Composition for diagnosing or treating anticancer drug resistance

Abstract

The present application relates to a composition for diagnosing resistance to ECF combination therapy (epirubicin, cisplatin, and 5-fluorouracil; ECF) for treating gastric cancer, and a diagnostic kit using the same. In order to solve the problem of recurrence and resistance, NINJ2 can be inhibited by early detection of the occurrence of resistance, thereby inhibiting the recurrence and treatment resistance of gastric cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to a composition capable of diagnosing and treating anticancer drug resistance. BACKGROUND

[0002] Cancer is one of the incurable diseases that humans need to solve, and in the global context, enormous funds have been invested for development in order to cure cancer. In Korea, cancer is the first cause of disease death, and more than 100,000 people are diagnosed with cancer every year, and more than 60,000 people die from cancer. In particular, gastric cancer is the fifth disease in terms of diagnosis frequency worldwide in 2018. Over the past decade, various anticancer therapies for cancer diagnosis and treatment have rapidly developed, but the mortality rate of cancer is still high. In addition, various attempts of anticancer drugs and various anticancer therapies are still accompanied by side effects. In order to alleviate these side effects, active research has been conducted.

[0003] Compared to surgery alone, preoperative chemotherapy or a combination of chemotherapy and radiotherapy can improve survival in gastric cancer patients. The National Comprehensive Cancer Network (NCNN) guidelines of 2017 recommend a three-drug combination treatment (epirubicin, cisplatin, and 5-fluorouracil; ECF) as one of the first-line chemotherapy regimens for gastric cancer, which was first developed in 1991 by the Royal Marsden Hospital in England. It has been confirmed that the 5-year survival rate of the preoperative ECF treatment group is advantageously increased by about 15% or more compared to the surgery-only treatment group. Despite such advantages, drug resistance is a major factor that antagonizes the effectiveness of successful anticancer treatment and worsens the prognosis of gastric cancer. Drug resistance of cancer cells (chemoresistance) is classified into existing drug resistance-mediated factors and newly acquired drug resistance caused by drug administration (Cancer Drug Resistance: An Evolving Paradigm. Nat Rev Cancer. 2013 Oct;13(10):714-26).

[0004] The causes of acquired drug resistance can include, for example, increased drug efflux, mutation of drug targets, repair of DNA damage, activation of alternative signaling pathways, or avoidance of cell death caused by drug resistance. Even if drug treatment is performed on a drug-resistant patient, the treatment effect cannot be guaranteed, and thus it is possible to cause unnecessary time and cost burdens to doctors and patients. Therefore, when starting anticancer treatment, the treatment plan should be determined considering the individual characteristics of the patient according to the difference in the treatment plan. In addition, what is needed in reality is not to blindly perform treatment, but to have a standard to estimate the treatment efficiency in advance through a specific biomarker in order to selectively use a drug tailored for a patient. As described above, there are few studies on drug resistance, and thus the present inventors found a marker that makes it possible to pre-select a patient resistant to ECF, thereby completing the present application. SUMMARY

[0005] TECHNICAL PROBLEM

[0006] An object of the present application is to provide a composition for diagnosing anticancer drug resistance.

[0007] Another object of the present application is to provide a kit for diagnosing anticancer drug resistance.

[0008] Still another object of the present application is to provide a method of providing anticancer drug resistance information.

[0009] Still another object of the present application is to provide a pharmaceutical composition for preventing or treating cancer and a method for preventing or treating cancer.

[0010] Another object of the present application is to provide a pharmaceutical composition for treating anticancer drug resistance and a method for treating anticancer drug resistance.

[0011] Another object of the present application is to provide a pharmaceutical composition for enhancing anticancer drug sensitivity and a method for enhancing anticancer drug sensitivity.

[0012] Still another object of the present application is to provide a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer and a method for preventing or treating anticancer drug-resistant cancer.

[0013] Still another object of the present application is to provide an anticancer drug-resistant cancer organoid.

[0014] Still another object of the present application is to provide a method of screening a drug for overcoming or treating anticancer drug resistance or a drug for enhancing anticancer drug sensitivity.

[0015] However, the objects to be achieved by the present application are not limited to the above-mentioned objects, and other objects not mentioned herein will be clearly understood by those of ordinary skill in the art from the following description.

[0016] TECHNICAL SOLUTION

[0017] Various embodiments according to the present application will be described herein below with reference to the accompanying drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. One or more embodiments may, however, be practiced without one or more of these specific details. In other instances, well-known methods and procedures have not been described in detail so as not to unnecessarily obscure the present application. Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure, configuration, or characteristic described in connection with the embodiment is included in at least one embodiment of the present application. Thus, the appearance of the phrase "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily referring to the same embodiment of the present application. Furthermore, the particular features, structures, configurations, or characteristics can be combined in any suitable manner in one or more embodiments.

[0018] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains.

[0019] 1. Use for diagnosing anticancer drug resistance

[0020] One embodiment of the present application relates to a composition for diagnosing anticancer drug resistance.

[0021] In the present application, the diagnostic composition can comprise a reagent for measuring the expression level of NINJ2 (Ninjurin 2) protein or a gene encoding the same.

[0022] In the present application, the protein encoded by the "NINJ2 (Ninjurin 2)" gene belongs to the Ninjurin family, which induces nerve injury. The NINJ2 protein refers to a cell surface adhesion protein that is upregulated in Schwann cells around the distal segment of an injured nerve and plays a role in nerve regeneration after nerve injury by promoting neurite growth. Information on the NINJ2 protein and gene can be obtained from the National Center for Biotechnology Information (NCBI) (Gene No. 4815). There are various variants of NINJ2 protein or a gene encoding the same, including isoform-1, isoform-2, and isoform-3. The amino acid sequences of NINJ2 isoform-1 and isoform-3 used in the present application are shown in SEQ ID NO: 1 and SEQ ID: 2, and the gene sequences encoding the NINJ2 isoform-1 and isoform-3 proteins are shown in SEQ ID NO: 3 and 4. In the present application, the NINJ2 protein or a gene encoding the same is derived from humans, but its origin is not limited to humans and can include any species.

[0023] In the present application, the "NINJ2 protein or gene encoding the same" can consist of the amino acid sequence of NINJ2 subtype 1 shown in SEQ ID NO: 1, the amino acid sequence of NINJ2 subtype 3 shown in SEQ ID NO: 2, the nucleotide sequence of NINJ2 subtype 1 shown in SEQ ID NO: 3, or the nucleotide sequence of NINJ2 subtype 3 shown in SEQ ID NO: 4, but is not limited thereto. Non-limiting examples thereof can include sequences having 99% to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% homology with the NINJ2 sequence, but are not limited thereto, and can include all sequences, as long as they apparently exert the intended effects of the present application to those skilled in the art.

[0024] In the present application, the term "drug" or "anti-cancer therapeutic drug" can be used interchangeably with the term "anti-cancer drug", and the term "anti-cancer drug" refers to a drug that exhibits an anti-cancer effect by killing cancer cells and cancer stem cells, and more preferably refers to a drug effective for treating gastric cancer.

[0025] In the present invention, the "anti-cancer drug" refers to a drug having a mechanism of killing cancer cells, and can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lapatinib, gefitinib, vandetanib, nilotinib, semasanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscum album, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab tusetan, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, floxuridine, enocitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmofur, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, dactinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, hexamethylmelamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, tretonine, exemestane, aminoglutethimide, anagrelide, navelbine, fadrazol, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine. Preferably, the anti-cancer drug can be a drug comprising at least one selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, more preferably, can be an ECF combination comprising epirubicin, cisplatin, and 5-fluorouracil. In addition, the anti-cancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0026] In the present application, the "epirubicin" is an anticancer drug classified as a member of the anthracycline family, which is known to inhibit DNA and RNA synthesis by binding to DNA and to induce DNA cleavage by DNA topoisomerase 2, thereby inhibiting cancer cells. In addition, epirubicin can damage DNA by generating free radicals, and examples of drugs in the same family as epirubicin include doxorubicin, daunorubicin, idarubicin, etc.

[0027] In the present application, the "cisplatin" refers to an anticancer drug classified as a member of the platinum family, which inhibits DNA repair and RNA synthesis by DNA cross-linking. Examples of anticancer drugs belonging to the platinum family include carboplatin, oxaliplatin, nedaplatin, triplatin tetranitrate, phenanthriplatin, satraplatin, picoplatin, etc.

[0028] In the present application, the "5-fluorouracil (5-FU)" is an anticancer drug classified as a member of the antimetabolite family, and is known to inhibit cell division and tumor growth by inhibiting metabolites. Examples of anticancer drugs belonging to the antimetabolite family include 6-mercaptopurine (6-MP), capecitabine, cytarabine, fluorouracil, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, phototrexate, etc.

[0029] The "ECF combination" in the present application corresponds to a drug proposed as one of the first-line chemotherapy regimens for gastric cancer in the 2017 National Comprehensive Cancer Network (NCCN) guidelines. The ECF combination is a drug first developed in 1991 by the Royal Marsden Hospital in the UK, and it is known that the 5-year survival rate of the preoperative ECF combination treatment group is increased. However, the ECF combination has problems such as an increase in tumor initiating cells (TICs) after treatment leading to cancer recurrence, and the development of resistance to the ECF combination. Therefore, research on various mechanisms of action of the ECF combination is ongoing.

[0030] In the present application, the anticancer drug belonging to the same family as ECF (epirubicin, cisplatin, and 5-fluorouracil) corresponds to a drug that inhibits cancer cells by the same mechanism, and thus the results exhibited by ECF-resistant cells are not limited to those exhibited by the ECF combination, but are also applicable to those exhibited by one or more anticancer drugs selected from the anthracycline, platinum, and antimetabolite families. Therefore, drugs having the same mechanism of action are not limited to the above-mentioned drugs.

[0031] In the present invention, the term "anticancer drug resistance" refers to a case where the effect of an anticancer drug is reduced when the anticancer drug is quantitatively and repeatedly used, and refers to a case where the same effect as that experienced by a patient having resistance to the anticancer drug is required to be obtained by increasing the frequency of use of the anticancer drug or the amount of the anticancer drug used, or a case where the same effect as that of the past cannot be obtained even if the same dose of the anticancer drug is administered. In the present invention, when the expression level of NINJ2 protein or a gene encoding the same is increased compared to a normal control group, the sample is diagnosed as having anticancer drug resistance.

[0032] In the present invention, the "diagnosis" is defined in a broad sense, and includes: determining the sensitivity of a subject to an anticancer drug; determining whether a currently developed disease has resistance to an anticancer drug; determining the prognosis of an anticancer drug-resistant cancer (for example, determining the responsiveness of a cancer to an anticancer drug; or providing diagnostic information).

[0033] As used herein, the term "prognosis" refers to an act of predicting the course of a disease and the result of death or survival. The term "prognosis" or "prognostic diagnosis" can be interpreted as any act of predicting the course of a disease by comprehensively considering the course and condition of a patient before / after treatment, which can be different depending on the physiological or environmental conditions of the patient. For the purpose of the present invention, the term "prognosis" can be interpreted as an act of predicting the responsiveness to treatment after treatment with an anticancer drug, preferably treatment with a drug that can be considered to belong to the same family as each drug in ECF, more preferably treatment with ECF combination, or an act of appropriately selecting whether to use ECF combination based on the prediction result of the responsiveness to treatment.

[0034] As used herein, the term "tumor" or "cancer" refers to a disease in which cell division is not regulated and cells continuously divide, and is classified into carcinoma and sarcoma according to the site where it occurs. The term "carcinoma" refers to a malignant tumor that occurs in epithelial cells such as mucosal cells or skin cells, and the term "sarcoma" refers to a malignant tumor that occurs in non-epithelial cells such as muscle cells, connective tissue cells, bone cells, cartilage cells, or blood vessel cells.

[0035] In the present invention, an anticancer treatment can be performed on a cancer patient using one or more selected from epirubicin, cisplatin, and 5-fluorouracil, and more preferably a combination of ECF (epirubicin, cisplatin, and 5-fluorouracil) containing epirubicin, cisplatin, and 5-fluorouracil. In addition, any anticancer drug that can be considered to belong to the same family as each drug in ECF can be used without limitation.

[0036] In the present invention, the prognosis prediction can be a prediction of the responsiveness to treatment after treatment of a cancer patient with the anticancer drug, or a prediction of whether resistance to the anticancer drug occurs.

[0037] As used herein, the term "cancer" as a disease to be treated refers to or describes a physiological condition of a mammal that is typically characterized by uncontrolled cell growth. The cancer can be thyroid cancer, parathyroid cancer, stomach cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, pelvic kidney cancer, CNS central nervous system tumor, primary CNS lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on cancer cells and / or cancer stem cells described in the present application.

[0038] The composition for diagnosing anticancer drug resistance of the present application can further contain a reagent for measuring the expression level of at least one of periostin and CD44 protein, or a gene encoding at least one protein.

[0039] As used herein, the term "periostin" is also referred to as POSTN, PN, or osteoblast-specific factor OSF-2, and refers to a protein encoded by POSTN gene in humans. In addition, the periostin protein is known as a ligand for α-V / β-3 and α-V / β-5 integrins, enabling epithelial cells to adhere and migrate. The periostin protein is a Gla domain vitamin K-dependent factor, and in many cancers, activates Akt / PKB and FAK-mediated signaling pathways by binding to integrins of cancer cells, thereby increasing cell survival, invasion, angiogenesis, metastasis, and epithelial-mesenchymal transition.

[0040] In the present application, information on the periostin protein and gene is available from the National Center for Biotechnology Information (NCBI) (Gene No.: 10631), and the amino acid sequence of the periostin used in the present application is shown as SEQ ID NO: 7. In the present application, the periostin protein or gene encoding the same is derived from humans, but its origin is not limited to humans, and can include any species. Non-limiting examples thereof can include sequences having 99% to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% homology to the periostin sequence, but are not limited thereto, and can include all sequences as long as a person skilled in the art can obviously see that the sequences exert the desired effects of the present application.

[0041] As used herein, the term "CD44" refers to a marker expressed on the plasma membrane of a cell or a cancer stem cell (e.g., a drug-resistant cancer cell). More specifically, the CD44 antigen is a cell surface glycoprotein involved in cell-cell interactions, cell adhesion, and migration. It is well known that CD44 plays a key role in tumorigenesis, plasticity of cancer stem cells, and chemoresistance.

[0042] In the present application, information on CD44 protein and gene is available from the National Center for Biotechnology Information (NCBI) (Gene No.: 960), and the amino acid sequence of CD44 used in the present application is shown as SEQ ID NO: 8. In the present application, the CD44 protein or gene encoding the same is derived from a human, but its origin is not limited to a human and can include any species. Non-limiting examples thereof can include sequences having 99% to less than 100%, 95% to less than 99%, 90% to less than 95%, 85% to less than 90%, or 80% to less than 85% homology to the CD44 sequence, but are not limited thereto, and can include all sequences as long as a person skilled in the art can obviously see that the sequences exert the desired effects of the present application.

[0043] In the composition for diagnosing anticancer drug resistance according to the present application, the preparation for measuring the expression level of a protein can include at least one selected from the group consisting of an antibody, an oligopeptide, a ligand, a peptide nucleic acid (PNA), and an aptamer that specifically binds to the protein, but is not limited thereto.

