed, and 500 μL of the above-mentioned transfection mixture was added, followed by 1.5 mL of antibiotic-free complete culture medium. The plate was then placed in a cell culture incubator for further culture. After 6-8 h of transfection, the culture medium was replaced with complete culture medium.

[0358] (3) Cell collection: After culturing for another 24 hours, cells can be collected to extract RNA for real-time quantitative PCR, or cells can be collected after 48 hours to extract protein for polyacrylamide gel electrophoresis to detect siRNA knockdown efficiency. At the same time, successfully transfected cells can be collected for subsequent experiments.

[0359] 22. Plasmid transformation and extraction

[0360] (1) Prepare LB liquid medium: Formula: 10g peptone, 5g yeast extract, 10g NaCl, add double distilled water to 1000mL, sterilize at high temperature and high pressure and store in a cold storage at 4℃; Prepare LB solid medium: 10g peptone, 5g yeast extract, 10g NaCl, 15-20g agar, add double distilled water to 1000mL, shake well and sterilize in a high temperature and high pressure autoclave and cool naturally to about 60℃, add a certain amount of 100μg / mL ampicillin, shake well and pour LB into bacterial plates, wait for the plates to cool and solidify naturally, then cover with sealing film and store in a cold storage or at 4℃ for later use;

[0361] (2) Transformation: Take a certain amount of plasmid (shRNA lentiviral plasmid purchased from GeneCopoeia, USA) or enzyme digestion ligation product and mix it thoroughly with 50 μL of competent E. coli DH5α (Beijing Qingke Biotechnology Co., Ltd.), and place it on ice for 30 minutes; then place it in a 42℃ water bath for 90 seconds, and then take it out and place it on ice immediately; add the above transformed bacterial solution to 500 μL of LB medium and amplify it by shaking for 2 hours; spread the above amplified bacterial solution on LB plates containing ampicillin, incubate it upright in a 37℃ incubator for 30 minutes to dry, and then invert it to continue culturing for about 16 hours;

[0362] (3) Single clone selection and amplification: Take out the plate transformed the day before, use a sterile pipette tip to select single clones of appropriate size, mix the selected clones thoroughly with 10 μL of sterile enzyme-free water; take out 1 μL of the bacterial mixture for PCR identification, then perform DNA agarose gel electrophoresis, and then send the bacterial solution with positive bands to Guangzhou Qingke Biotechnology Co., Ltd. for sequencing identification to determine if it is the desired clone; add the clones that are correctly matched by electrophoresis and sequencing to about 30 mL of liquid LB containing ampicillin, and place them in a shaker at 37℃ for amplification culture;

[0363] (4) Plasmid extraction: After approximately 16 hours of bacterial culture expansion, remove the bacterial culture and freeze a portion of it at a ratio of 50% sterile glycerol to bacterial culture of 1:1. Mix the two portions and store them at -80°C for long-term storage. Extract plasmids from the remaining bacterial culture using the Tiangen Endotoxin-Free Mini-Prep Kit (DP106) according to the manufacturer's instructions.

[0364] 23. Virus Packaging and Transfection

[0365] (1) Lentiviral packaging: HEK293T cells in good logarithmic growth phase were evenly seeded in 10cm dishes and then cultured in a 37℃ cell culture incubator containing 5% CO2. Observe under an inverted microscope. When the cell density reaches about 70-80%, lentiviral packaging and transfection can be performed. Take two 15mL centrifuge tubes and add 1.5mL of serum- and antibiotic-free Opti-MEM to each. Add packaging plasmid, 4μg of target plasmid and 30μL of Lipofectamine P3000 to one centrifuge tube, and add 30μL of Lipofectamine P3000 to the other centrifuge tube. 3000, mix thoroughly by pipetting and let stand for 5 min; then mix the liquids from the two centrifuge tubes, mix thoroughly by pipetting, let stand at room temperature for 15 min, then add to HEK293T cells, add culture medium to 10 mL, and place in a 37℃ cell culture incubator containing 5% CO2 for continued culture; after 6-8 hours, aspirate the culture medium from HEK293T cells, replace with 15 mL of complete culture medium containing 10% fetal bovine serum, and continue culture in the incubator for 48 hours;

[0366] (2) Virus collection: 48 hours after HEK293T cells were infected with the virus, the supernatant culture medium was carefully collected in a 15mL centrifuge tube and centrifuged at 1000rpm for 5 minutes at room temperature to remove cells and debris. Then the virus was aspirated into a 20mL syringe, filtered through a 0.45μm filter membrane and collected into a new centrifuge tube. The virus solution was then aliquoted into several small portions for direct cell infection or stored in a -80℃ freezer for later use, avoiding repeated freezing.

[0367] (3) Cell infection: U2OS and 143B cells in good logarithmic growth phase were evenly seeded into 6-well plates, shaken using the cross-hatching method, and then placed in a 37°C cell culture incubator containing 5% CO2 for adherent culture. Observe under an inverted microscope. When the cell density reaches 40-50%, 1 mL of virus solution and 1 mL of [unclear text - possibly a continuation of the previous sentence] were added to each well. DMEM complete medium was mixed with a certain amount of Polybrene (working final concentration of 8 μg / mL) to increase the efficiency of viral infection. The mixture was then placed in an incubator for further culture. After 12–16 hours, the viral solution was aspirated, and fresh DMEM complete medium was added for further culture. After 48 hours, the cells were observed under an inverted fluorescence microscope to determine the intensity of GFP fluorescence and thus the protein expression status, thereby determining the viral transfection efficiency. The cells were cultured until they reached a suitable density and then puromycin was added for selection (U2OS and 143B cells were selected at a final concentration of 2 μg / mL). After several generations of selection, once the cells were stable, RNA and protein were extracted from the cells to detect gene knockdown or overexpression efficiency, thus obtaining a stably transfected cell line for further experiments.

[0368] 24. Agarose gel electrophoresis

[0369] (1) Gel preparation: Weigh an appropriate amount of agarose to prepare a 1-2% agarose gel, heat it in a microwave oven and dissolve it in 1×TAE buffer; when the temperature drops to a temperature that is not hot to the touch, add 1μL of EB dye, shake well, pour the gel onto the gel preparation plate with the comb and base, and wait for it to solidify.

[0370] (2) Sample loading: Carefully place the prepared gel into the electrophoresis tank containing 1×TAE electrophoresis buffer. Add 5μL of DNA marker to the outside of the gel according to the required DNA molecular weight. Mix the DNA with the sample loading buffer and add the sample to the inside in sequence. Correctly connect the positive and negative terminals of the power supply and adjust the voltage to 90V to start electrophoresis.

[0371] (3) Stop electrophoresis when the gel reaches the appropriate position. Carefully remove the gel, place it under a UV lamp to observe the electrophoresis results, take photos and record them. The appropriate target bands can be recovered from the gel.

