Compositions for detecting esophageal cancer and uses thereof
By detecting the methylation status of the MT1A and EPO genes, and utilizing bisulfite treatment and DNA polymerase reaction, a composition and kit are provided that solves the problems of inconvenience and low sensitivity in existing esophageal cancer detection, enabling rapid and convenient detection of esophageal cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2017-12-01
- Publication Date
- 2026-03-31
AI Technical Summary
Existing esophageal cancer detection technologies suffer from inconvenience, low sensitivity, and high cost, especially lacking effective methods for early detection and screening of esophageal cancer.
A composition and kit are provided for the non-invasive in vitro detection of esophageal cancer by detecting the methylation status of the MT1A and EPO genes, utilizing bisulfite treatment and DNA polymerase reaction, combined with specific primers and blocking agents.
It achieves sensitive and specific detection of esophageal cancer, enabling rapid and convenient identification of early-stage esophageal cancer and improving the diagnostic rate of early-stage esophageal cancer.
Smart Images

Figure HDA0003671297790000011 
Figure HDA0003671297790000021 
Figure HDA0003671297790000022
Abstract
Description
[0001] This application is a divisional application of Chinese patent application No. 201711248825.5, entitled "Composition for Detecting Esophageal Cancer and Its Use Thereof", filed on December 1, 2017. Technical Field
[0002] This invention belongs to the field of biotechnology and relates to a composition and its use in disease detection, specifically to a composition for detecting esophageal cancer and its corresponding kit and use. Background Technology
[0003] Esophageal cancer is a common digestive tract tumor, causing approximately 300,000 deaths worldwide each year. China is one of the regions with a high incidence of esophageal cancer globally, accounting for half of all esophageal cancer deaths worldwide. Data from the National Cancer Prevention and Control Office shows that in 2015, the incidence rate of esophageal cancer in my country was 478 cases per 100,000 people, and the mortality rate was 375 cases per 10,000 people, ranking fourth and third among common cancers in my country, respectively. With a mortality rate approaching 80%, esophageal cancer is a highly malignant disease. A significant factor contributing to its high mortality rate is the low early-stage diagnosis rate. The cure rate for early-stage esophageal cancer is far higher than that for mid-to-late-stage cancer; however, due to the lack of obvious and specific symptoms in early-stage esophageal cancer, most patients are diagnosed at an advanced stage. Clinical studies have found that the process from lesion formation to the appearance of clinical symptoms takes an average of several years; this provides an effective window for detecting early-stage esophageal cancer and improving its diagnosis rate. Fully utilizing this window period holds promise for improving treatment outcomes and reducing esophageal cancer mortality.
[0004] Currently, the clinical applications of esophageal cancer diagnosis techniques have limited use in the detection and screening of early esophageal cancer, mainly because: 1) tissue biopsy is highly invasive and unsuitable for early cancer screening; 2) imaging techniques (such as esophagography and endoscopy) are limited by equipment costs, operating techniques, and invasiveness, making them difficult to widely promote as cancer screening techniques; 3) traditional serum tumor markers (such as AFP, CEA, CA125, and CA199) have low sensitivity for esophageal cancer detection and cannot fully meet the requirements for early cancer screening.
[0005] Recent studies have shown that epigenetics plays a crucial role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been extensively studied. Research data shows that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and continue throughout the occurrence and development of cancer; and the methylation of tumor suppressor genes is a key molecular mechanism for the transformation of precancerous lesions into malignant tumor cells. However, there is currently a lack of detection technologies, methods, and products for esophageal cancer methylation gene detection. Therefore, there is a current demand for methylation gene markers with high sensitivity and specificity for esophageal cancer detection. Summary of the Invention
[0006] Therefore, addressing the problems of inconvenience, low sensitivity, and high cost in existing esophageal cancer detection technologies, this invention provides a composition for detecting esophageal cancer. The composition provided by this invention can sensitively and specifically detect esophageal cancer. This invention also provides a kit comprising the said composition and its use in the detection of esophageal cancer. The kit provided by this invention has good sensitivity in detecting esophageal cancer and can conveniently, quickly, and effectively detect esophageal cancer.
[0007] The present invention provides a composition, a kit for in vitro detection of esophageal cancer, and the use thereof, as well as a method for performing the detection based on the kit, and for detecting esophageal cancer.
[0008] Specifically, this invention relates to the following:
[0009] 1. A composition for in vitro detection of esophageal cancer, said composition comprising:
[0010] Nucleic acid used to detect the methylation status of a target gene.
[0011] The target gene is one or both of the MT1A gene and the EPO gene.
[0012] 2. The composition according to claim 1, wherein the target sequence of the MT1A gene is shown in SEQ ID NO:1.
[0013] 3. The composition according to claim 1, wherein the target sequence of the EPO gene is shown in SEQ ID NO:3.
[0014] 4. The composition according to any one of claims 1 to 3, wherein the nucleic acid for detecting the methylation status of the target gene comprises:
[0015] A fragment of at least 9 nucleotides in the target sequence of the target gene.
[0016] The fragment contains at least one CpG dinucleotide sequence.
[0017] 5. The composition according to any one of claims 1 to 4, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:
[0018] A fragment of at least 15 nucleotides in the target sequence of the target gene is hybridized under moderately or strictly controlled conditions.
[0019] The fragment contains at least one CpG dinucleotide sequence.
[0020] 6. The composition according to any one of items 1 to 5, further comprising:
[0021] A reagent that converts the 5 unmethylated cytosine bases of the target gene sequence into uracil.
[0022] 7. The composition according to any one of claims 1 to 6, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:
[0023] Blockers that preferentially bind to target sequences in an unmethylated state.
[0024] 8. The composition according to claim 7, wherein,
[0025] The fragment of at least 9 nucleotides is either the sequence of SEQ ID NO:5 and SEQ ID NO:6, or the sequence of SEQ ID NO:9 and SEQ ID NO:10.
[0026] The fragment of at least 15 nucleotides is either the sequence of SEQ ID NO:7 or the sequence of SEQ ID NO:11.