[0044] As used herein, the term "antibody" refers to a substance that specifically binds to an antigen to cause an antigen-antibody reaction. For the purpose of the present application, the antibody refers to an antibody that specifically binds to a protein. The antibody of the present application includes all polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. The antibody can be easily prepared using techniques known in the art. For example, the polyclonal antibody can be prepared using methods known in the art, which include the process of injecting a protein antigen into an animal, collecting blood from the animal, and isolating serum containing the antibody. Such polyclonal antibodies can be prepared from any animal species (e.g., goat, rabbit, sheep, monkey, horse, pig, cow, or dog). In addition, the monoclonal antibody can be prepared using a hybridoma method known in the art (see Kohler and Milstein (1976), European Journal of Immunology, 6:511-519) or a phage antibody library technique (see Clackson et al., Nature, 352:624-628, 1991; Marks et al., Journal of Molecular Biology, 222:58, 1-597, 1991). The antibody prepared by the above method can be isolated and purified by gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, etc. In addition, the antibody of the present application includes a functional fragment of an antibody molecule as well as an intact form having two full-length light chains and two full-length heavy chains. The expression of the "functional fragment of an antibody molecule" refers to a fragment that retains at least one antigen-binding function, and examples of the functional fragment include Fab, F(ab'), F(ab')2, and Fv.

[0045] In the present application, the "oligopeptide" is a peptide consisting of 2 to 20 amino acids, and examples thereof include, but are not limited to, dipeptides, tripeptides, tetrapeptides, and pentapeptides.

[0046] In the present invention, the "peptide nucleic acid (PNA)" refers to an artificial synthetic polymer similar to DNA or RNA, which was first introduced by Professors Nielsen, Egholm, Berg and Buchardt (University of Copenhagen, Denmark) in 1991. DNA has a ribophosphate backbone, whereas PNA has a backbone consisting of N-(2-aminoethyl)glycine repeat units connected by peptide bonds. Due to this structure, the binding affinity of PNA to DNA or RNA is significantly increased, and the stability is significantly improved, and thus is used in molecular biology, diagnostic analysis, and antisense therapy. PNA is disclosed in detail in Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991), "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide", Science, 254 (5037): 1497-1500.

[0047] In the present invention, the "aptamer" is an oligonucleotide or peptide molecule, and the general content of the aptamer is disclosed in detail in Bock LC et al., Nature, 355 (6360): 564-6 (1992); Hoppe-Seyler F, Butz K, "Peptide aptamers: powerful new tools for molecular medicine", J Mol Med, 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R, "An artificial cell-cycle inhibitor isolated from a combinatorial library", Proc Natl Acad Sci U S A, 95 (24): 142727 (1998).

[0048] In the composition for diagnosing the anticancer drug resistance according to the present invention, the reagent for measuring the expression level of the gene encoding the protein can include at least one selected from the group consisting of primers, probes, and antisense nucleotides that specifically bind to the gene encoding the protein, without being limited thereto.

[0049] In the present invention, the "primer" is a fragment that recognizes a target gene sequence, and includes a pair of forward and reverse primers. Preferably, the primer is a primer pair that provides an analysis result with specificity and sensitivity. Since the nucleotide sequence of the primer does not match the non-target sequence in the sample, when the primer only amplifies the target gene sequence containing the complementary primer binding site without causing non-specific amplification, it can exhibit high specificity.

[0050] In the present invention, the "probe" refers to a substance that can specifically bind to a target substance to be detected in a sample, and can recognize the presence of the target substance in the sample through the binding specificity. The kind of probe is not particularly limited as long as it is a substance commonly used in the art. Preferably, the probe can be a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a peptide, a polypeptide, a protein, RNA, or DNA. Most preferably, the probe is a PNA. More specifically, the probe can be a biological material from an organism, an analog thereof, or a material produced in vitro, examples of which include enzymes, proteins, antibodies, microorganisms, animal / plant cells and organs, neural cells, DNA, and RNA. Examples of DNA include cDNA, genomic DNA, and oligonucleotides, examples of RNA include genomic RNA, mRNA, and oligonucleotides, and examples of proteins include antibodies, antigens, enzymes, and peptides.

[0051] In the present invention, the "locked nucleic acid (LNA)" refers to a nucleic acid analog containing a 2'-O or 4'-C methylene bridge [J Weiler, J Hunziker, and J Hall Gene Therapy (2006) 13, 496.502]. LNA nucleosides include common nucleic acid bases of DNA and RNA, and can form base pairs according to the Watson-Crick base pairing rule. However, due to the "locking" of the molecule caused by the methylene bridge, LNA fails to form an ideal shape in the Watson-Crick bond. When LNA is integrated into a DNA or RNA oligonucleotide, it can pair more quickly with a complementary nucleotide chain, thereby increasing the stability of the double strand.

[0052] In the present invention, the "antisense" refers to an oligomer having a nucleotide base sequence and a subunit-to-subunit backbone that allows the antisense oligomer to hybridize to a target sequence in RNA through Watson-Crick base pairing, forming a RNA: oligomer heteroduplex nucleic acid molecule, which is usually associated with mRNA. The oligomer can have exact sequence complementarity or near complementarity with the target sequence.

[0053] Information on NINJ2, periostin or CD44 protein or genes encoding these proteins according to the present application is known. Thus, based on these information, one skilled in the art can easily design primers, probes or antisense nucleotides that specifically bind to genes encoding the proteins.

[0054] Another embodiment of the present application relates to a kit for diagnosing anticancer drug resistance, the kit containing the composition for diagnosing anticancer drug resistance according to the present application.

[0055] In the present application, the "kit" refers to a tool capable of evaluating the expression level of a biomarker by using a probe or antibody specifically bound to a biomarker component labeled with a detectable tag. The term "labeled" with respect to the probe or antibody is intended to include direct labeling by coupling a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another directly labeled reagent. The kit can include a chromogenic substrate solution to induce a chromogenic reaction with the tag; a washing solution and other solutions, and can be formulated to contain reagent components to be used. In the present application, the kit can be a kit containing essential elements necessary for performing RT-PCR, in addition to each marker gene-specific primer pair, and can include test tubes, reaction buffer, deoxyribonucleotides (dNTPs), Taq-polymerase, reverse transcriptase, DNase, RNase inhibitor, sterile water, etc. Further, the kit can be a kit for detecting genes predicting HPD prognosis, containing essential elements necessary for performing DNA chip analysis. The DNA chip kit can include a substrate to which cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate can include cDNA corresponding to a quantitative control gene or a fragment thereof. The kit of the present application is not limited thereto, but can be any kit known in the art.

[0056] In the present application, the kit can be, but is not limited to, an RT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, a rapid kit or a multiple reaction monitoring (MRM) kit.

[0057] The kit according to the present application can further include one or more of other component compositions, solutions, or devices suitable for the analysis method. For example, the kit according to the present application can further include essential elements required for performing a reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit includes a pair of primers specific to a gene encoding a marker protein. Each primer is a nucleotide having a nucleic acid sequence specific to the gene, and can have a length of about 7 bp to about 50 bp, more preferably about 10 bp to about 30 bp. In addition, the kit can include primers specific to a nucleic acid sequence of a control gene. Furthermore, the reverse transcription polymerase reaction kit can include test tubes or other suitable containers, buffers (having different pH and magnesium concentrations), deoxyribonucleotides (dNTPs), enzymes (such as Taq-polymerase and reverse transcriptase), DNAse and RNAse inhibitors, DEPC-water, sterile water, etc.

[0058] In addition, the kit for diagnosing resistance to anticancer drugs according to the present application can include essential elements required for performing a DNA chip analysis. The DNA chip kit can include a substrate to which genes or cDNAs or oligonucleotides corresponding to the fragments are attached, and reagents, preparations, and enzymes for constructing a fluorescently labeled probe. In addition, the substrate can include a control gene or a cDNA or oligonucleotide corresponding to a fragment thereof.

[0059] In addition, the kit for diagnosing resistance to anticancer drugs according to the present application can include essential elements required for performing ELISA. The ELISA kit can include an antibody specific to the protein. The antibody has high specificity and affinity to the marker protein, and has no cross-reactivity with other proteins, and can be a monoclonal antibody, a polyclonal antibody, or a recombinant antibody. In addition, the ELISA kit can include an antibody specific to a control protein. Furthermore, the ELISA kit can further include a reagent capable of detecting the bound antibody, for example, a labeled secondary antibody, a chromophore, an enzyme (for example, conjugated to an antibody) and a substrate thereof, or other substances capable of binding to an antibody.

[0060] In the kit for diagnosing resistance to anticancer drugs according to the present application, the immobilization device for an antigen-antibody binding reaction can be a well plate synthesized from a glass slide made of nitrocellulose membrane, PVDF membrane, polyvinyl resin, or polystyrene resin, but is not limited thereto.

[0061] In the kit for diagnosing resistance to anticancer drugs according to the present application, the label for the secondary antibody is preferably a conventional color developer for color development, and examples of the label include, but are not limited to, fluorescein (such as HRP (horseradish peroxidase)), alkaline phosphatase, colloidal gold, FITC (poly-L-lysine-fluorescein isothiocyanate), RITC (rhodamine-B-isothiocyanate), and a dye.

[0062] In the kit for diagnosing anticancer drug resistance according to the present application, a chromogenic substrate that preferably induces a chromogenic reaction according to a chromogenic label can be TMB (3,3',5,5'-tetramethylbenzidine), ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)] or OPD (o-phenylenediamine). In this case, the chromogenic substrate is more preferably provided in a form of being dissolved in a buffer solution (0.1 M NaAc, pH 5.5). The chromogenic substrate (e.g., TMB) is degraded by HRP labeled as a conjugate of the secondary antibody, forming a chromogenic agent, and the presence of the labeled protein is detected by visually checking the degree of deposition of the chromogenic agent.

[0063] The washing solution in the kit for diagnosing anticancer drug resistance according to the present application preferably includes a phosphate buffer, NaCl and Tween 20. More preferably, the washing solution is a buffer solution (PBST) consisting of 0.02 M phosphate buffer, 0.13 M NaCl and 0.05% Tween 20. After the antigen-antibody binding reaction, the secondary antibody can react with the antigen-antibody complex, and then an appropriate amount of the washing solution is added to the fixation device to wash the resulting conjugate 3 to 6 times. As a reaction stop solution, a sulfuric acid (H2SO4) solution can be preferably used.

[0064] Another embodiment of the present application relates to a method for providing information for diagnosing anticancer drug resistance.

[0065] The method according to the present application can include a step of measuring the expression level of NINJ2 protein or a gene encoding the same in a biological sample isolated from a subject of interest.

[0066] The method according to the present application can be intended to screen for the presence or absence of anticancer drug resistance in a biological sample isolated from the subject of interest.

[0067] In the present application, the "subject of interest" refers to a subject who has or can have cancer, and can be a mammal including a human. For example, the subject of interest can be selected from the group consisting of a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog, a cat, a cow, a horse, a pig, a sheep and a goat. Preferably, the subject of interest can be a human, but is not limited thereto.

[0068] In the present application, the "biological sample" refers to any material, biological fluid, tissue or cell obtained or derived from the subject. For example, the biological sample can be at least one selected from the group consisting of whole blood, white blood cells, peripheral blood mononuclear cells, white blood cell layer, plasma, serum, sputum, tears, mucus, nasal wash, nasal aspirate, breathed air, urine, semen, saliva, peritoneal wash, ascites, cyst fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymphatic fluid, pleural fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extracts or cerebrospinal fluid, but is not limited thereto.

[0069] In the present application, the method can further include a step of measuring the expression level of at least one protein selected from periostin and CD44 or a gene encoding the at least one protein.

[0070] In the present application, the reagent for measuring the expression level of the protein can include at least one selected from the group consisting of an antibody, an oligopeptide, a ligand, a peptide nucleic acid (PNA) and an aptamer, the antibody, oligopeptide, ligand and aptamer specifically binding to the protein.

[0071] In the present application, the expression level of the protein can be measured by protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry) analysis, SELDI-TOF (surface-enhanced laser desorption / ionization time-of-flight mass spectrometry) analysis, radioimmunoassay, radioimmunodiffusion, double immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (LC-MS), LC-MS / MS (liquid chromatography-mass spectrometry / mass spectrometry), Western blotting or ELISA (enzyme-linked immunosorbent assay).

[0072] Further, in the present application, the expression level of the protein can be measured by a multiple reaction monitoring (MRM) method.

[0073] In the present application, a synthetic peptide obtained by substituting a specific amino acid of a target peptide with an isotope or E. coli β-galactosidase can be used as an internal standard in the multiple reaction monitoring method.

[0074] In the present application, the NINJ2 protein can consist of the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.

[0075] In the present application, the periostin protein can consist of the amino acid sequence set forth in SEQ ID NO: 7, but is not limited thereto.

[0076] In the present application, the CD44 protein can consist of the amino acid sequence represented by SEQ ID NO: 8, but is not limited thereto.

[0077] In the present application, the reagent for measuring the expression level of the gene encoding the protein can include at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide, which specifically binds to the gene encoding the protein.

[0078] In the present application, the expression level of the gene encoding the protein can be measured by reverse transcription-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or DNA chip assay.

[0079] In the present application, the gene encoding the NINJ2 protein can consist of the nucleotide sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, but is not limited thereto.

[0080] In the method of providing information according to the present application, the antibody, oligopeptide, ligand, peptide nucleic acid (PNA), aptamer, primer, probe, etc. overlap with the above, and thus a detailed description thereof will be omitted to avoid the present specification from being overly complex.

[0081] In the present application, when the expression level of the NINJ2 protein or the gene encoding the protein detected in a biological sample isolated from a subject of interest is higher than that of a control, it can be predicted that the subject of interest has a higher possibility of having or developing resistance to an anticancer drug, and thus it can be predicted that the subject has a lower treatment responsiveness to the anticancer drug or has a poorer prognosis for cancer treatment.

[0082] In the present application, in addition to when the expression level of the NINJ2 protein or the gene encoding the protein detected in a biological sample isolated from a subject of interest is higher than that of a control, when the expression level of at least one protein selected from the group consisting of periostin and CD44 protein or the gene encoding the at least one protein is higher than that of a control, it can be predicted that the subject of interest has a higher possibility of having or developing resistance to an anticancer drug, and thus it can be predicted that the subject has a lower treatment responsiveness to the anticancer drug or has a poorer prognosis for cancer treatment.

[0083] In the present application, the "control" can be a normal control in which no anticancer drug resistance has occurred, or the average or median of the expression level of NINJ2 protein or a gene encoding the same in anticancer drug-sensitive cells. The expression level of a marker protein or a nucleic acid molecule encoding the same in the control can be compared with that in a biological sample derived from a cancer patient to be analyzed, and whether or not the change in the expression level is significant can be determined, thereby diagnosing the presence or absence of anticancer drug resistance. The range of the normal control sample also includes cells, cell cultures from a cancer patient who is confirmed to have no acquired resistance to the anticancer drug of interest, and blood, serum, plasma, and tissues from the cancer patient.

