Deoxyribozyme molecular probe and use thereof

Abstract

The present application provides a method for regulating the activity of functional nucleic acid, which comprises modifying one or more bases of the functional nucleic acid to inactivate the functional nucleic acid. Preferably, the functional nucleic acid or the substrate of the functional nucleic acid is modified to inactivate the functional nucleic acid, and then the modified group is removed to activate the functional nucleic acid. The present application also provides a deoxyribozyme molecular probe, which comprises domain a, domain b and domain c. The deoxyribozyme molecular probe is obtained by screening 6 A closed Dz, which realizes m 6 A high-efficiency and sensitive detection of demethylase and screening and detection of inhibitor small molecule drugs.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular detection, and particularly relates to a deoxyribozyme molecular probe and application thereof. BACKGROUND

[0002] Deoxyribozyme (DNAzyme for short) is a kind of catalytically active DNA molecule obtained by in vitro screening. Compared with traditional protease and Ribozyme, DNAzyme has the characteristics of stable chemical properties, low cost, easy synthesis and modification, and high catalytic activity, and has been widely used in biosensing and clinical diagnosis in recent years, especially for intracellular analysis and detection. In these applications, the activity of DNAzyme is mainly regulated to achieve the purpose of detecting target objects. At present, there are three common means for regulating the activity of DNAzyme, one is to control the concentration of the cofactor (metal ion) of DNAzyme to regulate its activity, so as to detect metal ions; the second is to use nucleic acids or small molecules to change the structure of the catalytic active center of DNAzyme, and to activate the activity of DNAzyme by restoring the complete structure of DNAzyme; the third is to modify a photosensitive group at the end of the nucleic acid substrate or arm of DNAzyme, and to remove the photosensitive group by external light to restore the activity of DNAzyme. However, the above strategies are usually complex in design, low in universality, and belong to indirect regulation of the activity of DNAzyme.

[0003] Obesity-related protein (FTO protein) is an N6-methyladenine (m 6 A) demethylase. More and more studies have shown that FTO is overexpressed in various tumor cells, and is closely related to the formation, development and metastasis of tumors, so the detection of FTO, especially intracellular detection, is of great significance for early diagnosis of tumors. At present, the research on FTO protein mainly focuses on its pathogenic mechanism, and there is little work on its in vitro detection. Early detection of FTO mainly includes gel electrophoresis (PAGE), mass spectrometry (MS), high performance liquid chromatography (HPLC) and other methods, and these detection methods generally have the characteristics of complex operation and low work efficiency. The later developed fluorescence-based method still has the disadvantage of low detection sensitivity, and is not suitable for detection in complex intracellular environment.

[0004] In summary, in the prior art, on the one hand, there is little research on direct regulation of the activity of DNAzyme by macromolecular proteins, therefore, there is an urgent need to develop a new method for regulating the activity of DNAzyme by intracellular proteins (especially important proteins closely related to tumors). On the other hand, there is an urgent need to develop a simple and efficient probe suitable for detecting FTO in cells. SUMMARY

[0005] This invention aims to at least partially solve one of the technical problems existing in the prior art. Based on the high efficiency of DNAzyme catalytic activity and flexible regulation characteristics, it develops a method to regulate DNAzyme activity through FTO protein, so as to achieve efficient detection of FTO in vitro and in vivo. At the same time, the successful construction of this DNAzyme probe also greatly promotes the screening of small molecule inhibitors of FTO protein, which is of great significance for the clinical research of small molecule drugs.

[0006] In a first aspect, the present invention provides a method for regulating the activity of a functional nucleic acid, comprising modifying one or more bases of the functional nucleic acid or the substrate on which the functional nucleic acid acts to block the activity of the functional nucleic acid.

[0007] Preferably, after modifying one or more bases of the functional nucleic acid to block its activity, the modification group is removed to activate the functional nucleic acid.

[0008] Furthermore, the modification is m 6 A. Methylation modification.

[0009] Furthermore, using m 6 A demethylase removes the modified group.

[0010] Furthermore, the functional nucleic acid is a deoxyribonuclease or aptamer, preferably a deoxyribonuclease.

[0011] Deoxyribonuclease molecular probe, hereinafter referred to as Dz.

[0012] In a second aspect, the present invention provides a deoxyribozyme molecular probe (hereinafter also referred to as Dz-Me), the deoxyribozyme molecular probe comprising a domain a, a domain b, and a domain c; the nucleotide sequence of the domain a is shown in SEQ ID NO.1; the nucleotide sequence of the domain b is shown in SEQ ID NO.2; the nucleotide sequence of the domain c is shown in SEQ ID NO.3; the fifth base A in the domain c is m 6 A. Methylation modification.

[0013] The present invention provides a deoxyribozyme molecular probe (hereinafter referred to as Dz-Me) comprising three parts: domain a, domain b, and domain c. Domain c is the catalytic active center of Dz-Me and plays a decisive role in its activity. Domain a and domain b are the two arms of Dz-Me.

[0014] In a third aspect, the present invention provides a deoxyribozyme molecular probe (hereinafter also referred to as ED5-Me), the deoxyribozyme molecular probe comprising a domain e, a domain f, and a domain g; the nucleotide sequence of the domain e is shown in SEQ ID NO. 8; the nucleotide sequence of the domain f is shown in SEQ ID NO. 9; the nucleotide sequence of the domain g is shown in SEQ ID NO. 10; the fifth base A in the domain g is m 6 A. Methylation modification.

[0015] In a fourth aspect, the present invention provides a kit comprising a deoxyribonuclease molecular probe and a substrate S1 provided in the second aspect of the present invention, wherein the substrate S1 comprises a domain a* and a domain b*, an adenine ribonucleotide is disposed between the domain a* and the domain b*, the substrate S1 is labeled with a fluorophore FAM at its 5' end and with a quencher BHQ1 at its 3' end; the nucleotide sequence of the domain a* is shown in SEQ ID NO. 4; the nucleotide sequence of the domain b* is shown in SEQ ID NO. 5.

