A truncated molecule of the extracellular region of TGFβR2, a fusion protein thereof with an anti-EGFR antibody, and its anti-tumor use

Abstract

Provided are a variety of fusion proteins containing truncated forms of TGFβR2 and constructed with the EGFR antibody HPA8, as well as nucleic acids encoding the antibodies (including heavy / light chain variable regions), vectors containing the nucleic acids, pharmaceutical compositions and kits; also provided are fusion proteins of the prepared truncated forms of TGFβR2 receptor proteins and antibodies targeting EGFR and other multiple tumor targets.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of Chinese patent application No. 202010351280.6 filed on April 28, 2021, the contents of which are incorporated herein by reference. Technical Field

[0003] The present invention relates to the field of tumor immunotherapy drugs. Specifically, the present invention relates to molecules containing truncated forms of the extracellular region of the immunomodulatory factor TGFβR2, including fusion proteins containing the truncated forms and targeting molecules, pharmaceutical compositions containing the same, and their use as anti-tumor drugs. Background Art

[0004] Transforming growth factor-β (TGF-β) belongs to the TGF-β superfamily that regulates cell growth and differentiation. It is a multi-directional and multi-functional cytokine that regulates cell proliferation, differentiation, and apoptosis through receptor signal transduction pathways on the cell surface in an autocrine or paracrine manner. It plays an important regulatory role in the synthesis of extracellular matrix, wound repair, and immune function. There are three isoforms in mammals: TGF-β1, TGF-β2, and TGF-β3. The most abundant and most expressed subtype is TGF-β1. TGF-β activates the classical Smad and non-Smad pathways to transmit downstream by binding to the TGFβR1 and TGFβR2 serine-threonine kinase receptors on the cell membrane surface. In normal homeostasis, TGF-β signaling regulates key processes such as growth, regeneration, and differentiation of various tissues. In the immune system, TGF-β induces tolerance and suppresses inflammation. Gene mutations can alter the output of TGF-β signaling in tumor-initiating cells. In the initial stages of tumorigenesis, TGF-β plays a key tumor suppressor role by inhibiting cell proliferation and initiating apoptosis programs. However, as the tumor develops, selective pressure causes tumor cells to lose the tumor suppressor function of TGF-β through different mechanisms. Acquired loss-of-function mutations in the TGF-β signaling pathway enable a variety of malignant tumor cells to grow in a TGF-β-rich environment. In addition, tumor cells somehow transform the pro-apoptotic ability of TGF-β into pro-tumor development functions, such as invasion and migration capabilities, and promote mesenchymal transformation. TGF-β can regulate the types and functions of various immune cells. TGF-β controls adaptive immunity by directly promoting the proliferation of Treg cells and inhibiting the production and function of effector T cells and antigen-presenting dendritic cells. TGF-β can also inhibit NK cell function and transform macrophages and neutrophils into tumor-promoting subtypes, promoting the negative regulation of tumor immunity in the tumor microenvironment. TGF-β1 is often expressed at higher levels than in normal adjacent tissues in various solid tumors, including EGFR-positive colorectal cancer, non-small cell lung cancer, and head and neck squamous cell carcinoma. Clinical data suggest that blocking the TGF-β pathway alone is insufficient to fully restore the immune system and inhibit tumorigenesis. Therefore, no TGF-β antibodies are currently available.

[0005] Epidermal growth factor receptor (EGFR) is the expression product of the proto-oncogene C-ErbB1. It is a receptor for cell proliferation and signal transduction of epidermal growth factor (EGF). It is a member of the epidermal growth factor receptor (HER) family and belongs to the tyrosine kinase type receptor with a molecular weight of EGFR is divided into an extracellular ligand binding region, a transmembrane region, and an intracellular kinase region. After binding to the ligand, the extracellular region of EGFR changes from a monomer to a dimer, activating the intracellular kinase region and multiple downstream signaling pathways, playing an important role in physiological processes such as cell growth, proliferation, and differentiation. High expression of EGFR leads to enhanced downstream signal transduction. Increased expression of mutant EGFR receptors or ligands leads to sustained activation of EGFR, enhanced secretory loop function, and disruption of receptor downregulation mechanisms, which in turn activate genes related to tumor proliferation and differentiation, playing an important role in the formation and development of tumors. Overexpression of EGFR is associated with decreased survival in multiple cancer types, including head and neck, bladder, ovarian, cervical, and esophageal cancers. Furthermore, anti-EGFR drugs have shown significant improvements in overall survival, progression-free survival, and overall survival in several solid tumor types, including colorectal, head and neck, non-small cell lung cancer (NSCLC), and pancreatic cancer. Therefore, as a target clearly associated with tumor proliferation, EGFR targeted drugs have become the first-line treatment option for a variety of malignant tumors.

[0006] Although the signals initiated by TGF-β are different from those initiated by the EGF / EGFR pathway, the signaling pathways between the two can influence each other and have been found to interact with each other in a variety of tumors and jointly promote tumor progression. TGF-β can trans-induce the activation of EGFR and has a high degree of cell type and environment specificity. For example, TGF-β upregulates EGFR through the classic Smad and ERK / Sp1 signaling pathways, promoting the migration and proliferation of breast cancer cells (MDA-MB-231, T47D, 4T1) In squamous cell carcinoma (A431, SCC13), TGF-β activates the EGFR pathway through a H2O2-dependent mechanism to increase Erk1 / 2 EGF and its related downstream signaling pathways can also regulate TGF-β signaling in different cell types. For example, in human primary ovarian cancer cells, EGF reduces the susceptibility of ovarian cancer cells to the anti-proliferative effects of TGF-β by reducing the mRNA expression of the cell cycle regulator p15INK4B induced by TGF-β. Oncogenic Ras in breast and lung epithelial cells inhibits TGF-β-mediated signaling by downregulating Smad2 and Smad3, reducing TGF-β-induced cell growth inhibition. EGF can also positively regulate Smad2 signaling in COS7 cells by increasing Smad2 phosphorylation through the ERK pathway

[0007] TGF-β and EGF can synergistically promote the malignant phenotype of tumors. Studies in different tissues have shown that the combination of EGF and TGF-β can enhance epithelial to mesenchymal transition (EMT). For example, EGF and TGF-β1 promote the expression of laminin-332 and synergistically promote EMT in oral epithelial cancer. EGF and TGF-β1 downregulate E-cadherin through the MAPK pathway rather than the P13K, p38MAPK, JNK or AP-1 pathways, promoting intestinal epithelial cell EGF and TGF-β1 induce Slug and Snail expression through Smad and MEK1 / 2-dependent signaling pathways, downregulate E-cadherin, and promote ovarian epithelial cells EGF and TGF-β1 activate the ERK1 / 2 signaling pathway, synergistically upregulate the expression of Snail protein, and promote EMT and EGF enhances TGF-β-induced proliferation of lung cancer (H322, H358) and pancreatic cancer (HPAF-II, CAPAN-2) cells by promoting the binding of SHP2 to GAB1.

[0008] Several clinical studies have shown that elevated TGF-β levels are closely associated with drug resistance and poor prognosis. TGF-β1-induced EMT in osteosarcoma cancer stem-like cells reduces miR-499a expression, leading to increased SHKBP1 expression and, along with TGF-β-induced EMT, converts related kinases to an EGFR-independent AKT activation state, thereby reducing EGFR activity and inducing osteosarcoma resistance to EGFR kinase inhibitors. Treg cells are one of the main cells that produce TGF-β. The number of Treg cells in head and neck squamous cell carcinoma patients treated with Cetuximab increases, accompanied by an increase in TGF-β levels. The TGF-β levels in patients with poor Cetuximab efficacy are also higher. Elevated TGF-β can inhibit the expression of effector cell cytotoxic response-related molecular effectors, activate the EGFR-independent AKT pathway, and increase EMT induction to treat EGFR antibody. In EGFR-mutant non-small cell lung cancer, the canonical TGF-β / Smad signaling pathway is involved in PD-L1-induced tumor resistance to EGFR kinase inhibitors. In breast cancer tissue, the expression of TGF-β is positively correlated with the expression of EGFR, and elevated levels of TGF-β and EGFR are associated with poor prognosis in breast cancer patients. In summary, EGFR and TGF-β play relatively independent but closely related roles in the occurrence and development of tumors. In addition, TGF-β is a key molecule in tumors that develop acquired resistance to EGFR-targeted therapy. Animal experiments have shown that inhibiting TGF-β can enhance the in vivo anti-tumor effect of Cetuximab on head and neck squamous cell tumor xenografts. These provide a theoretical basis for combining TGF-β targeting to enhance the therapeutic effect of EGFR antibodies against EGFR-positive tumors.

[0009] The present invention provides a novel fusion protein containing a truncated form of TGFβR2, which can specifically target both EGFR and TGF-β, two relatively independent yet closely related signaling pathways, for the treatment of solid tumors including but not limited to gastric cancer. Summary of the Invention

[0010] In one aspect, the present invention provides a molecule that is a truncated form of the extracellular region of TGFβR2, compared to its native form.

[0011] a) at least the amino acid residues at positions 6 to 16 are deleted, and further optionally, the amino acid residues at positions 17 to 17+n are deleted, wherein n is an integer from 1 to 10; preferably, n is 2, 4, 8, 9 or 10; most preferably, n is 9; or

[0012] b) in addition to the deletion of amino acid residues at positions 6-26, further, the deletion of amino acid residues at positions 5, 4-5, 3-5, 2-5, 1, 1-2, 1-3, and 1-4; or

[0013] c) amino acid residues 7-26 are deleted.

[0014] In one embodiment, the amino acid sequence of the molecule comprises any one of SEQ ID NOs: 48-62.

[0015] In another aspect, the present invention provides a fusion protein comprising a molecule according to the present invention.

[0016] In one embodiment, the fusion protein comprises

[0017] a) a truncated form of the TGFβR2 extracellular domain and

[0018] b) Targeting moiety.

[0019] In one embodiment, the fusion protein targeting portion is a cancer cell-specific targeting portion selected from an antibody or an antigen-binding fragment thereof, a functional ligand or an Fc fusion protein thereof, and a receptor protein or an Fc fusion protein thereof.

[0020] In one embodiment, the targeting portion of the fusion protein is an anti-EGFR antibody or an antigen-binding fragment thereof.

[0021] In one embodiment, the N-terminus of the truncated form of the molecule in the fusion protein is linked to the C-terminus of the heavy chain of the targeting moiety, optionally via a linker.

[0022] In one embodiment, the linker is preferably a G4S flexible connecting peptide, preferably a (G4S)4 connecting peptide.

[0023] In another aspect, the present invention provides an isolated EGFR-binding antibody or antigen-binding fragment thereof, comprising

[0024] a) a heavy chain variable region, the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 domains of which comprise SEQ ID NOs: 19, 20 and 21, respectively, and / or

[0025] b) a light chain variable region, the light chain CDR1, light chain CDR2 and light chain CDR3 domains of which comprise SEQ ID NOs: 16, 17 and 18, respectively.

[0026] In one embodiment, the antibody or antigen-binding fragment thereof comprises

[0027] a) a heavy chain variable region, the sequence of which comprises SEQ ID NO: 28 or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or

[0028] b) a light chain variable region, the sequence of which comprises SEQ ID NO: 29, or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto.

[0029] In one embodiment, the antibody further comprises:

[0030] a) a heavy chain constant region, preferably, the sequence of which comprises SEQ ID NO: 30 or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and / or

[0031] b) a light chain constant region, preferably, whose sequence comprises SEQ ID NO: 31 or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto.

[0032] In one embodiment, the targeting portion in the fusion protein is selected from the anti-EGFR antibody, Trastuzumab, Bevacizumab, Ramucirumab, Ipilimumab or Panitumumab.

[0033] In one embodiment, the fusion protein

[0034] a) the heavy chain amino acid sequence comprises SEQ ID NO: 141, or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto; and

[0035] b) the light chain amino acid sequence is SEQ ID NO: 23 or a sequence having at least 85%, 88%, 90%, 95%, 98% or 99% sequence identity thereto;

[0036] It comprises two heavy chains and two light chains; a disulfide bond is formed between the first light chain and the first heavy chain, a disulfide bond is formed between the second light chain and the second heavy chain, and a disulfide bond is formed between the first heavy chain and the second heavy chain.

