Gene editing system for constructing OCA-1A albinism model pig nuclear transfer donor cells and its application
Gene editing in pig cells through CRISPR/Cas9 technology and ssODN homologous recombination technology was carried out to construct OCA-1A albinism model pigs, which solved the problem that existing animal models could not truly simulate human physiological pathology, improved the single-cell cloning ratio of target site mutations, simplified the production of model pigs, and provided effective experimental tools.
Patent Information
- Application Number
- CN202110774036.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-08
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2041-07-08
AI Technical Summary
Existing animal models, such as mice, are unable to truly simulate human physiological and pathological status, resulting in difficulties in studying the pathogenesis and drug development of OCA-1A type albinism.
CRISPR/Cas9 technology combined with ssODN homologous recombination technology, and co-transfected pig cells, using TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN proteins for gene editing to construct nuclear transplant donor cells of pigs with OCA-1A type albinism model.
The OCA-1A albinism model pig was successfully constructed, which increased the single-cell cloning ratio of point mutations in the target site, simplified the production cycle of the model pig, and provided effective experimental tools for studying the pathogenesis and drug development of OCA-1A albinism.
Smart Images

Figure BDA0003153653530000161 
Figure BDA0003153653530000171 
Figure HDA0003153653540000011
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically to a gene editing system for constructing OCA-1A albinism model pig nuclear transplantation donor cells based on the CRISPR / Cas9 system and ssODN homologous recombination technology and its application. Background Art
[0002] Gene editing is a biotechnology that has made significant progress in recent years. It encompasses technologies ranging from homologous recombination-based gene editing to nuclease-based editing techniques such as ZFNs, TALENs, and CRISPR / Cas9. CRISPR / Cas9 is currently the most advanced gene editing technology. Currently, gene editing technology is increasingly being applied to the creation of animal models.
[0003] Homologous recombination (HDR) is the exchange of DNA sequence information through sequence homology: the repair template contains the desired insert, and the ends of the repair template are recombination arms with sequence homology near the insertion site. Double-stranded DNA (dsDNA) was commonly used as a repair template in the past, but recent studies have revealed the advantages of single-stranded oligodeoxynucleotides (ssODNs) as donor templates for HDR. First, ssODNs as donor templates have higher insertion site specificity than dsDNA templates, which are prone to random insertions. Second, ssODNs require shorter homologous recombination arms than dsDNA templates. Designing recombination arms of 30-60 bases on each side can achieve efficient and stable HDR, providing higher insertion efficiency than similar dsDNA templates. Third, dsDNA is easily incorporated by the NHEJ repair pathway, resulting in duplication of homology arms or partial integration of the dsDNA template, while ssODNs are less susceptible to this phenomenon. In addition, dsDNAs are harmful to cultured cells. The transfection efficiency of linear or plasmid dsDNAs is low and they can cause adverse reactions in cells. ssODN templates have more advantages in these aspects.
[0004] Albinism is a general term for a variety of genetic disorders caused by reduced or deficient melanin synthesis, primarily manifested by hypopigmentation of the skin, hair, and eyes. Mutations in various genes can lead to albinism symptoms. Albinism can be divided into non-syndromic and syndromic categories based on the location of pigment loss and the presence or absence of other systemic abnormalities. Non-syndromic albinism can be further divided into ocular albinism (OA), which is a condition characterized by pigment loss only in the eyes, and oculocutaneous albinism (OCA), which is a condition characterized by pigment loss in the skin, hair, and eyes (i.e., systemic symptoms).
[0005] OCA is an autosomal recessive disorder characterized by decreased or absent melanin pigmentation in the eyes, skin, and hair. Over 90% of individuals with albinism have OCA, which is generally caused by mutations in genes involved in melanin synthesis or transport. The main clinical manifestations are generalized hypopigmentation, ocular changes including foveal hypoplasia, refractive error, poor vision, photophobia, iris translucency, nystagmus, hypopigmentation of the fundus, and abnormalities in the optic fiber pathway. In recent years, OCA has been classified based on the gene involved: mutations in the tyrosinase gene (TYR) cause OCA1, mutations in the OCA2 gene (formerly known as the P gene) cause OCA2, mutations in the tyrosinase-related protein-1 gene (TYRP1) cause OCA3, and mutations in the SLC45A2 gene (formerly known as MATP or AIM1) cause OCA4.
[0006] OCA-1, which accounts for approximately 40-50% of OCA cases, is caused by mutations in the TYR gene that disable the enzyme it encodes, tyrosinase. Research has shown that OCA-1 can be divided into two types: OCA-1A and OCA-1B, depending on whether tyrosinase activity is completely lost. OCA-1A, the most severe type, exhibits complete loss of tyrosinase activity, leading to a complete loss of skin and eye pigmentation and a reduction in visual acuity to 5%. In OCA-1B, tyrosinase activity is significantly decreased, but not completely lost. Skin, hair, and eye pigmentation may increase with age, and patients may tan.
[0007] Research into the pathogenesis and progression of OCA-1 caused by TYR mutations, as well as the development of corresponding drugs, requires animal models. Currently, mice are the most commonly used animal model. However, mice differ significantly from humans in terms of body shape, organ size, physiology, and pathology, and cannot accurately simulate normal human physiological and pathological conditions. Pigs, as large animals, have long been a primary source of meat for humans. Their size and physiological functions are similar to those of humans, making them easy to breed and raise on a large scale. Furthermore, they offer lower ethical and animal protection requirements, making them ideal animal models for human diseases. Summary of the Invention
[0008] The purpose of the present invention is to provide a gene editing system for constructing OCA-1A albinism model pig nuclear transplantation donor cells and its application.
[0009] The present invention provides a method for preparing a recombinant cell, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA of a pig cell with the DNA molecule shown in SEQ ID NO: 18 to obtain a recombinant cell.
[0010] The DNA molecule shown in SEQ ID NO: 18 is used to replace the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA of pig cells by co-transfecting TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein into pig cells.
[0011] The co-transfection specifically adopts the method of electric shock transfection.
[0012] The parameters for electroporation can be set as follows: 1450V, 10ms, 3 pulses.
[0013] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.
[0014] The present invention also provides the use of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein in preparing a kit.
[0015] The present invention also provides the use of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and PRONCN protein in preparing a kit.
[0016] The present invention also provides the use of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and a specific plasmid in preparing a kit.
[0017] The present invention also provides a kit comprising TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein.
[0018] The present invention also provides a kit comprising TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and PRONCN protein.
[0019] The present invention also provides a kit comprising TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and a specific plasmid.
[0020] Any of the above kits further comprises pig cells.
[0021] The use of any of the above kits is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing albino pig models; (c) preparing albino cell models, albino tissue models or albino organ models.
[0022] The ratios of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein are: 0.8-1.2μg TYR-gRNA1: 0.8-1.2μg TYR-gRNA2: 1.8-2.2μg TYR-E1mut-ss126: 3-5μg NCN protein.
[0023] The ratios of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein are: 1 μg TYR-gRNA1: 1 μg TYR-gRNA2: 2 μg TYR-E1mut-ss126: 4 μg NCN protein.