[0016] Domains a and b of Dz hybridize with the a* and b* domains of the substrate S1, respectively. TrAG represents the cleavage site, rA represents adenine ribonucleotide, and the 5' end is labeled with the fluorophore FAM, while the 3' end is labeled with the quencher BHQ1. Fluorescence resonance energy transfer occurs between the two fluorophores, and FAM undergoes fluorescence quenching. a hybridizes complementary to a*, and b hybridizes complementary to b*. Dz can hybridize with the substrate S1 and cleave the molecule between rA and G. First, a suitable methylated Dz is screened in vitro. Then, m-type hybridization is performed on the catalytic center of Dz and the substrate. 6 A. Methylation modification was used to investigate the effect of different methylation sites on the activity of Dz, and finally, the optimal Dz (named Dz-Me) was screened out after methylation modification, in which the cleavage activity was completely blocked. 6 The A-demethylase (FTO) removes the methyl group, restoring Dz-Me's original activity. It then cleaves the substrate S1, separating a* and b*, meaning the two fluorophores FAM and BHQ1 separate, and FAM's fluorescence is restored. Simultaneously, a demethylated and activated Dz can cleave multiple substrates, generating multiple fluorescence signals. Without a demethylase, even if Dz-Me and substrate S1 hybridize through their arms, and the distance between the two fluorophores is within 10 nm, fluorescence resonance energy transfer (FRET) can still occur. FAM's fluorescence is quenched by BHQ1, resulting in no fluorescence signal output.

[0017] In a fifth aspect, the present invention provides another kit comprising the deoxyribonuclease molecular probe and substrate S3 provided in the third aspect of the present invention, wherein substrate S3 comprises a domain e* and a domain f*, an adenine ribonucleotide is disposed between the domain e* and the domain f*, the 5' end of the substrate S3 is labeled with a fluorophore FAM, and the 3' end is labeled with a quencher BHQ1; the nucleotide sequence of the domain e* is shown in SEQ ID NO. 11; the nucleotide sequence of the domain f* is shown in SEQ ID NO. 12.

[0018] In a sixth aspect, the present invention provides another kit comprising the deoxyribonuclease molecular probe and substrate S2 provided in the second aspect of the present invention, wherein substrate S2 comprises a*, ab*, d, and d*, wherein an adenine ribonucleotide is disposed between a* and b*, the 5' end of substrate S2 is labeled with a fluorophore FAM, and the 3' end is labeled with a quencher BHQ1; the nucleotide sequence of a* is shown in SEQ ID NO.4; the nucleotide sequence of b* is shown in SEQ ID NO.5; the nucleotide sequence of d is shown in SEQ ID NO.6; and the nucleotide sequence of d* is shown in SEQ ID NO.7.

[0019] Substrate S2 comprises four domains: a*, b*, d, and d*. The 5' stem domain d and loop domain a* of S2 act as antisense oligonucleotides (ASOs) with gene silencing capabilities, hybridizing with FTO protein mRNA. Domains a* and b* form the loop of the hairpin structure of substrate S2. Domains d and d* hybridize complementaryly to form the stem of substrate S2. The 5' end of S2 is modified with the fluorophore FAM, and the 3' end with the quencher BHQ1. In the presence of FTO, removing the methyl group on Dz-Me restores its cleavage activity. The two arm domains a and b hybridize with the loop domains a* and b* of substrate S2, cleaving the rA and G groups and releasing the antisense nucleic acid (ASO). FAM separates from BHQ1, and the fluorescence of FAM is restored. An activated Dz can cyclically catalyze the cleavage of substrate S2 to release multiple antisense nucleic acids, generating a fluorescent signal. At the same time, the antisense nucleic acid specifically hybridizes with the mRNA of FTO protein, inhibiting the expression of FTO protein. In the absence of FTO, the antisense nucleic acid is blocked at the stem end of substrate S2 and cannot hybridize with mRNA. Therefore, a novel gene regulation strategy integrating diagnosis and therapy with self-activation was designed.

[0020] In a seventh aspect, the present invention provides a method for preparing the above-described deoxyribonuclease molecular probe for detecting m 6 A. Demethylase activity or screening m6 Application of A demethylase inhibitor drugs in kits or test reagents.

[0021] In an eighth aspect, the present invention provides a kit for detecting m as described above. 6 Applications of A demethylase activity. In the technical solution of this invention, the kit described in the third aspect of this invention can also be used to detect m in vitro. 6 The activity of purified demethylase A.

[0022] Based on m 6 The detection of FTO is achieved using Dz-Me activated by a demethylase. The application includes: mixing the Dz-Me probe, substrate S1, and FTO protein in 4-hydroxyethylpiperazine ethanesulfonic acid buffer (HEPES). The concentration of Dz-Me is 50 nM, and the concentration of substrate S1 is 250 nM. The mixture is incubated at room temperature for 2 hours, and the fluorescence intensity of the system is measured using a fluorescence spectrometer to obtain the m... 6 A. Demethylase activity.

[0023] Provide a m-based 6 A closed Dz-Me is used for m 6 A demethylase detection kit containing Dz-Me and substrate S1; when m 6 During demethylation, the methyl group on Dz-Me is removed, restoring cleavage activity. Domains a and b are the two arms of Dz-Me, responsible for hybridization with substrate S1. Substrate S1 consists of two parts: domain a* and domain b*. TrAG represents the cleavage site, and rA represents adenine ribonucleotide. Its 5' end is labeled with the fluorophore FAM, and its 3' end with the quencher BHQ1. Fluorescence resonance energy transfer occurs between the two fluorophores, quenching the fluorescence of FAM. Domain a hybridizes complementaryly with domain a*, and domain b hybridizes complementaryly with domain b*. Dz hybridizes with the substrate and cleaves the space between rA and G. In m 6 The action of demethylase A removes the methyl group, restoring Dz-Me's original activity. It then cleaves the substrate S1, separating domain a* from domain b*, meaning the two fluorophores FAM and BHQ1 separate, and FAM's fluorescence is restored. Simultaneously, one activated Dz can cleave multiple substrates, generating multiple fluorescence signals. Without demethylase, even if Dz-Me and the substrate hybridize through their arms, fluorescence resonance energy transfer (FRET) still occurs, and FAM's fluorescence is quenched by BHQ1, resulting in no fluorescence signal output. Therefore, the output of the fluorescence signal is positively correlated with the concentration of the target protein.