[0037] In one embodiment, the KD value of the binding affinity between the fusion protein and the human EGFR protein is 2.92 pM-26.3 pM, preferably 7 pM-9 pM, and most preferably 8.77 pM.

[0038] The KD value of the binding affinity to human TGF-β1 protein is 23pM-288.3pM, preferably 64pM-144pM, and most preferably 96.1pM.

[0039] In another aspect, the present invention provides a conjugate comprising a truncated form of the TGFβR2 extracellular region described in the present invention, the fusion protein described in the present invention, the antibody or antigen-binding fragment thereof described in the present invention and another therapeutic agent, preferably the antibody or antigen-binding fragment thereof and the other therapeutic agent are connected via a linker.

[0040] In another aspect, the present invention provides a nucleic acid encoding the truncated form of the TGFβR2 extracellular region, the fusion protein, the antibody or antigen-binding fragment thereof, which is mRNA and / or DNA.

[0041] In one embodiment, the nucleic acid comprises

[0042] Any one of SEQ ID NOs: 32-39;

[0043] Any one of SEQ ID NOs: 67-84; or

[0044] The sequence of any one of SEQ ID NOs: 148-163, or a functionally equivalent variant thereof.

[0045] In another aspect, the present invention provides an expression vector comprising the nucleic acid of the present invention.

[0046] In another aspect, the present invention provides a host cell comprising the nucleic acid of the present invention or the expression vector of the present invention.

[0047] In another aspect, the present invention provides a method for producing a truncated form of the TGFβR2 extracellular region, the fusion protein, the antibody or antigen-binding fragment thereof, which comprises culturing the host cell of the present invention under conditions suitable for the expression of the aforementioned protein molecule, and recovering the expressed product from the culture medium.

[0048] In another aspect, the present invention provides a pharmaceutical composition comprising

[0049] a) the truncated form of the TGFβR2 extracellular region of the present invention, the fusion protein of the present invention, the antibody or antigen-binding fragment thereof of the present invention, the antibody-drug conjugate of the present invention, the nucleic acid of the present invention, or the expression vector of the present invention; and

[0050] b) a pharmaceutically acceptable carrier; optionally

[0051] c) one or more additional therapeutic agents.

[0052] In another aspect, the present invention provides a truncated form of the TGFβR2 extracellular region of the present invention, the fusion protein of the present invention, the antibody or antigen-binding fragment thereof, the antibody-drug conjugate of the present invention, the nucleic acid of the present invention, the expression vector of the present invention, or the pharmaceutical composition of the present invention, for use in preventing and treating cancer, preferably treating gastric cancer.

[0053] In another aspect, the present invention provides a truncated form of the TGFβT2 extracellular region of the present invention, the fusion protein of the present invention, the antibody or antigen-binding fragment thereof, the antibody-drug conjugate of the present invention, the nucleic acid of the present invention, the expression vector of the present invention, and the pharmaceutical composition of the present invention, for use in preparing a drug for preventing and treating cancer, preferably treating gastric cancer.

[0054] In another aspect, the present invention provides a pharmaceutical combination comprising a truncated form of the TGFβR2 extracellular region described in the present invention, a fusion protein described in the present invention, an antibody or antigen-binding fragment thereof described in the present invention, an antibody-drug conjugate described in the present invention, a nucleic acid described in the present invention, an expression vector described in the present invention, or a pharmaceutical composition described in the present invention; and one or more additional therapeutic agents.

[0055] In another aspect, the present invention provides a kit comprising a truncated form of the TGFβR2 extracellular region described in the present invention, the fusion protein described in the present invention, the antibody or antigen-binding fragment thereof described in the present invention, the antibody-drug conjugate described in the present invention, the nucleic acid described in the present invention, the expression vector described in the present invention, and the pharmaceutical composition described in the present invention; preferably, it further comprises a drug administration device.

[0056] In another aspect, the present invention provides a method for preventing and treating tumor diseases, which comprises administering to a subject a truncated form of the TGFβR2 extracellular domain described in the present invention, the fusion protein described in the present invention, the antibody or antigen-binding fragment thereof described in the present invention, the antibody-drug conjugate described in the present invention, the nucleic acid described in the present invention, the expression vector described in the present invention, or the pharmaceutical composition described in the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 Binding assay of mouse antibody EGFR-mhPA8 and recombinant human EGFR-His protein;

[0058] Figure 2 The mouse antibody EGFR-mhPA8 blocks the binding of EGF to EGFR;

[0059] Figure 3 The mouse antibody EGFR-mhPA8 inhibits the proliferation of MDA-MB-468 cells;

[0060] Figure 4 Binding detection of humanized antibody EGFR-HPA8 and recombinant human EGFR-His protein;

[0061] Figure 5 The humanized antibody EGFR-HPA8 blocks the binding of EGF to EGFR;

[0062] Figure 6 The humanized antibody EGFR-HPA8 inhibits the proliferation of MDA-MB-468 cells under different ligand conditions;

[0063] Figure 7 Humanized antibody EGFR-HPA8 inhibits the proliferation of Fadu cells under different ligand conditions;

[0064] Figure 8 ADCC effect mediated by humanized antibody EGFR-HPA8;

[0065] Figure 9 Effect of EGFR-HPA8 on body weight of mice bearing SNU-5 gastric cancer subcutaneous transplanted tumors;

[0066] Figure 10 Effects of EGFR-HPA8 on tumor volume and TGI results in mice bearing SNU-5 gastric cancer subcutaneous xenografts;

[0067] Figure 11 Effect of EGFR-HPA8 on body weight of mice bearing subcutaneous NCI-H1975 non-small cell lung cancer xenografts;

[0068] Figure 12 Effects of EGFR-HPA8 on tumor volume and TGI results in mice bearing NCI-H1975 non-small cell lung cancer subcutaneous xenografts;

[0069] Figure 13 Schematic diagram of the EGFR / TGFβR2 antibody fusion protein structure;

[0070] Figure 14 Detection of the fragmentation of EGFR / TGFβR2 antibody fusion protein;

[0071] Figure 15 Detection of the degradation tendency of EGFR / TGFβR2 antibody fusion protein;

[0072] Figure 16 Detection of the binding ability of different truncated forms of TGFβR2 EGFR / TGFβR2 antibody fusion proteins to TGF-β1 and EGFR;

[0073] Figure 17 Detection of the ability of EGFR / TGFβR2 antibody fusion protein containing a truncated form of TGFβR2 to neutralize TGF-β1;

[0074] Figure 18 Detection of the ability of EGFR / TGFβR2 antibody fusion protein containing a truncated form of TGFβR2 to neutralize TGF-β3;

[0075] Figure 19Detection of the ability of fusion protein 6 to bind to TGF-β1 protein and TGF-β3 protein;

[0076] Figure 20 Detection of the ability of fusion protein 6 to block the binding of TGF-β1 protein or TGF-β3 protein to TGFβR2-Fc;

[0077] Figure 21 Fusion protein 6 binding and competition ability detection;

[0078] Figure 22 Affinity detection of fusion protein 6 and recombinant human EGFR protein;

[0079] Figure 23 Affinity detection of fusion protein 6 and recombinant human TGF-β1 protein;

[0080] Figure 24 Fusion protein 6 neutralizes the effects of TGF-β1 on Mv-1-lu cells;

[0081] Figure 25 The reporter gene system was used to detect the neutralization effect of fusion protein 6 on TGF-β1;

[0082] Figure 26 Fusion protein 6 inhibits the proliferation of MDA-MB-468 cells;

[0083] Figure 27 ADCC effect mediated by fusion protein 6;

[0084] Figure 28 Effect of fusion protein 6 on body weight of mice bearing subcutaneous transplanted tumors of NCI-H1975 non-small cell lung cancer;

[0085] Figure 29 Effect of fusion protein 6 on tumor volume in mice with subcutaneous transplanted NCI-H1975 non-small cell lung cancer;

[0086] Figure 30 Ultrafiltration stability test of fusion protein 6;

[0087] Figure 31 Detection of the fragmentation of X / TGFβR2 antibody fusion protein;

[0088] Figure 32 Degradation tendency detection of X / TGFβR2 antibody fusion protein;

[0089] Figure 33 Detection of the binding ability of X / TGFβR2 antibody fusion protein to TGF-β1;

[0090] Figure 34Detection of the ability of X / TGFβR2 antibody fusion protein to neutralize TGF-β1 and TGF-β3;

[0091] Figure 35 Detection of X / TGFβR2 antibody fusion protein binding to X-side target. DETAILED DESCRIPTION

[0092] definition

[0093] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For the purposes of the present invention, the following terms are further defined.

[0094] As used herein and in the appended claims, the singular forms "a," "an," "another," and "the" include plural referents unless the context clearly dictates otherwise.

[0095] The term "truncated" form of a protein molecule refers to a modification in which one or more amino acid residues are missing compared to the native form of the protein molecule.

[0096] The term "fusion protein" refers to a protein molecule that combines two or more proteins. It is usually obtained by expressing a hybrid gene that combines two or more gene sequences, which are inserted into an expression vector in the form of an expression frame.

[0097] The term "antibody" refers to an immunoglobulin molecule and refers to any form of an antibody that exhibits the desired biological activity, including but not limited to monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies), and even antibody fragments.

[0098] The term "variable region" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable regions of the heavy and light chains of native antibodies (VH and VL, respectively) generally have similar structures and can be further subdivided into hypervariable regions, called complementarity determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs).

[0099] The complementarity determining regions (CDRs) and framework regions (FRs) of a given antibody can be identified using the Kabat system (Kaba et al.: Sequences of Proteins of Immunological Interest, 5th ed., U.S. Department of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991).

[0100] The term "constant region" refers to amino acid sequences on the light and heavy chains of antibodies that are not directly involved in binding the antibody to the antigen, but exhibit various effector functions, such as antibody-dependent cellular toxicity.

[0101] An "antigen-binding fragment of an antibody" comprises a portion of an intact antibody molecule that retains at least some of the binding specificity of the parent antibody, typically including at least a portion of the antigen-binding region or variable region (e.g., one or more CDRs) of the parent antibody. Examples of antigen-binding fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, Fd fragment, Fd' fragment, single-chain antibody molecules (e.g., scFv, di-scFv or tri-scFv, diabodies or scFab), and single-domain antibodies.

[0102] The term "conjugate" refers to a biologically active protein or peptide molecule that forms a covalent or non-covalent linker with another molecule selected from a small molecule compound or a biological macromolecule.

[0103] " monoclonal antibody " refers to the antibody obtained from a substantially homogeneous antibody colony, that is, the colony comprising a single antibody is identical except that a possible mutation (such as natural mutation) may exist in a small amount. Therefore, the term " monoclonal antibody " shows the character of the antibody, i.e., is not a mixture of unrelated antibodies. Contrary to the polyclonal antibody preparations that generally include different antibodies for different determinants (epitopes), each monoclonal antibody of the monoclonal antibody preparation is directed to a single determinant on the antigen. Except for its specificity, the advantage of the monoclonal antibody preparation is that they are not contaminated by other antibodies conventionally. The term " monoclonal antibody " should not be construed as needing to produce the antibody by any specific method. The term monoclonal antibody specifically includes chimeric antibodies, humanized antibodies and human antibodies.

[0104] An antibody "specifically binds" to an antigen of interest, such as a tumor-associated antigen protein (herein, EGFR), i.e., it binds to the antigen with sufficient affinity to allow the antibody to be used as a therapeutic agent, targets tissues or cells expressing the antigen, and does not significantly cross-react with other proteins or with proteins other than homologs and variants (e.g., mutant forms, splice variants, or proteolytically truncated forms) of the antigenic target mentioned above.

[0105] The term "binding affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise indicated, "binding affinity" as used herein refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). D"," association rate constant kon" and "dissociation rate constant koff" are commonly used to describe the affinity between a molecule (e.g., an antibody) and its binding partner (e.g., an antigen), that is, how tightly a ligand binds to a specific protein. Binding affinity is affected by non-covalent intermolecular interactions, such as hydrogen bonds, electrostatic interactions, hydrophobic and van der Waals forces between the two molecules. In addition, the binding affinity between a ligand and its target molecule may be affected by the presence of other molecules. Affinity can be analyzed by conventional methods known in the art, including the ELISA described herein.