[0372] 25.m 6 A-seq and RNA-seq

[0373] (1) Total RNA was extracted and quantified using NanoDrop ND-1000;

[0374] (2)Use Arraystar Seq-Star TM Poly(A) mRNA Isolation Kit for mRNA purification;

[0375] (3) The purified mRNA was randomly divided into fragments of about 100 nt in the fragment buffer;

[0376] (4) Using anti-m 6 Antibody A (202003, Synaptic Systems) immunoprecipitates mRNA fragments, and retains 1 / 10 of the mRNA fragments as input for further RNA sequencing;

[0377] (5) RNA-seq library preparation was performed using the KAPA Stranded mRNA-seq Kit (Illumina, CA, USA);

[0378] (6) Methylated mRNA sequencing and analysis were performed using the Illumina HiSeq 4000 platform from Aksomics (Shanghai).

[0379] 26. RNA extraction

[0380] RNA was extracted from cells using the Trizol method. RNase-free pipette tips and EP tubes were used throughout the process. The specific steps are as follows:

[0381] (1) Take the vigorously growing cells from a 10cm dish, wash twice with PBS, add 1mL TRIzol (Invitrogen), repeatedly pipette to fully lyse the cells, and collect them into a 1.5mL EP tube;

[0382] (2) Add 200 μL of chloroform, mix by inverting for 15 seconds, and let stand at room temperature for 3 minutes; then, centrifuge at 12000 × g for 15 minutes in a pre-cooled centrifuge at 4 °C.

[0383] (3) After centrifugation, carefully aspirate the colorless aqueous phase liquid from the upper layer into a new enzyme-free EP tube, add 500 μL of isopropanol, invert 10 times, and let stand at room temperature for 10 min to precipitate RNA.

[0384] (4) Centrifuge at 12000×g for 10 min at 4℃; a white precipitate will be visible at the bottom of the tube. Remove the supernatant liquid; add 1 mL of pre-cooled 75% ethanol and centrifuge at 8000×g for 5 min to precipitate RNA again.

[0385] (5) Carefully aspirate the supernatant liquid and leave the tube open to dry the RNA; once the RNA has dried to a semi-transparent state, add about 50 μL of enzyme-free water and repeatedly blow and stir to dissolve the RNA.

[0386] (6) The purified RNA was quantitatively measured using a Nano Drop instrument. RNA with OD260 / 280 and OD260 / 230 close to 2.0 was considered to be of acceptable quality. The RNA concentration was determined for future use.

[0387] 27. RNA reverse transcription to prepare cDNA

[0388] Total RNA was extracted from cell or tissue samples using the Trizol method (Invitrogen). After quantifying the RNA concentration using a Nano Drop instrument, reverse transcription was performed using a reverse transcription kit (RR036, Takara) according to the instructions to prepare cDNA.

[0389] (1) Add 1 μg of total RNA to an RNase-free PCR tube and pre-deform at 65°C for 5 min;

[0390] (2) Add each reagent to ice according to the following system for each group: 1 μg total RNA, 4 μL 5×PrimerScript RTMaster Mix, and nuclease-free water to 20 μL. Mix the above reagents thoroughly.

[0391] (3) Place it on the Bio-Rad PCR instrument, react at 37℃ for 15 min, and then inactivate the enzyme at 85℃ for 5 s;

[0392] (4) Dilute with nuclease-free water to 200 μL and perform real-time quantitative PCR, or store at -80℃ for a long time.

[0393] 28. Real-time quantitative PCR

[0394] Using the cDNA obtained above as a template and SYBR (1725125, Bio-Rad) as a fluorescent dye, real-time quantitative PCR was performed.

[0395] (1) Set up 3 auxiliary wells for each group, and add various reagents for each reaction according to the following system: Mix 5 μL of Green Supermix (2×), 0.5 μL of Forward primer, 0.5 μL of Reverse primer, and 2 μL of Template cDNA, then add ddH2O to a final volume of 10 μL.

[0396] (2) The real-time fluorescence quantitative PCR instrument was set up with the following reaction program: pre-denaturation at 95℃ for 5 min, then denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, extension at 72℃ for 20 s, and 40 cycles were performed. Melting curve analysis was performed at 95℃ for 15 s, 60℃ for 1 min and 95℃ for 15 s.

[0397] (3) The Real Time PCR primers used in this embodiment are shown in Table 1.

[0398] Table 1 PCR Primers

[0399]

[0400] 29. Statistical Analysis

[0401] All results were derived from at least three independent experiments and represent a single, representative dataset. Data are presented as mean ± standard deviation (SD). Two-tailed Student's t-test, one-way ANOVA, or χ² test were used. 2 To assess whether the differences were statistically significant, the Kaplan-Meier method was used to evaluate overall survival, and the log-rank test was used for comparison. *p<0.05; **p<0.01; ***p<0.001. All statistical analyses were performed using R or GraphPad Prism (version 6.0).

[0402] Example 1: METTL14 is highly expressed in osteosarcoma clinical specimens and is associated with poor prognosis.

[0403] First, m was examined in osteosarcoma tissue and paired normal muscle tissue. 6 The overall level of A modification was investigated. Five pairs of osteosarcoma tissues and paired normal muscle tissues were randomly selected for RNA extraction. The total RNA was purified into mRNA and detected by liquid chromatography-mass spectrometry (LC-MS). The results showed that the mRNA in osteosarcoma tumor tissues... 6 Modification A was significantly higher than that in the control normal tissue. Figure 1 (A). To demonstrate the generalizability of these results, the inventors extracted RNA from 50 pairs of osteosarcoma tissue and paired normal muscle tissue, using Abcam's m... 6 A quantitative RNA methylation ELISA kit detects m in different samples 6 A modification level. Results showed that, compared to normal control samples, m in 50 pairs of osteosarcoma tissues... 6 A significantly increased RNA modification level ( Figure 1(B) Simultaneously, the inventors randomly performed Dot blot experiments on mRNA from three pairs of osteosarcoma tissues and paired normal muscle tissues, ensuring the same sample loading amount for each group. The results also showed that mRNA in osteosarcoma tissues... 6 RNA modification levels were significantly higher in A compared to normal tissues. Figure 1 (C). Furthermore, the inventors further analyzed the aforementioned 50 osteosarcoma patients by dividing them into groups with and without lung metastases. The results showed that m 6 The level of RNA modification was significantly higher in patients with lung metastases than in those without. Figure 1 (D) indicates m 6 RNA modification is associated with the invasion and metastasis of osteosarcoma, especially lung metastasis. Based on these results, the inventors discovered that in osteosarcoma, m... 6 A methylation modification showed a significant upward trend, with total RNA m 6 A modification is elevated, including mRNA m 6 A modification also shows an increasing trend. These results indicate that m 6 RNA modification is very likely involved in the malignant progression of osteosarcoma and plays an important role in regulating the occurrence and development of osteosarcoma.