[0024] In a ninth aspect, the present invention provides a kit for screening m 6Application of A demethylase inhibitor drugs.

[0025] Based on m 6 A demethylase-activated Dz-Me assay enables the detection and screening of FTO inhibitors: The process involves mixing the Dz-Me probe, substrate S1, FTO protein, and inhibitor in 4-hydroxyethylpiperazine ethanesulfonic acid buffer (HEPES). The concentrations of Dz-Me are 50 nM, substrate S1 is 250 nM, and FTO protein is 100 nM. The mixture is incubated at room temperature for 2 hours. The fluorescence intensity of the system is then measured using a fluorescence spectrometer to obtain the m-value. 6 Inhibition curve of A demethylase inhibitor.

[0026] In the presence of small molecule inhibitors, m 6 The activity of A demethylase is inhibited, and it cannot activate the Dz-Me cleavage substrate. Therefore, the output of the fluorescence signal is negatively correlated with the concentration of the inhibitor.

[0027] In the above method, the concentration of the 4-hydroxyethylpiperazine ethanesulfonic acid buffer is 50 mM, the pH is 7.0, and 283 μM (NH4)2Fe(SO4)2, 300 μM α-KG, 2 mM L-ascorbic acid, 50 μg / mL BSA and 0.1 mM ZnCl2 are added.

[0028] In a tenth aspect, the present invention provides the use of substrate S2 in the preparation of an antitumor drug, said substrate S2 comprising a domain a*, a domain b*, a domain d, and a domain d*, wherein an adenine ribonucleotide is disposed between the domain a* and the domain b*, the 5' end of said substrate S2 is labeled with a fluorophore FAM, and the 3' end is labeled with a quencher BHQ1; the nucleotide sequence of the domain a* is shown in SEQ ID NO. 4; the nucleotide sequence of the domain b* is shown in SEQ ID NO. 5; the nucleotide sequence of the domain d is shown in SEQ ID NO. 6; and the nucleotide sequence of the domain d* is shown in SEQ ID NO. 7.

[0029] The technical principle of this invention is as follows:

[0030] The detection method for protease FTO consists of two components: methylated Dz (Dz-Me) and substrate S. Our study found that methylation modification of the active catalytic site of Dz can completely block its activity. Demethylases remove the methyl group, restoring Dz's original activity and allowing it to cleave the substrate, such as... Figure 1As shown in (1), in the presence of FTO protease, the methyl group on Dz-Me is removed, restoring its cleavage activity and allowing for cyclic cleavage of substrate S1, thereby generating significant signal amplification. This Dz-Me probe comprises three parts: a, b, and c. Part c is the catalytic active site of Dz-Me, where m... 6 Modification A, where a and b are the two arms of Dz-Me, serves to hybridize with substrate S1. Substrate S1 comprises two parts, a* and b*, and can hybridize with Dz-Me. TrAG represents the cleavage site, rA represents adenine ribonucleotide, and its 5' end is labeled with the fluorophore FAM, while its 3' end is labeled with the quencher BHQ1. Fluorescence resonance energy transfer occurs between the two fluorophores, and FAM quenches the fluorescence. Dz-Me can hybridize with substrates a* and b*, and in m… 6 The A demethylase FTO removes the methyl group, restoring the original catalytic activity and cleaving the molecule between rA and G, separating a* and b*, i.e., the two fluorophores FAM and BHQ1 separate. FAM's fluorescence is restored, producing a fluorescent signal. Without m 6 During A demethylase activity, even if Dz-Me and the substrate hybridize together through both arms, and the distance between the two fluorophores is within 10 nm, fluorescence resonance energy transfer occurs, and the fluorescence of FAM is quenched by BHQ1, resulting in no fluorescence signal output; when the target molecule is present... 6When A-methyltransferases are activated, the target substance can activate Dz-Me to produce a large number of catalytically active Dz molecules. Simultaneously, one activated Dz cleaves multiple substrates S1, generating multiple fluorescent signals. At this point, the fluorescence intensity of the substrate fluorophore is positively correlated with the concentration of the target protease; the concentration of the target protease can be determined based on the change in fluorescence intensity. This probe can also be used for screening and detecting demethylase inhibitors. Under the action of small inhibitor molecules, the demethylation ability of demethylases is inhibited, thus hindering the recovery of Dz-Me activity. Therefore, the fluorescence intensity of the substrate fluorophore is negatively correlated with the concentration of the inhibitor; the inhibitory effect can be determined based on the change in fluorescence intensity. Furthermore, this method can also achieve integrated intracellular diagnosis and therapy. A hairpin substrate S2 was designed, containing four parts: a*, b*, d, and d*. The 5' stem d and loop a* sequences of S2 serve as antisense oligonucleotides (ASOs) with gene silencing capabilities, allowing hybridization with FTO protein mRNA. In the presence of FTO, the methyl group on Dz-Me is removed, restoring its cleavage activity and cleaving substrate S2, thereby releasing antisense oligonucleotides (ASO). Simultaneously, FAM separates from BHQ1, and the fluorescence of FAM is restored. The expression level of the demethylase in the cell is determined based on the fluorescence intensity value. One activated Dz can cyclically catalyze the cleavage of substrate S2 to release multiple antisense oligonucleotides, generating multiple fluorescence signals. Simultaneously, this antisense oligonucleotide specifically hybridizes with the mRNA of the demethylated protein, inhibiting the protein's expression. Therefore, based on the intracellular demethylase expression level, a corresponding amount of Dz can be activated, thereby releasing a quantitative amount of antisense nucleic acid, achieving the goal of intracellular self-activated, therapeutic gene regulation. The specific principle is as follows... Figure 1 As shown in (2).