[0084] In the present application, the anticancer drug can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, mistletoe, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, epratuzumab, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimprintacin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, floxuridine, ecogitarone, decitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladrabine, carmofur, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, actinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, altretamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulfan, exemestane, aminoglutethimide, anagrelide, navelbine, fararez, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine. Preferably, the anticancer drug can be a drug comprising any one selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, more preferably, the ECF combination comprising epirubicin, cisplatin, and 5-fluorouracil. In addition, the anticancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0085] In the present application, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on the cancer cell and / or cancer stem cell described in the present application.

[0086] 2. Use for cancer treatment and treatment of anticancer drug resistance

[0087] Another embodiment of the present application relates to a pharmaceutical composition for preventing or treating cancer.

[0088] In the composition of the present application, the cancer is a cancer that has occurred or can occur in a subject of interest. Preferably, the cancer can be a cancer in which the expression level of NINJ2 protein or a gene encoding the same is higher than that of a control, but is not limited thereto. Among them, the control can be the expression level of NINJ2 protein or a gene encoding the same in a normal individual corresponding tissue, or the average or median thereof, or the expression level of NINJ2 protein or a gene encoding the same in a cancer or a corresponding cancer, or the average or median thereof, but is not limited thereto.

[0089] In the present application, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvic cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on the cancer cell and / or cancer stem cell described in the present application.

[0090] As used herein, the term "prevention" can include, but is not limited to, any action of blocking or inhibiting or delaying a symptom caused by uncontrolled growth of cancer cells by using the composition according to the present application.

[0091] As used herein, the term "treatment" can include, but is not limited to, any action of alleviating or beneficially changing a symptom caused by uncontrolled growth of cancer cells by using the composition according to the present application.

[0092] The composition according to the present application can comprise, as an active ingredient, an agent for reducing the activity or expression level of NINJ2 protein; or an agent for reducing the expression level of a gene encoding the same.

[0093] In the present application, the NINJ2 protein can consist of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the gene encoding the same can consist of the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4, but is not limited thereto.

[0094] The composition according to the present application can further comprise an agent for reducing the activity or expression level of at least one protein selected from the group consisting of periostin and CD44, or an agent for reducing the expression level of a gene encoding the same.

[0095] In the present application, the periostin protein can consist of the amino acid sequence shown in SEQ ID NO: 7, but is not limited thereto.

[0096] In the present application, the CD44 protein can consist of the amino acid sequence shown in SEQ ID NO: 8, but is not limited thereto.

[0097] The agent for reducing the activity or expression level of the protein according to the present application can include one or more selected from the group consisting of a compound, a peptide, a peptidomimetic, an aptamer, an antibody, and a natural product that specifically binds to the protein or a portion thereof, but is not limited thereto. However, the agent for reducing the activity or expression level of the protein is not limited thereto, and can include any agent that exhibits an inhibitory effect on the activity or expression of the target NINJ2 protein by directly or indirectly acting on the same, and can be readily obtained by using known techniques of methods commonly used in the art.

[0098] In the present invention, the "mimetic peptide" is a peptide or non-peptide that inhibits the binding domain of the NINJ2 protein, thereby inhibiting the activity of NINJ2. The main residues of non-hydrolysable peptide analogs can be used with a beta-transdipeptide nucleus (Nagai et al., Tetrahedron Lett 26:6 47, 1985), a ketomethylene pseudopeptide (Ewenson et al., J Med Chem 29:295, 1986; and Ewenson et al., Peptides: Structure and Function (Proceedings of the Ninth American Peptide Symposium), Pierce Chemical Company, Rockland, Israel, 1985), an azetidine (Huffman et al., Peptides: Chemistry and Biology, G.R. Marshall, Ed., ESCOM Science Publishers: Leiden, The Netherlands, 1988), a benzodiazepine (Freidinger et al., Peptides: Chemistry and Biology, G.R. Marshall, Ed., ESCOM Science Publishers: Leiden, The Netherlands, 1988), a beta-amino alcohol (Gordon et al., Biochem Biophys Res Commun 126:419, 1985), and a substituted gamma-lactam ring (Garvey et al., Peptides: Chemistry and Biology, G.R. Marshall, Ed., ESCOM Science Publishers: Leiden, The Netherlands, 1988).

[0099] In the present invention, the "aptamer" is a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure by itself, and can bind to a target molecule with high affinity and specificity. Since the aptamer discovery technology called SELEX (Systematic Evolution of Ligands by Exponential Enrichment) was first developed (Ellington, AD and Szostak, JW, Nature, 346:818-822, 1990), many aptamers that can bind to various target molecules, including small organic molecules, peptides, and membrane proteins, etc., have been discovered. The aptamer can be comparable to a monoclonal antibody in that it has the ability to bind to a target molecule with a unique high affinity (usually at the pM level) and specificity, and has a high potential as an alternative antibody, especially a "chemical antibody".

[0100] In the present invention, the "antibody" can be prepared by injecting the protein or can be obtained on the market. In addition, the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.

[0101] The polyclonal antibody can be prepared by a conventional method of obtaining serum containing the antibody by injecting the protein into an animal and collecting blood from the corresponding animal. Such polyclonal antibody can be purified by any known method in the art and prepared from any animal species host such as a goat, a rabbit, a sheep, a monkey, a horse, a pig, a cow, a dog, etc.

[0102] The monoclonal antibody can be produced using any technique of providing antibody molecules by culturing a continuous cell line. These techniques include, but are not limited to, a hybridoma technique, a human B cell hybridoma technique, and an EBV hybridoma technique.

[0103] In addition, an antibody fragment containing a specific binding site for the protein can be produced. For example, a F(ab')2 fragment can be produced by degrading an antibody molecule with pepsin, and a Fab fragment can be produced by reducing disulfide bonds of a F(ab')2 fragment, but is not limited thereto. In addition, by reducing a Fab expression library, a monoclonal Fab fragment having a desired specificity can be quickly and easily identified.

[0104] In the present application, the antibody can be bound to a solid substrate to facilitate subsequent steps such as washing or separating a complex. Examples of the solid substrate include a synthetic resin, nitrocellulose, a glass substrate, a metal substrate, glass fiber, a microsphere, a microbead, etc. In addition, examples of the synthetic resin include polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, nylon, etc.

[0105] In the present application, the agent for reducing the activity or expression level of the protein can specifically bind to the NINJ2 protein polypeptide represented by SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the composition of the present application can include an antibody specific to the NINJ2 protein, wherein the antibody can specifically bind to the polypeptide represented by SEQ ID NO: 1 or SEQ ID NO: 2, but is not limited thereto.

[0106] According to the present application, the agent for reducing the expression level of the gene encoding the protein can include one or more selected from the group consisting of an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds to a gene (preferably the gene or a part thereof) encoding the protein in a complementary manner, but is not limited thereto. However, the agent for reducing the expression level of the gene is not limited thereto and can include any agent that exhibits an inhibitory effect on the expression of a gene encoding a targeted NINJ2 protein by directly or indirectly acting on the gene and can be readily obtained by known techniques using methods commonly used in the art.

[0107] In one embodiment of the present application, the agent for reducing the expression level of a gene encoding a NINJ2 protein according to the present application can include one or more selected from the group consisting of an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO 5 or 6, which is a part of a gene encoding a NINJ2 protein, and the like, but is not limited thereto.

[0108] In the present application, the antisense nucleotide binds (hybridizes) to the complementary nucleotide sequence of DNA, immature mRNA, or mature mRNA as defined by Watson-Crick base pairs, thereby interrupting the transmission of genetic information of the protein in DNA. The antisense nucleotide has a property of specificity to the target sequence, and thus has a multi-purpose. Since the antisense nucleotide is a long chain of monomer units, the antisense nucleotide is easily synthesized with respect to the target RNA sequence. In recent years, many studies have confirmed the utility of the antisense nucleotide as a biochemical means of studying target proteins. Since great progress has been made in the oligonucleotide chemistry and nucleotide synthesis in terms of cell line adsorption, target binding affinity, and nuclease resistance, the use of the antisense nucleotide can be considered as a new type of inhibitor.

[0109] In the present application, the "shRNA" and "siRNA" are nucleic acid molecules capable of mediating RNA interference or gene silencing, and can inhibit the expression of a target gene, and thus are used as an efficient gene knockout method or a gene therapy method. The shRNA has a hairpin structure formed by the binding of complementary sequences within a single-stranded oligonucleotide. In vivo, the shRNA can be cleaved by a dicer enzyme into a double-stranded oligonucleotide siRNA, which is a short RNA fragment of 21 to 25 nucleotides in length, and can specifically bind to mRNA having a complementary sequence to inhibit the expression of mRNA. In addition, the siRNA is a short double-stranded RNA (dsRNA) fragment of 21 to 25 nucleotides in length, and induces RNA interference (RNAi) by modifying the target mRNA.

[0110] In the present application, which kind of shRNA and siRNA to use can be determined by those skilled in the art, and similar expression reduction effects can be expected if they target the same mRNA sequence. For the purposes of the present application, siRNA can specifically act on the NINJ2-encoding gene to cleave the NINJ2 gene (e.g., mRNA molecules) and RNA interference (RNAi), thereby inhibiting the expression of the NINJ2 protein. siRNA can be synthesized by chemical or enzymatic means. The method of producing siRNA is not particularly limited, and the methods known in the art can be used to produce siRNA. Examples of the method of producing siRNA include, but are not limited to, a method of directly chemically synthesizing siRNA, a method of synthesizing siRNA using in vitro transcription, a method of enzymatically cleaving long double-stranded RNA synthesized by in vitro transcription, an expression method by intracellular delivery of an shRNA expression plasmid or a viral vector, and an expression method by intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette.

[0111] In one embodiment of the present application, the agent for reducing the expression level of a gene encoding the NINJ2 protein can be an shRNA consisting of the nucleotide sequence shown in SEQ ID NO: 9 or 10, but is not limited thereto.

[0112] In another embodiment of the present application, the agent for reducing the expression level of a gene encoding the NINJ2 protein can be an siRNA consisting of the nucleotide sequences shown in SEQ ID NOs: 11 and 12, but is not limited thereto.

[0113] In the present application, the "ribozyme" refers to an RNA molecule having catalytic activity. Various active ribozymes are known, and the ribozyme for the NINJ2 gene includes a known ribozyme or an artificially produced ribozyme. In addition, a ribozyme having target-specific RNA cleavage activity can be produced using known standard techniques.

[0114] Another embodiment of the present application also relates to a pharmaceutical composition for treating anticancer drug resistance or enhancing anticancer drug sensitivity.

[0115] The pharmaceutical composition for treating anticancer drug resistance or enhancing anticancer drug sensitivity according to the present application can include, as an active ingredient, an agent for reducing the activity or expression level of the NINJ2 protein, or an agent for reducing the expression level of a gene encoding the protein.

[0116] In one embodiment of the present application, the agent for reducing the expression level of a gene encoding the NINJ2 protein can contain any one or more selected from the group consisting of an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO 5 or 6, which is a part of a gene encoding the NINJ2 protein, but is not limited thereto.

[0117] The composition according to the present application can further comprise an agent for reducing the activity or expression level of at least one protein selected from the group consisting of periostin and CD44, or an agent for reducing the expression level of a gene encoding at least one protein.

[0118] In the present application, the term "anticancer drug resistance" means that the effect of an anticancer drug is reduced when the anticancer drug is used quantitatively and repeatedly, and means a situation in which the frequency of use of the anticancer drug or the amount of the anticancer drug used needs to be increased to obtain the same effect as that previously experienced by a patient who is resistant to the anticancer drug, or a situation in which the same effect as that previously experienced cannot be obtained even if the same dose of the anticancer drug is administered.

[0119] In the present application, the term "anticancer drug resistance treatment" means recovery from a state in which the effect of an anticancer drug is reduced when the anticancer drug is used quantitatively and repeatedly, or recovery from a state in which the frequency of use of the anticancer drug or the amount of the anticancer drug used needs to be increased to obtain the same effect as that previously experienced by a patient who is resistant to the anticancer drug, or a situation in which the same effect as that previously experienced cannot be obtained even if the same dose of the anticancer drug is administered. More specifically, the term "anticancer drug resistance treatment" means creating a condition in which the same anticancer effect can be obtained even with a lower frequency of use or a lower dose of the anticancer drug, or a condition in which the same effect can be obtained even with the same dose or a lower dose of the anticancer drug than that previously used, before the anticancer drug develops resistance.

[0120] In the present invention, the anticancer drug can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, mistletoe, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimprintacin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, furtulon, ecoguin, flutamide, decitabine, mercaptopurine, thioguanine, cladrabine, carmustine, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, dactinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, hexamethylmelamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulphan, exemestane, aminoglutethimide, anagrelide, navelbine, fararez, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine. Preferably, the anticancer drug can be a drug comprising at least one selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, more preferably, can be an ECF combination comprising epirubicin, cisplatin, and 5-fluorouracil. In addition, the anticancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0121] In the present application, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, pelvic kidney cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on the cancer cells and / or cancer stem cells described in the present application.

[0122] In the pharmaceutical composition for treating anticancer drug resistance and the composition for enhancing anticancer drug sensitivity according to the present application, each of the proteins or the genes encoding the proteins, the agent for reducing the activity or expression level of the proteins, or the agent for reducing the expression level of the genes encoding the proteins, is the same as described above in the pharmaceutical composition for preventing or treating cancer, and thus a detailed description thereof will be omitted in order to avoid excessive complexity of the specification.

[0123] A further embodiment of the present application relates to a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer.

[0124] The composition according to the present application can comprise, as an active ingredient, an agent for reducing the activity or expression level of NINJ2 protein, or an agent for reducing the expression level of a gene encoding the protein.

[0125] In one embodiment of the present application, the agent for reducing the expression level of a gene encoding the NINJ2 protein can contain any one or more selected from the group consisting of an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO 5 or 6, which is a part of a gene encoding NINJ2 protein, and is not limited thereto.

[0126] The composition according to the present application further comprises an agent for reducing the activity or expression level of at least one protein selected from the group consisting of periostin and CD44, or an agent for reducing the expression level of a gene encoding at least one protein.

[0127] The composition according to the present application can be very effectively used for preventing, alleviating or treating cancer having anticancer drug resistance. The composition according to the present application can be very effectively used for preventing, alleviating or treating cancer having anticancer drug resistance by reducing anticancer drug resistance of cancer having anticancer drug resistance while enhancing anticancer drug sensitivity of cancer.

[0128] In the present application, the anticancer drug can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, mistletoe, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimprintacin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, floxuridine, ecoguin, ecoguin, fludarabine, dacarbazine, mercaptopurine, thioguanine, cladribine, carmofur, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, dactinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, hexamethylmelamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulfan, exemestane, aminoglutethimide, anagrelide, navelbine, fararez, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine. Preferably, the anticancer drug can comprise at least one selected from the group consisting of epirubicin, cisplatin and 5-fluorouracil, more preferably, can be ECF combination comprising epirubicin, cisplatin and 5-fluorouracil. In addition, the anticancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0129] In the present application, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, pelvic kidney cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on the cancer cells and / or cancer stem cells described in the present application.

[0130] In the pharmaceutical composition for preventing or treating anticancer drug-resistant cancer according to the present application, each of the proteins or genes encoding the same, agents for reducing the activity or expression level of the proteins, or agents for reducing the expression level of the genes encoding the proteins, is the same as described above in the pharmaceutical composition for preventing or treating cancer, and thus a detailed description thereof will be omitted in order to avoid the present specification from being overly complicated.