[0404] m 6 A is mainly modified by m 6 A methyltransferases and m 6 A. Demethylases catalyze the production of enzymes such as methylases, which are called m. 6 A writer, primarily including METTL3, METTL14, and WTAP; m 6 A demethylase, also known as m 6 Aerasers, primarily including FTO and ALKBH5. 6 A modification is upregulated in osteosarcoma, possibly because of m 6 Abnormal expression of A-methyltransferases or demethylases leads to this. To verify this, the inventors tested m in 50 pairs of osteosarcoma tissues and paired normal tissues. 6 RNA expression levels of key genes, including methyltransferases METTL3, METTL14, WTAP, and demethylases FTO and ALKBH5, were analyzed. The results indicated that these m... 6 Among the key genes in A, almost all are showing an upregulated trend, with m being particularly prominent. 6 The A methyltransferase METTL14 was expressed at the highest level in tumor samples. Figure 2(A). Following this, the inventors extracted osteosarcoma tissue from seven pairs of osteosarcoma patients and paired normal tissue proteins for Western blot analysis. The results also confirmed that the expression level of METTL14 protein in osteosarcoma samples was significantly higher than that in adjacent normal tissues. Figure 2 (See Figure B). To verify the expression of METTL14 in osteosarcoma cell lines, the inventors extracted proteins from nine osteosarcoma cells and bone marrow mesenchymal stem cells (BMSCs) for Western blot experiments. The results showed that, compared to BMSCs, METTL14 protein levels were significantly elevated in many osteosarcoma cell lines. Figure 2 (C)

[0405] To investigate the clinical significance of METTL14 in osteosarcoma, the inventors performed immunohistochemical (IHC) staining to detect the expression of METTL14 in clinical osteosarcoma specimens (n=70). The results are shown in Table 2: High expression of METTL14 in osteosarcoma was significantly associated with clinicopathological features (such as lung metastasis), and high expression of METTL14 was closely related to a high rate of lung metastasis. Furthermore, Kaplan-Meier analysis showed that patients with high METTL14 expression had significantly worse overall survival and lung metastasis-free survival (LMFS) compared to other patients. Figure 3 Therefore, METTL14 can serve as a biomarker for the diagnosis and prognostic assessment of osteosarcoma. Furthermore, the expression of METTL14 in 70 human primary osteosarcoma specimens was investigated using IHC staining, and the results are as follows: Figure 4 As shown in Figure a. The predictive value of METTL14 for overall survival (five years) was analyzed using receiver operating characteristic (ROC) curve analysis, and the results are as follows: Figure 4 As shown in Figure e, its AUC is 0.695, further demonstrating that METTL14 can serve as a biomarker for the diagnosis and prognostic assessment of osteosarcoma.

[0406] Table 2. Demographic characteristics and clinical data of patients

[0407]

[0408] Expressed in numerical form (%).

[0409] The chi-square test shows that the p-values ​​in bold are statistically significant.

[0410] Example 2: METTL14 promotes osteosarcoma proliferation and metastasis in vitro and in vivo.

[0411] To elucidate the important function and role of METTL14 in the development and progression of osteosarcoma, the inventors used shRNA plasmids (shMETTL14#32 and #33, where the sequence of the positive strand of shMETTL14#32 is GGTTACAGAAGATGTGAAGAT (SEQ ID NO.31), the sequence of the antisense strand of shMETTL14#32 is ATCTCACATCTTCTGTAACC (SEQ ID NO.32); the sequence of the positive strand of shMETTL14#33 is GCTAATGTTGACATTGACTTA (SEQ ID NO.33); and the sequence of the antisense strand of shMETTL14#33 is TAAGTCAATGTCAACATTAGC (SEQ ID NO.34)) to package lentiviruses to infect U2OS and 143B cells. Cells were screened by adding 2 μg / mL puromycin to complete culture medium, successfully constructing a cell line with stable METTL14 knockdown. The knockdown efficiency was verified by Western blot experiments using extracted cellular proteins. Figure 5 (A). Because METTL14 is m 6 A type of methyltransferase, known to catalyze m 6 One of the key genes for A production. Does knocking down METTL14 in osteosarcoma cells cause its m... 6 What about the downregulation of A-modification? The inventors then extracted total RNA from METTL14-stabilized knockdown cell lines and serially diluted the RNA to ensure identical loading amounts across groups. Dot blot analysis was then used to detect the m-level of cellular RNA. 6 The A modification level indicated that after stable knockdown of METTL14, RNA m in U2OS and 143B cells was reduced. 6 The level of modification A was significantly downregulated. Figure 5 (B) The inventor then used m 6 An RNA methylation ELISA kit was used to detect RNA m in U2OS and 143B cell knockdown groups (shMETTL14#32 and shMETTL14#33) and the NC group (shNC). 6 A content, the results showed that the m in the METTL14 group was knocked down 6 A content decreased significantly ( Figure 5 (C). The above results indicate that METTL14 does indeed act as an m6A methyltransferase in osteosarcoma, and that METTL14 is a key regulatory gene causing m6A modification disorder in osteosarcoma.

[0412] Following this, the inventors used U2OS and 143B cells with stable METTL14 knockdown to further explore the role of METTL14 in osteosarcoma proliferation and metastasis. CCK-8 assay results showed that knockdown of METTL14 significantly inhibited the proliferation of U2OS and 143B cells. Figure 6 (A). Meanwhile, plate colony formation experiments showed that downregulating METTL14 also relatively reduced the colony-forming ability of U2OS and 143B cells. Figure 6 (B) These experiments showed that knocking down METTL14 inhibited the growth and proliferation of osteosarcoma cells in vitro.

[0413] To further verify whether the function of METTL14 in vivo is consistent with that in vitro in regulating the malignant progression of osteosarcoma, the inventors constructed an in situ tibial tumor model in nude mice (4-6 weeks old, female nude mice). 1×10-1 143B cells from METTL14 stably knocked-down (shMETTL14#32 and shMETTL14#33) and the control group (shNC) were seeded into the mid-segment of the right tibia of the nude mice. 6 The mice were fed and closely observed. After approximately 10 days, once tumors had formed, the mice were observed every three days, their weight was measured, and the transverse and vertical diameters of the tumors were recorded using calipers. After 32 consecutive days of measurements, the mice were euthanized, the tumors were dissected and collected, and their size and weight were measured and recorded, along with photographs. Statistical analysis of these results showed that, compared to the control group (shNC) 143B cells, the tumor proliferation capacity of the METTL14 knockdown groups (shMETTL14#32 and shMETTL14#33) was significantly reduced, manifested as a significant decrease in tumor volume and weight. Figure 7 (A-C). Furthermore, the inventors performed HE staining and immunohistochemical staining on the embedded sections of the obtained tumor tissue, finding that the expression of METTL14 was significantly reduced in the METTL14 knockdown group of tumor tissue, accompanied by a significant reduction in the expression of the tumor proliferation marker Ki-67. Figure 7 (D). The above results indicate that METTL14 promotes the growth and proliferation of osteosarcoma both in vitro and in vivo. Inhibiting METTL14 expression can suppress osteosarcoma growth and proliferation.