[0027] The blocking agent is the sequence of SEQ ID NO:8 or the sequence of SEQ ID NO:12.
[0028] 9. An oligonucleotide for in vitro detection of esophageal cancer, comprising:
[0029] The fragment comprising at least 9 nucleotides of SEQ ID NO:1 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or
[0030] The fragment comprising at least 9 nucleotides of SEQ ID NO:3 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0031] 10. The oligonucleotide according to claim 9, further comprising:
[0032] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1 or its complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or
[0033] A fragment that hybridizes to at least 15 nucleotides of the SEQ ID NO:3 or its complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0034] 11. The oligonucleotide according to claim 10, further comprising:
[0035] Blockers that preferentially bind to target sequences in an unmethylated state.
[0036] 12. An oligonucleotide for in vitro detection of esophageal cancer, comprising:
[0037] The sequences of SEQ ID NO:5 and SEQ ID NO:6.
[0038] 13. The oligonucleotide according to claim 12, further comprising:
[0039] The sequence of SEQ ID NO:7.
[0040] 14. The oligonucleotide according to claim 13, further comprising:
[0041] The sequence of SEQ ID NO:8.
[0042] 15. An oligonucleotide for in vitro detection of esophageal cancer, comprising:
[0043] The sequences of SEQ ID NO:9 and SEQ ID NO:10.
[0044] 16. The oligonucleotide according to claim 15, further comprising:
[0045] The sequence of SEQ ID NO:11.
[0046] 17. The oligonucleotide according to claim 16, further comprising:
[0047] The sequence of SEQ ID NO:12.
[0048] 18. Use of the MT1A gene in the preparation of a kit for in vitro detection of esophageal cancer.
[0049] 19. Use of the EPO gene in the preparation of a kit for in vitro detection of esophageal cancer.
[0050] 20. A kit comprising the composition of any one of items 1 to 8 or the oligonucleotide of any one of items 9 to 17.
[0051] 21. The kit according to claim 20, further comprising at least one other component selected from:
[0052] Nucleoside triphosphate, DNA polymerase, and buffer solution required for the function of the DNA polymerase.
[0053] 22. The kit according to item 20 or 21 further comprises: instructions for use.
[0054] 23. Use of the composition according to any one of items 1 to 8 or the oligonucleotide according to any one of items 9 to 17 in the preparation of a kit for in vitro detection of esophageal cancer.
[0055] 24. The use according to any one of claims 18, 19, and 23, wherein the kit for in vitro detection of esophageal cancer detects esophageal cancer by means of a method comprising the steps of:
[0056] 1) Isolate DNA samples containing the target gene sequence or fragments from the biological sample to be tested;
[0057] 2) Determine the methylation status of the target sequence of the target gene;
[0058] 3) The state of the biological sample is determined by the detection results of the methylation status of the target gene sequence, thereby realizing the in vitro detection of esophageal cancer.
[0059] 25. The use according to item 24, wherein the method comprises the following steps:
[0060] Extract genomic DNA from the biological sample to be tested;
[0061] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.
[0062] The reagent-treated DNA sample is contacted with DNA polymerase and primers for the target sequence of the target gene, and DNA polymerization is carried out in the presence of an inhibitor that preferentially binds to the target sequence in the unmethylated state.
[0063] Detection of amplification products using probes; and
[0064] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target gene sequence is determined.
[0065] 26. The use according to item 25, wherein the reagent is a bisulfite reagent.
[0066] 27. A method for detecting esophageal cancer, comprising the following steps:
[0067] Isolate DNA samples containing target gene sequences or fragments from biological samples to be tested;
[0068] Determine the methylation status of the target gene sequence; and
[0069] The state of a biological sample is determined by detecting the methylation status of the target gene sequence, thereby enabling in vitro detection of esophageal cancer.
[0070] 28. A method for detecting esophageal cancer, comprising the following steps:
[0071] Extract genomic DNA from the biological sample to be tested;
[0072] The extracted genomic DNA was treated with a reagent to convert the 5 unmethylated cytosine bases into uracil or other bases.
[0073] The reagent-treated DNA sample is contacted with DNA polymerase and primers for the target sequence of the target gene, and DNA polymerization is carried out in the presence of an inhibitor that preferentially binds to the target sequence in the unmethylated state.
[0074] Detection of amplification products using probes; and
[0075] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target gene sequence is determined.
[0076] 29. The method according to item 27 or 28, wherein,
[0077] The target gene is one or both of the MT1A gene and the EPO gene.
[0078] 30. The method according to item 29, wherein the target sequence of the MT1A gene is shown in SEQ ID NO:1.
[0079] 31. The method according to item 29, wherein the target sequence of the EPO gene is shown in SEQ ID NO:3.
[0080] 32. The method according to item 28, wherein the reagent is a bisulfite reagent.
[0081] 33. The method according to item 28, wherein the primer is:
[0082] The fragment comprising at least 9 nucleotides of SEQ ID NO:1 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or
[0083] The fragment comprising at least 9 nucleotides of SEQ ID NO:3 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0084] 33. The method according to claim 28, wherein the blocking agent is a blocking agent that preferentially binds to a target sequence in an unmethylated state.
[0085] 34. The method according to item 28, wherein the probe is:
[0086] A fragment that hybridizes to at least 15 nucleotides of SEQ ID NO:1 or its complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence; and / or
[0087] A fragment that hybridizes to at least 15 nucleotides of the SEQ ID NO:3 or its complementary sequence under moderately or strictly controlled conditions and contains at least one CpG dinucleotide sequence.
[0088] 35. The method according to item 33, wherein the primers are sequences of SEQ ID NO:5 and SEQ ID NO:6, or sequences of SEQ ID NO:9 and SEQ ID NO:10.
[0089] 36. The method according to claim 33, wherein the blocking agent is the sequence of SEQ ID NO:8 or the sequence of SEQ ID NO:12.
[0090] 37. The method according to item 34, wherein the probe is a sequence of SEQ ID NO:7 or a sequence of SEQ ID NO:11.