[0131] In the present application, the pharmaceutical composition can be in the form of a capsule, a tablet, a granule, an injection solution, an ointment, a powder, or a beverage. The pharmaceutical composition can be used for administration to humans.

[0132] For use, the pharmaceutical composition according to the present application can be formulated into oral preparations, including powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations for the skin, suppositories, and sterile injection solutions, without being limited thereto. The pharmaceutical composition according to the present application can include a pharmaceutically acceptable carrier. Examples of the pharmaceutically acceptable carrier that can be used in the present application include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, flavors, etc. that can be used for oral administration; buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. that can be used for injection; and bases, excipients, lubricants, preservatives, etc. that can be used for topical administration. The pharmaceutical composition according to the present application can be formulated into various forms by mixing the same with the pharmaceutically acceptable carriers as described above. For example, for oral administration, the pharmaceutical composition according to the present application can be formulated into tablets, troches, capsules, elixirs, suspensions, syrups, silicon tablets, or the like, and for injection, can be formulated into unit-dose ampoules or multi-dose vials. In addition, the pharmaceutical composition according to the present application can be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, or the like.

[0133] Meanwhile, examples of suitable carriers, excipients, and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, hydroxymethylbenzoate, hydroxypropylbenzoate, talc, magnesium stearate, and mineral oil. In addition, the pharmaceutical composition according to the present application can further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring, an emulsifier, a preservative, or the like.

[0134] The route of administration of the pharmaceutical composition according to the present application includes, but is not limited to, oral, intravenous, intramuscular, intra-arterial, intra-medullary, intra-dural, intra-cardiac, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, topical, sublingual, and intrarectal. Oral or parenteral administration is preferred.

[0135] As used herein, the term "parenteral" refers to injection or infusion techniques, including subcutaneous, transdermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional, and intracranial. Preferably, the pharmaceutical composition according to the present application can also be formulated as a rectal administration suppository, without being limited thereto.

[0136] The pharmaceutical composition according to the present application can vary depending on various factors, including the activity of the specific compound used, the age, body weight, general health condition, gender, and diet of the patient, the administration period, the administration route, the excretion rate, the drug content, and the severity of the specific disease to be prevented or treated. The dose of the pharmaceutical composition can be appropriately selected by those skilled in the art depending on the patient's condition and body weight, the severity of the disease, the drug form, and the administration route and time, and can be 0.0001-50 mg / kg / day or 0.001-50 mg / kg / day. The pharmaceutical composition can be administered once or more times a day. The dose does not limit the scope of the present application in any way. The pharmaceutical composition according to the present application can be formulated into a pill, a sugar-coated tablet, a capsule, a liquid, a gel, a syrup, a serum, or a suspension.

[0137] Another further embodiment of the present application relates to a method for preventing or treating cancer.

[0138] The method according to the present application can include the step of administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of NINJ2 (Ninjurin 2) protein, or an agent for reducing the expression level of a gene encoding the same.

[0139] In one embodiment of the present application, the method comprises the step of administering an effective amount of any one or more selected from the group consisting of: an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO 5 or 6, which is a part of a gene encoding a NINJ2 protein, and the like.

[0140] Another further embodiment of the present application relates to a method for preventing or treating anticancer drug-resistant cancer.

[0141] The method of the present application can comprise the step of administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of a NINJ2 (Ninjurin 2) protein, or an agent for reducing the expression level of a gene encoding the protein.

[0142] In one embodiment of the present application, the method comprises the step of administering an effective amount of any one or more selected from the group consisting of: an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO 5 or 6, which is a part of a gene encoding a NINJ2 protein, and the like.

[0143] Another further embodiment of the present application relates to a method for treating anticancer drug resistance or enhancing anticancer drug sensitivity.

[0144] The method of the present application can comprise the step of administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of a NINJ2 (Ninjurin 2) protein, or an agent for reducing the expression level of a gene encoding the protein.

[0145] In one embodiment of the present application, the method comprises the step of administering an effective amount of any one or more selected from the group consisting of: an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO 5 or 6, which is a part of a gene encoding a NINJ2 protein, and the like.

[0146] In the above-mentioned methods for preventing or treating cancer, the method for preventing or treating anticancer drug-resistant cancer, the method for enhancing anticancer drug sensitivity, and the method for treating anticancer drug resistance, each of the proteins or the gene encoding the protein, the preparation for reducing the activity or expression level of the protein, or the preparation for reducing the expression level of the gene encoding the protein, and the antisense nucleotide, short interfering RNA (siRNA), short hairpin RNA, and ribozyme complementary to the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 or 6, which are combined with the above-mentioned pharmaceutical composition for preventing or treating cancer, are the same, and thus a detailed description thereof will be omitted to avoid excessive complexity of the specification.

[0147] As used herein, the term "administration" refers to providing to a subject a certain composition described in the present application by any suitable method.

[0148] In the present application, a "subject" in need of administration can include mammals and non-mammals. Among them, examples of the mammals include, but are not limited to, humans, non-human primates such as chimpanzees, other apes or monkey species; farm animals such as cows, horses, sheep, goats or pigs; domestic animals such as rabbits, dogs or cats; laboratory animals such as rodents, e.g., rats, mice or guinea pigs. In addition, in the present application, examples of the non-mammals include, but are not limited to, birds or fish.

[0149] In the present application, the formulation of the composition to be administered as described above is not particularly limited. The composition can be administered as a solid dosage form preparation, a liquid dosage form preparation, or an aerosol preparation for inhalation. Specifically, the composition can be administered as a solid dosage form, which is intended to be converted into a liquid dosage form for oral or parenteral administration shortly before use. For example, the composition can be formulated and used as an oral preparation such as a powder, granule, capsule, tablet or aqueous suspension, and an external preparation, suppository or sterile injection solution, but is not limited thereto.

[0150] In addition, in the present application, a pharmaceutically acceptable carrier can be additionally administered together with the composition described in the present application. The pharmaceutically acceptable carrier which can be used in the present application includes a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a coloring agent, a flavoring agent, etc. which can be used for oral administration; a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. which can be used for injection; and a base, an excipient, a lubricant, a preservative, etc. which can be used for topical administration. The composition described in the present application can be formulated into various forms by mixing it with the pharmaceutically acceptable carrier described above. For example, for oral administration, the composition of the present application can be formulated into a tablet, a lozenge, a capsule, an elixir, a suspension, a syrup, a wafer, or the like, and for injection, into a unit-dose ampoule or a multi-dose vial. In addition, the composition described in the present application can be formulated into a solution, a suspension, a tablet, a capsule, a sustained-release preparation, or the like.

[0151] Meanwhile, examples of the carrier, the excipient, and the diluent which are suitable for formulation include lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, hydroxymethylbenzoate, hydroxypropylbenzoate, talc, magnesium stearate, and mineral oil. In addition, the pharmaceutical composition described in the present application can further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, a preservative, or the like.

[0152] The route of administration of the pharmaceutical composition according to the present application includes, but is not limited to, oral, intravenous, intramuscular, intra-arterial, intra-medullary, intra-dural, intra-cardiac, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, topical, sublingual, and intrarectal. Oral or parenteral administration is preferred.

[0153] As used herein, the term "parenteral" refers to includes subcutaneous, transdermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional, and intracranial injection or infusion techniques. Preferably, the pharmaceutical composition described in the present application can also be formulated as a rectal administration suppository, without being limited thereto.

[0154] As used herein, "pharmaceutically effective amount" means a quantity of an agent sufficient to provide a desired biological result. That result can be a decrease and / or alleviation of a sign, symptom, or cause of a disease, or any other desired alteration of a biological system. For example, an "effective amount" for therapeutic uses is the quantity of a composition disclosed herein required to provide a clinically significant decrease in a disease. An appropriate effective dose in any individual case can be determined by one of ordinary skill in the art using routine experimentation. Thus, the expression "effective amount" generally refers to an amount of an active agent that has a therapeutic effect. In the case of the present application, the active agent is an agent for preventing, ameliorating or treating cancer, and also an agent for preventing, ameliorating or treating anticancer drug-resistant cancer.

[0155] The composition of the present application can vary depending on various factors, including the activity of the active agent used, the age, body weight, general health condition, gender and diet of the patient, the administration period, the administration route, the excretion rate, the drug content, and the severity of the particular disease to be prevented or treated. The dose of the active agent can be appropriately selected by those skilled in the art depending on the patient's condition and body weight, the severity of the disease, the drug form, and the administration route and time, and can be 0.0001-100 mg / kg / day or 0.001-100 mg / kg / day. The composition can be administered once or several times a day. The dose does not limit the scope of the present application in any way. The composition according to the present application can be formulated into a pill, a sugar-coated tablet, a capsule, a liquid, a gel, a syrup, a serum, or a suspension.

[0156] The active agent of the present application can be used alone or in combination with surgery, radiotherapy, hormone therapy, chemotherapy, and methods using a biological response modifier.

[0157] In addition, the composition described in the present application can also be used in combination with other anticancer drugs. Among them, the anticancer drug can be at least one selected from the group consisting of nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, ivy, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab, septaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimera, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, floxuridine, ecitabine, flutamide, capecitabine, decitabine, mercaptopurine, thioguanine, cladrabine, carmofur, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, actinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, altretamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulfan, exemestane, aminoglutethimide, anagrelide, navelbine, farazac, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, vorinostat, entinostat, phenformin, metformin, talazoparib, and carmustine, but not limited thereto.

[0158] 3. Anti-cancer drug-resistant cancer organoids

[0159] Another further embodiment of the present application relates to an anti-cancer drug-resistant cancer organoid.

[0160] In the present application, the cancer organoid includes cancer cells expressing a NINJ2 protein or a gene encoding the same.

[0161] In the present application, the NINJ2 protein can be at least one of NINJ2 subtype 1 consisting of the amino acid sequence shown in SEQ ID NO: 1 and NINJ2 subtype 3 consisting of the amino acid sequence shown in SEQ ID NO: 2.

[0162] In the present application, the gene encoding the NINJ2 protein can be at least one of a NINJ2 subtype 1 gene consisting of the nucleotide sequence represented by SEQ ID NO: 3 and a NINJ2 subtype 3 gene consisting of the nucleotide sequence represented by SEQ ID NO: 4.

[0163] In the present application, the cancer cell can additionally express at least one protein selected from periostin and CD44, or a gene encoding at least one protein.

[0164] In the present application, the periostin protein can consist of the amino acid sequence represented by SEQ ID NO: 7, but is not limited thereto.

[0165] In the present application, the CD44 protein can consist of the amino acid sequence represented by SEQ ID NO: 8, but is not limited thereto.

[0166] In the present application, the cancer cell can be engineered to overexpress the protein or the gene encoding the protein, and preferably, the cancer cell can be transfected by introducing a recombinant vector comprising a gene encoding the protein into the cancer cell.

[0167] As used herein, the term "vector" refers to a means for expressing a gene of interest in a host cell. The vector can include elements for expressing a gene of interest, including an origin of replication, a promoter, an operator, a transcription terminator, etc., and can further include a suitable enzyme site (e.g., a restriction enzyme site) for introduction into the host cell genome and / or a selection marker for identifying successful introduction into the host cell, and / or a ribosome binding site (RBS), an internal ribosome entry site (IRES), etc., for translation into a protein. The vector can be modified by conventional genetic engineering methods so that the above-mentioned fusion polynucleotide (fusion promoter) serves as a promoter. The vector can also include a transcription control sequence (e.g., an enhancer, etc.) other than a promoter.

[0168] In the present application, the recombinant vector can be a viral vector or a non-viral vector. The viral vector can be an adenoviral vector, a retroviral vector including a lentivirus, an adeno-associated viral vector, or a herpes simplex viral vector, but is not limited thereto. In addition, the non-viral vector can be a plasmid vector, a bacteriophage vector, a liposome, a bacterial artificial chromosome, an artificial yeast chromosome, etc., but is not limited thereto.

[0169] In the present application, the gene of interest in the recombinant vector can be operably linked to the fusion polynucleotide. The term "operably linked" refers to a functional linkage between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence can control the transcription and / or translation of the other nucleotide sequence by "operable linkage". In the recombinant vector, the fusion polynucleotide can be linked to the 5' end of the gene of interest, thereby operably linking the fusion polynucleotide to the gene of interest. When the gene encoding the protein of interest to be expressed is operably linked, the recombinant vector of the present application can be used as a target protein expression vector and can efficiently express the protein of interest in an appropriate host cell.

[0170] The recombinant vector of the present application can further include a transcription control sequence. The transcription control sequence can be selected from at least one of the group consisting of a transcription termination sequence (such as a polyadenylation sequence (pA)) and a replication initiation point (such as an f1 replication initiation point, an SV40 replication initiation point, a pMB1 replication initiation point, an adenovirus replication initiation point, an AAV replication initiation point, and a BBV replication initiation point), but is not limited thereto.

[0171] In addition, in the present application, the recombinant vector can further include a selection marker. The selection marker is a gene for confirming whether the recombinant vector is successfully introduced into a host cell or constructing a stable cell line. For example, the selection marker can be selected from at least one of the group consisting of a drug resistance gene (such as an antibiotic), a metabolism-related gene, a gene amplification gene, and the like.

[0172] In the present application, the recombinant vector can be delivered (introduced) into a cancer cell using a delivery method known in the art. The delivery method can be, for example, microinjection, calcium phosphate precipitation, electroporation, ultrasound poration, magnetic infection, liposome-mediated transfection, gene bombardment, or a method using dendrimers and inorganic nanoparticles, but is not limited thereto.

[0173] In the present invention, the anticancer drug can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, mistletoe, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimprintacin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, furtulon, ecoguin, flutamide, decitabine, mercaptopurine, thioguanine, cladrabine, carmustine, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, dactinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, hexamethylmelamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulphan, exemestane, aminoglutethimide, anagrelide, navelbine, fararez, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine. Preferably, the anticancer drug can comprise at least one drug selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, more preferably, can be an ECF combination comprising epirubicin, cisplatin, and 5-fluorouracil. In addition, the anticancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0174] In the present invention, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, pelvic kidney cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer progression (such as tumor differentiation and / or proliferation) dependent on the cancer cells and / or cancer stem cells described in the present invention.

[0175] In the present invention, the cancer cells expressing the NINJ2 protein or the gene encoding the same can exhibit resistance to anticancer drugs. Accordingly, for the purpose of the present invention, the cancer cells can form a cancer-like organ that can be used to screen drugs for overcoming or treating resistance to anticancer drugs or drugs capable of enhancing sensitivity to anticancer drugs.

[0176] As used herein, the term "organoid" refers to cells having a 3D structure, and means a tissue-like model prepared through an artificial culture process, which is not collected or obtained from an animal. Unlike 2D culture, 3D cell culture can allow cells to grow in various directions in vitro.

[0177] 4. A method for screening a drug for overcoming or treating resistance to anticancer drugs or enhancing sensitivity to anticancer drugs

[0178] Further embodiments of the present invention also relate to a method for screening a drug for overcoming or treating resistance to anticancer drugs or a drug for enhancing sensitivity to anticancer drugs.