[0414] Subsequently, the inventors continued to investigate whether METTL14 promoted the migration and invasion of osteosarcoma cells. Scratch assays showed that, compared to the control group, the migration ability of cells in the METTL14 knockdown groups (shMETTL14#32 and shMETTL14#33) was significantly inhibited. Figure 8 Transwell migration and invasion assays also showed that knocking down METTL14 reduced the migration and invasion abilities of U2OS and 143B cells. Figure 8 (B) It can be seen that inhibiting METTL14 expression can suppress the migration and invasion of osteosarcoma cells.

[0415] To further verify whether METTL14 promotes osteosarcoma metastasis in vivo and to clarify its function in lung metastasis, the inventors constructed a tail vein lung metastasis model. Nude mice were injected via tail vein with 1×10⁶ METTL14 stably knocked-down (shMETTL14#32 and shMETTL14#33) and control group 143B (shNC) cells, respectively. 6 The mice were then fed and closely monitored. After 6 weeks, the nude mice were euthanized, and lung specimens were dissected and collected from each mouse. Lung metastatic nodules were photographed and recorded. The lung tissue was then paraffin-embedded, sectioned, and stained with hematoxylin and eosin (HE). The size and number of metastatic nodules in each lung were recorded under a microscope and photographed for preservation. Results showed that the number and size of lung metastatic nodules were significantly reduced in the two groups of 143B cells with knocked-down METTL14. Figure 9 These results indicate that METTL14 plays a crucial role in promoting the invasion and metastasis of osteosarcoma cells both in vivo and in vitro. Inhibiting METTL14 expression can suppress the migration and invasion of osteosarcoma cells both in vivo and in vitro.

[0416] The inventors constructed a plasmid overexpressing wild-type METTL14 and its catalytic site mutant (METTL14-R298P), and transfected it into osteosarcoma U2OS and 143B cells. Cellular proteins were then extracted and Western blot experiments were used to verify the transfection efficiency. Figure 10 (A). First, the inventors tested the expression of wild-type METTL14 plasmid and mutant plasmid in the cells, and the m 6 Whether the modification level changed. The inventors extracted RNA from the transfected cells and then performed a Dot blot experiment. The results showed that osteosarcoma cells overexpressing the wild-type METTL14 plasmid... 6 A modification was significantly increased, while the overexpression mutant plasmid group showed no significant difference from the control group. Figure 10 (B) Following this, the inventors conducted functional experiments to explore METTL14 as a m 6 Effects of METTL14 methyltransferase on osteosarcoma cell function. In vitro CCK-8 assays showed that wild-type METTL14 overexpression cells exhibited significantly enhanced proliferation compared to control cells transfected with the empty vector; however, cell proliferation transfected with METTL14-R298P showed no significant difference compared to control cells. Figure 10(C) Transwell migration assays also showed that cells overexpressing wild-type METTL14 exhibited significantly enhanced migration ability, while cells transfected with the METTL14-R298P plasmid showed no significant difference in migration ability compared to control cells (Figure 10D). All these results indicate that METTL14 plays a crucial role in osteosarcoma. 6 The catalytic activity of A methyltransferases and the METTL14-mediated carcinogenic ability to promote osteosarcoma cell proliferation and metastasis also depend on its m 6 A. Catalytic activity.

[0417] The above data indicate that METTL14 promotes the proliferation and metastasis of osteosarcoma in vitro and in vivo, and the oncogenic ability of METTL14 to promote the proliferation and metastasis of osteosarcoma cells does indeed depend on its m6A catalytic activity; inhibiting the expression of METTL14 can inhibit the growth, proliferation, migration and invasion of osteosarcoma cells.

[0418] Example 3: METTL14 maintains the stem cell nature of osteosarcoma cells

[0419] To clarify m 6 Whether A modification and METTL14 play a key role in maintaining the stemness of osteosarcoma, thereby regulating its malignant progression. First, the inventors cultured U2OS and 143B cells in a spheroidizing medium supplemented with multiple growth factors (EGF, bFGF, and N2 at 20 ng / mL) and collected a subset of stem sarcoma spheroid cells with cancer stem cell characteristics. Then, RNA was extracted from this cell population and detected by real-time quantitative RT-PCR (qRT-PCR). The results showed that compared with parental cells, the tumor stem cell markers of this stem sarcoma spheroid population, such as CD133, SOX2, and OCT4, were significantly elevated. Figure 11 (A) indicates that the enriched sarcoma spherocyte population possesses stronger stem cell capacity. Furthermore, the inventors detected the m... 6 The A modification level indicated that, compared to parental cells, U2OS and 143B stem sarcoma spherocytes showed higher m 6 A modification level significantly increased ( Figure 11 (METTL14). Following this, the inventors examined the expression levels of METTL14 in the RNA and protein of stem spheroid cells. The results showed that, compared to the parental cells, the RNA and protein expression levels of METTL14 in the stem spheroid cells of U2OS and 143B were also significantly increased. Figure 11 (C). The above results indicate that m 6 A modification and METTL14 do indeed play an important role in maintaining the stemness of osteosarcoma.

[0420] Next, the inventors performed PCR analysis on U2OS and 143B cells with stably knocked-down METTL14 (shMETTL14#32 and shMETTL14#33). The results showed that, compared to the control group, the expression of cell stem markers such as CD133, SOX2, and OCT4 was downregulated in U2OS and 143B cells after stable knockdown of METTL14. Figure 12 (A). Spheroidization experiments showed that, compared to control cells, stable knockdown of METTL14 significantly reduced the number and size of spheroids in U2OS and 143B cells. Figure 12 (B). Meanwhile, the inventors used an ALDH activity kit to detect that knocking down METTL14 significantly reduced ALDH activity in cells. Figure 12 (C). These results collectively indicate that m 6 A-modification and METTL14 do indeed play an important role in maintaining the stemness of osteosarcoma and reducing m 6 A modification and METTL14 expression weaken the stemness of osteosarcoma cells. Inhibiting METTL14 expression can reduce the stemness of osteosarcoma cells.

[0421] Example 4: MeRIP-seq and RNA-seq analysis confirmed that MN1 is a downstream target of METTL14-mediated m6A modification.