[0031] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0032] The present invention provides that m is obtained through screening. 6 A closed Dz implements m 6 This method provides highly efficient and sensitive detection of A-type demethylases and for screening and detecting inhibitory small molecule drugs. Compared with traditional mass spectrometry and high-performance liquid chromatography methods, this method is simple, stable, highly sensitive, and can be used for intracellular m-type demethylases. 6This study aims to monitor demethylases and regulate gene regulation in tumor cells. The method is simple to design, requiring no change to the Dz and substrate S. For different target proteins (modified or unmodified proteins), only different modification sites need to be changed. These modification sites can be located on either the Dz or the substrate S, making it a universal and efficient method for detecting both modified and unmodified proteins. This probe can also be used for the detection of protein inhibitors, enabling rapid and efficient screening of small molecule drugs. Furthermore, this probe can be used for the detection of intracellular proteases and gene regulation, reducing the toxic side effects of traditional gene regulation methods. This research is beneficial for achieving high-throughput screening of small molecule drugs and early diagnosis of cancer, and for further monitoring its development and progression. Attached Figure Description

[0033] Figure 1 (1) Detecting m with Dz-Me probe 6 A schematic diagram of demethylase A; Figure 1 (2) Monitoring intracellular m for Dz-Me 6 A schematic diagram of demethylases and gene regulation;

[0034] Figure 2 (A) is Dz-Me by m 6 A schematic diagram illustrating the activation of a demethylase to cleave the substrate and output a fluorescent signal; Figure 2 (B) is the polyacrylamide gel electrophoresis experiment. 6 A demethylase-activated Dz (17E-Me+FTO experimental group) and untreated m 6 A comparison of the cleavage activity of blocked Dz-Me (17E-Me control group); Figure 2 (C) is m 6 A demethylase-activated Dz (17E-Me+FTO experimental group) and untreated m 6 A comparison of reaction kinetic curves of closed Dz-Me (17E-Me control group);

[0035] Figure 3 (A) is m 6 A demethylase activates m 6 A schematic diagram of a closed ED5-Me; Figure 3 (B) shows the original ED5 (ED5 control group) and m in the polyacrylamide gel electrophoresis experiment. 6 A demethylase-activated ED5 (ED5-Me+FTO experimental group) and untreated m 6 A comparison of the cleavage activity of blocked ED5-Me (ED5-Me control group); Figure 3 (C) represents the original ED5 (ED5 control group), m 6A demethylase-activated ED5 (ED5-Me+FTO experimental group) and untreated m 6 A closed reaction kinetic curve of ED5-Me (ED5-Me control group);

[0036] Figure 4 (A) is Dz-Me by m 6 A schematic diagram of the reaction activation of A demethylase, using FTO protein as an example; Figure 4 (B) represents different systems (a: the original Dz, b: m) 6 A closed and inactivated Dz-Me, c:m 6 A closed Dz-Me is processed using FTO, d:m 6 A closed Dz-Me was treated with inactivated FTO, e:m 6 Time-dependent fluorescence intensity changes of the closed variant Dz treated with FTO; Inset: Summary Figure 4 (B) The change in final fluorescence intensity for each group; Figure 4 (C) activates m for FTO 6 A. Gel electrophoresis characterization of the activity of blocked Dz-Me, where "+" and "-" indicate the presence and absence of the corresponding components, respectively; Figure 4 (D) removes m from FTO 6 High performance liquid chromatography characterization of methyl groups on a blocked Dz-Me plate;

[0037] Figure 5 (A) activates FTO and ALKBH5 proteins. 6 The fluorescence signal ratio of A-modified Dz-Me, Dz-Me was treated with 100 nM FTO and 100 nM ALKBH5 protein, respectively; Figure 5 (B) activates FTO and ALKBH5 proteins. 6 A gel electrophoresis experiment of modified Dz-Me was conducted. The Dz-Me probe was treated with different FTO and ALKBH5 proteins and reacted with substrate S1. The activity of Dz was determined by the amount of substrate S1 cleaved.

[0038] Figure 6 (A) is m 6 A blocked Dz-Me analysis was used to study the fluorescence kinetics of FTO protein at different concentrations (a: 0 nM, b: 2 nM, c: 5 nM, d: 10 nM, e: 20 nM, f: 50 nM, g: 100 nM, h: 200 nM). Figure 6 (B) is m 6 A blocked Dz-Me assay was used to analyze the fluorescence changes of different concentrations of FTO protein. Inset: Linear curve of FTO protein detection in the system; Figure 6 (C)m 6The responsiveness of blocked Dz-Me to different proteins in cells; Figure 6 (D)m 6 The responsiveness of a blocked Dz-Me to different small molecules in cells;

[0039] Figure 7 (A) is m 6 A blocked Dz-Me assay was used to detect the inhibition curves of different FTO inhibitors (entacapone, meclofenamic acid, rhein, and isoniazid); Figure 7 (B) shows the chemical structure of the FTO small molecule inhibitor and the IC50 value derived from the inhibition curve in (A). 50 value;

[0040] Figure 8 (A) is a schematic diagram of Dz-Me and substrate S1 probe monitoring intracellular FTO protein; Figure 8 (B) CLSM plot of intracellular FTO for Dz-Me and substrate S1 probe analysis: where, a: S1 alone enters breast cancer (MCF-7) cells; b: m 6 A: Modified variant inactivates Dz(m-17E-Me) and substrate S1, entering MCF-7 cells; c: Dz-Me and substrate S1 enter MCF-7 cells; d: Dz-Me and substrate S1 enter MCF-7 cells after siRNA knockdown of FTO protein; e: Dz-Me and substrate S1 enter MCF-7 cells after plasmid overexpression of FTO protein; f: Dz-Me and substrate S1 enter normal mammary cells (MCF-10A). Scale bar is 20 μm. Figure 8 (C) Western blot experiments were used to verify the downregulation (siRNA-treated cells) and upregulation (plasmid-treated cells) of FTO protein in MCF-7 cells. GAPDH was used as an internal control protein. Dz-Me and substrate S1 were used to analyze the flow cytometry fluorescence signals of MCF-7 cells with different FTO expression levels (FTO protein downregulation: siFTO-treated cells were experimental group, siCtrl-treated cells were control group; FTO protein upregulation: pFTO-treated cells were experimental group, pCtrl-treated cells were control group). (D) The distribution of FAM fluorescence signals obtained by analyzing the cells in (B) using ImageJ software.