[0106] The term "targeting moiety" refers to a portion of a fusion protein that has the function of specifically binding to a target cell. The term includes antibodies and other natural (e.g., receptors, ligands) or synthetic (e.g., DARPins) molecules that can specifically bind to a target cell. As used herein, "specifically binds to a target cell" means that the moiety preferentially binds to a target cell within a complex mixture.

[0107] An "isolated" biomolecule is one that has been identified and separated from cells in which it is naturally expressed. Isolated biomolecules include biomolecules in situ within recombinant cells as well as biomolecules that have generally been prepared by at least one purification step.

[0108] The term "receptor" is a biochemical concept that refers to a class of molecules that can specifically recognize and bind to extracellular signals (i.e., the term "ligand") and produce specific effects in cells. The effect produced may only last for a short time, such as changing the metabolism of the cell or the movement of the cell. It may also be a long-lasting effect, such as upregulating or downregulating the expression of one or more genes. "Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fcγ receptors present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) enables these cytotoxic effector cells to specifically bind to target cells carrying antigens, and then use, for example, cytotoxins to kill the target cells. In order to assess the ADCC activity of the antibody of interest, an in vitro ADCC assay can be performed, such as the in vitro ADCC assay described in U.S. Patent No. 5,500,362 or 5,821,337 or U.S. Patent No. 6,737,056 (Presta), or the method described in the Examples of this application. Useful effector cells for this type of assay include PBMC and NK cells.

[0109] The truncated form of the TGFβR2 extracellular region of the present invention, including a fusion protein comprising the truncated form of the molecule and a targeting molecule

[0110] The full-length TGFβR2 extracellular domain contains multiple enzyme-susceptible cleavage sites between positions 7-15 of the N-terminus. To improve the structural stability of the fusion protein, the inventors deleted varying numbers of amino acids from the N-terminal amino acid sequence of the TGFβR2 extracellular domain. This yielded 15 truncated forms of the TGFβR2 extracellular domain.

[0111] The inventors used their newly isolated EGFR antibody EGFR-HPA8, Trastuzumab, Bevacizumab, Ramucirumab, Ipilimumab or Panitumumab as the targeting portion of the fusion protein, and a truncated form of the TGFβR2 protein extracellular region as the immunomodulatory portion of the fusion protein. By homologous recombination, the truncated form of the TGFβR2 protein extracellular region was connected to the C-terminus of the heavy chain of the EGFR antibody, forming an EGFR antibody / TGFβR2 light chain and extracellular region fusion protein (EGFR / TGFβR2) from the light chain and heavy chain. The fusion protein structure is as follows: Figure 13 As shown in Figure 2, the EGFR / TGFβR2 antibody fusion protein connects the C-terminal amino acid of the EGFR antibody heavy chain to the TGFβR2 amino acid with different amino acid deletions and the extracellular domain via a (G4S)4Linker (SEQ ID NO: 66). In addition, the C-terminal lysine amino group of the EGFR antibody heavy chain is removed to reduce the risk of proteolysis.

[0112] A preferred embodiment of the present invention is that the fusion protein 6 retains a high binding affinity with the human EGFR protein. The binding affinity of the fusion protein 6 with the human EGFR protein is K D The value is 8.77pM, and the binding constant kon is 1.68E+06M -1 s -1 The dissociation constant kdis is 1.47E-05s -1 In addition, the truncated TGFβR2 fusion protein 6 has a similar affinity to the human TGF-β1 protein as the full-length TGFβR2 fusion protein 1, K D The value is 96.1pM, and the binding constant kon value is 1.53E+06M -1 s -1 The dissociation constant kdis is 1.47E-04s -1 .

[0113] Nucleic acid of the present invention

[0114] The present invention also relates to nucleic acid molecules encoding truncated forms of the TGFβR2 extracellular domain of the present invention, including fusion proteins comprising the truncated forms and targeting molecules, or portions thereof. Some exemplary sequences of these nucleic acid molecules are shown in the sequence listing.

[0115] The nucleic acid molecules of the present invention are not limited to the sequences disclosed herein, but also include variants and other nucleic acid forms corresponding thereto, such as mRNA, cDNA and variants thereof. Variants in the present invention can be described with reference to their physical properties during hybridization. Those skilled in the art will recognize that nucleic acids can be used to identify their complements and equivalents or homologs thereof using nucleic acid hybridization techniques.

[0116] Recombinant vectors and expression

[0117] The present invention also provides a recombinant construct comprising one or more nucleotide sequences of the present invention. The recombinant construct of the present invention can be used together with a vector, such as a plasmid, phagemid, phage or viral vector, into which the nucleic acid molecule encoding the antibody of the present invention is inserted.

[0118] Provided herein are molecules of truncated forms of the extracellular region of TGFβR2, targeting molecules, and fusion proteins comprising truncated forms of the molecules and targeting molecules that can be prepared by recombinantly expressing nucleotide sequences encoding the molecules or proteins in host cells. The molecules or proteins may contain more than one amino acid. To recombinantly express multiple amino acids, host cells can be transfected with one or more recombinant expression vectors carrying encoding nucleotide sequences so that the multiple amino acids are expressed in the host cells. Standard recombinant DNA methodologies are used to prepare and / or obtain nucleic acids encoding the molecules or proteins, incorporate these nucleic acids into recombinant expression vectors, and introduce the vectors into host cells, such as those described in Sambrook, Fritsch and Maniatis (eds.), Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), Ausubel, FM et al. (eds.) Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), and U.S. Pat. No. 4,816,397 to Boss et al. Examples of prokaryotic host cells are bacteria, and examples of eukaryotic host cells are yeast, insect or mammalian cells. It will be appreciated that the design of the expression vector, including the selection of regulatory sequences, is influenced by factors such as the choice of host cell, the level of protein expression desired, and whether expression is constitutive or inducible.

[0119] The truncated forms of the TGFβR2 extracellular domain, targeting molecules, and fusion proteins of the present invention can be recovered and purified from recombinant cell cultures by known methods, including but not limited to ammonium sulfate or ethanol precipitation, acid extraction, protein A affinity chromatography, protein G affinity chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography. High performance liquid chromatography ("HPLC") can also be used for purification.

[0120] use

[0121] The molecules, antibodies and fusion proteins of the truncated forms of the TGFβR2 extracellular region of the present invention can be used to treat cancer, such as gastric cancer.

[0122] Pharmaceutical composition

[0123] One or more of the truncated molecules, fusion proteins, antibodies and antigen-binding fragments, truncated molecule-drug conjugates, fusion protein-drug conjugates, antibody-drug conjugates, nucleic acids, and carriers of the present invention can be prepared with at least one other chemical agent to form a pharmaceutical composition comprising the above-mentioned active ingredient and one or more pharmaceutically acceptable carriers, diluents or excipients; optionally, one or more other therapeutic agents.

[0124] Reagent test kit

[0125] The present invention also relates to pharmaceutical packaging and kits comprising one or more containers containing the pharmaceutical compositions of the present invention as described above. Associated with such containers may be a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals or biological products, reflecting approval by the agency for manufacture, use, or sale of the product for human administration.

[0126] Preparation and storage

[0127] The pharmaceutical compositions of the present invention can be manufactured in a manner known in the art, such as by means of conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing methods.

[0128] After pharmaceutical compositions comprising compounds of the invention formulated in an acceptable carrier have been prepared, they can be placed in appropriate containers and labeled for use in treating an indicated condition. Such labeling will include the amount, frequency, and method of administration.

[0129] Drug combinations

[0130] The above-mentioned pharmaceutical compositions comprising the antibodies of the present invention are also combined with one or more other therapeutic agents, where the resulting combination does not cause unacceptable adverse effects.

[0131] The following examples are provided to illustrate the present invention, but are not intended to limit the present invention.

[0132] Example

[0133] Example 1: Screening of murine antibodies that block the binding of EGF to EGFR using a phage antibody display library

[0134] 1.1 Mouse immunization and phage antibody library screening

[0135] Mice were immunized with nucleic acid plasmids pCMV3-mFlt3L (G12FE5S01-D, constructed by Shenzhou Cell Engineering Co., Ltd., SEQ ID NO: 142) and pCMV3-mCSF2 (G12FE5S02-D, constructed by Shenzhou Cell Engineering Co., Ltd., SEQ ID NO: 143). The specific method was as follows: two days before the first immunization, 10 μM cardiotoxin was injected intramuscularly. Each immunization was followed by an intramuscular injection of 20 μg / leg of a mixture of pCMV3-mFlt3L and pCMV3-mCSF2 at a mass ratio of 1:1. Three days later, 30 μg / leg of pGS6-EGFR-TT-WPRE (constructed by Shenzhou Cell Engineering Co., Ltd., SEQ ID NO: 144) was injected intramuscularly. For the fourth and fifth immunizations, 5×10 6 For insect cells overexpressing EGFR, the immunization intervals were 2 weeks, 2 weeks, 2 weeks, and 2 weeks, respectively. Starting from the third immunization, blood was collected from the orbital venous plexus seven days after each immunization. The ELISA method was used to coat recombinant human EGFR protein (source: Beijing Yiqiao Shenzhou Technology Co., Ltd., Cat 10001-H08B, the same below) to detect the titer of mouse anti-EGFR serum. With the immune serum titer reaching 8000 times and the serum titer OD>1 as the standard, after the fifth immunization serum titer reached the standard, 5×10 6 MDA-MB468 cells were injected intraperitoneally for boosting, and mice were killed 7 days later. The spleen tissues of mice were obtained and frozen in liquid nitrogen.

[0136] RNA was extracted from mouse spleen tissue using TriPure Isolation Reagent (Source: Roche Cat No. 11 667165 001) and reverse transcribed using the TriPure Isolation Reagent Reverse Transcription Kit (Source: Invitrogen Cat No. 18080-051) to obtain cDNA. Nucleotide sequences encoding the light and heavy chain variable regions of the mouse antibody were amplified by PCR. The nucleotide sequences encoding the light and heavy chain variable regions of the mouse antibody were spliced ​​into the nucleotide sequence encoding the scFv using overlap extension PCR. The light and heavy chain variable regions were connected via linkers:

[0137] TCTAGTGGTGGCGGTGGTTCGGGCGGTGGTGGAGGTGGTAGTTCTAGATCTTCC (SEQ ID NO: 2)

[0138] conduct The recombinant human EGFR protein was then digested with the restriction endonuclease Sfi I (source: Fermentas) and ligated into the phage vector pComb3x (source: Beijing Sino-Bio Technologies Co., Ltd.) and electroporated to construct a phage-displayed scFv antibody library for immunized mice. The recombinant human EGFR protein was coated on an ELISA plate, and a phage library enriched in anti-EGFR positive antibodies was obtained according to the phage antibody panning process. Subsequently, the above library was mixed with MDA-MB-468 cells (source: Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences), and a phage library enriched in anti-MDA-MB-468 cell positive antibodies was obtained from the above library according to the phage antibody panning process (O'Brien, PM, & Aitken, R. (Eds), Springer Science & Business Media. 2002; ISBN: 9780896037113). Monoclonal phages were selected from the enriched library for expression, and the binding to recombinant human EGFR protein was detected by ELISA. A high-binding antibody EGFR-mhPA8 scFv antibody clone that specifically binds to recombinant human EGFR was screened and obtained. The clone was sent to a sequencing company for sequencing to obtain the nucleotide sequence of the EGFR-mhPA8 scFv antibody (SEQ ID NO: 3).

[0139] 1.2 Functional testing of mouse antibodies targeting EGFR

[0140] 1.2.1 Mouse Antibody Binding and Ligand Competition Function

[0141] The binding ability of mouse antibodies to recombinant human EGFR protein was assessed by ELISA. Recombinant human EGFR-His protein (source: Beijing Sino Biological Technology Co., Ltd., hereinafter referred to as "Sino Biological") at various concentrations (1.37 ng / mL, 4.12 ng / mL, 12.35 ng / mL, 37.04 ng / mL, 111.11 ng / mL, 333.33 ng / mL, 1000 ng / mL, and 3000 ng / mL) was coated onto 96-well plates at 100 μL per well and incubated overnight at 4°C. The plates were washed the next day and blocked for 1 hour at room temperature. 13.89 nM EGFR-mhPA8 and negative control antibody H7N9-R1 (source: Sino Cell Engineering Co., Ltd., hereinafter referred to as "Sino Biological Technology") were added and incubated for 1 hour. The plates were then washed to remove any unbound antibody. Add the secondary antibody Goat anti-hIgG F(ab)2 / HRP (source: Jackson ImmunoResearch, Cat.109-036-006, same below) and incubate for 1 hour. Wash the plate repeatedly and add the substrate colorimetric solution for color development. After the color development is terminated, read the OD value on a microplate reader. 450 The concentration of recombinant human EGFR-His protein is used as the horizontal axis, and OD 450 The readings were taken as the vertical axis, and GraphPad Prism 6.0 software was used to fit the S-shaped curve and analyze the EC value of the antibody binding to the recombinant human EGFR-His protein. 50 The results are as follows Figure 1 As shown, the human-mouse chimeric antibody EGFR-mhPA8 can effectively bind to recombinant human EGFR-His and EC 50 128.7 ng / mL, R 2 =1.000. The negative control H7N9-R1 did not bind to the recombinant human EGFR-His protein.