[0422] To investigate the downstream target genes of METTL14, which play an important role in osteosarcoma, the inventors used a stably knocked-down METTL14 (shMETTL14#33) cell line and control U2OS and 143B cell lines (shNC) for m 6 Modified RNA immunoprecipitation sequencing (MeRIP-seq) and RNA transcriptome sequencing (RNA-seq) are two methods. With the development of m... 6 With the deepening of research on A-modification and the maturity and advancement of research techniques, the sequencing method of MeRIP-seq combined with RNA-seq has become a popular approach for exploring m-modification. 6 The most common approach is to target downstream genes with A-modification. MeRIP-seq sequencing results showed that after stable knockdown of METTL14 in U2OS and 143B cells, more than 1,366 and 1,816 differentially expressed genes were found, respectively. 6 A-peak related genes (fold change > 1.5) Figure 13 (A). Among them, the most common m 6 A motif GGAC (p<5.3e-19) in m 6 Peak A is significantly enriched. At m 6 Regarding the distribution of the A-modified peaks, the analysis shows that m 6The A modification peaks are most abundant near the mRNA stop codon and the 3' UTR, with only 6.61% (U2OS) and 6.91% (143B) of the modification peaks distributed in the 5' UTR of the mRNA. Figure 13 (B, C). In previous studies, considering that METTL14 is m 6 An important component of the A-methyltransferase complex, as a class of m 6 A methyltransferases play a role; therefore, the inventors here only consider that the abundance of m-methyltransferases decreases after stable knockdown of METTL14. 6 A modified peak (referred to as m) 6 The A-hypo peak is the true m 6 Peak A. According to this classification standard, the inventors knocked down METTL14 in U2OS and 143B cells, followed by m... 6 Intersection analysis was performed on genes downregulated by modification peak A. Combined with RNA transcriptome sequencing, the inventors identified 8 m... in U2OS and 143B cells with stable METTL14 knockdown. 6 Genes that are downregulated at both the A-hypo and mRNA levels ( Figure 13 (D). Among these 8 candidate genes, MN1 was the gene with the highest downregulation level, therefore it was selected as the subject of further research. Figure 13 (E). Indeed, the inventors discovered m in the MN1 mRNA transcript through analysis of MeRIP-seq data. 6 A modification was significantly reduced in METTL14 knockdown U2OS and 143B cells. Figure 13 (F). Furthermore, the inventors demonstrated through Western blotting and qRT-PCR that MN1 mRNA and protein levels were downregulated in U2OS and 143B cells stably knocked down by METTL14. Figure 13 (G, H). Following this, the inventor used m 6 Antibody A was used in a RIP assay on osteosarcoma cells, m 6 A-qPCR results showed that MN1 m in METTL14 knockdown osteosarcoma cells... 6 A modification was significantly reduced compared to the control group. Figure 13 (I). In summary, the inventors, through MeRIP-seq combined with RNA-seq sequencing and bioinformatics analysis, discovered that MN1 is a key factor in the METTL14-mediated malignant progression of osteosarcoma. 6 A new and important downstream target modified by A.

[0423] Example 5: METTL14 upregulates MN1 in vitro and in vivo to promote malignant progression of osteosarcoma.

[0424] The preceding content clarified the oncogenic role of METTL14 in osteosarcoma, and through MeRIP-seq combined with RNA-seq sequencing and bioinformatics analysis, it was found that MN1 is a key factor in the malignant progression of osteosarcoma mediated by METTL14. 6 A new and important downstream target for A-modification. A review of relevant literature revealed that MN1 plays a significant oncogenic role in leukemia, but its application in osteosarcoma has not yet been reported. The expression of MN1 in 70 human primary osteosarcoma specimens was investigated using IHC staining, and the results are as follows: Figure 4 As shown in Figure a. Kaplan-Meier analysis showed that osteosarcoma patients with high MN1 expression had significantly worse overall survival and lung metastasis-free survival (LMFS) compared to other patients. Figure 4 (c) The predictive value of MN1 for overall survival was analyzed using receiver operating characteristic (ROC) curve analysis, and the results are as follows: Figure 4 As shown in Figure e, its AUC is 0.727, indicating that MN1 can be used as a biomarker for the diagnosis and prognostic assessment of osteosarcoma.

[0425] To further investigate the oncogenic function of MN1 in osteosarcoma, stable MN1 knockdown cell lines (shMN1#a and shMN1#b, with the sequence of the sense strand of shMN1#a being GGCATCATGTCTAACTCTACC (SEQ ID NO. 35) and the sequence of the antisense strand of shMN1#a being GGTAGAGTTAGACATGATGCC (SEQ ID NO. 36); and the sequence of the sense strand of shMN1#b being GCGCAATTCGAGTATCCCATC (SEQ ID NO. 37), and the sequence of the antisense strand of shMN1#b being GATTGGGATACTCGAATTGCGC (SEQ ID NO. 38)) were established in U2OS and 143B cells using lentiviral vectors. Cellular proteins were extracted, and the knockdown efficiency was verified by Western blot experiments. Figure 14 (A). Next, a series of functional experiments were conducted using cell lines with MN1 knocked down to verify its role in osteosarcoma. In vitro CCK-8 assays showed that, compared to control cells (shNC), MN1 knockdown significantly inhibited the proliferation of U2OS and 143B cells. Figure 14 (Medium B). Plate cloning experiments also showed that after stable knockdown of MN1, the number and size of U2OS and 143B cell clones were significantly reduced. Figure 14 Transwell migration and invasion assays also showed that stable knockdown of MN1 (shMN1#a and shMN1#b) significantly inhibited the migration and invasion abilities of U2OS and 143B cells. Figure 14(D). Inhibiting MN1 expression can suppress the growth, proliferation, migration, and invasion of osteosarcoma cells.

[0426] Spheroidization experiments showed that stable knockdown of MN1 reduced the number and size of spheroids in U2OS and 143B cells. Figure 15 (A). Real-time quantitative PCR results showed that in U2OS and 143B cells with stable MN1 knockdown, tumor stem markers such as CD133, SOX2, and OCT4 were also significantly reduced. Figure 15 (See Figure B). These results demonstrate that MN1 plays a clear oncogenic role in osteosarcoma. Knockdown of MN1 significantly inhibited the proliferation, migration, and invasion of osteosarcoma cells, and weakened their stemness characteristics. Inhibiting MN1 expression can reduce the stemness of osteosarcoma cells.

[0427] Next, we investigated whether MN1 is regulated by METTL14 and whether MN1 and METTL14 interact in osteosarcoma. Therefore, we stably overexpressed MN1 in U2OS and 143B cells with METTL14 knockdown using a lentiviral overexpression plasmid, and validated this by Western blot. Figure 16 (A). Functional experiments were then conducted. In vitro CCK-8 assays showed that the proliferation of U2OS and 143B cells knocked down with METTL14 and MN1 was significantly inhibited. However, overexpression of MN1 in shMETTL14 cells could rescue the slowed cell proliferation caused by METTL14 knockdown. Figure 16 (Medium B). Plate colony assays also showed that knocking down METTL14 significantly increased the size and number of colonies of MN1-overexpressing U2OS and 143B cells. Figure 16 (C)