[0024] The ratios of pig cells, TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein are as follows: 100,000 pig cells: 0.8-1.2μg TYR-gRNA1: 0.8-1.2μg TYR-gRNA2: 1.8-2.2μg TYR-E1mut-ss126: 3-5μg NCN protein.
[0025] The ratios of pig cells, TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein are as follows: 100,000 pig cells: 1 μg TYR-gRNA1: 1 μg TYR-gRNA2: 2 μg TYR-E1mut-ss126: 4 μg NCN protein.
[0026] Any of the above TYR-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16.
[0027] Any of the above TYR-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 17.
[0028] Any of the above TYR-E1mut-ss126 is a single-stranded DNA molecule shown in SEQ ID NO: 18.
[0029] Any of the above-mentioned NCN proteins is a Cas9 protein or a fusion protein with a Cas9 protein.
[0030] Specifically, the NCN protein is shown in SEQ ID NO: 3.
[0031] Specifically, the TYR-gRNA1 is shown in SEQ ID NO: 16.
[0032] Specifically, the TYR-gRNA2 is shown in SEQ ID NO: 17.
[0033] Specifically, the TYR-gRNA1 is shown in SEQ ID NO: 10.
[0034] Specifically, the TYR-gRNA2 is shown in SEQ ID NO: 11.
[0035] Any of the above pig cells is a pig fibroblast.
[0036] Any of the above pig cells is a primary pig fibroblast.
[0037] The preparation method of the NCN protein comprises the following steps:
[0038] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria;
[0039] (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria;
[0040] (3) crushing the collected bacteria and collecting the crude protein solution;
[0041] (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography;
[0042] (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein;
[0043] Plasmid pKG-GE4 contains the fusion gene represented by nucleotides 5209 to 9852 in SEQ ID NO: 1.
[0044] The preparation method of the NCN protein specifically comprises the following steps:
[0045] (1) The plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.
[0046] (2) inoculating the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culturing with shaking;
[0047] (3) The bacterial solution obtained in step (2) was inoculated into liquid LB medium and cultured at 30°C and 230 rpm until the OD 600nmvalue = 1.0, then IPTG was added to make its concentration in the system 0.5 mM, and then cultured with shaking at 25°C and 230 rpm for 12 hours, and then the bacteria were collected by centrifugation;
[0048] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;
[0049] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then crush the bacterial cells, collect the supernatant by centrifugation, filter with a 0.22 μm pore size filter membrane, and collect the filtrate;
[0050] (6) Purifying the His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) from the filtrate obtained in step (5) by affinity chromatography;
[0051] (7) The column solution collected in step (6) was concentrated using an ultrafiltration tube and then diluted with 25 mM Tris-HCl (pH 8.0);
[0052] (8) adding recombinant bovine enterokinase with a His6 tag to the solution obtained in step (7) and performing enzymatic digestion;
[0053] (9) Mixing the solution obtained in step (8) with Ni-NTA resin, incubating, and then centrifuging to collect the supernatant;
[0054] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube and then added to the enzyme storage solution to obtain the NCN protein solution.
[0055] The specific method for purifying the fusion protein with the His6 tag from the filtrate obtained in step (5) by affinity chromatography is as follows:
[0056] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0057] Any of the above PRONCN proteins includes the following elements from upstream to downstream: a signal peptide, a molecular chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, and a nuclear localization signal.
[0058] The function of the signal peptide is to promote protein secretion and expression. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, the Staphylococcus aureus protein A signal peptide, the Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretion and expression of the target protein into the bacterial periplasm, thereby separating it from the bacterial intracellular proteins. The target protein secreted into the bacterial periplasm is expressed as a soluble protein and can be cleaved by the signal peptidase in the bacterial periplasm.
[0059] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably thioredoxin (TrxA protein). Thioredoxin can act as a molecular chaperone to help the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improve protein stability, correct folding, and increase the solubility and activity of the target protein.
[0060] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, more preferably a His tag. The His tag can bind to a Ni column, allowing the target protein to be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein.
[0061] The function of the protease cleavage site is to be used to remove the non-functional segment after purification to release the natural form of Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease or any other endoprotease, and enterokinase is further preferred. EK is an enterokinase cleavage site, which is convenient for using enterokinase to remove the fused TrxA-His segment to obtain the natural form of Cas9 protein. After the commercial enterokinase with a His tag is used to cut the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one affinity chromatography to obtain the natural form of Cas9 protein, thereby avoiding the damage and loss of the target protein caused by multiple purification and dialysis.
[0062] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. NLS is a nuclear localization signal, and an NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, to enable Cas9 to more effectively enter the cell nucleus for gene editing.
[0063] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.
[0064] The PRONCN protein is specifically shown in SEQ ID NO: 2.
[0065] Any of the above-mentioned specific plasmids includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a gene encoding PRONCN protein, and a terminator.
[0066] The promoter may specifically be a T7 promoter, which is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.
[0067] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, IPTG can be used to induce expression of the target protein at low temperatures. This can prevent the impact of premature expression of the target protein on host bacterial growth. Inducing expression at low temperatures also significantly improves the solubility of the expressed target protein.
[0068] The ribosome binding site is a ribosome binding site during protein translation and is necessary for protein translation.
[0069] The terminator may specifically be a T7 terminator, which can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.
[0070] For the codons of the spCas9 protein, this application has optimized its codons to make it fully adapt to the codon preference of the Escherichia coli high-efficiency expression strain E. coli BL21 (DE3) selected in this application, thereby improving the expression level of the Cas9 protein.
[0071] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.
[0072] The Lac operon is shown in nucleotides 5140 to 5164 of SEQ ID NO: 1.
[0073] The ribosome binding site is shown in nucleotides 5178 to 5201 of SEQ ID NO: 1.
[0074] The coding sequence of the alkaline phosphatase signal peptide is shown in nucleotides 5209 to 5271 in SEQ ID NO: 1.
[0075] The coding sequence of the TrxA protein is shown in nucleotides 5272-5598 in SEQ ID NO: 1.
[0076] The coding sequence of His-Tag is shown in nucleotides 5620-5637 in SEQ ID NO: 1.
[0077] The coding sequence of the enterokinase cleavage site is shown in nucleotides 5638 to 5652 in SEQ ID NO: 1.
[0078] The coding sequence of the nuclear localization signal is shown in nucleotides 5656-5670 of SEQ ID NO: 1.
[0079] The coding sequence of the spCas9 protein is shown in nucleotides 5701-9801 in SEQ ID NO: 1.
[0080] The coding sequence of the nuclear localization signal is shown in nucleotides 9802-9849 of SEQ ID NO: 1.
[0081] The T7 terminator is represented by nucleotides 9902 to 9949 in SEQ ID NO: 1.
[0082] Specifically, the specific plasmid is plasmid pKG-GE4.
[0083] Plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121 to 9949 in SEQ ID NO: 1.
[0084] Specifically, any one of the above plasmids pKG-GE4 is shown as SEQ ID NO: 1.
[0085] The present invention also protects the recombinant cells prepared by any of the above methods.
[0086] The present invention also protects the use of the recombinant cell in preparing an albino pig model.
[0087] The recombinant cells are used as nuclear transplant donor cells for somatic cell cloning to obtain cloned pigs, i.e., albino model pigs.