[0091] The inventors of this invention utilized epigenomics and bioinformatics techniques to analyze whole-genome methylation data from esophageal cancer tissues and adjacent normal control tissues, identifying two methylation genes associated with esophageal cancer and determining the target sequences for abnormal methylation of these two esophageal cancer methylation genes. Furthermore, the inventors discovered that the methylation status of these two genes can be sensitively and specifically detected using their target sequences, thus enabling the detection of cell-free DNA in peripheral blood. Testing of peripheral blood samples from esophageal cancer patients and normal controls showed that the composition and detection method described in this invention can sensitively and specifically detect esophageal cancer, including two common cell types: squamous cell carcinoma and adenocarcinoma. Therefore, this invention provides a composition and detection method for in vitro detection of esophageal cancer, possessing significant clinical application value.
[0092] Other features and advantages of the present invention will be described in detail in the following specific description and claims. Attached Figure Description
[0093] The above and other features of the present invention will be further described below in conjunction with the accompanying drawings and detailed description. It should be understood that these drawings only illustrate several exemplary embodiments according to the present invention and should therefore not be considered as limiting the scope of protection of the present invention. Unless otherwise specified, the drawings are not necessarily to scale, and similar reference numerals denote similar parts.
[0094] Figure 1 The results of screening the target genes of this invention are shown in the figure.
[0095] Figure 2 This invention was used to detect leukocyte genomic DNA (a negative reference for the methylation status of the target gene sequence) and leukocyte genomic DNA treated with DNA methyltransferase (a positive reference for the methylation status of the target gene sequence) using the composition and detection method provided by this invention. The results showed that the composition and detection method provided by this invention were negative for leukocyte genomic DNA and positive for leukocyte genomic DNA treated with DNA methyltransferase.
[0096] Figure 3 To achieve a non-invasive in vitro detection result diagram of esophageal cancer by detecting the methylation status of the target gene sequence using the aforementioned composition and detection method. Detailed Implementation
[0097] On one hand, the present invention provides a composition for in vitro detection of esophageal cancer, the composition comprising nucleic acid for detecting the methylation status of a target sequence of a target gene, wherein the target gene is one or both of the MT1A gene and the EPO gene.
[0098] This invention provides a set of target gene sequences that emit abnormal methylation in esophageal cancer, including target sequences of the MT1A gene and the EPO gene. The target sequence of the MT1A gene is shown in SEQ ID NO:1-2, and the target sequence of the EPO gene is shown in SEQ ID NO:3-4.
[0099] The target sequence of the MT1A gene is shown in SEQ ID NO:1.
[0100] SEQ ID NO:1
[0101] CACCCAGGGGAGCTCAGTGGACTGTGCGCCTTGCCTTTCTGCTGCGCAAAGCCCAGTCCAGGTCATCACCTCGGGCGGGGCGGACTCGGCTGGGCGGACTCAGCGGGGCGGGCGCAGGCGCAGGGCGGGTCCTTTGCGTCCGGCCCTCTTTCCCCTGACCATAAAAGCAGC
[0102] The complementary sequence of SEQ ID NO: 1 is shown as SEQ ID NO: 2. [[ID=[]]
[0103] SEQ ID NO:2
[0104] GCTGCTTTTATGGTCAGGGGAAAGAGGGCCGGACGCAAAGGACCCGCCCTGCGCCTGCGCCCGCCCCGCTGAGTCCGCCCAGCCGAGTCCGCCCCGCCCGAGGTGATGACCTGGACTGGGCTTTGCGCAGCAGAAAGGCAAGGCGCACAGTCCACTGAGCTCCCCTGGGTG
[0105] Preferably, the sequence of the target sequence of the EPO gene is shown as SEQ ID NO: 3.
[0106] SEQ ID NO:3
[0107] CGCGCACGCACACATGCAGATAACAGCCCCGACCCCCGGCCAGAGCCGCAGAGTCCCTGGGCCACCCCGGCCGCTCGCTGCGCTGCGCCGCACCGCGCTGTCCTCCCGGAGCCGGACCGGGGCCACCGCGCCCGCTCTGCTCCGACACCGCGCCCCCTGGACAGCCGCCCTCTCCTCCAGGCCCGTGGGGCTGGCCCTGCACCGCCGAGCTTCCCGGGATGAGGGCCCCCGGTGTGGTCACCCGGCGCGCCCCAGGTCG
[0108] The complementary sequence of SEQ ID NO: 3 is shown as SEQ ID NO: 4. [[ID=[]] [[ID=[]]
[0109] ]CGACCTGGGGCGCGCCGGGTGACCACACCGGGGGCCCTCATCCCGGGAAGCTCGGCGGTGCAGGGCCAGCCCCACGGGCCTGGAGGAGAGGGCGGCTGTCCAGGGGGCGCGGTGTCGGAGCAGAGCGGG CGCGGTGGCCCCGGTCCGGCTCCGGGAGGACAGCGCGGTGCGGCGCAGCGCAGCGAGCGGCCGGGGGTGGCCCAGGGACTCTGCGGCTCTGGCCGGGGGTCGGGGCTGTTATCTGCATGTGTGCGTGCCG
[0110] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least nine nucleotides from the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least nine nucleotides from the sequence after bisulfite transformation of the target sequence of the target gene, wherein the nucleotide fragment contains at least one CpG dinucleotide sequence.
[0111] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the target sequence of the target gene under moderately or strictly controlled conditions, wherein the fragment of said nucleotides contains at least one CpG dinucleotide sequence. In some preferred embodiments, such as when bisulfite is used to transform the DNA of the test sample, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridized to the bisulfite-transformed sequence of the target gene under moderately or strictly controlled conditions, wherein said fragment of said nucleotides contains at least one CpG dinucleotide sequence.
[0112] Preferably, the composition further includes a reagent for converting the 5-position unmethylated cytosine base of the target gene sequence into uracil. More preferably, the reagent is a bisulfite.