[0179] The screening method according to the present invention can comprise the steps of treating cancer cells expressing a NINJ2 protein or a gene encoding the same or a cancer organoid provided in the present invention with a candidate substance in vitro; and detecting the activity or expression level of the NINJ2 protein or detecting the expression level of the gene encoding the same in the cancer cells or the cancer organoid treated with the candidate substance.

[0180] In the present invention, the term "screening" refers to selecting a substance having any desired specific property from a candidate group consisting of several substances through a specific operation or evaluation method.

[0181] In the present application, the cancer cell can be isolated from a subject of interest, preferably a subject having or likely to have resistance to an anticancer drug, or can be engineered to overexpress the NINJ2 protein or a gene encoding the same. Preferably, the cancer cell can be transfected by introducing a recombinant vector containing a gene encoding the NINJ2 protein into the cancer cell.

[0182] Further, in the present application, the cancer cell can further express or can be engineered to overexpress at least one selected from the group consisting of CD44 and periostin protein or a gene encoding at least one protein. Preferably, the cancer cell can be transfected by introducing a recombinant vector containing a gene encoding at least one selected from the group consisting of CD44 and periostin protein into the cancer cell.

[0183] In the present application, the candidate substance can be at least one selected from the group consisting of a natural compound, a synthetic compound, RNA, DNA, a polypeptide, an enzyme, a protein, a ligand, an antibody, an antigen, a bacterial or fungal metabolite, and a bioactive molecule, but is not limited thereto.

[0184] In the present application, in addition to the step of measuring the activity or expression level of the NINJ2 protein or measuring the expression level of a gene encoding the same after treatment with the candidate substance, a step of measuring the activity or expression level of at least one selected from the group consisting of CD44 and periostin protein or measuring the expression level of a gene encoding at least one protein can be additionally performed.

[0185] In the present application, the reagent for measuring the activity or expression level of the protein is not particularly limited. However, for example, the reagent can include at least one selected from the group consisting of an antibody specifically binding to a protein, an oligopeptide, a ligand, a peptide nucleic acid (PNA), and an aptamer.

[0186] In the present application, examples of the method for measuring or comparing the activity or expression level of a protein include, but are not limited to, protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry) analysis, SELDI-TOF (surface-enhanced laser desorption / ionization time-of-flight mass spectrometry) analysis, radioimmunoassay, radioimmunodiffusion, double immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, complement fixation test, two-dimensional electrophoresis, liquid chromatography-mass spectrometry (LC-MS), liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS), Western blotting, and ELISA (enzyme-linked immunosorbent assay).

[0187] In the present application, the agent for measuring the expression level of the gene encoding the protein can include at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide, which specifically binds to the gene.

[0188] The information on the protein or the gene encoding the protein according to the present application is known. Thus, based on the information, those skilled in the art can easily design a primer, a probe, or an antisense nucleotide which specifically binds to the gene encoding the protein.

[0189] In the present application, examples of the method for analyzing the presence or absence and the expression level of the gene include, but are not limited to, reverse transcription-polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chip assay.

[0190] The method of the present application can further include a step of determining the measured candidate substance as a drug for overcoming or treating the resistance to anticancer drugs or a drug for enhancing the sensitivity to anticancer drugs when the activity or the expression level of the measured NINJ2 protein or the expression level of the measured gene encoding the protein is decreased in the cancer cell or the cancer organoid after treatment with the candidate substance.

[0191] Further, the method of the present application can further include a step of determining the measured candidate substance as a drug for overcoming or treating the resistance to anticancer drugs or a drug for enhancing the sensitivity to anticancer drugs when at least one of the activity or the expression level of CD44 and periostin or the expression level of the gene encoding at least one of the proteins is decreased in addition to when the activity or the expression level of the measured NINJ2 protein or the expression level of the measured gene encoding the protein is decreased in the cancer cell or the cancer organoid after treatment with the candidate substance.

[0192] In the present invention, the anticancer drug can be a drug comprising at least one selected from the group consisting of mechlorethamine, imatinib, oxaliplatin, rituximab, erlotinib, lenalidomide, lapatinib, gefitinib, vandetanib, nilotinib, semaxanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, mistletoe, asparaginase, tretinoin, hydroxyurea, dasatinib, estramustine, gemtuzumab, ozogamicin, ibritumomab, heptaplatin, methotrexate, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, pemetrexed, tegafur, capecitabine, gimprintacin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, furtulon, ecoguin, flutamide, decitabine, mercaptopurine, thioguanine, cladrabine, carmustine, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleomycin, daunorubicin, dactinomycin, pirarubicin, aclarubicin, peplomycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, hexamethylmelamine, dacarbazine, thiotepa, nimustine, chlorambucil, dibromomannitol, folinic acid, treosulphan, exemestane, aminoglutethimide, anagrelide, navelbine, fararez, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine. Preferably, the anticancer drug can comprise at least one drug selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, more preferably, can be an ECF combination comprising epirubicin, cisplatin, and 5-fluorouracil. In addition, the anticancer drug is not limited thereto, and can include any drug belonging to the same family as ECF.

[0193] In the present application, the cancer can be thyroid cancer, parathyroid cancer, gastric cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, pelvic kidney cancer, CNS central nervous system tumor, primary central nervous system (CNS) lymphoma, spinal cord tumor, brain stem glioma, or pituitary adenoma. However, the cancer is not limited thereto, and can be any type of cancer that depends on the cancer cells and / or cancer stem cells described in the present application in progression such as tumor differentiation and / or proliferation.

[0194] In the screening method described in the present application, the recombinant vector and introduction thereof are the same as described above in the anti-cancer drug-resistant cancer organoid, and thus a detailed description thereof will be omitted to avoid the present specification from being overly complex.

[0195] Advantageous effects

[0196] When the present application is used, it is possible to diagnose the resistance of anti-cancer drugs such as epirubicin, cisplatin, and 5-fluorouracil used for anti-cancer treatment. Accordingly, when a treatment plan for a cancer patient is made in the future, a clinician can predict the suitability of use of the above-mentioned anti-cancer drugs before administration, and thus use a suitable alternative anti-cancer drug. Accordingly, it is expected to reduce the physical, mental, and economic burden of the patient, and ultimately to further improve the cancer treatment effect of the patient.

[0197] In addition, when the present application is used, it is possible to overcome the resistance to anti-cancer drugs, and effectively prevent, improve, or treat cancer resistant to anti-cancer agents.

[0198] BRIEF DESCRIPTION OF DRAWINGS

[0199] Figure 1a A process of administering ECF drugs to each cell line according to one embodiment of the present application is shown.

[0200] Figure 1b Representative IC values of non-ECF drug-resistant parent cells and ECF drug-resistant cells according to one embodiment of the present application are shown. 50

[0201] Figure 1c Representative IC values of non-ECF drug-resistant parent cells and ECF drug-resistant cells according to one embodiment of the present application are shown. 50

[0202] ​​Figure 1d The illustration shows the results of examining changes in tumor volume after injecting ECF into a mouse model of tumors xenografted with non-ECF-resistant parental cells and ECF-resistant cells (ECF-R), according to an embodiment of the present invention.

[0203] Figure 2 The illustration shows a process for selecting genes, typically found in ECF resistant cell lines, using heatmaps according to an embodiment of the invention.

[0204] Figure 3a The results of quantitative qRT-PCR analysis of NINJ2 protein expression levels in non-ECF resistant parental cells and ECF resistant cells (ECF-R) according to an embodiment of the present invention are shown.

[0205] Figure 3b The results of Western blot analysis of NINJ2 protein expression levels in non-ECF resistant parental cells and ECF resistant cells (ECF-R) according to an embodiment of the present invention are shown.

[0206] Figure 4a The results of FACS analysis of NINJ2 expression on the surface of wild-type cells and ECF-resistant cells (ECF-R) from the MKN-74 cell line, according to an embodiment of the present invention, are shown.

[0207] Figure 4b The results of FACS analysis of CD44 expression on the surface of wild-type cells and ECF-resistant cells (ECF-R) derived from the MKN-74 cell line, according to an embodiment of the present invention, are shown.

[0208] Figure 4c The results of FACS analysis of CD44 expression in NINJ2(-) and NINJ2(+) populations classified from ECF-resistant cells (ECF-R) of the MKN-74 cell line, according to one embodiment of the present invention, are shown.

[0209] Figure 4d Immunofluorescence images depicting the expression levels of each marker (CD44 and NINJ2) in wild-type cells and ECF-resistant cells (ECF-R) derived from the MKN-74 cell line, according to one embodiment of the invention, are shown.

[0210] Figure 4e The results of Western blot analysis according to an embodiment of the present invention are shown, displaying the expression levels of each marker (CD44 and hNINJ2) in tumor spheres from the MKN-74 cell line.

[0211] Figure 4fImmunofluorescence images according to one embodiment of the present application showing the expression level of each marker (CD44 and hNINJ2) in tumor spheroids from MKN-74 cell line.

[0212] Figure 5a Representative IC values of ECF-treated NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines according to one embodiment of the present application are shown. 50

[0213] Figure 5b Expression levels of CD44 mRNA in NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines analyzed by qRT-PCR according to one embodiment of the present application are shown.

[0214] Figure 5c Proportion of CD44highcells in NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines analyzed by flow cytometry according to one embodiment of the present application are shown.

[0215] Figure 5d Results of in vitro limiting dilution analysis performed on NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines according to one embodiment of the present application are shown.

[0216] Figure 5e Results of analysis of the number of tumor spheroids formed by NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines according to one embodiment of the present application are shown.

[0217] Figure 6 Results of flow cytometry analysis of cell cycle changes in NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines according to one embodiment of the present application are shown.

[0218] Figure 7a Results of detection of NINJ2 / periostin interaction from stable NINJ2-HaloTag MKN-74 cancer cells using immunoblot analysis (co-immunoprecipitation; co-IP) using HaloTag pull-down system (G6504, Promega) according to one embodiment of the present application are shown.

[0219] Figure 7b Results of detection of periostin mRNA expression levels by qRT-PCR after isolation of mRNA from ECF-resistant MKN-74 cancer cells according to one embodiment of the present application are shown.

[0220] Figure 7c ​Figure 6 shows the results of Western blot analysis of highly expressed proteins in NINJ2 subtype-1 and subtype-3 overexpressing MKN-74 cell lines according to one embodiment of the present application.

[0221] Figure 8 Figure 7 shows the results of analysis of cell viability by crystal violet staining and WST-1 test after introducing shRNA lentivirus particles targeting human NINJ2 (Clone-1 and Clone-2) into ECF-resistant MKN-74 cell lines and then administering ECF to the cell lines according to one embodiment of the present application.

[0222] Figure 9a and 9b Figure 8 shows the results of measuring changes in tumor volume and weight after injecting ECF and siRNA into nude mice when wild-type or disrupted siRNA RES and siNINJ2 RES cancer cell lines from MKN-28 / 74 cell lines were transplanted into the nude mice and then the nude mice were injected with ECF and siRNA when the tumor volume reached 100 mm 3

[0223] Figure 10a Figure 9 shows the morphology of parent organoids and ECF-resistant human gastric cancer organoids and representative IC 50 values after ECF treatment according to one embodiment of the present application.

[0224] Figure 10b Figure 10 shows the results of comparing mRNA expression levels of human NINJ2 and CD44 in parent organoids and ECF-resistant human gastric cancer organoids according to one embodiment of the present application.

[0225] Figure 10c Figure 11 shows the results of NINJ2 score analysis by histological analysis of gastric cancer patients with partial response (PR), stable disease (SD), and progressive disease (PD) according to one embodiment of the present application.

[0226] Figure 10d Figure 12 shows the overall survival (OS) Kaplan-Meier curve of gastric cancer patients obtained from public data according to one embodiment of the present application.

[0227] Best Mode

[0228] One embodiment of the present application relates to a composition for diagnosing anticancer drug resistance, the composition comprising a reagent for measuring NINJ2 (Ninjurin 2) protein or a gene encoding the same.

[0229] ​Another embodiment of the present application relates to a kit for diagnosing anticancer drug resistance, the kit comprising the composition for diagnosing anticancer drug resistance according to the present application.

[0230] Another embodiment of the present application relates to a method for providing information for diagnosing anticancer drug resistance, the method comprising the step of measuring the expression level of NINJ2 protein or a gene encoding the protein in a biological sample isolated from a subject of interest.

[0231] Another embodiment of the present application relates to a pharmaceutical composition for treating anticancer drug resistance or enhancing anticancer drug sensitivity, the pharmaceutical composition comprising, as an active ingredient, an agent for reducing the activity or expression level of NINJ2 protein or an agent for reducing the expression level of a gene encoding the protein.

[0232] Another embodiment of the present application relates to a method for treating anticancer drug resistance or enhancing anticancer drug sensitivity, the method comprising administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of NINJ2 (Ninjurin 2) protein or an agent for reducing the expression level of a gene encoding the protein.

[0233] A further embodiment of the present application relates to a pharmaceutical composition for preventing or treating cancer, the pharmaceutical composition comprising, as an active ingredient, an agent for reducing the activity or expression level of NINJ2 protein or an agent for reducing the expression level of a gene encoding the protein.

[0234] Another further embodiment of the present application relates to a method for preventing or treating cancer, the method comprising the step of administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of NINJ2 (Ninjurin 2) protein or an agent for reducing the expression level of a gene encoding the protein.

[0235] Another further embodiment of the present application relates to a method for preventing or treating cancer, the method comprising the step of administering to a subject in need thereof an effective amount of any one or more selected from the group consisting of an antisense nucleotide complementary to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 5 or 6, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme.

[0236] Another further embodiment of the present application relates to a pharmaceutical composition for preventing or treating anticancer drug-resistant cancer, the pharmaceutical composition comprising, as an active ingredient, an agent for reducing the activity or expression level of NINJ2 protein or an agent for reducing the expression level of a gene encoding the protein.

[0237] Another further embodiment of the present application relates to a method for preventing or treating anticancer drug-resistant cancer, the method comprising the step of administering to a subject in need thereof an effective amount of an agent for reducing the activity or expression level of NINJ2 (Ninjurin 2) protein, or an agent for reducing the expression level of a gene encoding the protein.

[0238] A further embodiment of the present application relates to a method for preventing or treating anticancer drug-resistant cancer, the method comprising the step of administering to a subject in need thereof an effective amount of any one or more selected from the group consisting of an antisense nucleotide, a short interfering RNA (siRNA), a short hairpin RNA, and a ribozyme that binds in complement to a polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 5 or 6.

[0239] Still another further embodiment of the present application relates to an anticancer drug-resistant cancer organoid, the organoid comprising cancer cells expressing NINJ2 protein or a gene encoding the protein.

[0240] Another embodiment of the present application relates to a method for screening a drug for overcoming or treating anticancer drug resistance or a drug for enhancing anticancer drug sensitivity, the method comprising the steps of treating cancer cells expressing NINJ2 protein or a gene encoding the protein or a cancer organoid provided by the present application with a candidate substance in vitro; and detecting the activity or expression level of the NINJ2 protein or the expression level of a gene encoding the protein in the cancer cells or the cancer organoid treated with the candidate substance.

[0241] Mode for Invention

[0242] Hereinafter, the present application will be described in more detail with reference to examples. These examples are only for a more detailed illustration of the present application and, as will be apparent to those of ordinary skill in the art in light of the teachings of the present application, the scope of the present application is not limited by these examples.