[0142] This example further analyzed the ability of EGFR-mhPA8 to block EGFR ligand-receptor binding by FACS. 5 10 μL of biotin-labeled EGF-Fc protein with a final concentration of 217.1 nM (source: Beijing Yiqiao Shenzhou Technology Co., Ltd.) was added to each MDA-MB-468 cell. After incubation at 2-8°C for 30 minutes, EGFR-mhPA8 antibodies with final concentrations of 306.74 nM, 102.25 nM, 34.08 nM and 11.36 nM were added, and H7N9-R1 was used as a negative control antibody. After mixed incubation at 2-8°C for 20 minutes, the cells were washed with PBS and centrifuged to remove unbound antibodies and ligands. Streptavidin-488-FITC secondary antibody (source: Beijing Yiqiao Shenzhou Technology Co., Ltd., the same below) was added and incubated at 2-8°C for 1 hour, and the cells were washed repeatedly and centrifuged to remove unbound secondary antibodies. Finally, 200 μL of PBS was added to resuspend the cells, and the cells were filtered through a 400-mesh filter into a flow tube for flow cytometry detection. The results are as follows. Figure 2 As shown, EGFR-mhPA8 can effectively block the binding of EGF-Fc protein to EGFR on MDA-MB-468 cells in a concentration gradient.

[0143] 1.2.2 Inhibition of MDA-MB-468 cell proliferation by mouse antibodies

[0144] Breast cancer MDA-MB-468 cells highly express EGFR and autosecrete various ligands of EGFR. In this example, the WST-8 method was used to determine the growth inhibitory effect of mouse antibodies on MDA-MB-468 cells.

[0145] MDA-MB-468 cells were evenly seeded in 96-well plates, 5×10 3 / well. After the cells were cultured in a CO2 incubator for 3 hours, different concentrations of mouse antibody EGFR-mhPA8 (66.7nM, 22.2nM, 7.4nM, 2.5nM, 0.82nM, 0.27nM, 0.093nM, 0.033nM and 0.013nM) were added. At the same time, a negative control group M (containing cells) and a blank control group B (only culture medium was added, no cells were added) were set up. After the cells were incubated in a CO2 incubator at 37°C and 5% CO2 for 5 days, WST-8 was added at 15μL / well. After 240 minutes, the OD was detected by microplate reader. 450 -OD 630 , after subtracting the reading of the blank well B, the inhibition rate of the mouse antibody was calculated. Inhibition rate = (OD value of group M - OD value of sample) / (OD value of group M) × 100%. GraphPad Prism software was used to analyze and draw a dose-effect curve, with the horizontal axis representing the antibody concentration and the vertical axis representing the inhibition rate. Figure 3 As shown in the figure, EGFR-mhPA8 can effectively inhibit the proliferation of MDA-MB-468 cells and the inhibition rate increases in an "S" curve with the increase of drug concentration. 50 2.78nM, R 2 =0.991.

[0146] Example 2: Humanization of the murine antibody EGFR-mhPA8 and in vitro and in vivo performance analysis of the humanized antibody

[0147] 2.1 Humanization and production of the mouse antibody mhPA8

[0148] The nucleotide sequence of the EGFR-mhPA8 antibody was deduced, and the amino acid sequence of the heavy chain (SEQ ID NO: 8) and light chain variable region (SEQ ID NO: 9) of the EGFR-mhPA8 scFv antibody was obtained. The amino acid sequences of the three CDRs of each of the light and heavy chains of the EGFR-mhPA8 scFv were determined using the Kabat numbering scheme and are shown in SEQ ID NOs: 10-15. These three CDRs, with the exception of the N to D mutation at position 52 in LCDR2, were transplanted during subsequent humanization steps and retained in the resulting humanized antibody, EGFR-HPA8 scFv.

[0149] Table 1 EGFR-mhPA8 light chain and heavy chain CDR sequences

[0150]

[0151] Humanization of mouse antibodies using the classic CDR transplantation method Antibodies with at least 50% similarity to the mouse light and heavy chain variable regions, and whose framework regions show at least 50% amino acid sequence similarity to the light and heavy chain variable regions of the antibody to be modified, are selected as humanization template libraries. From these, humanized antibodies with the highest spatial structural similarity to the variable regions of the antibody to be modified are selected as humanization templates. The three CDR sequences of the mouse antibody light or heavy chain are substituted into the corresponding CDR amino acid sequences in the humanization template. To improve the chemical stability of the antibody and maintain biological function, amino acids with a high risk of deamidation, such as NG, NS, NA, and NT, are mutated. The affinity of the humanized antibodies is tested using ELISA, and those with maintained affinity are selected. In this example, the humanized template used for transplantation of the light chain variable region of EGFR-mhPA8 was IGKV1-NL1*01, which shares 68.4% homology with the EGFR-mhPA8 light chain. The humanized template for the heavy chain variable region was IGHV1-69-2*01, which shares 64.9% homology with the EGFR-mhPA8 heavy chain. In the LCDR2 variable domain of the humanized antibody EGFR-HPA8, the N-to-D mutation at position 52, a site susceptible to deamidation, was selected.

[0152] Because key positions in the mouse framework regions are crucial for maintaining the stability of the CDR structure, they were backmutated to the corresponding amino acids in the mouse antibody. According to Kabat numbering, position 45 of the light chain was backmutated to Q, position 48 to I, position 74 to K, and position 76 to D. Position 38 of the heavy chain was backmutated to K, position 48 to I, and position 70 to L. The humanized antibody EGFR-HPA8 was obtained by humanized CDR grafting and framework region backmutation. The heavy and light chain amino acid sequences of the antibody are shown in SEQ ID NOs: 22 / 23, respectively. The amino acid sequences of the heavy and light chains containing signal peptides are shown in SEQ ID NOs: 24 / 25, respectively, which respectively comprise heavy chain / light chain signal peptide amino acid sequences linked in sequence (SEQ ID NOs: 26 / 27). The variable region amino acid sequences of the humanized antibody heavy chain / light chain are shown in SEQ ID NOs: 28 / 29. The constant regions of the humanized antibody are human IgG1 heavy chain constant region / human kappa light chain constant region sequences (SEQ ID NOs: 30 / 31). The humanized CDR sequences are shown in Table 2.

[0153] Table 2 EGFR-HPA8 light chain and heavy chain CDR sequences

[0154]

[0155] The EGFR-HPA8 antibody light chain nucleotide sequence (SEQ ID NO: 33) containing a signal peptide was amplified by splicing PCR. This sequence contained the light chain signal peptide nucleotide sequence (SEQ ID NO: 35), the humanized antibody light chain variable region nucleotide sequence (SEQ ID NO: 37), and the human kappa light chain constant region nucleotide sequence (SEQ ID NO: 39). This PCR product was inserted into the pSTEP2 vector (Source: Shenzhou Cell Engineering Co., Ltd., similarly hereinafter) (double-digested with HindIII and Xba I) by in-fusion, and the correct plasmid was verified by sequencing. The EGFR-HPA8 antibody heavy chain variable region nucleotide sequence (SEQ ID NO: 36) was obtained by whole-gene synthesis and inserted into the pSTEP2 vector containing the heavy chain signal peptide nucleotide sequence (SEQ ID NO: 34) and the human IgG1 heavy chain constant region nucleotide sequence (SEQ ID NO: 38) by in-fusion, and the correct EGFR-HPA8 light and heavy chain expression vectors were verified by sequencing. After plasmid extraction, HEK-293 cells (fut8 gene knockout) were transfected and cultured for expression for 7 days. After centrifugation, the cell supernatant was purified by affinity chromatography. The chromatography medium was Protein A filler that interacts with Fc. The Protein A chromatography column was equilibrated with 50mM Tris, 10mM NaCl, pH 8.0 buffer for 5-10 column volumes, and the filtered culture supernatant was added to the chromatography column for binding. The column was eluted with 20mM Tris, 0.3M Arg, pH 6.5 buffer for 5-10 column volumes, and then the column was washed with 0.1M Gly, 10mM NaCl, pH 3.5 elution buffer. The collected sample was neutralized with 2M Tris (pH 8.0) to obtain high-purity and high-quality ADCC-enhanced EGFR-HPA8 antibodies.

[0156] F1 (SEQ ID NO. 167) GTCACCGTCCTGACACGAAGCTTGCCGCCACC R1(SFQ ID NO.168) ACTATAGAATAGGGCCCTCTAGA F2 (SEQ ID NO. 169) GGCAAGGCTCCAAAGCTGCTGATTTAC R2 (SEQ ID NO. 170) GTAAATCAGCAGCTTTGGAGCCTTGCC F3 (SEQ ID NO. 171) ACCTACTACTGTATGCAGTCCTATGAT R3 (SEQ ID NO 172) ATCATAGGACTGCATACAGTAGTAGGT

[0157] Primer sequences for the heavy chain variable region of the EGFR-HPA8 antibody synthesized from the whole gene

[0158]

[0159]

[0160] 2.2 In vitro performance analysis of humanized EGFR-HPA8 antibody

[0161] 2.2.1 Humanized Antibody Specific Binding and Ligand Competition Function

[0162] Referring to Example 1.2.1, ELISA was used to detect the binding ability of human antibodies to recombinant human EGFR protein, and SCT200 (described in CN200610012002.8, the same below), Erbitux (MERCK, 201621, the same below) and negative controls were set up. Figure 4 As shown, the specific binding of humanized EGFR-HPA8 antibody to recombinant human EGFR-His EC 50 116.6 ng / mL, R 2 =1.000; EC of SCT200 50 166.5 ng / mL, R 2 =1.000; EC of Erbitux binding 50 was 253.6 ng / mL, R 2 =1.000; negative control H7N9-R1 showed no binding. The results showed that EGFR-HPA8 had a better ability to bind to recombinant human EGFR-his than SCT200 and Erbitux.

[0163] At the same time, the ability of humanized antibody EGFR-HPA8 to block EGFR ligand receptor binding was analyzed by FACS with reference to Example 1.2.1, and SCT200, Erbitux and negative controls were set. Figure 5 As shown in the results, EGFR-HPA8 has a stronger ability to block the binding of EGF-Fc protein to EGFR on MDA-MB-468 cells than SCT200 and Erbitux.

[0164] 2.2.2 Inhibition of proliferation of different tumor cells by humanized antibodies

[0165] 2.2.2.1 Humanized Antibodies Inhibit MDA-MB-468 Cell Proliferation

[0166] MDA-MB-468 cells were evenly seeded in 96-well plates, 5×10 3After culturing the cells in a COx incubator for 3 hours, different concentrations of the humanized antibody EGFR-HPA8 (666.7 nM, 222.2 nM, 74.1 nM, 24.7 nM, 8.23 ​​nM, 2.74 nM, 0.91 nM, 0.31 nM, and 0.1 nM) were added, and SCT200 and Erbitux controls were set up. For ligand addition experiments, HB-EGF (source: Beijing Sino-Biological Technology Co., Ltd., the same below), BTC-Fc (source: Beijing Sino-Biological Technology Co., Ltd., the same below), or Fc-EREG (source: Beijing Sino-Biological Technology Co., Ltd., the same below) were added at a final concentration of 8 ng / mL. After incubation for 5 days in a CO2 incubator at 37°C and 5% CO2, WST-8 was added at 15 μL / well. After 240 minutes, the OD value was measured using a microplate reader. 450 -OD 630 Calculate the cell growth inhibition rate of the antibody. The group with ligand but no antibody is the M group. Inhibition rate = (OD value of group M - OD value of sample) / (OD value of group M) × 100%. Use GraphPad Prism software to analyze and draw a dose-effect curve, with the horizontal axis being the antibody concentration and the vertical axis being the inhibition rate. The results are shown in Figure 2. Figure 6 As shown in Table 3, under ligand-free conditions, EGFR-HPA8 has a better inhibitory effect on the growth of MDA-MB-468 cells than SCT200 and Cetuximab control antibody. EGFR-HPA8 has a similar maximum inhibition rate to SCT200, but has a lower growth inhibition EC 50 The results of Example 2.2.1 show that EGFR-HPA8 has a stronger ability to block the binding of EGF-Fc protein to EGFR on MDA-MB-468 cells than SCT200 and Erbitux. In this example, different EGFR ligands were added to the MDA-MB-468 cell growth inhibition test to further verify the ability of EGFR-HPA8 to block the binding of EGFR ligand receptors at the cell function level. The results are shown in Figure 2. Figure 6 As shown in Figures B-6D and Table 3, under different ligand conditions, the ability of EGFR-HPA8 to inhibit the proliferation of MDA-MB-468 cells was superior to that of SCT200 and Cetuximab.