[0428] To further verify the relationship between METTL14 and MN1 in vivo and to investigate whether the regulation of MN1 by METTL14 is consistent in vivo with that in vitro, the inventors constructed an in situ tibial tumor model in nude mice. The same number of METTL14 stably knocked-down (shMETTL14#33+vector), MN1 stably knocked-down (shMN1#a+vector), METTL14 knocked-down followed by MN1 overexpression (shMETTL14#33+oeMN1), MN1 overexpression (shNC+oeMN1), and control group 143B cells (shNC+vector) were inoculated into the mid-shaft of the right tibia of nude mice. The mice were then fed and closely observed. After approximately 10 days of tumor formation, the nude mice were observed every three days, their weight was measured, and the transverse and vertical diameters of the tumors were recorded using calipers. After 32 days of continuous measurement, the nude mice were euthanized, the tumors were dissected and collected, and their size and weight were measured and recorded, along with photographs. Figure 17 (A). The results showed that the tumor proliferation ability of 143B cells with stable METTL14 knockdown (shMETTL14#33+vector) and stable MN1 knockdown (shMN1#a+vector) was significantly reduced, and both tumor size and weight were significantly decreased. In the 143B cells with METTL14 knockdown, the tumor proliferation ability, tumor size, and weight were significantly restored in the shMETTL14#33+oeMN1+vector group. Compared with the control group (shNC+vector) cells, the tumor proliferation ability of the shNC+oeMN1+vector group was relatively stronger, and the tumor volume and size were relatively larger. Figure 17 (B, C). Furthermore, the inventors performed HE staining and immunohistochemical staining on the embedded sections of the tumor tissue, finding that the expression of the tumor proliferation marker Ki-67 was significantly reduced in the METTL14 and MN1 knockdown groups. In 143B cells with METTL14 knockdown, Ki-67 expression increased in the MN1 overexpression group (shMETTL14#33+oeMN1). Figure 17 (D). In summary, both in vivo and in vitro experiments indicate that MN1 plays an important carcinogenic role in osteosarcoma, and METTL14 accelerates the malignant progression of osteosarcoma by upregulating MN1 in vitro and in vivo; inhibiting the expression of MN1 and / or METTL14 can achieve the goal of treating osteosarcoma.

[0429] Example 6: METTL14 upregulates MN1 in osteosarcoma to induce retinoic acid (ATRA) resistance.

[0430] Numerous experiments and clinical trials have confirmed that ATRA and its derivatives are effective and promising drugs for treating leukemia (APL) and various malignant tumors such as neuroblastoma, melanoma, and breast cancer. However, the efficacy of ATRA in treating osteosarcoma is unclear, and its clinical application in osteosarcoma treatment has not progressed in the past 20 years. Previous research found that METTL14 regulates MN1 expression and plays a pro-cancer role; therefore, it was hypothesized that METTL14 might affect the sensitivity of osteosarcoma to ATRA by regulating MN1 expression. Firstly, qPCR and Western blot experiments revealed that the expression levels of MN1 gene RNA and protein in U2OS and 143B cells were significantly higher than those in HL60 cells derived from AML patients. Figure 18 (A, B). The inventors then used a CCK-8 assay to detect the sensitivity of HL60, U2OS, and 143B cells to ATRA. The results showed that the IC50 values ​​for ATRA sensitivity in U2OS and 143B cells were... 50 The values ​​were much higher than those of HL60 cells. Compared to HL60 cells, U2OS and 143B cells were relatively insensitive to ATRA. Next, the study investigated whether the expression of METTL14 and MN1 affected the sensitivity of osteosarcoma cells to ATRA. CCK-8 and colony formation assays showed that, compared to the control group, U2OS and 143B cells in the stably knocked-down MN1 (shMN1#a+vector) and stably knocked-down METTL14 (shMETTL14#33+vector) groups showed increased sensitivity to ATRA. However, after overexpressing MN1 (shMETTL14#33+oeMN1) in stably knocked-down METTL14 cells, their resistance to ATRA was restored. Figure 18 (C~G).

[0431] Next, the inventors verified in nude mice whether the expression of METTL14 and MN1 affected the sensitivity of osteosarcoma cells to ATRA. Consistent with the previous method, an in situ tibial tumor model was constructed in nude mice. The same number of METTL14 stably knocked-down (shMETTL14#33+vector), MN1 stably knocked-down (shMN1#a+vector), METTL14 stably knocked-down followed by MN1 overexpression (shMETTL14#33+oeMN1), and control 143B cells (shNC+vector) were inoculated into the mid-shaft of the right tibia of nude mice. The mice were then fed and closely observed. After approximately 14 days, once the tumors had formed and reached a certain size, each group of tumor-bearing mice was randomly divided into two groups (ATRA treatment group and DMSO group). The ATRA treatment group and the DMSO group were administered equal volumes of ATRA (25 mg / kg) and DMSO-containing 5% glucose solution via intraperitoneal injection, respectively. Administration was repeated every 3 days for 14 consecutive days. Nude mice were observed every three days, weighed, and their tumor diameters (transverse and vertical) were recorded using calipers. Figure 19 (A). After 32 days of continuous measurement, nude mice were euthanized, and tumors were collected by dissection. Tumor size and weight were measured and recorded, and photographs were taken. Results of the in situ tibial tumor model in nude mice showed that, compared with the DMSO group, the tumor volume and weight were significantly reduced in the ATRA-treated MN1 knockdown (shMN1#a+vector) group and the METTL14 knockdown (shMETTL14#33+vector) group, while no significant change was observed in the ATRA-treated (shNC+vector) group. This indicates that inhibiting the expression of METTL14 and MN1 can increase the sensitivity of osteosarcoma cells to ATRA. Figure 19 (Groups B and C). Compared to other groups, stable knockdown of METTL14 followed by overexpression of MN1 (shMETTL14#33+oeMN1) resulted in decreased sensitivity to ATRA, as evidenced by no significant reduction in tumor volume or weight. Subsequently, the tumor tissues were embedded and sectioned, and immunohistochemically stained. The results showed that the expression of MN1 and Ki-67 in the tumor tissues of the stably knocked-down METTL14 (shMETTL14#33+vector) group was lower than that in the control group (…). Figure 19 (D). In summary, studies on ATRA resistance show that METTL14 upregulates MN1 expression in osteosarcoma, thereby inducing resistance to ATRA; and that inhibiting the expression of METTL14 and MN1 can increase the sensitivity of osteosarcoma cells to ATRA.

[0432] Example 7: METTL14 via IGF2BP2 at m 6 A-dependent mechanisms regulate MN1 mRNA stability and translation.

[0433] To investigate METTL14-mediated m in osteosarcoma 6 To investigate whether A modification affects the stability and translation efficiency of MN1 mRNA, U2OS and 143B osteosarcoma cells were treated with the transcription inhibitor actinomycin D (Act D), and then cellular RNA was extracted. The half-life of MN1 mRNA was detected by real-time quantitative PCR. The results showed that compared with the control group (shNC), the half-life of MN1 mRNA in U2OS and 143B cells with stable knockdown of METTL14 (shMETTL14#32 and shMETTL14#33) was significantly shortened. Figure 20 (A). Furthermore, the study continued to investigate whether METTL14 regulates the translation efficiency of MN1. Polysome analysis of 143B cells revealed that, compared to the control group, stable knockdown of METTL14 significantly reduced the translation efficiency of MN1. Figure 20 (B) This indicates that METTL14-mediated m 6 A modification affected the stability and translation efficiency of MN1 mRNA in osteosarcoma cells.