[0041] Figure 9 (A) is a schematic diagram of gene regulation triggered by the activation of the Dz-Me probe by the intracellular FTO protein; Figure 9 (B) CLSM diagram of intracellular FTO in MCF-7 live cells analyzed by Dz-Me and substrate hairpin S2 probe: where, a: substrate S2 enters the cell alone; b: m 6A: Modified variant Dz(m-17E-Me) and substrate S2 enter the cell; c: Dz-Me and substrate S2 enter the cell. Scale bar is 20 μm. Figure 9 (C) Western blot analysis of FTO activation by the Dz-Me / S2 probe downregulating FTO protein levels and the inability of FTO to activate m-17E-Me (m 6 Comparison of FTO protein content between A-modified variants Dz) / S2 and Dz-Me / m-S2 (hairpin S2 mutation); Figure 9 (D) The MTT assay for cell proliferation analysis showed that FTO activation of Dz-Me / S2 downregulates FTO protein, inhibiting cell growth, and FTO cannot activate m-17E-Me (m 6 Comparison of cell growth curves caused by A-modified variants Dz) / S2 and Dz-Me / m-S2 (hairpin S2 mutation); Figure 9 (E) Live / dead cell staining assays were used to analyze the effects of FTO activation by Dz-Me / S2 downregulation of FTO protein promoting cell death and FTO failure to activate m-17E-Me (m 6 A comparison of cell death caused by A-modified variants Dz / S2 and Dz-Me / m-S2 (hairpin S2 mutation). Scale bar: 200 μm; Figure 9 (F) Flow cytometry analysis using an apoptosis kit showed that FTO activation of Dz-Me / S2 downregulated FTO protein promoted apoptosis, and FTO failed to activate m-17E-Me (m 6 A comparison of the number of apoptotic cells caused by the A-modified variants Dz) / S2 and Dz-Me / m-S2 (hairpin S2 mutation). Detailed Implementation

[0042] The present invention will be explained below with reference to embodiments and comparative examples. Those skilled in the art will understand that the following embodiments and comparative examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Unless otherwise specified, the methods used are conventional methods known in the art, and the consumables and reagents used are commercially available unless otherwise specified. Unless otherwise stated, the technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be applied to the present invention.

[0043] Example 1: Design and preparation of DNA probes, substrate S1, substrate S2, and substrate S3

[0044] Design and preparation of DNA probes, substrates S1, S2, and S3: The relevant DNA probes and substrates were designed using NUPACK software, and the relevant nucleic acid sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and Baori Biotechnology Co., Ltd. The sequences are shown in Table 1. All DNA probe powders were first dissolved in enzyme-free water, and then their absorbance was measured using a UV spectrophotometer to calculate the accurate concentration. All reactions were carried out in HEPES buffer (50 mM, pH 7.0, containing 283 μM (NH4)2Fe(SO4)2, 300 μM α-KG, 2 mM L-ascorbic acid, 50 μg / mL BSA, and 0.1 mM ZnCl2).

[0045] Figure 1 (1) is m 6 A demethylase activates m 6 A schematic diagram of a closed Dz-Me.

[0046] Table 1. DNA probes and substrates used in the system

[0047]

[0048] Example 2:

[0049] FTO protein and Dz-Me (100 nM) were first mixed in HEPES buffer and incubated at 25 °C for 2 h. Then, this mixture was mixed with substrate S1 (1 μM), and EDTA was added at different reaction times to terminate the shearing (17E-Me + FTO experimental group). As a control, Dz-Me (100 nM) was incubated at 25 °C for 2 h, then mixed with substrate S1 (1 μM), and EDTA was added at different reaction times to terminate the shearing (17E-Me control group). Polyacrylamide gel electrophoresis was used to analyze the Dz shearing activity of the blocked and activated (17E-Me control group and 17E-Me + FTO experimental group). The results are as follows: Figure 2 As shown. Figure 2 (B) represents m in the polyacrylamide gel electrophoresis experiment. 6 Comparison of cleavage activity between Dz-Me (17E-Me+FTO experimental group) activated by demethylase (FTO protein) and untreated Dz-Me (17E-Me control group); Figure 2 (C)m 6 Comparison of reaction kinetics between Dz-Me activated by demethylase A (FTO protein) and untreated Dz-Me. Figure 2 (B) and Figure 2 (C) It can be seen that m 6 The cleavage activity of A-modified Dz-Me was completely blocked, while FTO-demethylated Dz-Me restored its high cleavage activity.Figure 2 (A) is m 6 A schematic diagram of the fluorescence signal output from the Dz-Me cleavage substrate activated by A demethylase.

[0050] Example 3

[0051] FTO protein and ED5-Me (100 nM) were first mixed in HEPES buffer and incubated at 25 °C for 2 h. Then, this mixture was mixed with substrate S3 (1 μM), and EDTA was added at different reaction times to terminate the shearing (ED5-Me + FTO experimental group). As a control, ED5-Me (100 nM) was incubated at 25 °C for 2 h, then mixed with substrate S3 (1 μM), and EDTA was added at different reaction times to terminate the shearing (ED5-Me control group). The Dz shearing activity of the blocked and activated (ED5-Me control group and ED5-Me + FTO experimental group) samples was analyzed using polyacrylamide gel electrophoresis. The results are as follows: Figure 3 As shown. Similarly, m 6 The activity of A-modified ED5-Me was also completely inhibited (see...). Figure 3 ). Figure 3 (B) represents m in the polyacrylamide gel electrophoresis experiment. 6 Comparison of cleavage activity between ED5-Me activated by demethylase (FTO protein) (ED5-Me+FTO experimental group) and untreated ED5-Me (ED5-Me control group); Figure 3 (C) is m 6 A comparison of the reaction kinetics of ED5-Me activated by demethylase A (FTO protein) and untreated ED5-Me. Figure 3 (B) and Figure 3 (C) It can be seen that m 6 The cleavage activity of A-modified ED5-Me was completely blocked, while FTO-demethylated ED5-Me restored its high cleavage activity. Figure 3 (A) is m 6 A schematic diagram of the fluorescence signal output by ED5-Me cleavage of substrate activated by A demethylase.