[0167] Table 3 EC50 and maximum neutralization rate of EGFR-HPA8 antibody in inhibiting MDA-MB-468 cell proliferation

[0168]

[0169]

[0170] 2.2.2.2 Humanized antibodies inhibit Fadu cell proliferation

[0171] Human pharyngeal squamous cell carcinoma cells, Fadu, highly express EGFR and auto-secrete various ligands of EGFR. Referring to Example 2.2.2.1, the WST-8 assay was used to measure the inhibitory effect of EGFR-HPA8 antibody on the proliferation of Fadu cells (Source: Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) under different ligand conditions. The results are shown in Figure 2. Figure 7 As shown in Table 4, under ligand-free conditions, EGFR-HPA8 exhibited similar growth inhibitory activity against Fadu cells as SCT200 and superior activity to Cetuximab. However, under different ligand conditions, EGFR-HPA8 exhibited significantly superior growth inhibitory activity against Fadu cells compared to both SCT200 and Cetuximab. These results demonstrate that the EGFR-HPA8 antibody possesses superior inhibitory activity against EGFR ligand-receptor binding compared to SCT200 and Cetuximab.

[0172] Table 4 EC50 and maximum neutralization rate of EGFR-HPA8 antibody in inhibiting Fadu cell proliferation

[0173]

[0174] 2.2.3 ADCC effect of humanized antibodies

[0175] This example uses a recombinant CD16a reporter gene system to detect ADCC mediated by the humanized antibody EGFR-HPA8. The recombinant CD16a reporter gene system consists of effector cells, Jurkat-NFAT-Luc2p-CD16A, and target cells expressing EGFR. When these two cells are co-cultured and an EGFR antibody is added, the Fab fragment of the EGFR antibody binds to EGFR expressed on the surface of the target cells. The Fc fragment of the EGFR antibody then binds to effector cells that overexpress the Fcγ receptor CD16a, thereby activating the effector cells, Jurkat-NFAT-Luc2p-CD16A, and promoting NFAT-RE-mediated bioluminescence.

[0176] Target cells A431 cells (Source: Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were evenly seeded in 96-well plates, 1×10 4 After overnight incubation, different concentrations of antibodies (2.67nM, 0.53nM, 0.11nM, 0.021nM, 0.0043nM, 0.00085nM, 0.00017nM and 0.000034nM) were added at 40μL / well, followed by the addition of 1×10 5Effector cells Jurkat-NFAT-Luc2p-CD16A (source: Shenzhou Cell Engineering Co., Ltd., the same below), 40 μL / well, 3 replicates for each assay. At the same time, target cells, effector cells and negative antibody control wells were set up. After the cells were placed in a CO2 incubator at 37°C and 5% CO2 for 4 hours, Passive Lysis 5×Buffer was added, 20 μL / well. The cells were frozen and thawed once, and after shaking the plate to mix, 20 μL of supernatant was taken from each well and transferred to a 96-well white bottom plate, and luminescence detection was performed using an LB960-microplate luminescence detector. GraphPad Prism software was used to analyze and draw the dose-effect curve, with the horizontal axis representing the concentration of the sample and the vertical axis representing the RLU value. The bioluminescence intensity induction factor = sample RLU / negative control group RLU. The results are shown in Figure 8 As shown in Figure 2, EGFR-HPA8 and the positive controls Erbitux and SCT200 can mediate effective ADCC effects on EGFR-expressing A431 tumor cells. EGFR-HPA8 has advantages in terms of half effective concentration and induction multiple. 50 0.008nM, R 2 =0.999.

[0177] 2.3 Efficacy of EGFR-HPA-8 on subcutaneous xenografts of human gastric cancer cell line SNU-5 and human non-small cell lung cancer line NCI-H1975 in mice

[0178] SNU-5 cells (ATCC cell bank) in the logarithmic growth phase were washed with PBS and digested with 0.25% trypsin. The digestion solution was collected and the cells were collected by centrifugation at 800 rpm for 5 min. The cells were resuspended in PBS and the cell concentration was adjusted to 5.0×10 7 Balb / c-nude (Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) mice were subcutaneously inoculated with 5.0×10 6 SNU-5 cell suspension, 100 μL / cell. When the tumor volume reaches 170 mm 3 The mice were randomly divided into seven groups according to tumor size, with 5 mice in each group. Drug administration began on the day of grouping, with intraperitoneal injection (IP) twice a week for 7 consecutive doses. The specific dosing schedule is shown in Table 5 below.

[0179] Table 5 Experimental groups and drug administration

[0180]

[0181] Note: The administration volume is calculated based on 10 mL / kg of mouse body weight.

[0182] Tumor Growth Inhibition Value (TGI) calculation method: T / C (%) = T RTV / C RTV ×100%(T RTV RTV for the treatment group; C RTV is the negative control group RTV), relative tumor volume RTV=V T / V0, V0 is the tumor volume measured on D0 when the drug was administered in different cages, V T The tumor volume measured at each time is TGI (%) = 1-T / C (%).

[0183] During the administration period, all experimental animals were in good condition and had a certain degree of weight gain. There was no significant difference in the weight of mice in each administration group compared with the vehicle control group (P>0.05). Figure 9 and Table 6.

[0184] Table 6 Effect of EGFR-HPA8 on body weight in SNU-5 human gastric cancer transplanted tumor model mice

[0185]

[0186] a Mean ± standard deviation

[0187] b The body weights of the treatment groups were statistically compared with those of the solvent control group 31 days after administration using t-test;

[0188] The tumor volume and TGI results of each group in the experiment are shown in Table 7 and Figure 10 After 31 days of treatment, the average tumor volume in the Vehicle group was 559.9±144.9mm 3 The tumor volume of the positive control SCT200 low-dose 5mpk group was 317.1±197.6mm 3 The TGI was 44.3%, which was not significantly different from the Vehicle group (P=11.28%). The EGFR-HPA8 low-dose 5mpk group showed better efficacy, with a tumor volume of 113.8±74.0mm 3 The TGI was 80.0%, which was significantly different from the Vehicle group (P < 0.05), indicating that EGFR-HPA8 showed slightly better tumor inhibition than the positive control SCT200 at this dose (P = 0.09). The tumor volume of the positive control SCT200 20mpk group was 191.8 ± 189.1 mm 3 The TGI was 66.5%, which was significantly different from that of the Vehicle group (P < 0.05). The tumor volume of the EGFR-HPA8 high-dose 20 mpk group was 175.0 ± 175.0 mm3 The TGI was 68.9%, significantly different from the vehicle group (P < 0.05). Both the EGFR-HPA8 and positive control SCT200 20 mpk groups showed significant tumor inhibition, with no significant difference in tumor volume between the two groups (P = 0.9). In summary, EGFR-HPA8 demonstrated significant antitumor efficacy in the SNU-5 human gastric cancer xenograft model at both the 5 mpk and 20 mpk dose levels, with slightly superior tumor inhibition compared to SCT200 at the lower dose.

[0189] Table 7 Effects of EGFR-HPA8 on tumor volume in SNU-5 human gastric cancer xenograft model mice

[0190]

[0191] a Mean ± standard deviation

[0192] EGFR-HPA8 also demonstrated a significant tumor-suppressing effect against subcutaneous xenografts of the human non-small cell lung cancer line NCI-H1975 in mice. NCI-H1975 cells (Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were subcutaneously inoculated on the right back of Balb / c-nude mice. The experimental groups and dosing are shown in Table 8.

[0193] Table 8 Experimental groups and drug administration

[0194]

[0195] Note: The administration volume is calculated based on 10 mL / kg of mouse body weight.

[0196] During the administration period, all experimental animals were in good condition and their weight increased to a certain extent. There was no significant difference in the weight of mice in each administration group compared with the solvent control group (P>0.05). Figure 11 and Table 9.

[0197] Table 9 Effect of EGFR-HPA8 on body weight of mice with NCI-H1975 human lung cancer transplantation model

[0198]

[0199]

[0200] a Mean ± standard deviation

[0201] b The body weights of the treatment groups were statistically compared with those of the solvent control group 31 days after administration using t-test;

[0202] The tumor volume and TGI results of each group in the experiment are shown in Table 10 and Figure 12 After 18 days of treatment, both the positive control SCT200 and the high- and low-dose EGFR-HPA8 groups showed significant tumor inhibition effects. Statistical analysis showed significant differences in tumor volume between each treatment group and the Vehicle group. The average tumor volume of the Vehicle group on Day 18 was 1564.3±529.0mm. 3 The tumor volumes after SCT200 5 mpk and EGFR-HPA8 5 mpk treatment were 151.9±99.1mm 3 and 86.5±107.5mm 3 The TGI was 90.4% and 94.5%, respectively. The tumor volume after SCT200 20 mpk and EGFR-HPA8 20 mpk treatment was 289.8±321.4 mm 3 and 149.3±94.9mm 3 , TGI were 81.8% and 90.4%, respectively. EGFR-HPA8 showed slightly superior tumor inhibition compared to the positive control SCT200 at both 5 and 20 mpk doses, but the difference was not statistically significant. Taken together, these results suggest that EGFR-HPA8 exhibits significant antitumor efficacy in the NCI-H1975 human non-small cell lung cancer xenograft model.

[0203] Table 10 Effects of EGFR-HPA8 on tumor volume and TGI in the NCI-H1975 human lung cancer xenograft model

[0204]

[0205] a Mean ± standard deviation

[0206] Example 3: Design and Quality Function Testing of EGFR / TGFβR2 Antibody Fusion Proteins Containing Different Truncated Forms of TGFβR2

[0207] 3.1 Design of EGFR / TGFβR2 antibody fusion protein expression vectors containing different truncated forms of TGFβR2 and protein expression and purification

[0208] This example uses EGFR antibody as the targeting portion of the fusion protein, and the extracellular domain of TGFβR2 as the immunomodulatory portion of the fusion protein. The extracellular domain of TGFβR2 is linked to the C-terminus of the heavy chain of the EGFR antibody by homologous recombination, forming an EGFR antibody / TGFβR2 extracellular domain fusion protein (EGFR / TGFβR2) composed of two chains, the light chain and the heavy chain. The fusion protein structure is as follows: Figure 13As shown. Mass spectrometry analysis results showed that there are multiple enzyme-cutting sites between the 7-15 positions of the N-terminal end of the full-length TGFβR2 extracellular domain. In order to improve the structural stability of the fusion protein, the N-terminal amino acid sequence of the TGFβR2 extracellular domain was modified by deletion of different numbers of amino acids in this example (SEQ ID NO: 47-65). The EGFR / TGFβR2 antibody fusion protein connects the heavy chain C-terminal amino acid of the EGFR antibody to the TGFβR2 extracellular domain with different amino acid deletion forms through (G4S)4Linker (SEQ ID NO: 66). In addition, the C-terminal lysine amino group of the heavy chain of the EGFR antibody was removed to reduce the risk of proteolysis. The specific design scheme of the EGFR / TGFβR2 antibody fusion protein is shown in Table 11.