[0434] To explore the regulation of m in osteosarcoma 6 A methylation modification of MN1 mRNA is specific to m 6 A-binding protein was used to prepare MN1-specific biotin-labeled RNA probes, and RNA pull-down experiments were performed. Further analysis of several classic m-binding proteins was then conducted using Western blotting. 6 A-binding proteins were identified, and the study focused on proteins that recognize and bind to MN1 mRNA. The results showed that IGF2BP2 primarily binds to the full-length MN1 mRNA in U2OS and 143B cells, rather than IGF2BP1 / 3 or YTH family proteins. Figure 21 (A) To further investigate the specific binding sites of IGF2BP2 and MN1, we divided the MN1 mRNA into three regions: the CDS region, the 5'UTR, and the 3'UTR, and analyzed the predicted mRNA binding sites in each region. 6 Mutation occurs at site A, m 6 The base A at site A is changed to T, and then a specific biotin-labeled RNA probe is prepared using in vitro transcription. RNA pull-down experiments are then performed again. The results show that IGF2BP2 mainly binds to the CDS region of MN1 mRNA, rather than the 5'UTR or 3'UTR. [The text then abruptly shifts to a seemingly unrelated topic: "Mutating m..."] 6 Following site A, the binding of IGF2BP2 to MN1 decreases. Figure 21 (A). RIP experiments showed that knocking down METTL14 reduced the binding of IGF2BP2 to MN1. Figure 21 (B) The above results indicate that m 6 The A-modified MN1 can be m 6 A-binding protein IGF2BP2 recognizes and binds to it.

[0435] Next, the expression of IGF2BP2 in osteosarcoma patient specimens was examined. It was observed that the expression of IGF2BP2 in osteosarcoma was significantly higher than in normal paired tissues. Figure 22 (A). To clarify the relationship between IGF2BP2 and m in osteosarcoma. 6 Does the binding of A-modified MN1 have a regulatory effect on MN1 fate? The expression of IGF2BP2 in 70 human primary osteosarcoma specimens was investigated using IHC staining. The results are as follows: Figure 4 As shown in Figure a. Kaplan-Meier analysis (log-rank test) of overall survival (OS) in patients with upregulated molecular markers (n=70) was performed. Patients were grouped according to the individual median expression levels of METTL14, MN1, and IGF2BP2 based on immunohistochemical analysis, and were further divided into three groups based on the suggestions. Figure 4 (d). The predictive value of IGF2BP2 for overall survival (five years) was analyzed using receiver operating characteristic (ROC) curve analysis, and the results are as follows: Figure 4 As shown in Figure e, its AUC was 0.641, indicating that IGF2BP2 can serve as a biomarker for the diagnosis and prognostic assessment of osteosarcoma. Receiver operating characteristic (ROC) curve analysis was used to analyze the predictive value of IGF2BP2, MN1, and METTL1 for overall survival (five years), and the results are as follows: Figure 4 As shown in Figure e, the AUC was 0.754, indicating that IGF2BP2, MN1, and METTL1 can serve as a combination of biomarkers for the diagnosis and prognostic assessment of osteosarcoma. IGF2BP2 siRNA (siIGF2BP2#1 and siIGF2BP2#2, where siIGF2BP2#1 is a reverse complementary double-stranded RNA, one strand of which has the sequence CATGCCGCATGATTCTTGA (SEQ ID NO. 39); and siIGF2BP2#2 is a reverse complementary double-stranded RNA, one strand of which has the sequence GAACGAACTGCAGAACTTA (SEQ ID NO. 40)) was transiently transfected into U2OS and 143B cells to knock down the IGF2BP2 expression. Western blot experiments were then performed to verify the knockdown efficiency. PCR and western blot experiments were then used to investigate whether knockdown of IGF2BP2 affected MN1 expression. The results showed that knockdown of IGF2BP2 led to a decrease in MN1 protein expression. Figure 22(B). Then, RNA half-life detection and polysome analysis were performed. The results showed that, compared with the control group (siNC), knockdown of the IGF2BP2 gene significantly shortened the half-life of MN1 mRNA and significantly reduced the translation efficiency of MN1. Figure 22 (C, D). In summary, our findings indicate that METTL14-mediated m 6 A modification regulates the stability and translation of MN1 mRNA, and this regulation mainly depends on m 6 The A-binding protein IGF2BP2 plays a role in the recognition and binding of modified MN1, thereby affecting the expression level of MN1. In summary, METTL14 uses IGF2BP2 to... 6 A-dependent mechanisms regulate MN1 mRNA stability and translation efficiency. Correspondingly, inhibiting IGF2BP2 expression can suppress the growth, proliferation, metastasis, and invasion of osteosarcoma cells, reduce osteosarcoma cell stemness, and simultaneously increase osteosarcoma sensitivity to ATRA, ultimately improving or treating osteosarcoma.