[0052] Example 4

[0053] The original Dz(a) and m were separately added in parallel to HEPES buffer. 6 A. Closed and inactivated Dz-Me(b), m 6 A closed Dz-Me is treated with FTO (c), m 6 A closed Dz-Me was treated with inactivated FTO (d), m 6The blocked variant Dz was treated with FTO (e) and incubated at 25°C for 2 h. Then, the above five groups of substances were mixed with substrate S1 (1 μM), and the fluorescence intensity was detected at different reaction times. Analysis was performed using a fluorescence spectrometer, and the results are as follows: Figure 4 As shown in (B), the original Dz (curve a) reacts with substrate S1 to produce a significant fluorescence signal, while m 6 The fluorescence signal produced by the reaction of the closed Dz-Me (curve b) with substrate S1 is consistent with the background signal, indicating that m 6 Modification A can completely block the original Dz activity. Furthermore, inactivating the FTO protein (curve c) or replacing the original m with a mutant inactivated Dz (m-Dz) (curve d) (altering two bases at the catalytic center) can also be achieved. 6 A-modified Dz cannot produce a significant fluorescence signal; only when the original m is also present... 6 A significant fluorescent signal can only be generated when Dz-Me and FTO proteins are modified with A.

[0054] Similarly, experiments have shown (see...) Figure 5 This Dz-Me can also be used by another type of m 6 Activation of the A demethylase ALKBH5 protein; these results indicate m 6 A demethylase can efficiently activate blocked Dz-Me activity.

[0055] Using gel electrophoresis to measure m 6 The cleavage activity of Dz-Me activated by demethylase A was characterized. The reaction solution was prepared as follows: Dz-Me concentration was 100 nM, FTO concentration was 100 nM, and substrate S1 concentration was 1 μM in HEPES buffer. The mixture was reacted at room temperature for 2 h. The reaction solution was then mixed with loading buffer and added to a 15% acrylamide gel. The electrophoresis voltage was set to 100 V, and the gel was removed after 2 h. Finally, the FAM-labeled substrate DNA was visualized using a chemiluminescence imaging system. FTO activation m 6 The gel electrophoresis results of a blocked Dz-Me active cleavage substrate are as follows: Figure 4 As shown in (C), "+" and "-" indicate the presence and absence of the corresponding component, respectively. As can be seen from the figure, in m... 6 A demethylase activates the blocked Dz, which cleaves the substrate S1, producing substrate fragments. This result is consistent with the fluorescence experiment results.

[0056] High performance liquid chromatography was used to analyze m 6Characterization was performed by removing methyl groups from Dz-Me using a demethylase. The reaction solution was prepared as follows: 1 μM Dz-Me and 100 nM or 200 nM FTO were added to 30 μL HEPES buffer, and the mixture was reacted at room temperature for 3 h. The oligonucleotide chain was then degraded into individual nucleotides using nuclease (180 U), phosphodiesterase (0.004 U), and alkaline phosphatase (30 U). The final product was analyzed by high-performance liquid chromatography (HPLC). Results are as follows... Figure 4 As shown in (D), m 6 A demethylase can completely remove the m-modified β-carotene on Dz-Me. 6 A methyl group yields A base.

[0057] The experimental results of Examples 2-4 above prove that m 6 A demethylase activates m 6 The successful construction of the Dz-Me system demonstrates that this modified and blocked Dz can be used for the detection of various target proteins and for the activity regulation of various functional nucleic acids.

[0058] Example 5

[0059] Based on m 6 A closed Dz-Me pair m 6 In vitro detection of A demethylase.

[0060] In HEPES buffer, Dz-Me (50 nM), substrate S1 (250 nM), and different concentrations of FTO protein (0, 2, 5, 10, 20, 50, 100, 200 nM) were mixed and incubated at room temperature for 2 h. The fluorescence intensity of the system was measured using a fluorescence spectrometer (excitation voltage 650 V, excitation slit 5 nm, emission slit 10 nm, excitation wavelength 490 nm, wavelength scanning range 505-650 nm).

[0061] Figure 6 (A) is m 6 A blocked Dz-Me analysis was used to study the fluorescence kinetics of FTO protein at different concentrations (a: 0 nM, b: 2 nM, c: 5 nM, d: 10 nM, e: 20 nM, f: 50 nM, g: 100 nM, h: 200 nM). Figure 6 (B) is m 6 A blocked Dz-Me assay was used to analyze the fluorescence changes of different concentrations of FTO protein. Inset: Linear curve of FTO protein detection in the system; Figure 6 (C) is m 6A. The responsiveness of blocked Dz-Me to different proteins in cells (bovine serum albumin BSA, polynucleotide kinase PNK, bovine intestinal mucosal alkaline phosphatase ALP, thrombin, and uracil DNA glycosylase UDG). Figure 6 (D) is m 6 The responsiveness of a blocked Dz-Me probe to different small molecules in cells (reduced glutathione GSH, hydrogen peroxide H2O2, adenosine triphosphate ATP, glucose).

[0062] Depend on Figure 6 (A) As can be seen, when no target FTO is added to the system, the fluorescence of the system shows only a slight change (curve a). When different concentrations of target FTO are added, the change in fluorescence intensity is positively correlated with the concentration of FTO, which can be used to detect FTO protein. Figure 6 (B) As can be seen, the fluorescence intensity (λ = 520 nm) of the system gradually increases with the increase of the target FTO protein concentration. This change in fluorescence intensity shows a good linear relationship with the target protein concentration in the range of 0-20 nM, and the detection limit is 0.5 nM, achieving the target m 6 Rapid and highly sensitive detection of demethylase A.

[0063] To demonstrate the selectivity of this method for detecting the target FTO within cells, we investigated several intracellular proteins and small molecules. Figure 6 (C) and Figure 6 (D) It can be seen that the system only produces obvious fluorescence signals when it interacts with FTO. The fluorescence changes caused by several common intracellular proteins and small molecules are very small. The above results show that the method of the present invention has good selectivity for target detection in cells.

[0064] Example 6

[0065] Based on m 6 A closed Dz-Me pair m 6 Detection and screening of A demethylase inhibitors.