[0209] Table 11 EGFR / TGFβR2 antibody fusion protein design scheme

[0210]

[0211]

[0212] The target gene is amplified by PCR or overlap PCR, ligated into an expression vector via in-fusion, and after correct sequencing, the respective plasmids are extracted and transiently transfected into HEK-293 cells (fut8 knockout) and cultured until day 7. The cells are then centrifuged and the supernatant collected. The supernatant is then purified using Protein A affinity chromatography to yield the ADCC-enhanced EGFR / TGFβR2 antibody fusion protein.

[0213] 3.2 Fragmentation of EGFR / TGFβR2 Antibody Fusion Proteins Containing Different Truncated Forms of TGFβR2

[0214] The sample expression purity and fragmentation were analyzed by reducing SDS-PAGE. The different truncated EGFR / TGFβR2 antibody fusion proteins 1-16 purified in Example 3.1 were subjected to reducing SDS-PAGE detection. Specific steps of reducing SDS-PAGE: (1) SDS-PAGE preparation: 3.9% concentrated gel, 13% separation gel; (2) The sample was boiled at 100°C for 2 minutes, and 8μg was loaded after centrifugation: (3) Constant current 40mA, electrophoresis time 1h. The test results are shown in Figure 14. The molecular weight of the light chain of the EGFR / TGFβR2 antibody fusion protein is about 25KDa, the molecular weight of the heavy chain is about 66KDa, and the molecular weight of the spliced ​​body is between 45-66KDa. The results showed that there were obvious spliced ​​bodies in the extracellular region of TGFβR2, and the fusion proteins of different truncated forms of the extracellular region of TGFβR2 had significantly fewer broken bands than the fusion proteins of the full-length form of the extracellular region of TGFβR2. Therefore, the different truncated forms of the TGFβR2 extracellular region prepared in the present invention significantly improved the stability of the fusion protein containing the TGF-β receptor antibody.

[0215] 3.3 Degradation tendency of EGFR / TGFβR2 antibody fusion proteins containing different truncated forms of TGFβR2

[0216] In this example, the stability of EGFR / TGFβR2 antibody fusion proteins targeting different truncated forms of TGFβR2 was further evaluated using 293E cell supernatant to accelerate the treatment of the fusion protein. The 293E cell expression system is commonly used for antibody expression, as it expresses a variety of host cell proteins (HCPs) and proteases required for cell growth. Therefore, the stability of the antibody can be assessed by observing the propensity of the fusion protein to break down in the 293E cell supernatant.

[0217] The purified fusion protein was mixed with the supernatant of 10-day-old 293E cells at a volume ratio of 1:0.3, resulting in a final fusion protein concentration of approximately 1 mg / mL. The mixture was vortexed and incubated at 37°C for 48 hours. A cell-free supernatant control was also included. Sample purity and the content of splice variants were assessed by reducing SDS-PAGE, and the purity of the fusion protein heavy chain was calculated using BandScan software.

[0218] Test results are shown in Figure 15 The fragmentation ratios for each sample are shown in Table 12. The results showed that the proportion of splice variants in the truncated TGFβR2 fusion proteins (fusion proteins 2-16) in the control group was less than 4.0%, significantly lower than the 24.8% of the full-length TGFβR2 fusion protein (fusion protein 1). After incubation with the cell supernatant at 37°C for 48 hours, the full-length TGFβR2 fusion protein (fusion protein 1) in the experimental group was completely cleaved, reaching a ratio of 100%. The truncated TGFβR2 fusion proteins (fusion proteins 2-16) contained varying proportions of splice variants, but were significantly superior to the full-length control. Fusion proteins 2, 6, 9, 10, and 13 performed best, with splice variants less than 3.0%.

[0219] Table 12 Degradation ratio of EGFR / TGFβR2 antibody fusion proteins containing different truncated forms of TGFβR2

[0220]

[0221] The above results indicate that compared with the full-length TGFβR2 fusion protein 1, the EGFR / TGFβR2 antibody fusion proteins with different truncated forms of TGFβR2 have a stronger ability to resist protease degradation.

[0222] 3.4 Detection of TGF-β binding by EGFR / TGFβR2 antibody fusion proteins containing different truncated forms of TGFβR2

[0223] 100 ng / mL TGF-β1 and 40 ng / mL EGFR-His protein were coated on a 96-well plate, 100 μL / well, and coated overnight at 4°C. The next day, the plate was washed and blocked at room temperature for 1 hour. Then, 2 μg / mL EGFR / TGFβR2 antibody fusion protein containing different truncated forms of TGFβR2 was added at 100 μL / well. After incubation for 1 hour, the plate was washed to remove unbound antibodies, and the secondary antibody Goat anti-hIgG Fc / HRP was added for incubation and the plate was washed again. Finally, the substrate colorimetric solution was added for color development, and the OD was read on a microplate reader after termination. 450 The results are as follows Figure 16 As shown, the binding abilities of EGFR / TGFβR2 antibody fusion proteins with different truncated forms of TGFβR2 to TGF-β1 vary greatly, but their binding abilities to EGFR are similar.

[0224] 3.5 Neutralization of TGF-β by EGFR / TGFβR2 Antibody Fusion Proteins Containing Different Truncated Forms of TGFβR2

[0225] TGF-β regulates cellular function by modulating the transcription of multiple target genes. Plasminogen activator inhibitor 1 (PAI-1) is a key downstream target of the TGF-β1 / Smad signaling pathway. Activated Smad3 binds to cis-acting elements in the PAI-1 promoter region, regulating PAI-1 expression. Elements containing the PAI-1 promoter region were inserted into a luciferase-containing vector in a specific format and transformed into HepG2 cells. In this reporter gene system, the addition of exogenous TGF-β protein activates the expression of the luciferase reporter gene, which then emits light in response to the substrate. When exogenous TGF-β antibodies are added, they neutralize the TGF-β protein, blocking its binding to TGF-βR2 and inhibiting downstream signaling pathways, ultimately suppressing luciferase reporter gene expression. Therefore, the in vitro efficacy of TGF-β antibody neutralization can be determined by measuring the intensity of the light signal.

[0226] HepG2-3TP-Luc2p-puro cells (Source: Shenzhou Cell Engineering Co., Ltd., hereinafter referred to) were evenly seeded in a 96-well plate at 30,000 cells / well. After overnight attachment, the medium in the 96-well plate was discarded and replaced with DMEM supplemented with 0.5% FBS. The cells were incubated at 37°C in a 5% CO2 incubator for 6 hours. The medium in the 96-well plate was discarded, and 4 ng / mL TGF-β1 protein was added, along with an EGFR / TGFβR2 antibody fusion protein at a final concentration of 0.02 μg / mL. The cells were incubated at 37°C in a 5% CO2 incubator for another 18 hours. A negative control group (M) (containing cells and TGF-β1) and a negative control group (M') (containing cells without TGF-β1) were also set up. Finally, 5× Lysis buffer was added, and 10 μL of cell sample was collected for bioluminescence intensity measurement (RLU) to calculate the neutralization efficiency of the EGFR / TGFβR2 antibody fusion protein. Neutralization rate (%) = (RLU value of group M - RLU value of sample) / (OD value of group M - OD value of group M') × 100%. The concentration of the antibody was used as the horizontal axis and the neutralization rate of the antibody was used as the vertical axis. The dose-effect curve was analyzed and drawn using GraphPad Prism software. The results are shown in the figure. Figure 17 As shown, EGFR / TGFβR2 antibody fusion proteins 2 to 6, 8, 13, 14, and 16 containing truncated forms of TGFβR2 all had some ability to neutralize TGF-β1. Fusion protein 2 had a neutralizing ability similar to that of fusion protein 1 containing the full-length form of TGFβR2, while fusion proteins 5, 6, and 8 had better neutralizing abilities than fusion protein 1 at this concentration. Fusion protein 6 exhibited the strongest neutralizing ability against TGF-β1. The remaining EGFR / TGFβR2 antibody fusion proteins containing truncated forms of TGFβR2 had little or no neutralizing ability.

[0227] TGF-β3 protein has a high affinity with TGFβR2 and can activate TGF-β downstream signaling. This example uses a reporter gene system to test the ability of the fusion protein to neutralize TGF-β3 (20ng / mL final concentration). The results are as follows Figure 18 As shown, the ability of fusion protein 2, fusion protein 4 and fusion protein 13 to neutralize TGF-β3 is similar to that of fusion protein 1, while the ability of fusion protein 3, fusion protein 5, fusion protein 6 and fusion protein 8 to neutralize TGF-β3 is better than that of fusion protein 1. Fusion protein 6 also shows the strongest ability to neutralize TGF-β3.

[0228] Based on the above analysis of the stability and neutralization ability of fusion proteins containing truncated forms of TGFβR2, the present invention prefers truncated forms of TGFβR2 of fusion proteins 2 to 6, 8, 13, 14 and 16, more preferably truncated forms of TGFβR2 of fusion proteins 2, 5, 6 and 8, and most preferably truncated forms of TGFβR2 of fusion protein 6.

[0229] Example 4: In vitro biological function of the truncated form of TGFβR2 (fusion protein 6) EGFR / TGFβR2 antibody fusion protein

[0230] 4.1 EGFR / TGFβR2 Antibody Fusion Protein Binding Ability Detection

[0231] 4.1.1 EGFR / TGFβR2 Antibody Fusion Protein Binding and Competition for TGF-β

[0232] TGF-β1 protein and TGF-β3 protein with a final concentration of 2 μg / mL were coated on 96-well plates, 100 μL / well, and coated overnight at 4°C. The next day, the plates were washed and blocked at room temperature for 1 hour. EGFR / TGFβR2 antibody fusion protein 6 with different concentrations (1.22pM, 4.88pM, 19.53pM, 78.13pM, 312.5pM, 1250pM, 500pM, 2000pM) were added and incubated for 1 hour. The unbound antibodies were then washed to remove them. Secondary antibodies Goat anti-hIgG F(ab)2 / HRP were added for incubation and the plates were washed repeatedly. The substrate colorimetric solution was added for color development. After termination, the OD was read on a microplate reader. 450 The results are as follows Figure 19 As shown in Figure 2, the binding ability of fusion protein 6 to TGF-β1 and TGF-β3 proteins is similar to that of fusion protein 1, and the binding EC 50 91pM, R 2 =0.998, EC binding to TGFβ3 protein 50 102pM, R 2 =0.998.

[0233] This example further analyzed the ability of fusion protein 6 to compete with TGF-β1 protein or TGF-β3 protein for binding to TGFβR2-Fc protein at the protein level.

[0234] TGF-β1 protein at a final concentration of 0.2 μg / mL or TGF-β3 protein at 0.5 μg / mL was coated onto 96-well plates at 100 μL / well, and the plates were coated overnight at 4°C. The next day, the plates were washed and blocked for 1 hour at room temperature. Then, 100 μL of EGFR / TGFβR2 antibody fusion protein at different concentrations (0.05 nM, 0.14 nM, 0.42 nM, 1.25 nM, 3.75 nM, 11.24 nM, 33.71 nM, and 101.12 nM) was added, along with 100 μL of biotinylated TGFβR2-Fc protein at a final concentration of 0.2 μg / mL (for TGF-β1 competition) or 1 μg / mL (for TGF-β3 competition) (protein source: Beijing Sino Biological Technology Co., Ltd., biotin-labeled by Sino Cell Engineering Co., Ltd., same below). Positive control wells containing only TGFβR2-Fc protein were also set up. After incubation for 1 hour, wash the plate, add the secondary antibody Streptavidin / HRP and incubate for 1 hour, then wash the plate again. Finally, add the substrate colorimetric solution for color development, and read the OD value on the microplate reader after termination. 450 According to OD 450 The competitive inhibition rate PI% of the fusion protein was calculated by the following equation: Inhibition rate PI (%) = (OD 450 Value - Sample well OD 450 value) / positive well OD 450 The result is Figure 20 As shown, fusion protein 6 has similar ability to fusion protein 1 in blocking the binding of TGF-β1 protein or TGF-β3 protein to TGFβR2-Fc.

[0235] 4.1.2 EGFR-binding properties of EGFR / TGFβR2 antibody fusion protein

[0236] Referring to Example 1.2.1, the binding ability of the fusion protein to the recombinant human EGFR protein was detected by ELISA. Figure 21 As shown in the figure, the ability of fusion protein 6 to bind to EGFR and compete with EGF for binding to EGFR is similar to that of EGFR-HPA8. 50 was 133.1 ng / mL, R 2 =1.000.