[0088] The present invention also protects the pig tissue of the model pig prepared by using the recombinant cells, that is, the albinism tissue model.
[0089] The present invention also protects pig organs of model pigs prepared using the recombinant cells, namely, an albinism organ model.
[0090] The present invention also protects pig cells of a model pig prepared using the recombinant cells, namely, an albino cell model.
[0091] The present invention also protects the use of the recombinant cell, the albinism tissue model, the albinism organ model, the albinism cell model, or the albinism model pig, which is as follows (d1) or (d2) or (d3) or (d4):
[0092] (d1) Screening for drugs to treat albinism;
[0093] (d2) Conduct efficacy evaluation of drugs for albinism;
[0094] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for albinism;
[0095] (d4) Study the pathogenesis of albinism.
[0096] Any of the above-mentioned pigs can specifically be Congjiang Xiang pigs.
[0097] Any of the above albinisms may be OCA-1 albinism.
[0098] Any of the above albinisms may be OCA-1A albinism.
[0099] OCA-1A albinism is caused by the following mutation in the TYR gene: R77L mutation in the TYR gene.
[0100] Porcine TYR gene information: Encodes tyrosinase; located on chromosome 9; Gene ID 407745, Sus scrofa. The amino acid sequence encoded by the porcine TYR gene is shown in SEQ ID NO: 8. The porcine TYR gene has the DNA segment shown in SEQ ID NO: 9.
[0101] Compared with the prior art, the present invention has at least the following beneficial effects:
[0102] (1) The research object of the present invention (pig) has better applicability than other animals (rat, mouse, and primate).
[0103] Rodents such as mice and rats differ significantly from humans in terms of body shape, organ size, physiology, and pathology, making them unable to truly simulate normal human physiological and pathological conditions. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but their small size, late sexual maturity (mating begins at 6-7 years old), and single-birth primates make population expansion extremely slow and their breeding costs very high. Furthermore, primate cloning is inefficient, difficult, and costly.
[0104] Pigs, however, do not have these drawbacks as model animals. They are the closest relative to humans besides primates, with body shape, weight, and organ size similar to humans. Their anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis are highly similar to humans. Furthermore, pigs reach sexual maturity early (4-6 months), have high fertility, and can produce many offspring per litter, allowing them to form a large population within 2-3 years. Furthermore, pig cloning technology is highly mature, and the costs of cloning and rearing pigs are much lower than those of primates. Therefore, pigs are highly suitable as models for human diseases.
[0105] (2) The vector constructed by the invention uses a strong promoter T7-lac that can efficiently express the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic protein alkaline phosphatase (phoA) to guide the secretion and expression of the target protein into the bacterial periplasmic cavity, thereby separating it from the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble. At the same time, the thioredoxin protein TrxA is fused with the Cas9 protein for expression. TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein. At the same time, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment to obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by His-tagged enterokinase, the TrxA-His polypeptide fragment and His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of the Cas9 protein, avoiding damage and loss to the target protein caused by multiple purification and dialysis. At the same time, the present invention also designs an NLS site at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the cell nucleus for gene editing. In addition, the present invention selects the E. coli BL21 (DE3) strain as the target protein expression strain. This strain can efficiently express exogenous genes cloned in an expression vector containing a bacteriophage T7 promoter (such as pET-32a). At the same time, the present invention performs codon optimization on the codons of the Cas9 protein to fully adapt to the codon preference of the expression strain, thereby improving the expression level of the target protein. In addition, after the bacteria grow to a certain number, the present invention uses IPTG to induce the expression of the target protein at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Inducing expression at low temperature also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization designs and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with the commercial Cas9 protein.
[0106] (3) The Cas9 high-efficiency protein constructed and expressed by the present invention was combined with in vitro transcribed gRNA for gene editing, and the optimal dosage ratio of Cas9 and gRNA was optimized. In combination with synthetic ssODN as donor DNA, the single-cell clone rate of target site point mutation was as high as 18.75%, which is much higher than the conventional point mutation efficiency (<5%).
[0107] (4) Using the target gene point mutation single-cell clone obtained by the present invention to perform somatic cell nuclear transplantation animal cloning can directly obtain cloned pigs containing target site mutations, and the mutation can be stably inherited.
[0108] The method used in mouse model creation involves microinjecting gene-edited materials into fertilized eggs and then performing embryo transplantation. However, the probability of directly obtaining offspring with point mutations is very low (less than 1%), requiring hybridization and selection of offspring. This is not suitable for model creation in large animals (such as pigs) with long gestation periods. Therefore, the present invention uses a technically difficult and challenging method of in vitro editing of primary cells and ssODN homologous recombination and screening for positively edited single-cell clones. Later, somatic cell nuclear transfer animal cloning technology is used to directly obtain the corresponding disease model pigs. This can greatly shorten the model pig production cycle and save manpower, material, and financial resources.
[0109] This study used CRISPR / Cas9 technology combined with ssODN homologous recombination to perform site-directed mutagenesis of the TYR gene, mimicking the naturally occurring genetic characteristics of OCA-1A albinism. Single-cell clones carrying the TYR gene point mutation were generated, laying the foundation for the development of an OCA-1A albinism model pig using somatic cell nuclear transfer (SCNT) animal cloning technology. This model pig will provide a powerful experimental tool for studying the pathogenesis of OCA-1A albinism and developing drugs.
[0110] This invention lays a solid foundation for creating an OCA-1A albinism pig model with a TYR gene point mutation through gene editing. It will help study and reveal the pathogenesis of OCA-1A albinism caused by TYR gene point mutations. It can also be used for drug screening, drug efficacy testing, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and a powerful experimental method for the successful treatment of human OCA-1A albinism. This invention has significant application value in the development of OCA-1A albinism drugs and in revealing the pathogenesis of the disease. BRIEF DESCRIPTION OF THE DRAWINGS
[0111] Figure 1 Schematic diagram of the structure of plasmid pET-32a.
[0112] Figure 2 Schematic diagram of the structure of plasmid pKG-GE4.
[0113] Figure 3 This is the electrophoresis diagram of the optimized ratio of gRNA to NCN protein in Example 3.
[0114] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 3.
[0115] Figure 5 This is the electrophoresis diagram of PCR amplification using the genome extracted from the ear tissue of the pig named 1 as a template using different primer pairs in Example 4.
[0116] Figure 6 The electrophoretic diagrams are obtained by using the genomic DNA of 18 pigs as templates and the primer pairs consisting of TYR-E1-JDF70 and TYR-E1-JDR511 for PCR amplification in Example 4.
[0117] Figure 7 This is an electrophoresis diagram comparing the editing efficiency of different targets in Example 4.
[0118] Figure 8 This is the electrophoresis diagram in Example 5.
[0119] Figure 9 The forward and reverse sequencing results of the single cell clone numbered 12 were compared with the wild-type sequence of the target site.
[0120] Figure 10 The forward and reverse sequencing results of the single-cell clone numbered 8 were compared with the wild-type sequence of the target site.
[0121] Figure 11 The forward and reverse sequencing results of the single cell clone numbered 46 were compared with the wild-type sequence of the target site.