[0066] In HEPES buffer, Dz-Me (50 nM), substrate S1 (250 nM), FTO protein (100 nM) were mixed with different concentrations of small molecule inhibitors (2, 5, 10, 20, 50, 100, 200 μM) and incubated at room temperature for 2 h. The fluorescence intensity of the system was measured using a fluorescence spectrometer (excitation voltage 650 V, excitation slit 5 nm, emission slit 10 nm, excitation wavelength 490 nm, wavelength scanning range 505-650 nm).

[0067] When small molecule inhibitors are present, m is inhibited. 6The demethylation ability of A-type demethylases is such that Dz-Me cannot be activated, thus substrate S1 cannot be cleaved, resulting in a low fluorescence signal. The fluorescence intensity is negatively correlated with the inhibitor concentration; inhibition curves are obtained based on the intensity of the fluorescence signal. We selected several commonly used m... 6 The detection ability of this Dz-Me probe against demethylase inhibitors (entacapone, meclofenamic acid, and rhein) and non-inhibitors (isonicotinic acid) was investigated. Experimental results are as follows: Figure 7 As shown, by Figure 7 (A) It can be seen that the demethylation ability of FTO decreases with increasing inhibitor concentration, and the IC50 values ​​of the three inhibitors obtained are... 50 The concentrations were 29.1 μM (entacapone), 32.1 μM (meclofenamic acid), and 47.2 μM (rhein), respectively, which are basically consistent with the literature reports. These results indicate that Dz-Me can efficiently detect and screen inhibitors, providing a simple and rapid analytical tool for small molecule drug screening.

[0068] Example 7

[0069] Based on m 6 A blocked Dz-Me affects intracellular m 6 Monitoring of A demethylase.

[0070] Human breast cancer cells (MDA-MB-231, MCF-7) and cervical cancer cells (HeLa) were cultured in DMEM containing 10% fetal bovine serum at 37°C and 5% CO2, while normal human breast cells (MCF-10A) were cultured in a dedicated complete culture medium. Cells were seeded into 20 mm glass-bottom confocal dishes and grown for 12 h before transfection with nucleic acid probes. The detailed procedure was as follows: a mixture of Dz-Me (0.025 nmol) and substrate S1 (0.1 nmol) was dispersed in 200 μL of Opti-MEM medium, and 4 μL of Lipo 3000 was dispersed in another 200 μL of Opti-MEM medium. The two mixtures were then thoroughly mixed and incubated at room temperature for 10 min. The final mixture was then dropped into confocal dishes containing cells and incubated at 37°C for 3 h. The cells were subsequently washed three times with PBS and imaged using a laser confocal scanning microscope (CLSM). For the experiment of downregulating cellular FTO protein by siRNA treatment, siRNA (final concentration of 100 nM) was first transfected into MCF-7 cells and incubated for 48 h, and then the Dz-Me / S1 probe was transfected and incubated for 3 h. The cells were then imaged using a confocal microscope. For the experiment of upregulating cellular FTO protein by plasmid treatment, the plasmid was first transfected into MCF-7 cells and incubated for 48 h, and then the Dz-Me / S1 probe was transfected and incubated for 3 h. The cells were then imaged using a confocal microscope.

[0071] Depend on Figure 8 (B) As can be seen, a significant fluorescence signal was observed in MCF-7 cells transfected with the Dz-Me / S1 probe (sample c), while transfection with S1 alone or m-Dz-Me (m 6 The modified Dz / S1 probe showed almost no fluorescence signal in MCF-7 cells (samples a and b), while a weak fluorescence signal was observed in normal breast cells (MCF-10A) (sample f). This indicates that the Dz-Me probe can be activated by the highly expressed FTO protein in tumor cells after entering the cells, cleaving the substrate S1 to generate a fluorescence signal. Furthermore, the fluorescence intensity after the nucleic acid probe enters the cells indicates that the expression level of FTO protein in tumor cells is higher than that in normal cells, which is consistent with previous reports. These results suggest that the Dz-Me imaging system can distinguish between normal and tumor cells by determining the difference in FTO protein expression based on the intensity of the fluorescence signal. Furthermore, MCF-7 cells with pre-regulated FTO protein using siRNA showed a significantly reduced fluorescence signal (sample d, compared to sample c), while MCF-7 cells with pre-regulated FTO protein using plasmid showed a significantly enhanced fluorescence signal (sample e, compared to sample c). This indicates that FTO protein is indeed present in MCF-7 cells and activates the Dz-Me probe, demonstrating that this Dz-Me imaging system can also monitor different FTO levels in cells, revealing the m 6 A blocked Dz-Me probe improves the accuracy and sensitivity of FTO protein detection in cells. We used ImageJ to collect... Figure 8 (B) Fluorescence signal of each pixel in the cell image, and the resulting scatter plot of the corresponding fluorescence signal distribution. Figure 8 (D) further demonstrates that the Dz-Me probe possesses powerful intracellular bioimaging capabilities. Meanwhile, as... Figure 8 As shown in (C), we collected 10,000 cells using flow cytometry and analyzed the fluorescence intensity of MCF-7 cells with different FTO expression levels. Cells with FTO protein downregulated by siRNA showed significantly reduced fluorescence, while cells with FTO protein upregulated by plasmid pFTO showed significantly increased fluorescence. This result is consistent with... Figure 8 (B) The results of fluorescence imaging are consistent. The above results indicate that the Dz-Me probe successfully achieved in-situ detection of FTO protein in different living cells.

[0072] Example 8

[0073] Based on m 6 A blocked Dz-Me affects intracellular m 6 Monitoring and gene regulation of A demethylases.