[0237] 4.2 EGFR / TGFβR2 Antibody Fusion Protein Binding Affinity Detection

[0238] In this example, a biomolecular interaction analysis system (model: OctetRED96e, manufacturer: Fortebio) was used to determine the affinity of the EGFR / TGFβR2 antibody fusion protein to biotinylated recombinant human EGFR protein and TGF-β1 protein, with EGFR-HPA8 and H7N9-R1 as negative controls. Affinity parameters were obtained by fitting the binding and dissociation curves at multiple concentration points. The results are shown in Tables 13 and 14. For specific kinetic characteristic parameter curves, see Figure 22 and Figure 23 .

[0239] The results showed that compared with the monoclonal antibody EGFR-HPA8, fusion protein 6 retained a higher binding affinity with human EGFR protein. The KD value of the binding affinity of fusion protein 6 with human EGFR protein was 8.77 pM, and the binding constant k on The value is 1.68E+06M -1 s -1 , dissociation constant k dis 1.47E-05s -1 In addition, the truncated TGFβR2 fusion protein 6 has a similar affinity to the human TGF-β1 protein as the full-length TGFβR2 fusion protein 1, K D The value is 96.1pM, and the binding constant k on The value is 1.53E+06M -1 s -1 , dissociation constant k dis 1.47E-04s -1 .

[0240] Table 13 Affinity of truncated EGFR / TGFβR2 antibody fusion protein and recombinant human EGFR protein

[0241]

[0242] Table 14 Affinity of truncated EGFR / TGFβR2 antibody fusion protein and recombinant human TGF-β1 protein

[0243]

[0244] The above results show that fusion protein 6 has good affinity with human EGFR and TGF-β1.

[0245] 4.3 Detection of TGF-β activity neutralization by EGFR / TGFβR2 antibody fusion protein

[0246] TGF-β1 can inhibit the proliferation of Mv-1-lu cells, so the WST-8 method can be used to detect the ability of EGFR / TGFβR2 antibody fusion protein to neutralize TGF-β1.

[0247] Mv-1-lu cells (Source: Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) were evenly seeded in a 96-well plate at a cell seeding density of 1×10 3 / well. The cells were cultured in a CO2 incubator for about 3 hours to allow them to adhere to the wall, and then EGFR / TGFβR2 antibody fusion protein samples of different concentrations (0.0078nM, 0.0156nM, 0.0313nM, 0.0625nM, 0.125nM, 0.25nM, 0.5nM, 1nM, 2nM) diluted with 1640 culture medium containing 10% FBS were added at 50μL / well. Finally, TGF-β1 factor was added at a final concentration of 1ng / mL at 10μL / well. At the same time, a positive control M group (containing cells and TGF-β1), a negative control M' group (containing cells without TGF-β1) and a blank control B group (only culture medium without cells) were set up. After the cells were incubated in a CO2 incubator at 37°C and 5% CO2 for 5 days, WST-8 was added at 10μL / well. After the sample was left for 180min, the OD was detected by a microplate reader. 450 -OD 630 The neutralization rate of the EGFR / TGFβR2 antibody fusion protein was calculated by subtracting the reading of the blank control B. Neutralization rate (%) = (OD value of the M' group - OD value of the sample) / (OD value of the M' group - OD value of the M group) × 100%. GraphPad Prism software was used to analyze and draw a dose-effect curve, with the horizontal axis representing the antibody concentration and the vertical axis representing the inhibition rate. Figure 24 As shown, both fusion protein 6 and the TGFβR2 control H7N9-R1-43-IgG1(L9) (biotin-labeled by Sinocell Engineering Co., Ltd., same below) effectively neutralized the inhibitory effect of TGF-β1 on Mv-1-lu proliferation in a dose-dependent manner. The 50% effective concentration of fusion protein 6 was lower than that of the control H7N9-R1-43-IgG1(L9), indicating that this molecule has better neutralizing activity. EGFR-HPA8 did not neutralize TGF-β1, indicating that it is the TGFβR2 end of fusion protein 6 that exerts its TGF-β1 neutralizing effect.

[0248] This example further tested the ability of fusion protein 6 to neutralize TGF-β using a reporter gene system. The specific method is described in Example 3.5. Figure 25 As shown in the results, both fusion protein 6 and the TGFβR2 control substance H7N9-R1-43-IgG1 (L9) can effectively neutralize TGF-β1 in a dose-dependent manner, and the maximum neutralization rate of fusion protein 6 (74.8%) is much higher than that of the control substance H7N9-R1-43-IgG1 (L9) (55.3%), further illustrating the excellent neutralizing activity of fusion protein 6.

[0249] 4.4 Detection of cell proliferation inhibition activity of EGFR / TGFβR2 antibody fusion protein

[0250] The WST-8 assay was used to determine the inhibitory effect of the EGFR / TGFβR2 antibody fusion protein on the growth of MDA-MB-468 cells, as described in Example 1.2.2, to determine the functional activity of the EGFR end. Figure 26 As shown, the ability of fusion protein 6 to inhibit MDA-MB-468 cell proliferation is similar to that of EGFR-HPA8, and the inhibition rate increases in an "S" curve with increasing drug concentration. The control substance H7N9-R1-43-IgG1 (L9) with TGFβR2 function has no inhibitory effect on MDA-MB-468 cells, indicating that the role of fusion protein 6 in inhibiting tumor cell proliferation is due to its EGFR terminal function.

[0251] 4.5 ADCC effect of EGFR / TGFβR2 antibody fusion protein

[0252] The ADCC effect of EGFR / TGFβR2 antibody fusion protein on cells expressing EGFR was detected with reference to Example 2.2.3. Figure 27 As shown, within the concentration range of 0.00004-3nM, fusion protein 6 and the anti-EGFR antibody EGFR-HPA8 mediated similar ADCC effects on EGFR-expressing tumor cells A431. The control substance H7N9-R1-43-IgG1 (L9), which has TGFβR2 function, had no ADCC effect on A431 cells, indicating that the EGFR end of fusion protein 6 mediates ADCC function in this experimental system.

[0253] Example 5: Pharmacodynamics study of the truncated form of TGFβR2 (fusion protein 6) EGFR / TGFβR2 antibody fusion protein in the NCI-H1975 subcutaneous transplant tumor model

[0254] Balb / c-nu mice were subcutaneously inoculated with 1×10 6 NCI-H1975 cells. When the tumor volume reaches about 300mm 3 Around 6 s, animals were randomly divided into groups based on tumor volume for dosing. Dosing began on the day of grouping, with intraperitoneal injection (IP) twice weekly for 10 consecutive doses. After the last dose, the drug was discontinued and tumor recurrence was observed. The specific dosing schedule is shown in Table 15 below.

[0255] Table 15 Experimental groups and drug administration

[0256]

[0257] Note: The administration volume is calculated based on 10 mL / kg of mouse body weight.

[0258] The animals in each test group were in good condition in terms of activity and eating during the administration period, and their body weight increased to a certain extent. There was no significant difference in body weight between the drug group and the vehicle control group after administration (P>0.05). The changes in body weight of all animals are shown in Table 16 and Figure 28 .

[0259] Table 16 Effects of fusion protein 6 on body weight of mice transplanted with H1975 non-small cell lung cancer subcutaneously

[0260]

[0261] a Mean ± SD;

[0262] b The body weights of the treatment groups were statistically compared with those of the solvent control group 35 days after administration using t-test;

[0263] The tumor volume results of each group in the experiment are shown in Table 17 and Figure 29 After 35 days of treatment, the average tumor volume of the solvent control group was 7150.78 ± 780.4 mm 3 In the fusion protein 6 group, 5 of the 6 mice had complete tumor disappearance (CR), with an average tumor volume of 4.55±4.55mm 3 The TGI reached 99.9%, a significant difference compared to the tumor volume in the vehicle control group (P < 0.001). In contrast, only one mouse in the EGFR-HPA8 group had complete tumor disappearance, with an average tumor volume of 79.44 ± 28.65 mm³ and a TGI of 98.9%. The results showed that fusion protein 6 had a significant inhibitory effect on subcutaneous xenografts of NCI-H1975 non-small cell lung cancer, and its tumor inhibition effect was superior to that of EGFR-HPA8 at the same molar dose (P = 0.237).

[0264] Table 17 Effects of fusion protein 6 on tumor volume in H1975 non-small cell lung cancer transplanted tumor model mice

[0265]

[0266]

[0267] a Statistical comparison of tumor volume in the EGFR-HPA8-Ae0 treatment group and that in the solvent control group using t test;

[0268] b Statistical comparison of tumor volume in the fusion protein 6-treated group and the solvent control group using t-test;

[0269] Example 6: Stability Analysis of TGFβR2 Truncated Form (Fusion Protein 6) EGFR / TGFβR2 Antibody Fusion Protein

[0270] 6.1 Ultrafiltration Stability Analysis of EGFR / TGFβR2 Antibody Fusion Protein

[0271] The EGFR / TGFβR2 antibody fusion protein sample was concentrated to a concentration of approximately 10 mg / mL by ultrafiltration in 100 mM Glycine, 10 mM NaCl, 50 mM Tris, pH 7.5 buffer. The concentrated sample was then analyzed for purity and stability using reducing SDS-PAGE and molecular sieve chromatography (SEC-HPLC, Agilent 1260 liquid chromatography system, TSK-G3000SWXL column). SEC-HPLC operation steps: (1) Mobile phase: 200 mM NaH2PO4, 100 mM Arginine, pH 6.5; (2) Sample load: 80 μg; (3) Analysis time: 30 min, flow rate: 0.5 mL / min, column temperature: 25°C; (4) Purity was calculated by peak area normalization.

[0272] The purity test results after sample concentration can be found in Figure 30 The sample purity and fragment ratio are shown in Table 18. The results show that the truncated form of TGFβR2, preferably fusion protein 6, is less likely to break after concentration and has higher ultrafiltration stability than the full-length TGFβR2 fusion protein.

[0273] Table 18 SEC results of ultrafiltration stability of EGFR / TGFβR2 antibody fusion protein

[0274]

[0275] 6.2 Thermal Stability Analysis of EGFR / TGFβR2 Antibody Fusion Protein

[0276] The thermal stability of the samples was determined using differential scanning fluorimetry (DSF) using the UNcle system (Unchained Labs, model: UNCLE-0330). The following steps were used: (1) 9 μL sample volume was loaded; (2) experimental parameters were set: temperature range 25°C-95°C, heating rate 0.3°C / min; (3) data were analyzed using UNcle Analysis software. The midpoint of the internal fluorescence curve under UV266 was taken as the Tm, and the aggregation onset temperature of the aggregate curve formed by the static light scattering signal under UV266 / Blue473 was taken as the Tagg266 and Tagg473.

[0277] The thermal stability test results of fusion protein 6 are shown in Table 19, showing good thermal stability.

[0278] Table 19 Tm test results of fusion protein 6

[0279]

[0280] 6.3 Thermal Accelerated Stability Analysis of EGFR / TGFβR2 Antibody Fusion Protein

[0281] After the samples were stored at 45°C for one week, the accelerated stability of the samples was analyzed by SEC-HPLC and SDS-PAGE. The specific operation steps were the same as 6.1.

[0282] The results of the heat-accelerated stability test of fusion protein 6 are shown in Table 20. After storage at 45°C for one week, the SEC purity of fusion protein 6 decreased by 0.7%, but the purity was still high, the aggregate level increased slightly, and the fragment level remained unchanged, demonstrating good heat-accelerated stability.

[0283] Table 20 Results of thermal acceleration stability test of fusion protein 6

[0284]

[0285]

[0286] 6.4 Freeze-thaw stability analysis of EGFR / TGFβR2 antibody fusion protein

[0287] The samples were stored at -80°C for 3 hours, then transferred to 45°C for 1 hour and thawed. This process was repeated five times. The freeze-thaw stability of the samples was analyzed by SEC-HPLC, following the same procedures as in 6.1.

[0288] The freeze-thaw stability test results of fusion protein 6 are shown in Table 21. After five freeze-thaw cycles, the SEC purity of fusion protein 6 did not change significantly, and the aggregate level and fragment level did not increase significantly, demonstrating good freeze-thaw stability.