[0243] Example 1 Preparation of anticancer drug (epirubicin, cisplatin, and 5-fluorouracil; ECF)-resistant cells

[0244] To obtain ECF-resistant gastric cancer cells containing a combination of epirubicin, cisplatin, and 5-fluorouracil (ECF), primary human gastric cancer cell lines (SNU-488 and SNU-520) and metastatic human gastric cancer cell lines (MKN-28 / 74, MKN-74, MKN-45, and SNU-668) were first prepared. Subsequently, as shown in FIG. 1, each of the gastric cancer cell lines was sequentially treated with ECF IC 50 , ECF IC 70and ECF IC 80 Treatment, followed by administration of on-time drug treatment (3 days) and drug withdrawal (1-3 weeks), respectively, for more than 2 months. To determine whether ECF-resistant gastric cancer cell lines were created, drug responsiveness was evaluated in vitro and in xenograft animal models. The results showed that the IC 50 values of ECF-resistant gastric cancer cell lines were significantly higher than those of the parent cells Figure 1b and 1c ) in primary and metastatic gastric cancer cell lines. In xenograft animal models, it was confirmed that the tumor volume produced by ECF-resistant gastric cancer cell lines gradually increased, while the tumor volume of the control group decreased Figure 1d ).

[0245] Example 2 Selection of anticancer drug (epirubicin, cisplatin, and 5-fluorouracil; ECF) resistance genes and verification of the potential of NINJ2 biomarker to diagnose ECF resistance

[0246] 2.1 Selection of NINJ2 (Ninjurin 2)

[0247] ECF-resistant gastric cancer cells were obtained from Example 1, and a heat map was used to select genes that were more common in ECF-resistant cell lines than in wild-type cells (see Figure 2 ). For a new gene related to ECF resistance, mRNA was extracted according to the conventional procedure, and then mRNA expression was detected using the affymetrix HG-U133A, HG-U133 Plus 2.0, and HG-U133A 2.0 platforms. The measured gene expression was set as a gene expression value, and further correlation analysis was performed, and the results were evaluated by RNA sequencing for transcriptome analysis. The present application can ultimately screen the NINJ2 (Ninjurin 2) biomarker by focusing on the changes in genes related to the plasma membrane and cell adhesion protein components in RES and WT (wild type). Through the results of the heat map, it was confirmed that the NINJ2 gene was highly expressed in the RES cell line, as with the known stem cell marker CD44, and showed the same tendency as CD44 (see Figure 2 ). Using this marker, only RES cell lines, i.e., cells resistant to drugs, can be selected.

[0248] 2.2 Verification of the potential of NINJ2 marker to diagnose anticancer drug (ECF) resistance

[0249] To verify whether the NINJ2 marker among the selected markers can diagnose anticancer drug (ECF) resistance, additional experiments were conducted at the cellular and tissue levels. First, the expression levels of NINJ2 mRNA and protein in ECF-resistant primary gastric cancer cell lines (SNU-488 and SNU-520) and metastatic gastric cancer cell lines (MKN-28 / 74, MKN-74, MKN-45, and SNU-668) were detected by qRT-PCR and Western blotting. As shown in Figure 3a and 3b , it was confirmed that the expression levels of NINJ2 mRNA and protein in ECF-resistant gastric cancer cell lines were significantly higher than those in the parent cells.

[0250] Example 3 Study on the correlation of NINJ2 and CD44 markers in ECF-resistant gastric cancer cell lines

[0251] In gastric cancer-initiating cells, CD133, CD44, aldehyde dehydrogenase 1 (ALDH1), and ATP-binding cassette subfamily G member 2 (ABCG2) are expressed. It is well known that the effect of anticancer treatment is lower and the risk of recurrence is higher than that of regular cancer cells in terms of cancer stem cells. CD44 is also one of the markers expressed in cancer stem cells, and it was confirmed that the expression level of the CD44 marker was higher in ECF-resistant cell lines with high expression of NINJ2 Figure 4b and 4c . At the same time, in ECF-resistant MKN-74 cells, the proportion of surface NINJ2-positive cells was 9.6% ± 1.3%, whereas that in the parent cells was 0.8% ± 0.09%; in ECF-resistant MKN-74 cells, the proportion of surface NINJ2 protein-expressing cells was 13.4% ± 2.7%, whereas that in the parent cells was only 1.4% ± 0.7% Figure 4a and 4b . To analyze the correlation of NINJ2 and CD44, the expression level of CD44 in NINJ2(+) or (-) cells in ECF-resistant cells was analyzed. As shown in Figure 4c and 4d , it was confirmed that in ECF-resistant cells, the NINJ2(+) cell population was mainly composed of CD44-high-expressing cells, and the NINJ2(-) cell population was mainly composed of CD44(-) cells. Thus, it was confirmed that NINJ2(+) CD44hi gastric cancer-initiating cells were significantly increased in ECF-resistant gastric cancer cells.

[0252] Next, to assess NINJ2 expression in cancer stem cells, a group known as the anti-cancer drug-resistant population, cancer spheroids were prepared by culturing the MKN-74 cell line in serum-free medium supplemented with growth factors. The expression levels of CD44 and NINJ2 mRNA in MKN-74-derived tumor spheroids were detected by qRT-PCR, and the expression level of NINJ2 protein was analyzed by Western blotting. The results are as follows: Figure 4e As shown, the expression levels of CD44 and NINJ2 mRNA, as well as the expression level of NINJ2 protein, were significantly increased in MKN-74-derived tumor microspheres. Furthermore, after culture, the microspheres were placed on a glass slide, and cells were fixed with 1% (w / v) paraformaldehyde (PFA) and incubated for 30 minutes, followed by washing three times with PBS. Cells were then incubated for 30 minutes with blocking buffer (1% BSA, 0.05% Triton X-100). Cells were treated with NINJ2 antibody (R&D Systems) and incubated at 4°C for 16 hours. Cells were washed three times with PBS. Alexa-488-labeled secondary antibody (Thermo Fisher Scientific) was added to the cells, followed by incubation for 1 hour. Cells were washed three times with PBS, treated with CD44 antibody, and incubated at 4°C for 16 hours, followed by three washes with PBS for 20 minutes each. Alexa-555-labeled secondary antibody (Thermo Fisher Scientific) was added to the cells, followed by incubation for 1 hour. After rinsing three times with PBS and allowing 20 minutes, the cells were stained with DAPI, and immunofluorescence images were observed using a confocal microscope. The results of examining the immunofluorescence images are as follows: Figure 4f As shown, NINJ2 and CD44 are co-localized within the glomerulus, while NINJ2(+)CD44hi gastric cancer initiating cells are located outside the glomerulus. Therefore, the NINJ2(+) cell population in ECF-resistant gastric cancer cells mainly corresponds to gastric cancer initiating cells with high CD44 expression.

[0253] Example 4: Increasing cancer stem cells (cancer initiation cells) through NINJ2 overexpression.

[0254] To overexpress NINJ2 in the MKN-74 cell line, NINJ2 isotype-1 (Iso-1) (NP_057617.3) and isotype-3 (Iso-3) (NP_001281275.1) were cloned into pHTC, respectively. The NINJ2 Iso-1 and Iso-3 vectors were then transfected into MKN-74 cells using ViaFect™ transfection reagent. Cells transfected with growth medium containing G-418 (Promega) were selected. The cell viability of NINJ2 Iso-1 and Iso-3 overexpressing gastric cancer cell lines after ECF treatment was measured, and the results are as follows: Figure 5aAs shown in FIG. 1, it was confirmed that the cell viability of the gastric cancer cell lines overexpressing NINJ2 Iso-1 and Iso-3 was significantly higher than that of the parent cell. In addition, it was confirmed that the CD44 mRNA expression level and the number of CD44-expressing cells were significantly increased in the NINJ2 Iso-1 and Iso-3 overexpressing gastric cancer cell lines (FIGS). Figure 5b and 5c ).

[0255] Next, in order to detect the frequency of gastric cancer initiating cells inducing tumor characteristics, the spheroid formation ability thereof was evaluated using an in vitro limiting dilution method. More specifically, the NINJ2 Iso-1 and Iso-3 overexpressing cell lines were diluted 2-fold, respectively, and then seeded at a density of 1000-8 cells / well in a 96-well plate. The cells were cultured in DMEM-F12 to which 20 ng / ml rhEGF, 20 ng / ml rhbFGF, and 5 μg / ml insulin were added, and quantified using an extreme limiting dilution assay (ELDA). The results are shown in FIG. 2. Figure 5d As shown in FIG. 2, it was confirmed that a large number of gastric cancer initiating cells were present in the gastric cancer cells overexpressing NINJ2 Iso-1 and Iso-3.

[0256] 1000 cells overexpressing NINJ2 Iso-1 or Iso-3 were placed in a 24-well plate, and the cells were cultured in DMEM-F12 to which 20 ng / ml rhEGF, 20 ng / ml rhbFGF, and 5 μg / ml insulin were added, according to the above-described method. After 10 days, the number of tumor spheres was counted. In this case, only spheres having a size of 5000 μm 2 or more were counted. As a result, it was confirmed that the number of tumor spheres was increased upon overexpression of NINJ2 Iso-1 and Iso-3 (see FIG. 3). Figure 5e

[0257] Example 5 Increase in cell cycle arrest by NINJ2 overexpression

[0258] Silenced cancer cells are considered to be a major factor in the development of resistance to many anticancer drugs. Therefore, the present inventors investigated the cell cycle change induced by NINJ2. Bromodeoxyuridine (BrdU) was added to cells overexpressing NINJ2 Iso-1 and Iso-3 from the gastric cancer cell line MKN-74, and the cells were cultured for an additional 1 hour. After staining with anti-bromodeoxyuridine and bisbenzamide (Hoeschest 33342), the cell cycle was analyzed using a flow cytometer. As a result, it was confirmed that the cell cycle arrest was significantly increased in the NINJ2 Iso-1 and Iso-3 overexpressing gastric cancer cells by inducing the progression of antiproliferative activity by inhibiting the G0 / G1 phase to the S phase (see FIG. 4). Figure 6

[0259] Example 6 Identification of ECF resistance induction mechanism​​

[0260] To investigate the mechanism of NINJ2-induced drug resistance, the inventors selected candidate proteins that interact with NINJ2. For this, NINJ2 complex was pulled down using a HaloTag pull-down system (G6504, Promega) according to the manufacturer's instructions, and then analyzed by liquid chromatography-tandem mass spectrometry (LC-MS / MS). The proteins identified to interact with NINJ2 were periostin, PTPRk (protein tyrosine phosphatase receptor type K), RNA-binding protein 28, and fibrinogen gamma chain. Among the candidate proteins, periostin and PTPRk are known to be involved in drug resistance, and only periostin is involved in inducing ECF resistance. It can be confirmed by immunoblot analysis after pull-down that NINJ2 interacts with periostin to induce ECF resistance (see Figure 7a ). In addition, the expression level of periostin in the ECF-resistant MKN74 cell line was also examined. It can be confirmed from this that the expression level of periostin in the ECF-resistant cell line is as high as NINJ2 ( Figure 7b ). At the same time, using a phosphorylation antibody array with a gastric cancer cell line overexpressing NINJ2, 4 phosphorylated proteins, VE-Cadherin (Phospho-Tyr731), VAV2 (Phospho-Tyr142), JunD (Phospho-Ser255), and ATF2 (Phospho-Ser112 / 94), were identified to be upregulated by more than 1.5-fold. Consistent results were obtained by Western blot analysis (see Figure 7c ). From the above results, it can be seen that NINJ2 induces ECF resistance through the activation of VAV2, JunD, and ATF2 pathways via VE-cadherin. In summary, the above results suggest that not only the NINJ2 marker can be used for the diagnosis of ECF resistance, but also the periostin marker that interacts with NINJ2 can be additionally used for the diagnosis of ECF resistance.

[0261] Example 7 Evaluation of drug resistance treatment potential of shNINJ2 using ECF-resistant gastric cancer cell lines

[0262] To assess whether NINJ2 is involved in drug resistance, stable NINJ2 knockout (K / D) ECF-resistant cancer cell lines were prepared using shRNA lentiviral particles and puromycin. More specifically, to stably knock out NINJ2 in ECF-resistant MKN-74 cells, two shRNAs (TRCN0000063773 (clone-1) and TRCN0000063775 (clone-2)) targeting different regions of the NINJ2 gene (isotype-1, isotype-2, and isotype-3) were used as shown in Table 1 below, along with a non-targeted pLKO.1-puro shRNA control (SHC002) as a negative control. shRNA clones (TRCN0000063773, TRCN0000063775, and SHC002) containing pMDLg / pRRE, pRSV-Rev, and pMD2.G plasmids, respectively, were transfected into 293T cells using Fugene HD (Promega) according to the manufacturer's instructions. After 48 hours, each supernatant was collected and filtered. ECF-resistant MKN-74 cells were then transfected with lentiviral particles and cultured in puromycin-containing medium. qRT-PCR was used to confirm the knockout of the NINJ2 gene in lentivirally transfected MKN-74 cells. Cells were then treated with ECF, and the regeneration of cancer cells in the negative control (Mock) and shNINJ2 groups (clones 1 and 2) was detected.

[0263] Table 1

[0264]

[0265] like Figure 8 As shown, crystal violet staining and WST-1 analysis performed 3 weeks after ECF treatment confirmed that, in the case of NINJ2 knockdown (K / D) resistant cancer cells (clone-1 and clone-2), cancer cell recurrence and regeneration were significantly inhibited compared to the negative control (Mock). This indicates that ECF resistance can be overcome by knocking out NINJ2 at the cellular level.

[0266] Example 8: Evaluation of the therapeutic potential of siNINJ2 against drug resistance using an animal model of ECF-resistant gastric cancer cell line transplantation.

[0267] 8.1 Preparation of ECF-resistant gastric cancer cell line transplant animal model

[0268] A mouse model was established by xenografting Balb / c nude mice with spheroids prepared from the MKN-28 / 74 cell line using the method described in Example 3. Specifically, 10 7ECF-resistant cancer cells (ECF-R cancer cells) and parent cancer cells were subcutaneously injected into Balb / c nude mice, respectively, to observe whether the xenograft animal model (RES) of ECF-resistant cancer cells established in vitro had ECF resistance. Subsequently, to evaluate the drug resistance treatment effect of NINJ2 inhibition using the prepared ECF-resistant animal model, the expression of NINJ2 was inhibited using siNINJ2 primers (as shown in SEQ ID NOs: 11 and 12) and control primers as shown in Table 2 below, and then an additional drug administration experiment was performed. To this end, 5.7 mg / kg of epirubicin, 6.67 mg / kg of cisplatin, and 22 mg / kg of 5-FU were administered to the xenograft tumor model mice having a tumor size of 100 mm 3 for 15 days once a week, and the tumor weight and tumor volume were measured every 3 days using a digital caliper. As described above, the ECF drug administration experiment was performed on the control group, the NINJ2-knockout RES cell line group, and the NINJ2-highly-expressed RES cell line group for about 1 month, respectively.