[0122] Figure 12 The forward and reverse sequencing results of the single cell clone numbered 20 were compared with the wild-type sequence of the target site.
[0123] Figure 13 The forward and reverse sequencing results of the single cell clone numbered 9 were compared with the wild-type sequence of the target site.
[0124] Figure 14 This is the result of forward and reverse sequencing of the single-cell clone numbered 2 and alignment with the wild-type sequence of the target site. DETAILED DESCRIPTION
[0125] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0126] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good results. The commercial Cas9-B protein is a commercially available Cas9 protein with good results. Complete culture medium (% is volume ratio): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, constant temperature incubator with 5% CO2 and 5% O2.
[0127] The primary porcine fibroblasts used in the examples were prepared from ear tissue of fresh-born Congjiang Xiang pigs. The following preparation methods were used: ① 0.5 g of pig ear tissue was removed, hair and bone tissue removed, and then soaked in 75% alcohol for 30-40 seconds. The tissue was then washed five times with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco), followed by one wash with PBS buffer. ② The tissue was minced with scissors and digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 hour. The cells were then centrifuged at 500 g for 5 minutes and the supernatant discarded. ③ The pellet was resuspended in 1 mL of complete culture medium and plated onto a 10 cm diameter cell culture dish sealed with 0.2% gelatin (VWR) containing 10 mL of complete culture medium. The cells were cultured until they approximately covered 60% of the bottom of the dish. ④ After completing step ③, the cells were trypsinized, harvested, and resuspended in complete culture medium. These cells were used for subsequent electroporation experiments.
[0128] Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6. In NO: 2, nucleotides 395-680 constitute the CMV enhancer, nucleotides 682-890 constitute the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleavage polypeptide P2A (the amino acid sequence of the self-cleavage polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the self-cleavage cleavage position is The sequence of the nucleotide sequence of the present invention is as follows: nucleotides 5333-6046 encode the EGFP protein, nucleotides 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is "EGRGSLLTCGDVEENPGP", and the cleavage site is between the first and second amino acid residues starting from the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 constitute the WPRE sequence element, nucleotides 7382-7615 constitute the 3'LTR sequence element, and nucleotides 7647-7871 constitute the bGH poly(A) signal sequence element. In SEQ ID NO: 2 in patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express the fusion protein. Due to the presence of the self-cleaving polypeptide P2A and the self-cleaving polypeptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.
[0129] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in patent application 202010084343.6. In SEQ ID NO: 3 in patent application 202010084343.6, nucleotides 2280-2539 constitute the hU6 promoter, and nucleotides 2558-2637 are used to transcribe the gRNA backbone. During use, a 20-bp DNA molecule (used to transcribe the target sequence binding region of the gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, which is then transcribed in cells to produce the gRNA.
[0130] Example 1. Construction of prokaryotic Cas9 efficient expression vector
[0131] The schematic diagram of the structure of plasmid pET-32a is shown in Figure 1 .
[0132] Plasmid pKG-GE4 was modified from plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid. The schematic diagram of the structure is shown in Figure 2 .
[0133] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode an alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag, nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotide sequence encoding the spCas9 protein has been codon-optimized for the Escherichia coli BL21(DE3) strain.
[0134] The main modifications of plasmid pKG-GE4 are as follows: ① The coding region of TrxA protein is retained. TrxA protein can help the expressed target protein form disulfide bonds and increase the solubility and activity of the target protein; the coding sequence of alkaline phosphatase signal peptide is added before the coding region of TrxA protein. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the periplasmic cavity of the bacterial membrane and can be cleaved by prokaryotic periplasmic signal peptidase; ② The coding sequence of His-Tag is added after the coding sequence of TrxA protein. His-Tag can be used for ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the codon-optimized Cas9 gene suitable for expression in Escherichia coli BL21 (DE3) strain, and add the nuclear localization signal coding sequence upstream and downstream of the gene to increase the nuclear localization ability of the Cas9 protein purified later.
[0135] The fusion gene in plasmid pKG-GE4 is shown at nucleotides 5209-9852 in SEQ ID NO: 1, encoding the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein). Due to the presence of the alkaline phosphatase signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, which is named NCN protein.
[0136] Example 2: Preparation and purification of NCN protein
[0137] 1. Inducible Expression
[0138] 1. Introduce plasmid pKG-GE4 into Escherichia coli BL21 (DE3) to obtain recombinant bacteria.
[0139] 2. The recombinant bacteria obtained in step 1 were inoculated into liquid LB medium containing 100 μg / ml ampicillin and cultured overnight at 37°C and 200 rpm with shaking.
[0140] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium and culture at 30°C and 230 rpm until the OD 600nm The value was set to 1.0, and then isopropylthiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The cells were shaken and cultured at 25°C and 230 rpm for 12 hours, and then centrifuged at 4°C and 10,000 g for 15 minutes to collect the cells.
[0141] 4. Take the bacteria obtained in step 3 and wash them with PBS buffer.
[0142] 2. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0143] 1. Take the cells obtained in step 1, add crude extraction buffer and suspend the cells, then use a homogenizer to break the cells (1000 par three times), then centrifuge at 4°C, 15000g for 30 minutes, collect the supernatant, filter the supernatant through a 0.22μm pore size filter, and collect the filtrate. In this step, 10ml of crude extraction buffer is added for every gram of wet weight of cells.
[0144] Crude extraction buffer: contains 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, and the balance is ddH2O.
[0145] 2. Purify the fusion protein using affinity chromatography.
[0146] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate of 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration solution (flow rate of 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate of 1 ml / min) to remove impurities; then elute with 10 column volumes of eluent at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0147] Ni-NTA agarose column: GenScript, L00250 / L00250-C, filler volume 10 ml.
[0148] Equilibration solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.
[0149] Buffer: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, and the balance is ddH2O.
[0150] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.
[0151] 3. Enzymatic cleavage of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
[0152] 1. Take 15 ml of the post-column solution collected in step 2 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity). Then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.
[0153] 2. Add commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotechnology, C620031, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (approximately 6 ml). Digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.
[0154] 3. Take the solution from step 2 (about 6 ml) and mix it with 480 μl Ni-NTA resin (GenScript, L00250 / L00250-C). Rotate and mix at room temperature for 15 min, then centrifuge at 7000 g for 3 min and collect the supernatant (4-5.5 ml).
[0155] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.
[0156] Sequencing revealed that the N-terminal 15 amino acid residues of the protein in the NCN protein solution were as shown in positions 1 to 15 of SEQ ID NO: 3, namely, the NCN protein.
[0157] The NCN proteins used in the subsequent examples were all provided by NCN protein solutions.
[0158] Enzyme storage solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (volume ratio) glycerol, and the balance is ddH2O.
[0159] Example 3: Performance of NCN protein
[0160] Two gRNA targets targeting the TTN gene were selected as follows:
[0161] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;
[0162] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.
[0163] The primers used to identify the target fragment containing the gRNA in the TTN gene are as follows:
[0164] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;
[0165] TTN-R560: CAAAGTTAACTCTCTGTGTCT.
[0166] 1. Preparation of gRNA
[0167] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates
[0168] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.