[0436] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention. SEQUENCE LISTING <110> The First Affiliated Hospital of Sun Yat-sen University <120> Application of MN1 in the diagnosis and treatment of osteosarcoma <130> <160> 40 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <400> 1 atccccaagg cttcaaccag 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 gcgagtgcca ggagatagtc 20 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 agagaacaaa ggaacactgc ct 22 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 aatgaagtcc ccgtctgtgc 20 <210> 5 <211> 18 <212> DNA <213> Artificial sequence <400> 5 ggcgaagtgt cgaatgct 18 <210> 6 <211> 18 <212> DNA <213> Artificial sequence <400> 6 ccaactgctg gcgtgtct 18 <210> 7 <211> twenty two <212> DNA <213> Artificial sequence <400> 7 gaatactgat ggtctggtgc ta 22 <210> 8 <211> 18 <212> DNA <213> Artificial sequence <400> 8 cttggctgtg gtcttgga 18 <210> 9 <211> 19 <212> DNA <213> Artificial sequence <400> 9 tgggttcatc ctacaacgg 19 <210> 10 <211> 18 <212> DNA <213> Artificial sequence <400> 10 cctcttcagg gccttcac 18 <210> 11 <211> 19 <212> DNA <213> Artificial sequence <400> 11 cccgagggct tcgtcaaca 19 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <400> 12 cgacacccga ataggcttga 20 <210> 13 <211> twenty two <212> DNA <213> Artificial sequence <400> 13 cctgaagcag aagaggatca cc 22 <210> 14 <211> twenty two <212> DNA <213> Artificial sequence <400> 14 aaagcggcag atggtcgttt gg 22 <210> 15 <211> twenty two <212> DNA <213> Artificial sequence <400> 15 gctacagcat gatgcaggac ca 22 <210> 16 <211> twenty two <212> DNA <213> Artificial sequence <400> 16 tctgcgagct ggtcatggag tt 22 <210> 17 <211> twenty two <212> DNA <213> Artificial sequence <400> 17 cactaccaag gacaaggcgt tc 22 <210> 18 <211> twenty two <212> DNA <213> Artificial sequence <400> 18 caacgcctct ttggtctcct tg 22 <210> 19 <211> twenty two <212> DNA <213> Artificial sequence <400> 19 tcaagatgtc cctcagcctg ga 22 <210> 20 <211> twenty two <212> DNA <213> Artificial sequence <400> 20 aagctgaggg aagtcttgga gc 22 <210> twenty one <211> 20 <212> DNA <213> Artificial sequence <400> twenty one ctccacctct tcttgtttgc 20 <210> twenty two <211> twenty three <212> DNA <213> Artificial sequence <400> twenty two gatgacccat ttactgatga ttt 23 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <400> twenty three gccttggctt tgattcttgc 20 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <400> twenty four tccacttggc tttctgtcct c 21 <210> 25 <211> twenty three <212> DNA <213> Artificial sequence <400> 25 gactcgctgg aatacaatta ccc 23 <210> 26 <211> 19 <212> DNA <213> Artificial sequence <400> 26 acccgctgca taatgaggc 19 <210> 27 <211> twenty three <212> DNA <213> Artificial sequence <400> 27 agtggaattg catgggaaaa tca 23 <210> 28 <211> 19 <212> DNA <213> Artificial sequence <400> 28 caacggcggt ttctgtgtc 19 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 tgcaccacca actgcttagc 20 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <400> 30 ggcatggact gtggtcatga g 21 <210> 31 <211> twenty one <212> DNA <213> Artificial sequence <400> 31 ggttacagaa gatgtgaaga t 21 <210> 32 <211> twenty one <212> DNA <213> Artificial sequence <400> 32 atcttcacat cttctgtaac c 21 <210> 33 <211> twenty one <212> DNA <213> Artificial sequence <400> 33 gctaatgttg acattgactt a 21 <210> 34 <211> twenty one <212> DNA <213> Artificial sequence <400> 34 taagtcaatg tcaacattag c 21 <210> 35 <211> twenty one <212> DNA <213> Artificial sequence <400> 35 ggcatcatgt ctaactctac c 21 <210> 36 <211> twenty one <212> DNA <213> Artificial sequence <400> 36 ggtagagtta gacatgatgc c 21 <210> 37 <211> twenty one <212> DNA <213> Artificial sequence <400> 37 gcgcaattcg agtatcccat c 21 <210> 38 <211> twenty one <212> DNA <213> Artificial sequence <400> 38 gatgggatac tcgaattgcg c 21 <210> 39 <211> 19 <212> DNA <213> Artificial sequence <400> 39 catgccgcat gattcttga 19 <210> 40 <211> 19 <212> DNA <213> Artificial sequence <400> 40 gaacgaactg cagaactta 19

Claims

1. The application of substances that detect MN1 expression levels in the preparation of products for the diagnosis or prognostic assessment of osteosarcoma; or Application of substances that detect METTL14 expression level, MN1 expression level, and IGF2BP2 expression level in the preparation of products for osteosarcoma diagnosis or prognostic assessment.

2. The application according to claim 1, characterized in that: The substance used to detect METTL14 expression levels is a substance that detects METTL14 at the gene level and / or protein level.

3. The application according to claim 1, characterized in that: The substance used to detect METTL14 expression levels is a substance selected from one or more detection techniques or methods from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarray.

4. The application according to claim 1, characterized in that: The substance used to detect METTL14 expression levels is selected from at least one of the following groups: METTL14-specific probes, gene chips, and PCR primers.

5. The application according to claim 1, characterized in that: The substance used to detect METTL14 expression levels is selected from: METTL14 antibody; and / or METTL14-specific PCR primers.

6. The application according to claim 5, characterized in that: The sequences of the METTL14-specific PCR primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The application according to claim 1, characterized in that: The substance used to detect MN1 expression levels is a substance that detects MN1 at the gene level and / or protein level.

8. The application according to claim 1, characterized in that: The substance used to detect MN1 expression levels is a substance selected from one or more detection techniques or methods from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarray.

9. The application according to claim 1, characterized in that: The substance used to detect MN1 expression levels is selected from at least one of the following groups: MN1-specific probes, gene chips, and PCR primers.

10. The application according to claim 1, characterized in that: The substance used to detect MN1 expression levels is selected from: MN1 antibody; and / or MN1-specific PCR primers.

11. The application according to claim 10, characterized in that: The sequences of the MN1-specific PCR primers are shown in SEQ ID NO.25 and SEQ ID NO.

26.

12. The application according to claim 1, characterized in that: The substance used to detect IGF2BP2 expression levels is a substance that detects IGF2BP2 at the gene level and / or protein level.

13. The application according to claim 1, characterized in that: The substance used to detect IGF2BP2 expression levels is a substance selected from one or more detection techniques or methods from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarray.

14. The application according to claim 1, characterized in that: The substance used to detect IGF2BP2 expression levels is selected from at least one of the following groups: IGF2BP2-specific probes, gene chips, and PCR primers.

15. The application according to claim 1, characterized in that: The substance used to detect IGF2BP2 expression levels is selected from: IGF2BP2 antibody; and / or IGF2BP2-specific PCR primers.

16. The application according to claim 15, characterized in that: The sequences of the IGF2BP2-specific PCR primers are shown in SEQ ID NO.27 and SEQ ID NO.

28.

17. A diagnostic product, characterized in that: The diagnostic product contains METTL14-specific PCR primers, the sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4; and MN1-specific PCR primers, the sequences of which are shown in SEQ ID NO.25 and SEQ ID NO.

26. IGF2BP2-specific PCR primers, the sequences of which are shown in SEQ ID NO.27 and SEQ ID NO.

28.

18. Application of MN1 inhibitors in the preparation of drugs for the prevention and treatment of osteosarcoma; The MN1 inhibitor comprises at least one of (h1) to (h3): (h1) shRNA targeting MN1; (h2) encodes the nucleic acid molecule of (h1); (h3) contains an expression cassette, vector, or transgenic cell line of (h2); The shRNA targeting MN1 includes shMN1 #a and / or shMN1 #b; The sequence of the sense chain of shMN1 #a is shown in SEQ ID NO.35, and the sequence of the antisense chain of shMN1 #a is shown in SEQ ID NO.36; The sequence of the sense chain of shMN1 #b is shown in SEQ ID NO.37, and the sequence of the antisense chain of shMN1 #b is shown in SEQ ID NO.

38.

19. A product comprising: The MN1 inhibitor and retinoic acid as described in claim 18.

20. The product according to claim 19, characterized in that: The product has the function of preventing and treating osteosarcoma.

Citation Information

Patent Citations

  • System for prognosis of small cell lung cancer patient and application thereof

    CN113736879A

  • METHODS FOR MODULATING AND ASSAYING m6A IN STEM CELL POPULATIONS

    US20160264934A1