[0113] Preferably, the nucleic acid used to detect the methylation status of the target gene further includes an inhibitor that preferentially binds to DNA in an unmethylated state.
[0114] Preferably, the composition comprises one or more of the following primers, probes, and / or blocking agents:
[0115] MT1A primer F
[0116] SEQ ID NO:5
[0117] CGGACGTAAAGGATTC
[0118] MT1A primer R
[0119] SEQ ID NO:6
[0120] GAAACGAACTCGACTAAACG
[0121] MT1A probe
[0122] SEQ ID NO:7
[0123] TGCGTTTGCGTTCGTTTCG
[0124] MT1A blocker
[0125] SEQ ID NO:8
[0126] CAAACTCAACTAAACAAACTCAACAAAACAAAC
[0127] EPO primer F
[0128] SEQ ID NO:9
[0129] AGTCGTAGAGTTTTTGGGTT
[0130] EPO primer R
[0131] SEQ ID NO:10
[0132] CAACGCGATACGACG
[0133] EPO probe
[0134] SEQ ID NO:11
[0135] CGCAACGAACGACCGA
[0136] EPO blocking agents
[0137] SEQ ID NO:12
[0138] GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
[0139] On the other hand, the present invention provides oligonucleotides for in vitro detection of esophageal cancer, comprising: a fragment of at least 9 nucleotides in SEQ ID NO:1 or its complementary sequence and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO:3 or its complementary sequence and containing at least one CpG dinucleotide sequence.
[0140] Preferably, the oligonucleotide for in vitro detection of esophageal cancer comprises: a fragment of at least 9 nucleotides in the sequence of SEQ ID NO:1 or its complementary sequence after bisulfite conversion; and / or a fragment of at least 9 nucleotides in the sequence of SEQ ID NO:3 or its complementary sequence after bisulfite conversion and containing at least one CpG dinucleotide sequence.
[0141] The oligonucleotide of the present invention for in vitro detection of esophageal cancer further comprises: a fragment hybridized to at least 15 nucleotides of SEQ ID NO:1 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized to at least 15 nucleotides of SEQ ID NO:3 or its complementary sequence under moderately or strictly controlled conditions and containing at least one CpG dinucleotide sequence.
[0142] Preferably, the oligonucleotide for in vitro detection of esophageal cancer comprises: a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence after bisulfite conversion of SEQ ID NO:1 or its complementary sequence, and containing at least one CpG dinucleotide sequence; and / or a fragment hybridized under moderately or strictly controlled conditions to at least 15 nucleotides of a sequence after bisulfite conversion of SEQ ID NO:3 or its complementary sequence, and containing at least one CpG dinucleotide sequence.
[0143] The oligonucleotide of the present invention for in vitro detection of esophageal cancer further includes: an inhibitor that preferentially binds to DNA in an unmethylated state.
[0144] In one specific embodiment, the oligonucleotide for in vitro detection of esophageal cancer includes the sequences of SEQ ID NO:5 and SEQ ID NO:6. It also includes the sequence of SEQ ID NO:7 and the sequence of SEQ ID NO:8.
[0145] In another specific embodiment, the oligonucleotide for in vitro detection of esophageal cancer includes the sequences of SEQ ID NO:9 and SEQ ID NO:10. It also includes the sequence of SEQ ID NO:11. Furthermore, it includes the sequence of SEQ ID NO:12.
[0146] On the other hand, the present invention provides a kit comprising the aforementioned composition. The kit further comprises at least one other component selected from: nucleoside triphosphate, DNA polymerase, and a buffer required for the function of the DNA polymerase.
[0147] The present invention also relates to the use of the MT1A gene and / or the EPO gene in the preparation of a kit for in vitro detection of esophageal cancer.
[0148] MT1A, or metallothionein 1A, is located in the q13 region of human chromosome 16 and belongs to the metallothionein gene family. Metallothioneins are small proteins rich in cysteine and lacking amino acids containing aromatic groups. They can bind divalent heavy metal ions. Metallothioneins are antioxidants that protect cells from damage caused by hydroxyl-containing free radicals, maintain intracellular metal ion balance, and remove heavy ion toxicity. Loss of function of the metallothionein gene can lead to pathological phenomena such as cancer.
[0149] The EPO gene, or erythropoietin gene, is located on chromosome 7 (q22.1) in humans. The protein encoded by this gene is a glycosylated cytokine secreted by cells. When erythropoietin binds to its corresponding receptor, it promotes the synthesis of red blood cells.
[0150] In another aspect, the present invention provides a method for in vitro detection of esophageal cancer, the method comprising the following steps:
[0151] 1) Isolate the target gene sequence or its fragment from the biological sample to be tested;
[0152] 2) Determine the methylation status of the target sequence of the target gene;
[0153] 3) The state of the biological sample is determined by the detection results of the methylation status of the target gene sequence, thereby realizing the in vitro detection of esophageal cancer.
[0154] According to certain preferred embodiments, the method further includes the following steps:
[0155] 1) Extract genomic DNA from the biological sample to be tested;
[0156] 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable.
[0157] 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target gene sequence, so that the treated target gene sequence is amplified to produce an amplification product or is not amplified; if the treated target gene sequence undergoes DNA polymerization, an amplification product will be produced; if the treated target gene sequence does not undergo DNA polymerization, it will not be amplified.
[0158] 4) Detect the amplification products using probes; and
[0159] 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target gene target sequence.
[0160] Preferably, the primers typically comprise fragments of the target gene sequence, which contain fragments that are equivalent to, complementary to, or hybridize under moderate or severe conditions to at least nine nucleotides selected from SEQ ID NO:1-2 and SEQ ID NO:3-4.
[0161] Preferably, the probe is a fragment of the target gene sequence, the fragment comprising a fragment that is equivalent to, complementary to, or hybridizes to at least 15 nucleotides selected from SEQ ID NO:1-2 and SEQ ID NO:3-4 under moderate or severe conditions.
[0162] Preferably, the typical blocking agent is one that preferentially binds to DNA in an unmethylated state.