[0169] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.
[0170] 2. Obtain gRNA by in vitro transcription
[0171] TTN-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908) to obtain a single-stranded RNA, as shown in SEQ ID NO: 6.
[0172] TTN-T7-gRNA2 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM TTN-gRNA2 was recovered and purified using Transcription Clean-Up Kit (Thermo, AM1908) to obtain TTN-gRNA2. TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.
[0173] 2. Optimization of the ratio of gRNA to NCN protein
[0174] 1. Co-transfection of primary porcine fibroblasts
[0175] Group 1: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.
[0176] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.
[0177] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0178] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.
[0179] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into primary porcine fibroblasts. Ratio: approximately 100,000 primary porcine fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0180] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0181] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0182] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.
[0183] Electrophoresis diagram Figure 3The 505bp band is the wild-type band (WT), and the 254bp band (the wild-type band is 505bp and theoretically lacks 251bp) is the deletion mutation band (MT).
[0184] Gene deletion mutation efficiency = (MT grayscale / MT band bp number) / (WT grayscale / WT band bp number + MT grayscale / MT band bp number) × 100%. The gene deletion mutation efficiency was 19.9% in the first group, 39.9% in the second group, 79.9% in the third group, and 44.3% in the fourth group. No mutation occurred in the fifth group.
[0185] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1μg:1μg:4μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1μg:1μg:4μg.
[0186] 3. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein
[0187] 1. Co-transfection of primary porcine fibroblasts
[0188] Cas9-A Group: Co-transfect porcine primary fibroblasts with TTN-gRNA1, TTN-gRNA2, and commercially available Cas9-A protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.
[0189] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0190] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.
[0191] Control group: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0192] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0193] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0194] 3. After completing step 2, trypsin was used to digest and collect the cells, and genomic DNA was extracted. PCR amplification was performed using a primer pair consisting of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis was performed.
[0195] Electrophoresis diagram Figure 4 The gene deletion mutation efficiency using the commercial Cas9-A protein was 28.5%, the gene deletion mutation efficiency using the NCN protein was 85.6%, and the gene deletion mutation efficiency using the commercial Cas9-B protein was 16.6%.
[0196] The results showed that compared with commercial Cas9 protein, the NCN protein prepared by the present invention significantly improved the gene editing efficiency.
[0197] Example 4: Screening of efficient gRNA targets for the TYR gene
[0198] Porcine TYR gene information: Encodes tyrosinase; located on chromosome 9; GeneID 407745, Sus scrofa. The amino acid sequence encoded by the porcine TYR gene is shown in SEQ ID NO: 8. In genomic DNA, the porcine TYR gene has five exons. The TYR gene point mutation associated with human OCA-1A is the R77L mutation. The R77L mutation corresponds to exon 1 of the porcine TYR gene. In porcine genomic DNA, the partial sequence of the TYR gene (including exon 1 and some upstream nucleotides) is shown in SEQ ID NO: 9.
[0199] 1. Conservative analysis of the TYR gene's pre-specified point mutation sites and adjacent genomic sequences
[0200] 18 newborn Congjiang Xiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).
[0201] TYR-E1-JDF48:AGAATGCTCCTGGCTGCTTT;
[0202] TYR-E1-JDR511: CCTGTGGGGATGACGAAGTC;
[0203] TYR-E1-JDF70:ACTGCCTGCTCTGGACTTTC;
[0204] TYR-E1-JDR508:GTGGGGATGACGAAGTCTGG.
[0205] The genome was extracted from the ear tissue of the pig named 1 and used as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. Figure 5 . Figure 5 Middle: Group 1: Primer pair consisting of TYR-E1-JDF48 and TYR-E1-JDR511; Group 2: Primer pair consisting of TYR-E1-JDF48 and TYR-E1-JDR508; Group 3: Primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR511; Group 4: Primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR508. The results showed that the primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR511 was the preferred pair for amplifying the target fragment.
[0206] PCR amplification was performed using the genomic DNA of 18 pigs as templates, using the primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR511, and then subjected to 1% agarose gel electrophoresis. Figure 6 The PCR amplification products were recovered and sequenced, and the sequencing results were compared with the TYR gene sequences in public databases. The conserved regions shared by the 18 pigs were selected for gRNA target design.
[0207] 2. Target Screening
[0208] By screening NGG (avoiding possible mutation sites), several targets were initially screened, and 4 targets were further screened after preliminary experiments.
[0209] The four targets are as follows:
[0210] TYR-E1-gRNA1:ACCTCAGTTCCCCTTCACCG;
[0211] TYR-E1-gRNA2:GTCCTGTGTAAAAGACGGA;
[0212] TYR-E1-gRNA3: AGACTCCCGTTCATCCACCC;
[0213] TYR-E1-gRNA4:GGTCCTGTTGTAAAAGACGG.
[0214] 3. Preparation of recombinant plasmid
[0215] The plasmid pKG-U6gRNA was taken and digested with the restriction endonuclease BbsI to recover the vector backbone (a large linear fragment of about 3 kb).
[0216] TYR-E1-gRNA1-S and TYR-E1-gRNA1-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (TYR-E1-gRNA1). Plasmid pKG-U6gRNA (TYR-E1-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 TYR-E1-gRNA1 sgRNA TYR-E1-gRNA1 (SEQ ID NO: 10):
[0217] ACCUCAGUUCCCUUCACCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0218] TYR-E1-gRNA2-S and TYR-E1-gRNA2-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (TYR-E1-gRNA2). Plasmid pKG-U6gRNA (TYR-E1-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 TYR-E1-gRNA2 sgRNA TYR-E1-gRNA2 (SEQ ID NO: 11):
[0219] GUCCUGUUGUAAAAGACGGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0220] TYR-E1-gRNA3-S and TYR-E1-gRNA3-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (TYR-E1-gRNA3). Plasmid pKG-U6gRNA (TYR-E1-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12 TYR-E1-gRNA3 sgRNA TYR-E1-gRNA3 (SEQ ID NO: 12):
[0221] AGACUCCCGUUCAUCCACCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0222] TYR-E1-gRNA4-S and TYR-E1-gRNA4-A were synthesized separately, then mixed and annealed to obtain double-stranded DNA molecules with sticky ends. The double-stranded DNA molecules with sticky ends were ligated to the vector backbone to obtain plasmid pKG-U6gRNA (TYR-E1-gRNA4). Plasmid pKG-U6gRNA (TYR-E1-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13 TYR-E1-gRNA4 sgRNA TYR-E1-gRNA4 (SEQ ID NO: 13):
[0223] GGUCCUGUUGUAAAAGACGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0224] TYR-E1-gRNA1-S:caccgACCTCAGTTCCCCTTCACCG;
[0225] TYR-E1-gRNA1-A:aaacCGGTGAAGGGGAACTGAGGTc;
[0226] TYR-E1-gRNA2-S: caccGTCCTGTTGTAAAAGACGGA;
[0227] TYR-E1-gRNA2-A:aaacTCCGTCTTTTACAACAGGAC;
[0228] TYR-E1-gRNA3-S: caccgAGACTCCCGTTCATCCACCC;
[0229] TYR-E1-gRNA3-A:aaacGGGTGGATGAACGGGAGTCTc;
[0230] TYR-E1-gRNA4-S:caccGGTCCTGTTGTAAAAGACGG;
[0231] TYR-E1-gRNA4-A:aaacCCGTCTTTACAACAGGACC.