[0269] Table 2

[0270]

[0271] 8.2 Evaluation of siNINJ2 drug resistance treatment effect

[0272] Reference Figure 9a It was confirmed that the tumor volume changed after the administration of ECF drugs to the xenograft animal model of each cell line group. Figure 9b The graph of the change in the tumor volume and weight was quantified. It was confirmed that the tumor volume and weight were significantly reduced in the NINJ2-knockout RES cell line in which the expression of NINJ2 mRNA was inhibited, compared to the RES group. As time passed, a large difference in the tumor volume appeared, suggesting that the drug resistance to ECF drugs had been overcome.

[0273] Example 9 Identification of increased expression of NINJ2 in ECF-resistant gastric cancer organoids and its clinical significance for cancer progression

[0274] Patient-derived human gastric cancer tumor organoids (HCM-BROD-0115-C16, PDM-135) were purchased from the American Type Culture Collection (ATCC), subcultured according to the ATCC guidelines, and used for experiments. The organoids were treated with IC 50 concentrations of ECF, and after 72 hours, the medium was replaced with a drug-free medium and 2 additional passages were performed. Then, the organoids were exposed to appropriate IC 70 and IC 80 concentrations, and then the above steps were repeated. To prevent the organoids from returning to the ECF drug-sensitive state, IC 80ECF-treated organoids of various concentrations, thereby constructing ECF-resistant organoids. Figure 10a are micrographs of the parental gastric cancer organoids and the ECF-resistant gastric cancer organoids, and show the IC of each organoid to ECF 50 The results of the assay. The expression levels of NINJ2 and CD44 mRNA in the parental gastric cancer organoids and the ECF-resistant gastric cancer organoids were quantitatively analyzed by qRT-PCR, as shown in Figure 10b NINJ2 and CD44 mRNA in the ECF-resistant gastric cancer organoids were significantly higher than those in the parental gastric cancer organoids, as in the results obtained in the cell lines.

[0275] Next, to examine the clinical relevance of the expression level of NINJ2 to drug response, two pathologists analyzed the expression intensity and extent of NINJ2 by histological analysis of the tissues of partial remission (PR), stable (SD), and progressive (PD) gastric cancer patients. The results, as shown in Figure 10c , confirmed that the extensive expression of NINJ2 in PD was significantly higher than that in PR / SD. Next, to determine the clinical relevance between the expression level of NINJ2 and survival rate, the hazard ratio (HR) of gastric cancer patients and public data were used for Kaplan-Meier analysis and log-rank test. As a result, it can be seen that the survival rate of the NINJ2 expression group was very low in gastric cancer patients, and in particular, the overall survival rate of the high expression group of NINJ2 in the Her2-negative group was higher than that in the Her2-positive group (see Figure 10d ).

[0276] As a result of summarizing the results of the above-described Examples 1 to 9, it can be seen that it is possible to diagnose ECF resistance using NINJ markers and periostin markers, and it is possible to overcome ECF resistance by inhibiting the expression of NINJ. Therefore, by treating patients who have developed resistance to anticancer drugs after ECF treatment, it is expected to improve the anticancer effect.

[0277] Although the present application has been described in detail with reference to specific features, it is apparent that such a detailed description is only a preferred embodiment of the present application, and does not limit the scope of the present application. Therefore, the substantial scope of the present application will be defined by the appended claims and their equivalents.

[0278] Industrial applicability

[0279] The composition according to the present application can not only diagnose anticancer drug resistance, but also very effectively treat cancer. In addition, the composition can be very effectively used to overcome anticancer drug resistance, and thus effectively prevent, improve, or treat anticancer drug-resistant cancer.

[0280] Sequence listing free text

[0281] SEQ ID NO 1 : mesarenidl qpgssdprsq pinlnhyatk ksvaesmldv alfmsnamrl kavleqgpss hyyttlvtli slslllqvvi gvllvviarl nlnevekqwr lnqlnnaati lvfftvvinv fitafgahkt gflaarasrn pl

[0282] SEQ ID NO 2: mldvalfmsn amrlkavleq gpsshyyttl vtlislslll qvvigvllvvi arlnlnevek qwrlnqlnn aatilvfftv vinvfitafg ahktgflaar asrnpl

[0283] SEQ ID NO 3: agagactcag acggcggagc ctggaggagc ccacgcagtc tgttcccggc acccggtgcg tgtgaaggga cttgagggca gcgagatgga atcagcaaga gaaaacatcg accttcaacctggaagctcc gaccccagga gccagcccat caacctgaac cattacgcca ccaagaagag cgtggcggagagcatgctgg acgtggccct gttcatgtcc aacgccatgc ggctgaaggc ggtgctggag cagggaccatcctctcacta ctacaccacc ctggtcaccc tcatcagcct ctctctgctc ctgcaggtgg tcatcggtgtcctgctcgtg gtcattgcac ggctgaacct gaatgaggta gaaaagcagt ggcgactcaa ccagctcaacaacgcagcca ccatcttggt cttcttcact gtggtcatca atgttttcat tacagccttc ggggcacataaaacagggtt cctggctgcc agggcctcaa ggaatcctct ctgaatgcag cctgggaccc aggttctgggcctggaactt ctgcctcctt cctccgtgat ctgccaggct cgtgggcact ttccacagcc caggagagcttctgaaagga cagtatagct gcccttgctc cctacccaca gcacctgagt taaaaagtga tttttatgttattggtctaa gggacttcca tcttggtctg aagtcctgag ctcagacgca ggtactgcca gccataccttcctggtagca tctgctggac ctaagtaagg catgtctgtc taaggccaag tctgcccggc ttaaggatgctggttctgac tctaccccac tgcttccttc tgctccaggc ctcaattttc ccttcttgta aaatggaatctatatctata aaggtttcttcaaatcca

[0284] SEQ ID NO 4: gt tgcaaagc agccgctcgg tggccgtaca acgcttcatc tctccgagcctcggtttcct catctccagc cctaaaatga cgacacgccc cacaggtctt gggaggatta agtgaggggacatgagcctg gaagctccga ccccaggagc cagcccatca acctgaacca ttacgccacc aagaagagcgtggcggagag catgctggac gtggccctgt tcatgtccaa cgccatgcgg ctgaaggcgg tgctggagcagggaccatcc tctcactact acaccaccct ggtcaccctc atcagcctct ctctgctcct gcaggtggtcatcggtgtcc tgctcgtggt cattgcacgg ctgaacctga atgaggtaga aaagcagtgg cgactcaaccagctcaacaa cgcagccacc atcttggtct tcttcactgt ggtcatcaat gttttcatta cagccttcggggcacataaa acagggttcc tggctgccag ggcctcaagg aatcctctct gaatgcagcc tgggacccaggttctgggcc tggaacttct gcctccttcc tccgtgatct gccaggctcg tgggcacttt ccacagcccaggagagcttc tgaaaggaca gtatagctgc ccttgctccc tacccacagc acctgagtta aaaagtgatttttatgttat tggtctaagg gacttccatc ttggtctgaa gtcctgagct cagacgcagg tactgccagccataccttcc tggtagcatc tgctggacct aagtaaggca tgtctgtcta aggccaagtc tgcccggcttaaggatgctg gttctgactc taccccactg cttccttctg ctccaggcct caattttccc ttcttgtaaaatggaatcta tatctataaaggtttcttca aatcca

[0285] SEQ ID NO 5: CGTGGTCATTGCACGGCTGAA

[0286] SEQ ID NO 6: CTGAACCTGAATGAGGTAGAA

[0287] SEQ ID NO 7: mipflpmfsl llllivnpin annhydkila hsrirgrdqg pnvcalqqil gtkkkyfstc knwykksicg qkttvlyecc pgymrmegmk gcpavlpidh vygtlgivga tttqrysdask lreeiegkg sftyfapsne awdnldsdir rglesnvnve llnalhshmi nkrmltkdlk ngmiipsmyn nlglfinhyp ngvvtvncar iihgnqiatn gvvhvidrvl tqigtsiqdf ieaeddlssf raaaitsdilealgrdghft lfaptneafe klprgvleri mgdkvaseal mkyhilntlq csesimggav fetlegntieigcdgdsitv ngikmvnkkd ivtnngvihl idqvlipdsa kqvielagkq qttftdlvaq lglasalrpdgeytllapvn nafsddtlsm dqrllklilq nhilkvkvgl nelyngqile tiggkqlrvf vyrtavciens cmekgskqg rngaihifre iikpaekslh eklkqdkrfs tflslleaad lkelltqpgd wtlfvptndafkgmtseeke ilirdknalq niilyhltpg vfigkgfepg vtnilkttqg skiflkevnd tllvnelksk esdimttngv ihvvdkllyp adtpvgndql leilnkliky iqikfvrgst fkeipvtvyk piikkytkiidgvpveitek etreeriitg peikytrist gggeteetlk kllqeevtkv tkfieggdgh lfedeeikrllqgdtpvrkl qankkvqgsr rrlregrsq

[0288] SEQ ID NO 8:mdkfwwhaaw glclvplsla qidlnitcrf agvfhvekng rysisrteaadlckafnstl ptmaqmekal sigfetcryg fieghvvipr ihpnsicaan ntgvyiltsn tsqydtycfnasappeedct svtdlpnafd gpititivnr dgtryvqkge yrtnpediyp snptdddvss gsssersstsggyifytfst vhpipdedsp witdstdrip atrhshgsqe gganttsgpi rtpqipewli ilasllalalilavciavns rrrcgqkkkl vinsgngave drkpsglnge asksqemvhl vnkessetpd qfmtadetrnlqnvdmkigv

[0289] SEQ ID NO 9:

[0290] CCGG-CGTGGTCATTGCACGGCTGAA-CTCGAG-TTCAGCCGTGCAATGACCACG-TTTTTG

[0291] SEQ ID NO 10:

[0292] CCGG-CTGAACCTGAATGAGGTAGAA-CTCGAG-TTCTACCTCATTCAGGTTCAG-TTTTTG

[0293] SEQ ID NO 11:GUAAGGCAUGUCUGUCUAAGGCC

[0294] SEQ ID NO 12:GGCCUUAGACAGACAUGCCUUAC <110> Industry-Academia Collaboration Foundation, Yonsei University <120> Compositions for the diagnosis or treatment of anticancer drug resistance <130> POPB212163PCT <150> KR 10-2020-0025872 <151> 2020-03-02 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 142 <212> PRT <213> Homo sapiens <400> 1 Met Glu Ser Ala Arg Glu Asn Ile Asp Leu Gln Pro Gly Ser Ser Asp 1 5 10 15 Pro Arg Ser Gln Pro Ile Asn Leu Asn His Tyr Ala Thr Lys Lys Ser 20 25 30 Val Ala Glu Ser Met Leu Asp Val Ala Leu Phe Met Ser Asn Ala Met 35 40 45 Arg Leu Lys Ala Val Leu Glu Gln Gly Pro Ser Ser His Tyr Tyr Thr 50 55 60 Thr Leu Val Thr Leu Ile Ser Leu Ser Leu Leu Leu Gln Val Val Ile 65 70 75 80 Gly Val Leu Leu Val Val Ile Ala Arg Leu Asn Leu Asn Glu Val Glu 85 90 95 Lys Gln Trp Arg Leu Asn Gln Leu Asn Asn Ala Ala Thr Ile Leu Val 100 105 110 Phe Phe Thr Val Val Ile Asn Val Phe Ile Thr Ala Phe Gly Ala His 115 120 125 Lys Thr Gly Phe Leu Ala Ala Arg Ala Ser Arg Asn Pro Leu 130 135 140 <210> 2 <211> 106 <212> PRT <213> Homo sapiens <400> 2 Met Leu Asp Val Ala Leu Phe Met Ser Asn Ala Met Arg Leu Lys Ala 1 5 10 15 Val Leu Glu Gin Gly Pro Ser Ser His Tyr Tyr Thr Thr Leu Val Thr 20 25 30 Leu Ile Ser Leu Ser Leu Leu Leu Gin Val Val Ile Gly Val Leu Leu 35 40 45 Val Val Ile Ala Arg Leu Asn Leu Asn Glu Val Glu Lys Gin Trp Arg 50 55 60 Leu Asn Gin Leu Asn Asn Ala Ala Thr Ile Leu Val Phe Phe Thr Val 65 70 75 80 Val Ile Asn Val Phe Ile Thr Ala Phe Gly Ala His Lys Thr Gly Phe 85 90 95 Leu Ala Ala Arg Ala Ser Arg Asn Pro Leu 100 105 <210> 3 <211> 918 <212> DNA <213> Homo sapiens <400> 3 agagactcag acggcggagc ctggaggagc ccacgcagtc tgttcccggc acccggtgcg 60 tgtgaaggga cttgagggca gcgagatgga atcagcaaga gaaaacatcg accttcaacc 120 tggaagctcc gaccccagga gccagcccat caacctgaac cattacgcca ccaagaagag 180 cgtggcggag agcatgctgg acgtggccct gttcatgtcc aacgccatgc ggctgaaggc 240 ggtgctggag cagggaccat cctctcacta ctacaccacc ctggtcaccc tcatcagcct 300 ctctctgctc ctgcaggtgg tcatcggtgt cctgctcgtg gtcattgcac ggctgaacct 360 gaatgaggta gaaaagcagt ggcgactcaa ccagctcaac aacgcagcca ccatcttggt 420 cttcttcact gtggtcatca atgttttcat tacagccttc ggggcacata aaacagggtt 480 cctggctgcc agggcctcaa ggaatcctct ctgaatgcag cctgggaccc aggttctggg 540 cctggaactt ctgcctcctt cctccgtgat ctgccaggct cgtgggcact ttccacagcc 600 caggagagct tctgaaagga cagtatagct gcccttgctc cctacccaca gcacctgagt 660 taaaaagtga tttttatgtt attggtctaa gggacttcca tcttggtctg aagtcctgag 720 ctcagacgca ggtactgcca gccatacctt cctggtagca tctgctggac ctaagtaagg 780 catgtctgtc taaggccaag tctgcccggc ttaaggatgc tggttctgac tctaccccac 840 tgcttccttc tgctccaggc ctcaattttc ccttcttgta aaatggaatc tatatctata 900 aaggtttctt caaatcca 918 <210> 4 <211> 926 <212> DNA <213> Homo sapiens <400> 4 gttgcaaagc agccgctcgg tggccgtaca acgcttcatc tctccgagcc tcggtttcct 60 catctccagc cctaaaatga cgacacgccc cacaggtctt gggaggatta agtgagggga 120 [[ID=二十]]catgagcctg gaagctccga ccccaggagc cagcccatca acctgaacca ttacgccacc 180 [[ID=二十二]]aagaagagcg tggcggagag catgctggac gtggccctgt tcatgtccaa cgccatgcgg 240 ctgaaggcgg tgctggagca gggaccatcc tctcactact acaccaccct ggtcaccctc 300 atcagcctct ctctgctcct gcaggtggtc atcggtgtcc tgctcgtggt cattgcacgg 360 ctgaacctga atgaggtaga aaagcagtgg cgactcaacc agctcaacaa cgcagccacc 420 atcttggtct tcttcactgt ggtcatcaat gttttcatta cagccttcgg ggcacataaa 480 It should be noted that in the translation of item , "智人(Homo sapiens)" is a scientific name, and this is the standard English translation. Also, for item and , the numbers in the original text seem to be used as part of the sequence or identifier, and they are directly retained in the translation. If there are specific requirements or corrections regarding these, please let me know.GCTGGAGTGG ATTCACCGT GGTCTTCCTG GAGGTGATTC CTGGCTTCCT GAGCTTCCT G GTTCTGGGCCT GGAAGCTTCT GCCTCCTTCC TCCGTGATCT GCCAGGCTCG TGGGCACCTT 600 CACAGCCCAG GAGAGCTTCT GAAAGGACAG TATAGCTGCC CTTCCTACCC ACAGC 660 ACCTGAGTTG AAAAGTGATT TTATGTGTAT TGGTCTAAGG GACTTCCATC TTGGTCTGAA 720 GTCCTGAGCT CAGACGCAGG TACTGCCAGC CATACCTTCC TGGTAGCATC TGCTGGACCT 780 AAGTAAGGCA TGTCTGTCTA AGGCCAAGT CTGCCCAGCT AAGGATGCTG GTTCTGACTC 840 TACCCCACCG CTTCCTTCTG CTCCAGGCCT CAATTTCCCC TTCCTTGTA AAATGGAATC TA 900 TATCTATAAA GGTTCCTTCA AATCCA 926 <210> 5 <211> 21 <212> DNA <213> Homo sapiens <400> 5 Cgtggtcatt gcacggctga a 21 <210> 6 <211> 21 <212> DNA <213> Homo sapiens <400> 6 Ctgaacctga atgaggtaga a 21 <210> 7 <211> 779 <212> PRT <213> Homo sapiens <400> 7 Met Ile Pro Phe Leu Pro Met Phe Ser Leu Leu Leu Leu Leu Ile Val 1 5 10 15 Asn Pro Ile Asn Ala Asn Asn His Tyr Asp Lys Ile Leu Ala His Ser 20 25 30 Arg Ile Arg Gly Arg Asp Gln Gly Pro Asn Val Cys Ala Leu Gln Gln 35 40 45 Ile Leu Gly Thr Lys Lys Lys Tyr Phe Ser Thr Cys Lys Asn Trp Tyr 50 55 60 Lys Lys Ser Ile Cys Gly Gln Lys Thr Thr Val Leu Tyr Glu Cys Cys 65 70 75 80 Pro Gly Tyr Met Arg Met Glu Gly Met Lys Gly Cys Pro Ala Val Leu 85 90 95 Pro Ile Asp His Val Tyr Gly Thr Leu Gly Ile Val Gly Ala Thr Thr 100 105 110 Thr Gln Arg Tyr Ser Asp Ala Ser Lys Leu Arg Glu Glu Ile Glu Gly 115 120 125 Lys Gly Ser Phe Thr Tyr Phe Ala Pro Ser Asn Glu Ala Trp Asp Asn 130 135 140 Leu Asp Ser Asp lie Arg Arg Gly Leu Glu Ser Asn Val Asn Val Glu 145 150 155 160 Leu Leu Asn Ala Leu His Ser His Met lie Asn Lys Arg Met Leu Thr 165 170 175 Lys Asp Leu Lys Asn Gly Met lie lie Pro Ser Met Tyr Asn Asn Leu 180 185 190 Gly Leu Phe lie Asn His Tyr Pro Asn Gly Val Val Thr Val Asn Cys 195 200 205 Ala Arg lie lie His Gly Asn Gin lie Ala Thr Asn Gly Val Val His 210 215 220 Val lie Asp Arg Val Leu Thr Gin lie Gly Thr Ser lie Gin Asp Phe 225 230 235 240 lie Glu Ala Glu Asp Asp Leu Ser Ser Phe Arg Ala Ala Ala lie Thr 245 250 255 Ser Asp lie Leu Glu Ala Leu Gly Arg Asp Gly His Phe Thr Leu Phe 260 265 270 Ala Pro Thr Asn Glu Ala Phe Glu Lys Leu Pro Arg Gly Val Leu Glu 275 280 285 Arg lie Met Gly Asp Lys Val Ala Ser Glu Ala Leu Met Lys Tyr His 290 295 300 Ile Leu Asn Thr Leu Gin Cys Ser Glu Ser lie Met Gly Gly Ala Val 305 310 315 320 Phe Glu Thr Leu Glu Gly Asn Thr lie Glu lie Gly Cys Asp Gly Asp 325 330 335 Ser lie Thr Val Asn Gly lie Lys Met Val Asn Lys Lys Asp lie Val 340 345 350 Thr Asn Asn Gly Val lie His Leu lie Asp Gin Val Leu lie Pro Asp 355 360 365 Ser Ala Lys Gin Val lie Glu Leu Ala Gly Lys Gin Gin Thr Thr Phe 370 375 380 Thr Asp Leu Val Ala Gin Leu Gly Leu Ala Ser Ala Leu Arg Pro Asp 385 390 395 400 Gly Glu Tyr Thr Leu Leu Ala Pro Val Asn Asn Ala Phe Ser Asp Asp 405 410 415 Thr Leu Ser Met Asp Gin Arg Leu Leu Lys Leu lie Leu Gin Asn His 420 425 430 Ile Leu Lys Val Lys Val Gly Leu Asn Glu Leu Tyr Asn Gly Gin lie 435 440 445 Leu Glu Thr lie Gly Gly Lys Gin Leu Arg Val Phe Val Tyr Arg Thr 450 455 460 Ala Val Cys Ile Glu Asn Ser Cys Met Glu Lys Gly Ser Lys Gin Gly 465 470 475 480 Arg Asn Gly Ala Ile His Ile Phe Arg Glu Ile Ile Lys Pro Ala Glu 485 490 495 Lys Ser Leu His Glu Lys Leu Lys Gin Asp Lys Arg Phe Ser Thr Phe 500 505 510 Leu Ser Leu Leu Glu Ala Ala Asp Leu Lys Glu Leu Leu Thr Gin Pro 515 520 525 Gly Asp Trp Thr Leu Phe Val Pro Thr Asn Asp Ala Phe Lys Gly Met 530 535 540 Thr Ser Glu Glu Lys Glu Ile Leu Ile Arg Asp Lys Asn Ala Leu Gin 545 550 555 560 Asn Ile Ile Leu Tyr His Leu Thr Pro Gly Val Phe Ile Gly Lys Gly 565 570 575 Phe Glu Pro Gly Val Thr Asn Ile Leu Lys Thr Thr Gin Gly Ser Lys 580 585 590 Ile Phe Leu Lys Glu Val Asn Asp Thr Leu Leu Val Asn Glu Leu Lys 595 600 605 Ser Lys Glu Ser Asp Ile Met Thr Thr Asn Gly Val Ile His Val Val 610 615 620 Asp Lys Leu Leu Tyr Pro Ala Asp Thr Pro Val Gly Asn Asp Gln Leu 625 630 635 640 Leu Glu Ile Leu Asn Lys Leu Ile Lys Tyr Ile Gln Ile Lys Phe Val 645 650 655 Arg Gly Ser Thr Phe Lys Glu Ile Pro Val Thr Val Tyr Lys Pro Ile 660 665 670 Ile Lys Lys Tyr Thr Lys Ile Ile Asp Gly Val Pro Val Glu Ile Thr 675 680 685 Glu Lys Glu Thr Arg Glu Glu Arg Ile Ile Thr Gly Pro Glu Ile Lys 690 695 700 Tyr Thr Arg Ile Ser Thr Gly Gly Gly Glu Thr Glu Glu Thr Leu Lys 705 710 715 720 Lys Leu Leu Gln Glu Glu Val Thr Lys Val Thr Lys Phe Ile Glu Gly 725 730 735 Gly Asp Gly His Leu Phe Glu Asp Glu Glu Ile Lys Arg Leu Leu Gln 740 745 750 Gly Asp Thr Pro Val Arg Lys Leu Gln Ala Asn Lys Lys Val Gln Gly 755 760 765 Ser Arg Arg Arg Leu Arg Glu Gly Arg Ser Gln 770 775 <210> 8 <211> 340 <212> PRT <213> Homo sapiens <400> 8 Met Asp Lys Phe Trp Trp His Ala Ala Trp Gly Leu Cys Leu Val Pro 1 5 10 15 Leu Ser Leu Ala Gln Ile Asp Leu Asn Ile Thr Cys Arg Phe Ala Gly 20 25 30 Val Phe His Val Glu Lys Asn Gly Arg Tyr Ser Ile Ser Arg Thr Glu 35 40 45 Ala Ala Asp Leu Cys Lys Ala Phe Asn Ser Thr Leu Pro Thr Met Ala 50 55 60 Gln Met Glu Lys Ala Leu Ser Ile Gly Phe Glu Thr Cys Arg Tyr Gly 65 70 75 80 Phe Ile Glu Gly His Val Val Ile Pro Arg Ile His Pro Asn Ser Ile 85 90 95 Cys Ala Ala Asn Asn Thr Gly Val Tyr Ile Leu Thr Ser Asn Thr Ser 100 105 110 Gln Tyr Asp Thr Tyr Cys Phe Asn Ala Ser Ala Pro Pro Glu Glu Asp 115 120 125 Cys Thr Ser Val Thr Asp Leu Pro Asn Ala Phe Asp Gly Pro Ile Thr 130 135 140 Ile Thr Ile Val Asn Arg Asp Gly Thr Arg Tyr Val Gln Lys Gly Glu 145 150 155 160 Tyr Arg Thr Asn Pro Glu Asp Ile Tyr Pro Ser Asn Pro Thr Asp Asp 165 170 175 Asp Val Ser Ser Gly Ser Ser Ser Glu Arg Ser Ser Thr Ser Gly Gly 180 185 190 Tyr Ile Phe Tyr Thr Phe Ser Thr Val His Pro Ile Pro Asp Glu Asp 195 200 205 Ser Pro Trp Ile Thr Asp Ser Thr Asp Arg Ile Pro Ala Thr Arg His 210 215 220 Ser His Gly Ser Gln Glu Gly Gly Ala Asn Thr Thr Ser Gly Pro Ile 225 230 235 240 Arg Thr Pro Gln Ile Pro Glu Trp Leu Ile Ile Leu Ala Ser Leu Leu 245 250 255 Ala Leu Ala Leu Ile Leu Ala Val Cys Ile Ala Val Asn Ser Arg Arg 260 265 270 Arg Cys Gly Gln Lys Lys Lys Leu Val Ile Asn Ser Gly Asn Gly Ala 275 280 285 Val Glu Asp Arg Lys Pro Ser Gly Leu Asn Gly Glu Ala Ser Lys Ser 290 295 300 Gln Glu Met Val His Leu Val Asn Lys Glu Ser Ser Glu Thr Pro Asp 305 310 315 320 Gln Phe Met Thr Ala Asp Glu Thr Arg Asn Leu Gln Asn Val Asp Met 325 330 335 Lys Ile Gly Val 340 <210> 9 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNINJ2 Clone 1 <400> 9 ccggcgtggt cattgcacgg ctgaactcga gttcagccgt gcaatgacca cgtttttg 58 <210> 10 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNINJ2 Clone 2 <400> 10 ccggctgaac ctgaatgagg tagaactcga gttctacctc attcaggttc agtttttg 58 <210> 11 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Sense siNINJ2 <400> 11 guaaggcaug ucugucuaag gcc 23 <210> 12 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense siNINJ2 <400> 12 ggccuuagac agacaugccu uac 23

Claims

1. The use of the composition in the preparation of a reagent for diagnosing drug resistance to gastric cancer, characterized in that, The composition contains a formulation for measuring NINJ2 (nerve injury-inducing protein 2) protein or the gene encoding said protein. The anti-gastric cancer drugs are selected from the following group: epirubicin, cisplatin and 5-fluorouracil.

2. The use as described in claim 1, characterized in that, The composition also includes a formulation for measuring the expression level of at least one protein selected from periostin and CD44 or a gene encoding at least one protein.

3. The use of the pharmaceutical composition in the preparation of a medicament for treating anticancer drug resistance in patients with gastric cancer, characterized in that, The pharmaceutical composition contains, as an active ingredient, a formulation for reducing the expression level of the gene encoding NINJ2 (nerve injury-inducing protein 2) protein. The reagent used to reduce the expression level of the gene encoding the NINJ2 protein is a short interfering RNA (siRNA) or a short hairpin RNA, wherein the short interfering RNA (iRNA) or short hairpin RNA binds complementary to the gene encoding the NINJ2 protein, and The anticancer drugs are selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil.

4. The use of the pharmaceutical composition in the preparation of a medicament for enhancing the sensitivity of patients with gastric cancer to anticancer drugs, characterized in that, The pharmaceutical composition contains, as an active ingredient, a formulation for reducing the expression level of the gene encoding NINJ2 (nerve injury-inducing protein 2) protein. The reagent used to reduce the expression level of the gene encoding the NINJ2 protein is a short interfering RNA (siRNA) or a short hairpin RNA, wherein the short interfering RNA (iRNA) or short hairpin RNA binds complementary to the gene encoding the NINJ2 protein, and The anticancer drugs are selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil.

5. The use of the pharmaceutical composition in the preparation of a medicament for enhancing the sensitivity of patients with gastric cancer to anticancer drugs, characterized in that, The pharmaceutical composition contains short interfering RNA (iRNA) or short hairpin RNA as the active ingredient, wherein the short interfering RNA (iRNA) or short hairpin RNA binds complementary to a polynucleotide sequence consisting of the nucleotide sequence shown in SEQ ID NO 5 or 6. Among them, SEQ ID NO:5 or 6 is part of a gene encoding the NINJ2 protein; The anticancer drugs are selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil.

6. The use of the pharmaceutical composition in the preparation of a medicament for treating drug-resistant gastric cancer, characterized in that, The pharmaceutical composition contains, as an active ingredient, a formulation for reducing the expression level of the gene encoding NINJ2 (nerve injury-inducing protein 2) protein. The reagent used to reduce the expression level of the gene encoding the NINJ2 protein is a short interfering RNA (siRNA) or a short hairpin RNA, wherein the short interfering RNA (iRNA) or short hairpin RNA binds complementary to the gene encoding the NINJ2 protein, and The anticancer drugs are selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil.

7. The use of the pharmaceutical composition in the preparation of a medicament for treating drug-resistant gastric cancer, characterized in that, The pharmaceutical composition contains short interfering RNA (iRNA) or short hairpin RNA as the active ingredient, wherein the short interfering RNA (iRNA) or short hairpin RNA is combined with a polynucleotide sequence shown in SEQ ID NO 5 or 6 to form a polynucleotide. Among them, SEQ ID NO:5 or 6 is part of a gene encoding the NINJ2 protein; The anticancer drugs are selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil.

8. A method for screening drugs for treating drug resistance to anti-gastric cancer drugs, characterized in that, The drug is selected from the group consisting of epirubicin, cisplatin, and 5-fluorouracil, and the method includes the steps of: Gastric cancer cells that overexpress NINJ2 (nerve injury-inducing protein 2) protein or genes encoding said protein, or gastric cancer organoids containing said gastric cancer cells, are treated in vitro with the candidate material. and The activity or expression level of the NINJ2 protein or the expression level of the gene encoding the protein in the gastric cancer cells or gastric cancer organoids after treatment with the candidate substance was measured.

9. The method as described in claim 8, characterized in that, The method further includes the steps of: measuring the activity or expression level of at least one protein selected from CD44 and periostrin, or measuring the expression level of a gene encoding at least one protein.

Images