[0163] Preferably, one or more of the primers, probes, and / or blocking agents are as follows:
[0164] MT1A primer F
[0165] SEQ ID NO:5
[0166] CGGACGTAAAGGATTC
[0167] MT1A primer R
[0168] SEQ ID NO:6
[0169] GAAACGAACTCGACTAAACG
[0170] MT1A probe
[0171] SEQ ID NO:7
[0172] TGCGTTTGCGTTCGTTTCG
[0173] MT1A blocker
[0174] SEQ ID NO:8
[0175] CAAACTCAACTAAACAAACTCAACAAAACAAAC
[0176] EPO primer F
[0177] SEQ ID NO:9
[0178] AGTCGTAGAGTTTTTGGGTT
[0179] EPO primer R
[0180] SEQ ID NO:10
[0181] CAACGCGATACGACG
[0182] EPO probe
[0183] SEQ ID NO:11
[0184] CGCAACGAACGACCGA
[0185] EPO blocking agents
[0186] SEQ ID NO:12
[0187] GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
[0188] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.
[0189] According to certain preferred embodiments, the methylation status of at least one CpG dinucleotide in the target gene sequence is determined by the cycle threshold Ct value of the PCR reaction. By utilizing PCR to analyze DNA in biological samples, the methylation status of the target gene sequence can be conveniently detected, and the PCR cycle threshold can be used to quickly and easily determine whether the sample is positive. Therefore, this provides a non-invasive and rapid in vitro detection method for esophageal cancer.
[0190] The biological samples are selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.
[0191] The preferred biological sample is plasma.
[0192] The present invention also provides a kit comprising the said composition. Typically, the kit includes a container for containing a patient's biological sample. Furthermore, the kit also includes instructions for using and interpreting the test results.
[0193] This invention provides a method for non-invasive in vitro detection of esophageal cancer by detecting the methylation status of target gene sequences. The inventors have discovered a significant difference in the methylation status of the MT1A and EPO gene target sequences between esophageal cancer tissue and normal esophageal tissue: in esophageal cancer tissue, the MT1A and EPO gene target sequences are methylated, while in normal esophageal tissue, they are not methylated. Therefore, this application provides a method for in vitro detection of esophageal cancer by detecting the methylation status of the MT1A and EPO gene target sequences in a sample. The method provided by this invention enables non-invasive and rapid detection of esophageal cancer.
[0194] Unless otherwise defined, the technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not restrictive.
[0195] The present invention also provides a composition capable of sensitively and specifically detecting the methylation status of a target gene sequence; and a method and kit for non-invasive in vitro detection of esophageal cancer.
[0196] The following description outlines examples of the compositions, kits, nucleic acid sequences, and detection methods of the present invention. A first set of embodiments discloses a target gene and its target sequence; a second set of embodiments discloses a composition for detecting the methylation status of the target gene sequence, comprising nucleic acids for detecting the methylation status of the target gene sequence; and a third set of embodiments discloses a method for non-invasive in vitro detection of esophageal cancer by detecting the methylation status of the target gene sequence.
[0197] In some embodiments, the composition further includes a reagent for converting the unmethylated cytosine base at position 5 of a gene into uracil. Preferably, this reagent is a bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because it has the same base-pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most common method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted into uracil, which corresponds to thymine in its pairing behavior; however, under these conditions, 5-methylcytosine remains unmodified. The original DNA is thus transformed in this way, making 5-methylcytosine, which was previously indistinguishable from cytosine in its hybridization behavior, now detectable as the only remaining cytosine by conventional known molecular biology techniques, such as amplification and hybridization. All these techniques, based on different base-pairing properties, can now be fully utilized. Therefore, typically, this application provides the combined use of bisulfite techniques with one or more methylation assays to determine the methylation status of a CpG dinucleotide sequence within a target sequence of a target gene. Furthermore, the methods of this invention are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or feces. Therefore, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, those skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion, or extent) of a specific CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered as referring to a value reflecting the methylation status of a CpG dinucleotide sequence.
[0198] In some embodiments, the method of this application specifically includes: 1) extracting genomic DNA from a biological sample to be tested; 2) treating the DNA sample obtained in step 1) with a reagent to convert the 5-position unmethylated cytosine base into uracil or other bases, that is, converting the 5-position unmethylated cytosine base of the target gene target sequence into uracil or other bases, wherein the converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable; 3) contacting the DNA sample treated in step 2) with DNA polymerase and primers of the target gene target sequence, such that the treated target gene target sequence is amplified to produce an amplification product or is not amplified; if the treated target gene target sequence undergoes a DNA polymerization reaction, an amplification product is produced; if the treated target gene target sequence does not undergo a DNA polymerization reaction, it is not amplified; 4) detecting the amplification product with a probe; 5) and determining the methylation status of at least one CpG dinucleotide of the target gene target sequence based on the presence or absence of the amplification product.
[0199] Typically, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme; using a polymerase lacking 5-3' exonuclease activity; using PCR; and generating a nucleic acid molecule of the amplified product with a detectable label. Preferably, PCR is used to determine the methylation status, and methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene. The fluorescence-based real-time PCR assay is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a methylation-dependent sequence-differentiated pool in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers that overlap with known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence-detected amplification level. Fluorescence-based real-time PCR assays can be used as a quantitative assay for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe that overlaps a specific CpG dinucleotide. A bias-free control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The fluorescence-based real-time PCR method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter and a quencher molecule and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than that of the forward or reverse primers. This allows TaqMan probes to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters an annealed TaqMan probe. The 5' to 3' endonuclease activity of the Taq polymerase then replaces the TaqMan probe by digesting it, releasing a fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that has not yet been quenched. Typical reagents for fluorescence-based real-time PCR analysis may include, but are not limited to: PCR primers for target gene sequences; non-specific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.