[0232] TYR-E1-gRNA1-S, TYR-E1-gRNA1-A, TYR-E1-gRNA2-S, TYR-E1-gRNA2-A, TYR-E1-gRNA3-S, TYR-E1-gRNA3-A, TYR-E1-gRNA4-S, and TYR-E1-gRNA4-A are all single-stranded DNA molecules.
[0233] 4. Comparison of Editing Efficiency of Different Targets
[0234] 1. Co-transfection
[0235] Group 1: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (TYR-E1-gRNA1) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (TYR-E1-gRNA1): 1.08 μg plasmid pKG-GE3.
[0236] Group 2: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (TYR-E1-gRNA2) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (TYR-E1-gRNA2): 1.08 μg plasmid pKG-GE3.
[0237] Group 3: Co-transfect primary porcine fibroblasts with plasmid pKG-U6gRNA (TYR-E1-gRNA3) and plasmid pKG-GE3. Ratio: approximately 200,000 primary porcine fibroblasts: 0.92 μg plasmid pKG-U6gRNA (TYR-E1-gRNA3): 1.08 μg plasmid pKG-GE3.
[0238] Group 4: Co-transfect porcine primary fibroblasts with plasmid pKG-U6gRNA (TYR-E1-gRNA4) and plasmid pKG-GE3. Ratio: approximately 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA (TYR-E1-gRNA4): 1.08 μg plasmid pKG-GE3.
[0239] Group 5: Primary porcine fibroblasts were electroporated with the same electroporation parameters but without adding plasmids.
[0240] Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator (parameter settings: 1450 V, 10 ms, 3 pulses).
[0241] 2. After completing step 1, culture the cells in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0242] 3. After completing step 2, trypsin was used to digest and collect the cells, the cells were lysed, genomic DNA was extracted, and PCR amplification was performed using the primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR511, followed by 1% agarose gel electrophoresis. The mutation of the target gene in the cells was detected, and the electrophoresis diagram is shown in FIG. Figure 7 .
[0243] After gel excision and recovery of the target product, the product was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of the different targets. The gene editing efficiencies of groups 1 to 4 were 40%, 30%, 14%, and 18%, respectively. No gene editing occurred in group 5. The results demonstrated that TYR-E1-gRNA1 and TYR-E1-gRNA2 had the highest editing efficiencies.
[0244] Example 5: Preparation of single-cell clones with precise TYR gene mutations using somatic cell cloning
[0245] The two highly efficient gRNA targets (TYR-E1-gRNA1 and TYR-E1-gRNA2) screened in Example 4 were selected.
[0246] 1. Preparation of gRNA
[0247] 1. Preparation of TYR-T7-gRNA1 and TYR-T7-gRNA5 transcription templates
[0248] The TYR-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.
[0249] The TYR-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.
[0250] 2. Obtain gRNA by in vitro transcription
[0251] The TYR-T7-gRNA1 transcription template was taken and in vitro transcription was performed using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441). TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification to obtain TYR-gRNA1. TYR-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 16.
[0252] TYR-gRNA1 (SEQ ID NO: 16):
[0253] GGACCUCAGUUCCCUUCACCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.
[0254] Take TYR-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, and then use MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) was used for recovery and purification to obtain TYR-gRNA2. TYR-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 17.
[0255] TYR-gRNA2 (SEQ ID NO: 17):
[0256] GGGUCCUGUUGUAAAAGACGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU.
[0257] 2. Synthesis of single-stranded Donor DNA with mutations at the TYR gene target site
[0258] A single-stranded DNA corresponding to the R77L mutation was synthesized as donor DNA. In addition to the target site mutation, this single-stranded DNA also contained synonymous mutations in the 3' end sequence of the target PAM or adjacent PAM of TYR-E1-gRNA1 and TYR-E1-gRNA2. This single-stranded donor DNA was designated TYR-E1mut-ss126.
[0259] TYR-E1mut-ss126 is shown in SEQ ID NO:18.
[0260] TYR-E1mut-ss126 (SEQ ID NO: 18):
[0261] ggacatcattctgtccaaggcacccctgggacctcagttccccttcaccggAgtggatgaacTggagtcttggccctcAgtcttttacaacaggacctgccagtgctttggcaacttcatgggatt.
[0262] 3. Transfection of Primary Porcine Fibroblasts
[0263] 1. Co-transfect porcine primary fibroblasts with TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126, and NCN protein. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TYR-gRNA1: 1 μg TYR-gRNA2: 2 μg TYR-E1mut-ss126: 4 μg NCN protein. Co-transfection was performed by electroporation using the Mammalian Nucleofection Kit (Neon kit, Thermofisher) and the Neon™ transfection system (parameters: 1450V, 10 ms, 3 pulses).
[0264] 2. After completing step 1, culture the cells in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total culture time after electroporation is 48 hours.
[0265] 3. After completing step 2, use trypsin to digest and collect the cells, then wash with complete culture medium, resuspend in complete culture medium, and then pick each monoclonal clone and transfer it to a 96-well plate (1 cell per well, each well contains 100 μl complete culture medium) and culture for 2 weeks (replace new complete culture medium every 2-3 days).
[0266] 4. After completing step 3, trypsinize and collect the cells (about 2 / 3 of the cells obtained in each well are inoculated into a 6-well plate filled with complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).
[0267] 5. Take the 6-well plate from step 4 and culture until the cells grow to 80% confluence, digest and collect the cells with trypsin, and freeze the cells using cell freezing solution (90% complete culture medium + 10% DMSO, volume ratio).
[0268] 6. Take the centrifuge tube from step 4, take the cells, lyse the cells and extract genomic DNA. Use the primer pair consisting of TYR-E1-JDF70 and TYR-E1-JDR511 for PCR amplification, and then perform electrophoresis. Use primary porcine fibroblasts as wild-type control (WT). See the electrophoresis diagram. Figure 8 . Figure 8 The lane numbers in the figure are consistent with the cell numbers in Table 1.
[0269] 7. After completing step 6, recover the PCR amplification product and sequence it.
[0270] There is only one sequencing result for primary porcine fibroblasts, and its genotype is homozygous wild type. If a single-cell clone has two sequencing results, one of which is consistent with the sequencing result of primary porcine fibroblasts and the other has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is heterozygous. If a single-cell clone has two sequencing results, both of which have a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic different mutation type. If a single-cell clone has only one sequencing result and has a mutation compared to the sequencing result of primary porcine fibroblasts (mutation includes deletion, insertion, or substitution of one or more nucleotides), the genotype of the single-cell clone is biallelic identical mutation type. If a single-cell clone has only one sequencing result and is consistent with the sequencing result of primary porcine fibroblasts, the genotype of the single-cell clone is homozygous wild type.