[0074] Cells were seeded into 20 mm glass-bottomed confocal dishes or plates and grown for 12 h, followed by transfection with Dz-Me and substrate S2 probe. The detailed procedure is as follows: a mixture of Dz-Me (0.025 nmol) and substrate S2 (0.1 nmol) was dispersed in 200 μL of Opti-MEM medium, and 4 μL of Lipo 3000 was dispersed in another 200 μL of Opti-MEM medium. The two mixtures were then thoroughly mixed and incubated at room temperature for 10 min. The resulting mixture was then dropped into confocal dishes containing cells and incubated at 37 °C for 3 h. The cells were subsequently washed three times with PBS and imaged using a laser confocal scanning microscope. Figure 9 As shown in (B), only cells transfected with the Dz-Me / S2 probe can produce a significant fluorescent signal (sample c), while cells transfected with the S2 substrate alone (sample a) and m... 6 Neither the modified Dz(m-17E-Me) nor substrate S2 (sample b) produced a fluorescent signal upon entering the cells, demonstrating that the newly designed hairpin substrate S2, like substrate S1, can be used to monitor FTO protein in tumor cells. To verify that Dz-Me, upon activation by FTO in cells, cleaves substrate S2 to release antisense nucleic acid, thus knocking down FTO protein in cells, we seeded cells in 12-well plates, transfected them with Dz-Me and substrate S2, and after 36 hours, collected the cells and lysed them with RIPA buffer to obtain the cellular protein. Western blot analysis was then used to display the FTO protein content in the cells. Figure 9 (C) shows that FTO protein expression is reduced in cells transfected with Dz-Me and substrate S2, while m-17E-Me (m 6 Cells transfected with the A-modified variant Dz / S2 and the Dz-Me / m-S2 (hairpin S2 mutation) had no effect on FTO protein levels. Finally, to verify that FTO protein activation of Dz-Me leading to downregulation of FTO protein in cells inhibits tumor cell growth and promotes tumor cell death, [further details needed]. Figure 9 As shown in (D)-9(F), our MTT assay, live / dead cell staining, and flow cytometry apoptosis assay revealed that cells transfected with Dz-Me and substrate S2 grew significantly slower. Figure 9 (D) shows the blue growth curve) and the cells show obvious death / apoptosis. Figure 9 (E) and Figure 9 (F)); while m-17E-Me(m 6Cells treated with the A-modified variant Dz / S2 and the Dz-Me / m-S2 (hairpin S2 mutation) as control groups showed no effect on cell growth or apoptosis. This demonstrates that the highly expressed FTO protein in tumor cells can activate Dz-Me, leading to a downregulation of intracellular FTO protein levels, thereby altering the growth state of tumor cells, inhibiting their growth, and promoting apoptosis. Therefore, we have constructed a novel intelligent, imaging-guided approach to tumor cell therapy. Compared to directly delivered gene drugs, this on-demand delivery method improves the accuracy and effectiveness of gene therapy and reduces the toxic side effects of traditional gene therapy.

[0075] The m 6 The closed Dz system, as a universal, simple, and reliable sensing strategy, can be used for the efficient detection of various nucleic acid (de)modified proteins. It can also be extended to the activity regulation of various functional nucleic acids, and has broad application prospects in small molecule drug screening, clinical diagnosis, and prognosis.

[0076] Although embodiments and comparative examples of the present invention have been shown and described above, it is to be understood that the above embodiments and comparative examples are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. sequence list <110> Wuhan University <120> A deoxyribozyme molecular probe and its application <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 8 <212> DNA <213> Artificial Sequence <400> 1 atctctcc 8 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <400> 2 atagtggcca 10 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <400> 3 tccgagccgg tcgaa 15 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <400> 4 tggccactat 10 <210> 5 <211> 9 <212> DNA <213> Artificial Sequence <400> 5 gggagagat 9 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <400> 6 gggagagatg tgttaa 16 <210> 7 <211> 14 <212> DNA <213> Artificial Sequence <400> 7 aacacatctc tccc 14 <210> 8 <211> 9 <212> DNA <213> Artificial Sequence <400> 8 ccgcggcca 9 <210> 9 <211> 9 <212> DNA <213> Artificial Sequence <400> 9 cctggacga 9 <210> 10 <211> 15 <212> DNA <213> Artificial Sequence <400> 10 ggctagctac aacga 15 <210> 11 <211> 9 <212> DNA <213> Artificial Sequence <400> 11 tcgtccagg 9 <210> 12 <211> 9 <212> DNA / RNA <213> Artificial Sequence <400> 12 uggccgcgg 9

Claims

1. A deoxyribozyme molecular probe, characterized in that, The sequence of the deoxyribonuclease molecular probe is ATCTCTCCTCCGAGCCGGTCGAAATAGTGGCCA; the modified sequence of the deoxyribonuclease molecular probe is ATCTCTCCTCCGA. Me GCCGGTCGAAATAGTGGCCA.

2. A deoxyribozyme molecular probe, characterized in that, The sequence of the deoxyribonuclease molecular probe is CCGCGGCCAGGCTAGCTACAACGACCTGGACGA; the modified sequence of the deoxyribonuclease molecular probe is CCGCGGCCAGGCTA. Me GCTACAACGACCTGGACGA.

3. A reagent kit, characterized in that, It includes the deoxyribozyme molecular probe of claim 1 and substrate S1, wherein the sequence of substrate S1 is FAM-TGGCCACTAT rA GGGAGAGAT-BHQ.

4. A reagent kit, characterized in that, It includes the deoxyribozyme molecular probe of claim 2 and substrate S3, wherein the sequence of substrate S3 is FAM-TCGTCCAGG rA UGGCCGCGG-BHQ.

5. A reagent kit, characterized in that, The invention includes the deoxyribozyme molecular probe of claim 1 and substrate S2, wherein the sequence of substrate S2 is FAM-GGGAGAGATGTGTTAATGGCCACTAT rA GGGAGAGATAACACATCTCTCCC-BHQ.

6. A deoxyribozyme molecular probe according to claim 1 or 2 in the preparation of a probe for detecting m 6 Application in reagents for detecting A demethylase activity.

7. A deoxyribozyme molecular probe according to claim 1 or 2 in the preparation of a probe for screening m 6 Application in the detection reagents for A demethylase inhibitor drugs.

8. A kit according to any one of claims 3 to 5 for preparing and detecting m 6 Application in reagents for detecting A demethylase activity.

9. A kit according to any one of claims 3 to 5 for preparing screening m 6 Application in the detection reagents for A demethylase inhibitor drugs.

Images