[0200] Example
[0201] Example 1
[0202] By analyzing whole-genome methylation microarray data (Illumina HumanMethylation450k microarray) from 233 esophageal cancer tissues and 171 normal esophageal tissues, the inventors found that the methylation levels of the MT1A and EPO genes in esophageal cancer tissues were significantly higher than those in normal esophageal tissues (analysis results are shown in Figure 1). Figure 1 (As shown). Furthermore, by analyzing the probe sequences and corresponding methylation rate data of the MT1A and EPO genes on a whole-genome methylation chip, the inventors identified the sequence fragments with the most significant methylation differences between esophageal cancer tissue and normal esophageal tissue, thus determining them as the target sequences of these two genes. The target sequence of the MT1A gene is shown in SEQ ID NO:1. The complementary sequence of the target sequence of the MT1A gene is shown in SEQ ID NO:2. The target sequence of the EPO gene is shown in SEQ ID NO:3. The complementary sequence of the target sequence of the EPO gene is shown in SEQ ID NO:4.
[0203] Example 2
[0204] Step 1: Obtain the DNA from the biological sample to be analyzed. This source can be any suitable source, such as cell lines, histological sections, biopsy tissue, paraffin-embedded tissue, body fluids, feces, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, and all possible combinations thereof. The DNA is then isolated from the sample using any standard method available in the art. In short, when DNA is encased in a cell membrane, the biological sample must be broken down and lysed by enzymatic, chemical, or mechanical means. Proteins and other contaminants are then removed, for example, by digestion with protein kinase K. The DNA is then recovered from the solution. This can be achieved through various methods, including salting out, organic extraction, or binding the DNA to a solid support. The choice of method is influenced by a variety of factors, including time, cost, and the amount of DNA required. When the sample DNA is not encased in a cell membrane (e.g., circulating DNA from a blood sample), standard methods for isolating and / or purifying DNA in the art can be used. These methods include the use of protein-degrading agents, such as dissociative salts like guanidine hydrochloride or urea; or detergents such as sodium dodecyl sulfate (SDS) or cyanogen bromide. Other methods include, but are not limited to, ethanol or propanol precipitation, vacuum concentration by centrifugation, etc. Those skilled in the art may also utilize devices such as ultrafiltration filters, silicon surfaces or membranes, magnetic particles, polystyrene particles, polystyrene surfaces, positively charged surfaces, and positively charged membranes, charged membranes, charged surfaces, charged conversion membranes, and charged conversion surfaces. Once the nucleic acids are extracted, the DNA is used for analysis.
[0205] In this embodiment, the biological sample DNA consists of leukocyte genomic DNA and leukocyte genomic DNA treated with DNA methyltransferase. The target gene sequence of the leukocyte genomic DNA is unmethylated; therefore, leukocyte genomic DNA serves as a negative reference for the methylation status of the target gene sequence. The target gene sequence of the leukocyte genomic DNA treated with DNA methyltransferase is methylated; therefore, leukocyte genomic DNA treated with DNA methyltransferase serves as a positive reference for the methylation status of the target gene sequence.
[0206] Step 2: The two DNA samples are treated separately to convert the unmethylated cytosine base at position 5 into uracil, thymine, or another base that is not used for cytosine in hybridization behavior. Preferably, this is achieved by treatment with a bisulfite reagent. The term "bisulfite reagent" refers to a reagent including bisulfites, acid sulfites, or combinations thereof, as disclosed herein, which can be used to distinguish between methylated and unmethylated CpG dinucleotide sequences. Preferably, the bisulfite treatment is carried out in the presence of a denaturing solvent, such as, but not limited to, n-alkyl glycols, especially diethylene glycol dimethyl ether (DME), or in the presence of dioxane or dioxane derivatives. In a preferred embodiment, the denaturing solvent is used at a concentration of 1% to 35% (v / v). It is also preferred that the bisulfite reaction is carried out in the presence of a scavenging agent, such as, but not limited to, chromogen derivatives, such as 6-hydroxy-2,5,7,8,-tetramethylchromogen 2-carboxylic acid or trihydroxybenzoic acid and its derivatives, such as gallic acid. The bisulfite conversion is preferably carried out at a reaction temperature of 30°C to 70°C, wherein the temperature is briefly increased to above 85°C during the reaction. The bisulfite-treated DNA is preferably purified prior to quantification. This can be done by any method known in the prior art, such as, but not limited to, ultrafiltration.
[0207] Step 3: Amplify the treated DNA fragments using the primers and amplification enzymes of this invention. Several DNA fragments can be amplified simultaneously in the same reaction vessel. Preferably, the length of the amplification product is 100 to 2,000 base pairs. When the genomic DNA of the biological sample to be tested is a mixture of methylated and unmethylated states, especially when the amount of methylated DNA is much less than the amount of unmethylated DNA, such as in cell-free DNA in the peripheral blood of cancer patients, this invention employs a target gene-specific blocking agent in the PCR reaction system to improve the amplification specificity of the PCR primers. The blocking agent's nucleotide sequence has a 5' overlap region of 5 nucleotides with the 3' end of the forward (F) or reverse (R) primer; the blocking agent and the forward (F) or reverse (R) primer are complementary to the same strand of the target gene DNA; the blocking agent's melting temperature is 5°C higher than the forward (F) or reverse (R) primer; the blocking agent's nucleotide sequence contains at least one CpG dinucleotide sequence and is complementary to the unmethylated target gene DNA after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be tested is a mixture of methylated and unmethylated states, especially when the methylated DNA is far less than the unmethylated DNA, the unmethylated DNA, after bisulfite conversion, preferentially binds to the blocking agent, thereby inhibiting the binding of the DNA template to the PCR primer and thus preventing PCR amplification. The methylated DNA, however, does not bind to the blocking agent and therefore binds to the primer, resulting in PCR amplification. The fragments obtained through amplification are then detected directly or indirectly. Preferably, the marker is in the form of a fluorescent marker, a radionuclide, or an attachable molecular fragment.