[0271] The results are shown in Table 1. The genotype of single cell clones numbered 5, 12, 18, 25, 30, 44, and 45 is homozygous wild type. The genotype of single cell clones numbered 3, 8, 9, 11, 16, 17, 19, 23, 26, 27, 28, 29, 32, 33, 34, 36, 37, 38, 39, 41, 42, 47, and 48 is heterozygous. The genotype of single cell clones numbered 4, 7, 15, 21, 22, 24, 31, 35, and 46 is a double allelic different mutation type. The genotype of single cell clones numbered 1, 2, 6, 10, 13, 14, 20, 40, and 43 is a double allelic identical mutation type. Among them, the single cell clone numbered 9 is a heterozygous type for the target site mutation (i.e., one of the two homologous chromosomes completes the replacement of the single-stranded Donor DNA). Single-cell clones numbered 7, 15, 21, 24, 31, and 35 were biallelic different mutation types with target site mutations (i.e., one of the two homologous chromosomes completed the replacement of the single-stranded Donor DNA). Single-cell clones numbered 2 and 40 were biallelic identical mutation types with target site mutations (i.e., both homologous chromosomes completed the replacement of the single-stranded Donor DNA). The rate of obtaining TYR gene exon 1 gene-edited single-cell clones was 85.42%, and the rate of obtaining single-cell clones with target site mutations (i.e., single-cell clones numbered 2, 7, 9, 15, 21, 24, 31, 35, and 40) was 18.75%.
[0272] Exemplary sequencing comparison results are shown in Figures 9 to 14 . Figure 9 This is the result of alignment of the forward and reverse sequencing of the single-cell clone numbered 12 with the wild-type sequence of the target site, which is a homozygous wild type. Figure 10 This is the result of reverse sequencing of the single-cell clone numbered 8 and the comparison with the wild-type sequence of the target site, which is a heterozygous type. Figure 11 This is the result of alignment of forward sequencing and reverse sequencing of the single-cell clone numbered 46 with the wild-type sequence of the target site, which is a double-allelic mutation type. Figure 12 This is the result of alignment of forward sequencing and reverse sequencing of the single cell clone numbered 20 with the wild-type sequence of the target site, which is a biallelic identical mutation type. Figure 13 This is the result of alignment of the forward sequencing and reverse sequencing of the single-cell clone numbered 9 with the wild-type sequence of the target site, which is a heterozygous type of the point mutation at the target site. Figure 14 This is the comparison result of forward sequencing and reverse sequencing of the single cell clone numbered 2 with the wild-type sequence of the target site, which is a biallelic identical mutation type of the target site point mutation.
[0273] Table 1 Genotyping results of single-cell clones with TYR gene point mutations
[0274]
[0275]
[0276] Note: Target site mutation refers to the completion of the replacement of single-stranded donor DNA; that is, the DNA molecule shown in SEQ ID NO: 18 replaces the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA.
[0277] Single-cell clones numbered 2 and 40 exhibit bi-allelic identical mutations at the target site (i.e., single-stranded donor DNA has been replaced on both homologous chromosomes). Bi-allelic identical mutants at the target site can be used for subsequent cloned pig production. Using these cells as nuclear transfer donors for somatic cell cloning, cloned pigs can be obtained, creating albino pig models.
[0278] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. Sequence Listing <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing OCA-1A albinism model pig nuclear transfer donor cells and its application <130> GNCYX212009 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttta agttctgcta tgtggcgcgg tattacccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataccatga gtgatacac tgcggccac ttactctga caacgatcgg 1020 aggaccgaag gagctaccg cttttgca siacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcacaacgt tgcgcaacct atttactggc gaactactta ctctagcttc 1200 ccggcaacaa ttatagact ggatggaggc ggataagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttactacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgccctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaccga agaccattca tgttgttgct caggtcgcag 3180 acgtttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cattaaggca acccccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380 tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560. gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccaccgggga aacggtctga 4680. taagagacac cggcatactc tgcgacatcg fathercgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800. atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980. gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040. aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 5160 ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Tyr Thr Arg Lys Asn 225 230 235 240 Arg With Cys Tyr Leu Gln Glu Phe Serves As An Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290,295,300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu With Arg Lys Arg Pro Leu Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 It Will Be Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 930 935 940 Only Gln With Asp Ser Arg With Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys With Arg Glu Val Val Lys With Thr Lys Ser Ser Lys 965,970,975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980,985,990 Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 531 <212> PRT <213> Sus scrofa <400> 8 Met Leu Leu Ala Ala Leu Tyr Cys Leu Leu Trp Thr Phe Gln Thr Ser 1 5 10 15 Ala Gly His Phe Pro Arg Ala Cys Ala Ser Ser Lys Asn Leu Met Glu 20 25 30 Lys Glu Cys Cys Pro Pro Trp Gly Gly Asp Gly Ser Pro Cys Gly Gln 35 40 45 Leu Ser Gly Arg Gly Ser Cys Gln Asp Ile Ile Leu Ser Lys Ala Pro 50 55 60 [[ID=^44]]Leu Gly Pro Gln Phe Pro Phe Thr Gly Val Asp Glu Arg Glu Ser Trp 65 70 75 80 Pro Ser Val Phe Tyr Asn Arg Thr Cys Gln Cys Phe Gly Asn Phe Met 85 90 95 Gly Phe Asn Cys Gly Ser Cys Lys Phe Gly Phe Gln Gly Pro Asn Cys 100 105 110 Thr Glu Arg Arg Leu Leu Val Arg Arg Asn Ile Phe Asp Leu Ser Val 115 120 125 Pro Glu Lys Asn Lys Phe Leu Ala Tyr Leu Thr Leu Ala Lys His Thr 130 135 140 Thr Ser Pro Asp Phe Val Ile Pro Thr Gly Thr Tyr Gly Gln Met Asn 145 150 155 160 Asn Gly Ser Thr Pro Met Phe Ser Asp Ile Asn Ile Tyr Asp Leu Phe 165 170 175 Val Trp Met His Tyr Tyr Val Ser Arg Asp Thr Leu Leu Gly Gly Ser 180 185 190 Glu Ile Trp Arg Asp Ile Asp Phe Ala His Glu Ala Pro Gly Phe Leu 195 200 205 Pro Trp His Arg Leu Phe Leu Leu Val