[0208] Based on the target gene sequences SEQ ID NO:1-2 and SEQ ID NO:3-4, primer, probe, and blocking agent sequences (SEQ ID NO:5-12) for detecting the methylation status of the two target gene sequences MT1A and EPO were designed in this invention:
[0209] Preferably, one or more of the primers, probes, and / or blocking agents are as follows:
[0210] MT1A primer F
[0211] SEQ ID NO:5
[0212] CGGACGTAAAGGATTC
[0213] MT1A primer R
[0214] SEQ ID NO:6
[0215] GAAACGAACTCGACTAAACG
[0216] MT1A probe
[0217] SEQ ID NO:7
[0218] TGCGTTTGCGTTCGTTTCG
[0219] MT1A blocker
[0220] SEQ ID NO:8
[0221] CAAACTCAACTAAACAAACTCAACAAAACAAAC
[0222] EPO primer F
[0223] SEQ ID NO:9
[0224] AGTCGTAGAGTTTTTGGGTT
[0225] EPO primer R
[0226] SEQ ID NO:10
[0227] CAACGCGATACGACG
[0228] EPO probe
[0229] SEQ ID NO:11
[0230] CGCAACGAACGACCGA
[0231] EPO blocking agents
[0232] SEQ ID NO:12
[0233] GAGTTTTTGGGTTATTTTGGTTGTTTGTTG
[0234] In this invention, real-time PCR detection can be performed using various commercial real-time PCR instruments according to standard operating procedures of the prior art. According to certain specific embodiments, real-time PCR detection is performed on a Life Technologies instrument (7500Fast). The PCR reaction mixture consists of 25-40 ng of bisulfite-converted DNA template, 300-600 nM primers and blocking agents, 150-300 nM probes, 1 U Taq polymerase, 50-400 μM of individual dNTPs, 1-10 mM MgCl2, and 2X PCR buffer to a final volume of 2-100 μl. The sample is pre-cycled for amplification at 85-99°C for 3-60 minutes, followed by 35-55 cycles of annealing at 50-72°C for 1-30 seconds, annealing and extension at 45-80°C for 5-90 seconds, and denaturation at 85-99°C for 5-90 seconds. The gene fragment is detected by observing amplification only on the methylated target gene sequence, using a probe specific to the CpG island region of the target gene sequence containing 5-methylcytosine. Furthermore, in some embodiments, the β-actin gene (ACTB) can be used as an internal control for PCR. β-actin gene amplicons are created using primers complementary to the β-actin gene sequence, and the β-actin gene amplicons are detected using specific probes. Each sample undergoes at least one real-time PCR, and in some embodiments, two or three real-time PCR detections are performed.
[0235] Experimental results show that... Figure 2 The results of the following tests were observed: When using the composition and detection method provided by this invention to detect leukocyte genomic DNA (a negative reference for the methylation status of the target gene sequence), no PCR amplification occurred, and the result was negative, indicating that the target gene sequence of the tested DNA sample was not methylated. However, when using the composition and detection method provided by this invention to detect leukocyte genomic DNA (a positive reference for the methylation status of the target gene sequence) treated with DNA methyltransferase, PCR amplification occurred, and the result was positive, indicating that the target gene sequence of the tested DNA sample was methylated. Therefore, it can be determined that the composition and detection method provided by this invention can specifically detect the methylation status of the target gene sequence.
[0236] Example 3
[0237] According to a specific embodiment of this application, based on the average Ct value of the detection results of a certain number of esophageal cancer samples and normal samples, a Ct value, i.e., a threshold value, is determined for the target gene that can effectively distinguish between esophageal cancer and normal tissue. The methylation state of at least one CpG dinucleotide of the target gene target sequence is determined by the cycle threshold Ct value of the polymerase chain reaction. By comparing the Ct value of the tested sample with the pre-set threshold value, it is determined whether the analysis result based on the target gene is negative (normal) or positive (esophageal cancer).
[0238] This embodiment includes the following steps:
[0239] First, plasma samples were obtained from 20 esophageal cancer patients and 22 healthy individuals. All samples were sourced from Borcheng Pharmaceuticals. Peripheral blood cell-free DNA was then extracted from the samples and pretreated to convert the unmethylated cytosine base at position 5 into uracil, thymine, or another base that does not act as cytosine in hybridization. In this embodiment, this pretreatment was achieved using a bisulfite reagent. DNA extraction and treatment can be performed using any standard method available in the art; specifically, in this embodiment, all sample DNA extraction and bisulfite DNA modification were performed using a Borcheng Pharmaceuticals plasma processing kit.
[0240] Then, the aforementioned target gene primer, probe, and blocking agent combination was added to DNA samples from 20 esophageal cancer patients and 22 healthy individuals after treatment. The methylation status of the target gene sequence was detected by PCR. In this experiment, the PCR was performed on a Life Technologies instrument (7500). The PCR reaction mixture consisted of 35 ng of bisulfite-converted DNA template, 450 nM primers and blocking agent, 225 nM probe, 1 U Taq polymerase, 200 μM of each dNTP, 4.5 mM MgCl2, and 2X PCR buffer, adjusted to a final volume of 50 μl. The samples were amplified using pre-cycle amplification at 94 °C for 20 minutes, followed by 45 cycles of annealing at 62 °C for 5 seconds, annealing and extension at 55.5 °C for 35 seconds, and denaturation at 93 °C for 30 seconds.
[0241] Finally, the Ct values of real-time PCR for the target gene sequence were measured in DNA samples from 20 esophageal cancer patients and 22 healthy individuals. The results are as follows: Figure 3As shown: 1) By selecting a specific threshold value, preferably Ct = 37, the detection of the methylation status of the target gene sequence using the composition and detection method provided by the present invention can effectively detect esophageal cancer patients; in this embodiment, when Ct value is 37 as the threshold value, the sensitivity of the target gene sequence methylation detection of esophageal cancer is 55% (MT1A) and 45% (EPO); 2) The methylation of the target gene sequence has good specificity. The detection of normal people shows that the specificity of the target gene sequence methylation for normal people is 95% (MT1A) and 95% (EPO); 3) By combining the methylation detection results of the MT1A gene and the EPO gene, the sensitivity of esophageal cancer detection can be increased to 60%, while the specificity remains at 95%.
[0242] The above experimental results demonstrate that methylated DNA of the target gene sequence is a marker of esophageal cancer. The detection of methylated DNA of the target gene sequence according to this invention enables non-invasive in vitro detection of esophageal cancer and improves the detection rate.
[0243] In summary, this application utilizes the aforementioned composition, nucleic acid sequence, kit, and their uses, as well as the above-described detection method, to achieve in vitro detection of esophageal cancer using methylation biomarkers of target gene sequences by detecting methylated nucleic acid sequences of target gene target sequences and their fragments. This effectively improves the sensitivity and specificity of in vitro esophageal cancer detection. By using real-time PCR analysis of cell-free DNA in plasma samples, the methylation status of target gene target sequences can be conveniently detected, and the CT value of real-time PCR can be used to quickly and easily determine whether a sample is positive, providing a non-invasive and convenient in vitro detection method for esophageal cancer.
[0244] While various aspects and embodiments of the invention have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The aspects and embodiments disclosed herein are for illustrative purposes only and not for limiting purposes. The scope and spirit of the invention are determined solely by the appended claims. sequence list <110> Bocheng (Beijing) Technology Co., Ltd. <120> Compositions for detecting esophageal cancer and their uses <130> PA00035D2 <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 171 <212> DNA <213> Humans <400> 1 cacccagggg agctcagtgg actgtgcgcc ttgcctttct gctgcgcaaa gcccagtcca 60 ggtcatcacc tcgggcgggg cggactcggc tgggcggact cagcggggcg ggcgcaggcg 120 cagggcgggt cctttgcgtc cggccctctt tcccctgacc ataaaagcag c 171 <210> 2 <211> 171 <212> DNA <213> Human <400> 2 gctgctttta tggtcagggg aaagagggcc ggacgcaaag gacccgccct gcgcctgcgc 60 ccgccccgct gagtccgccc agccgagtcc gccccgcccg aggtgatgac ctggactggg 120 ctttgcgcag cagaaaggca aggcgcacag tccactgagc tcccctgggt g 171 <210> 3 <211> 259 <212> DNA <213> Human <400> 3 cgcgcacgca cacatgcaga taacagcccc gacccccggc cagagccgca gagtccctgg 60 gccaccccgg ccgctcgctg cgctgcgccg caccgcgctg tcctcccgga gccggaccgg 120 ggccaccgcg cccgctctgc tccgacaccg cgccccctgg acagccgccc tctcctccag 180 gcccgtgggg ctggccctgc accgccgagc ttcccgggat gagggccccc ggtgtggtca 240 cccggcgcgc cccaggtcg 259 <210> 4 <211> 259 <212> DNA [[ID=१०]]<213> Human <400> 4 cgacctgggg cgcgccgggt gaccacaccg ggggccctca tcccgggaag ctcggcggtg 60 cagggccagc cccacgggcc tggaggagag ggcggctgtc cagggggcgc ggtgtcggag 120 cagagcgggc gcggtggccc cggtccggct ccgggaggac agcgcggtgc ggcgcagcgc 180 agcgagcggc cggggtggcc cagggactct gcggctctgg ccgggggtcg gggctgttat 240 ctgcatgtgt gcgtgcgcg 259 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 cggacgtaaa ggattc "16" <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 gaaacgaact cgactaaacg 20 <210> 7 <211> 19 <212> DNA Note: In the translation, for the Chinese character "人类", it is translated as "Human" which is more in line with the context of biological or scientific texts. Also, for the Chinese "人工序列", it is translated as "Artificial Sequence". And for the Chinese "引物", it is translated as "Primer". The numbers within the sequences are kept as they are. <213> Artificial sequence <220> <223> probe <400> 7 tgcgtttgcg ttcgtttcg 19 <210> 8 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Blocker <400> 8 caaactcaac taaacaaact caacaaaaca aac 33 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 9 agtcgtagag tttttgggtt 20 <210> 10 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 10 caacgcgata cgacg 15 <210> 11 <211> 16 <212> DNA <213> Artificial sequence <220> <223> probe <400> 11 cgcaacgaac gaccga 16 <210> 12 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Blocker <400> 12 gagtttttgg gttattttgg ttgtttgttg 30
Claims
1. Use of a composition in the preparation of a kit for in vitro detection of esophageal cancer, the composition being selected from: a nucleic acid for detecting methylation state of a target gene, wherein the target gene being an MT1A gene, wherein the target sequence of the MT1A gene is shown as SEQ ID NO: 1, the nucleic acid being: an MT1A primer F shown as SEQ ID NO: 5, an MT1A primer R shown as SEQ ID NO: 6, an MT1A probe shown as SEQ ID NO: 7, and an MT1A blocker shown as SEQ ID NO:
8.
2. Use of a target sequence of an MT1A gene in the preparation of a kit for in vitro detection of esophageal cancer, wherein the target sequence of the MT1A gene being shown as SEQ ID NO:
1.
3. Use according to claim 2, wherein, The kit for in vitro detection of esophageal cancer detects esophageal cancer by a method comprising the following steps: isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested; determining the methylation state of the target sequence of the target gene; and judging the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of esophageal cancer.
4. Use according to claim 3, wherein, The method comprises the following steps: extracting genomic DNA of a biological sample to be tested; treating the extracted genomic DNA with a reagent to convert 5-unmethylated cytosine bases to uracil or other bases; contacting the DNA sample treated with the reagent with a DNA polymerase and primers of a target sequence of a target gene, and performing a DNA polymerization reaction in the presence of a blocker that preferentially binds to the target sequence in a non-methylated state; detecting the amplification product with a probe; and determining the methylation state of at least one CpG dinucleotide of the target sequence of the target gene based on whether the amplification product is present.
5. Use according to claim 4, wherein, The reagent is a bisulfite reagent.
Citation Information
Patent Citations
Method for activating expression of erythrogenin genes
CN103667344A
Gene marker and method for detection of oral cancer
US20110300536A1