Trp Glu Gln Glu Ile Gln Lys 210 215 220 Leu Thr Gly Asp Glu Asn Phe Thr Ile Pro Tyr Trp Asp Trp Arg Asp 225 230 235 240 Ala Glu Asn Cys Asp Ile Cys Thr Asp Glu Tyr Met Gly Gly Arg Asn 245 250 255 Pro Ala Asn Pro Asn Leu Leu Ser Pro Ala Ser Phe Phe Ser Ser Trp 260 265 270 Gln Ile Ile Cys Ser Arg Leu Glu Glu Tyr Asn Ser Arg Gln Ala Leu 275 280 285 Cys Asn Gly Thr Pro Glu Gly Pro Leu Leu Arg Asn Pro Gly Asn His 290 295 300 Asp Lys Ser Arg Thr Pro Arg Leu Pro Ser Ser Ala Asp Val Glu Phe 305 310 315 320 Cys Leu Ser Leu Thr Gln Tyr Glu Ser Gly Ser Met Asp Lys Ser Ala 325 330 335 Asn Phe Ser Phe Arg Asn Thr Leu Glu Gly Phe Ala Ser Pro Leu Thr 340 345 350 Gly Ile Ala Asp Ala Ser Gln Ser Ser Met His Asn Ala Leu His Ile 355 360 365 Tyr Met Asn Gly Thr Met Ser Gln Val Gln Gly Ser Ala Asn Asp Pro 370 375 380 Ile Phe Leu Leu His His Ala Phe Val Asp Ser Ile Phe Glu Gln Trp 385 390 395 400 Leu Arg Lys His His Pro Leu Leu Glu Val Tyr Pro Glu Ala Asn Ala 405 410 415 Pro Ile Gly His Asn Arg Glu Ser Tyr Met Val Pro Phe Ile Pro Leu 420 425 430 Tyr Arg Asn Gly Asp Phe Phe Ile Ser Ser Arg Asp Leu Gly Tyr Asp 435 440 445 Tyr Ser Tyr Leu Gln Asp Ser Glu Pro Asp Phe Phe Gln Asp Tyr Ile 450 455 460 Lys Pro Tyr Leu Glu Gln Ala Ser Arg Ile Trp Pro Trp Leu Leu Gly 465 470 475 480 Ala Ala Val Val Gly Ser Val Leu Thr Ala Val Leu Gly Gly Ile Thr 485 490 495 Arg Arg Leu Cys Cys Arg Arg Lys Arg Lys Arg Leu Pro Glu Glu Lys 500 505 510 Gln Pro Leu Leu Met Glu Lys Glu Asp Tyr Asp Ser Leu Leu Tyr Gln 515 520 525 Ser His Leu 530 <210> 9 <211> 869 <212> DNA <213> Sus scrofa <400> 9 tgtggctcaa ttaacaagct caaacagacc ttgtgagaac tagaggaaga atgctcctgg 60 ctgctttgta ctgcctgctc tggactttcc agacttccgc cggacacttc cctcgagcct 120 gtgcctcctc caagaacctg atggagaagg aatgctgccc accctgggga ggtgatggga 180 gtccctgtgg ccagctctca ggcaggggtt cctgtcagga catcattctg tccaaggcac 240 ccctgggacc tcagttcccc ttcaccgggg tggatgaacg ggagtcttgg ccctccgtct 300 tttacaacag gacctgccag tgctttggca acttcatggg atttaactgt ggaagttgta 360 agtttggctt tcagggaccc aactgcacag agaggcgact tttggtcaga agaaacatct 420 ttgatttgag tgtgccagag aagaacaaat ttcttgccta cctcacttta gcgaaacata 480 ctaccagccc agacttcgtc atccccacag gcacctatgg ccaaatgaat aatggatcaa 540 cacccatgtt tagtgacatc aacatttatg acctctttgt ctggatgcat tattacgtgt 600 ctagggacac actacttggg ggctctgaaa tctggagaga cattgatttt gctcatgaag 660 caccaggttt cctgccttgg catcgactct tcttgctggt atgggaacaa gaaatccaga 720 agctgacagg ggatgagaac ttcactattc catactggga ttggcgagat gcagaaaatt 780 gtgacatttg cacagatgag tacatgggag gacgcaaccc tgcaaaccct aatctactca 840 gcccagcatc cttcttctcc tcttggcag 869 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10<00012cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 gguccuguug uaaaagacgg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 225 <212> DNA <213> Artificial Sequence <400> 14 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggacctc agttcccctt caccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 15 <211> 225 <212> DNA <213> Artificial Sequence <400> 15 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggtcct gttgtaaaag acggagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 16 <211> 102 <212> RNA <213> Artificial Sequence <400> 16 ggaccucagu uccccuucac cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 17 <211> 102 <212> RNA <213> Artificial Sequence <400> 17 ggguccuguu guaaaagacg gaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 18 <211> 126 <212> DNA <213> Artificial Sequence <400> 18 ggacatcatt ctgtccaagg cacccctggg acctcagttc cccttcaccg gagtggatga 60 actggagtct tggccctcag tctttacaa caggacctgc cagtgctttg gcaacttcat 120 gggatt 126 <210> 19 <211> 126 <212> DNA <213> On sow <400> 19 ggacatcatt ctgtccaagg cacccctggg acctcagttc cccttcaccg gggtggatga 60 acgggagtct tggccctccg tctttacaa caggacctgc cagtgctttg gcaacttcat 120 gggatt 126
Claims
1. A method for preparing a recombinant cell, comprising the steps of: replacing the DNA molecule of SEQ ID NO: 19 in the chromosomal DNA of a porcine fibroblast with the DNA molecule of SEQ ID NO: 18 to obtain a recombinant cell; Replacing the DNA molecule of SEQ ID NO: 19 in the chromosomal DNA of porcine fibroblasts with the DNA molecule of SEQ ID NO: 18 is achieved by co-transfecting TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126, and NCN protein into porcine fibroblasts; the TYR-gRNA1 is an sgRNA, the target sequence binding region of which is as shown in nucleotides 3-22 of SEQ ID NO: 16; the TYR-gRNA2 is an sgRNA, the target sequence binding region of which is as shown in nucleotides 3-22 of SEQ ID NO: 17; and the TYR-E1mut-ss126 is a single-stranded DNA molecule as shown in SEQ ID NO:
18. The NCN protein is shown in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21 (DE3) to obtain recombinant bacteria; (2) culturing the recombinant bacteria in a liquid medium at 30° C., then adding IPTG and inducing the culture at 25° C., and then collecting the bacteria; (3) crushing the collected bacteria and collecting the crude protein solution; (4) purifying the His6-tagged fusion protein from the crude protein solution using affinity chromatography; (5) The His6-tagged fusion protein was cleaved with enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein; The plasmid pKG-GE4 is shown in SEQ ID NO:
1.
2. The method according to claim 1, wherein: The ratios of porcine fibroblasts, TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126 and NCN protein are as follows: 100,000 porcine fibroblasts: 0.8-1.2μg TYR-gRNA1: 0.8-1.2μg TYR-gRNA2: 1.8-2.2μg TYR-E1mut-ss126: 3-5μg NCN protein.
3. Use of TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126, and NCN protein in preparing kits; TYR-gRNA1 is the TYR-gRNA1 described in claim 1; TYR-gRNA2 is the TYR-gRNA2 described in claim 1; TYR-E1mut-ss126 is the TYR-E1mut-ss126 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing albino pig model; (c) preparing albino cell model, albino tissue model or albino organ model.
4. A kit comprising TYR-gRNA1, TYR-gRNA2, TYR-E1mut-ss126, and NCN protein; TYR-gRNA1 is the TYR-gRNA1 described in claim 1; TYR-gRNA2 is the TYR-gRNA2 described in claim 1; TYR-E1mut-ss126 is the TYR-E1mut-ss126 described in claim 1; NCN protein is the NCN protein described in claim 1; The purpose of the kit is as follows (a) or (b) or (c): (a) preparing recombinant cells; (b) preparing albino pig model; (c) preparing albino cell model, albino tissue model or albino organ model.
Citation Information
Patent Citations
CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects
CN112522255A
Application of gRNA target combinations in construction of hemophilia model pig cell line
CN112442515A