[0289] Table 21 Freeze-thaw stability test results of fusion protein 6

[0290]

[0291] 6.5 Oscillation Stability of EGFR / TGFβR2 Antibody Fusion Protein

[0292] The sample was placed in a deep-well plate and vortexed at 800 rpm for 24 hours. SEC-HPLC was used to analyze the sample's vortex stability, following the same procedures as in 6.1. The results are shown in Table 22. After 24 hours of vortexing, the sample's SEC monomer purity remained unchanged, and there was no significant increase in aggregate or fragment levels, demonstrating that fusion protein 6 possesses good vortex stability.

[0293] Table 22 Oscillation stability test results of fusion protein 6

[0294]

[0295] Example 7: Design and quality function testing of multiple antigen X / TGFβR2 antibody fusion proteins targeting solid tumors of truncated forms of TGFβR2 (fusion protein 6)

[0296] 7.1 Design of Expression Vector Containing the Truncated TGFβR2 X / TGFβR2 Antibody Fusion Protein and Protein Expression and Purification

[0297] To further validate the structural stability and TGF-β1 neutralization ability of the preferred truncated TGFβR2 form described in Example 3.2, this example employed various solid tumor antigens as the targeting portion of the fusion protein, and the extracellular domain of TGFβR2 (full-length and ECD delete (6-26) fusion protein 6) as the immunomodulatory portion of the fusion protein to form the X antibody / TGFβR2 extracellular region fusion protein (X / TGFβR2 antibody fusion protein). Similarly, the X / TGFβR2 antibody fusion protein linked the C-terminal amino acid of the X antibody's heavy chain to the TGFβR2 extracellular region via a (G4S)4 linker. Furthermore, the C-terminal lysine residue of the X antibody's heavy chain was removed to reduce the risk of proteolysis. The construction scheme for the X / TGFβR2 antibody fusion protein is shown in Table 23.

[0298] Table 23 Design of X / TGFβR2 Antibody Fusion Protein

[0299]

[0300]

[0301] Amplify the target gene by PCR or overlap-PCR and ligate it into an expression vector via in-fusion. Once the recombinant expression vector is sequenced and confirmed, the plasmid is extracted and transiently transfected into HEK-293 cells (fut8 knockout). After 7 days of culture, the supernatant is collected by centrifugation. The resulting cell supernatant is then purified using Protein A affinity chromatography.

[0302] 7.2 Fragmentation of the TGFβR2 Truncated Form X / TGFβR2 Antibody Fusion Protein

[0303] The purity and fragmentation of X / TGFβR2 antibody fusion protein were detected by reducing SDS-PAGE. Figure 31 As shown, for different X / TGFβR2 antibody fusion proteins, the expression samples of the preferred truncated TGFβR2 extracellular domain were significantly more stable than the control samples of the full-length TGFβR2 extracellular domain, with fewer broken bands. This indicates that the stability of the samples of different truncated TGFβR2 extracellular domains prepared by the present invention has universal applicability and is not significantly correlated with the antibody properties of the fusion protein targeting portion.

[0304] 7.3 Degradation Propensity of TGFβR2 Truncated Form X / TGFβR2 Antibody Fusion Proteins

[0305] In this example, 293E cell supernatant was used to accelerate the treatment of fusion protein, and the degradation stability of TGFβR2 extracellular domain truncated X / TGFβR2 antibody fusion protein was further optimized. The specific operation was the same as in Example 3.3. The sample purity test results are shown in Figure 32 The sample purity and splice ratio are shown in Table 24. The results show that compared with the full-length TGFβR2 extracellular domain fusion protein, the preferred TGFβR2 extracellular domain truncated multiple X / TGFβR2 antibody fusion protein has a stronger ability to resist protease degradation.

[0306] Table 24 Degradation ratio of TGFβR2 truncated form X / TGFβR2 antibody fusion protein

[0307]

[0308] To investigate the stability of the preferred TGFβR2 extracellular domain truncated X / TGFβR2 antibody fusion protein under certain concentration conditions, the ultrafiltration stability was analyzed using the method of Example 6.1. The results, as shown in Table 25, indicate that the preferred TGFβR2 extracellular domain truncated X / TGFβR2 antibody fusion protein was not susceptible to fragmentation after concentration, with the proportion of sheared forms less than 4.0% (SDS-PAGE purity), demonstrating superior ultrafiltration stability compared to the full-length TGFβR2 extracellular domain X / TGFβR2 antibody fusion protein.

[0309] Table 25 SEC and SDS fragmentation assay after concentration of X / TGFβR2 antibody fusion protein

[0310]

[0311] In summary, by linking multiple solid tumor antigens as the targeting portion of the fusion protein, it was further verified that the fusion protein containing the preferred truncated form of the TGFβR2 extracellular region has better stability.

[0312] Example 8: In vitro biological functions of various antigen X / TGFβR2 antibody fusion proteins targeting solid tumors (fusion protein 6)

[0313] 8.1 Detection of X / TGFβR2 Antibody Fusion Protein Binding to TGF-β1

[0314] The binding ability of X / TGFβR2 antibody fusion protein to TGF-β1 was detected by ELISA method according to Example 3.4. Figure 33 As shown, the ability of the preferred TGFβR2 truncated form X / TGFβR2 antibody fusion protein to bind to TGF-β1 is slightly lower than that of the TGFβR2 full-length form X / TGFβR2 antibody fusion protein.

[0315] 8.2 Detection of TGF-β Neutralization by X / TGFβR2 Antibody Fusion Protein

[0316] The ability of the X / TGFβR2 antibody fusion protein to neutralize TGF-β1 and TGF-β3 was tested with reference to Example 3.5. Figure 34 As shown, the ability of the preferred TGFβR2 truncated form X / TGFβR2 antibody fusion protein to neutralize TGF-β1 and TGF-β3 is better than that of the TGFβR2 full-length form X / TGFβR2 antibody fusion protein.

[0317] 8.3 Detection of X-side Target Binding of X / TGFβR2 Antibody Fusion Protein

[0318] The X-side corresponding antigens ERBB2-his, VEGF165, VEGFR2-His, CTLA4-his and EGFR-His with final concentrations of 10 ng / mL, 5 ng / mL, 80 ng / mL, 80 ng / mL and 40 ng / mL were coated on 96-well plates, 100 μL / well, and coated overnight at 4 ° C. The next day, the plate was washed and blocked at room temperature for 1 hour. Then, 100 μL of X / TGFβR2 antibody fusion protein with a final concentration of 13.89 nM was added and incubated for 1 hour. The plate was washed to remove unbound antibodies, and the secondary antibody Goat anti-hIgG Fc / HRP was added for incubation and the plate was washed repeatedly. Finally, the substrate color development solution was added for color development. After termination, the OD450 was read on a microplate reader. The results are as follows Figure 35 As shown, the ability of the X-side corresponding antigen-binding protein containing the preferred truncated form of TGFβR2 / TGFβR2 antibody fusion protein is similar to that of the X-side corresponding antigen-binding protein containing the full-length form of TGFβR2 / TGFβR2 antibody fusion protein.

[0319] Sequence Listing

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352] References

[0353] 1. Xie, F., et al., TGF-beta signaling in cancer metastasis. Acta Biochim Biophys Sin (Shanghai), 2018. 50(1): p. 121-132.

[0354] 2. Colak, S. and P. Ten Dijke, Targeting TGF-beta Signaling in Cancer. Trends Cancer, 2017. 3(1): p. 56-71.

[0355] 3. Fabregat, I., et al., TGF-beta signaling in cancer treatment. Curr Pharm Des, 2014. 20(17): p. 2934-47.

[0356] 4. Batlle, E. and J. Massague, Transforming Growth Factor-beta Signaling in Immunity and Cancer. Immunity, 2019. 50(4): p. 924-940.

[0357] 5. Laskin, J.J. and A.B. Sandler, Epidermal growth factor receptor: a promising target in solid tumours. Cancer treatment reviews, 2004. 30(1): p. 1-17.

[0358] 6. Hynes, N., et al., The ErbB receptor tyrosine. family as signal integrators. Endocrine-related cancer, 2001. 8(3): p. 151-159.

[0359] 7.Zandi,R.,et al.,Mechanisms for oncogenic activation of theepidermal growth factor receptor.Cellular signalling,2007.19(10):p.2013-2023.

[0360] 8.Seshacharyulu,P.,et al.,Targeting the EGFR signaling pathw ay incancer therapy.Expert opinion on therapeutic targets,2012.16(1):p.15-31.

[0361] 9.Zhao,Y.,et al.,TGF-βtransactivates EGFR and facilitates breastcancer migration and invasion through canonical Smad3 and ERK / Sp1 signalingpathways.Molecular oncology,2018.12(3):p.305-321.

[0362] 10.Wendt,M.K.,J.A.Smith,and W.P.Schiemann,Transforming growth factor-β-induced epithelial-mesenchymal transition facilitates epidermal growthfactor-dependent breast cancer progression.Oncogene,2010.29(49):p.6485.

[0363] 11.Lee,E.,et al.,Transforming growth factorβ1transactivates EGFR viaan H2O2-dependent mechanismin squamous carcinoma cell line.Cancer letters,2010.290(1):p.43-48.

[0364] 12.Dunfield,L.D.and M.W.Nachtigal,Inhibition of the antiproliferativeeffect of TGFβby EGF in primary human ovarian cancer cells.Oncogene,2003.22(30):p.4745.

[0365] 13.Kretzschmar,M.,et al.,A mechanism of repression of TGFβ / Smadsignaling by oncogenic Ras.Genes&development,1999.13(7):p.804-816.

[0366] 14.ten Dijke,P.,K.Miyazono,and C.-H.Heldin,Signaling inputs convergeon nuclear effectors in TGF-βsignaling.Trends in biochemical sciences,2000.25(2):p.64-70.

[0367] 15.Funaba,M.,C.M.Zimmerman,and L.S.Mathews,Modulation of Smad2-mediated signaling by extracellular signal-regulated kinase.Journal ofBiological Chemistry,2002.277(44):p.41361-41368.

[0368] 16.Richter,P.,et al.,EGF / TGFbeta1 co-stimulation of oral squamouscell carcinoma cells causes an epithelial-mesenchymal transition cellphenotype expressing laminin 332.J Oral Pathol Med,2011.40(1):p.46-54.

[0369] 17.Uttamsingh,S.,et al.,Synergistic effect between EGF and TGF-beta1in inducing oncogenic properties of intestinal epithelial cells.Oncogene,2008.27(18):p.2626-34.

[0370] 18.Xu,Z.,et al.,TGFbeta and EGF synergistically induce a moreinvasive phenotype of epithelial ovarian cancer cells.Biochem Biophys ResCommun,2010.401(3):p.376-81.

[0371] 19.Xiong,J.,et al.,Epidermal growth factor promotes transforminggrowth factor-beta1-induced epithelial-mesenchymal transition in HK-2cellsthrough a synergistic effect on Snail.Mol Biol Rep,2014.41(1):p.241-50.

[0372] 20.Buonato,J.M.,I.S.Lan,and M.J.Lazzara,EGF augments TGFbeta-inducedepithelial-mesenchymal transition by promoting SHP2 binding to GAB1.J CellSci,2015.128(21):p.3898-909.

[0373] 21.Wang,T.,et al.,The TGFβ-miR-499a-SHKBP1 pathway induces resistanceto EGFR inhibitors in osteosarcoma cancer stem cell-like cells.Journal ofExperimental&Clinical Cancer Research,2019.38(1):p.226.

[0374] 22.Jie,H.B.,et al.,CTLA-4(+)Regulatory T Cells Increased inCetuximab-Treated Head and Neck Cancer Patients Suppress NK Cell Cytotoxicityand Correlate with Poor Prognosis.Cancer Res,2015.75(11):p.2200-10.

[0375] 23.Bedi,A.,et al.,Inhibition of TGF-beta enhances the in vivoantitumor efficacy of EGF receptor-targeted therapy.Mol Cancer Ther,2012.11(11):p.2429-39.

[0376] 24.Zhang,Y.,et al.,The canonical TGF-beta / Smad signalling pathway isinvolved in PD-L1-induced primary resistance to EGFR-TKIs in EGFR-mutant non-small-cell lung cancer.Respir Res,2019.20(1):p.164.

[0377] 25.Jones,S.T.and M.M.Bendig,Rapid PCR-cloning of full-length mouseimmunoglobulin variable regions.Biotechnology(N Y),1991.9(6):p.579.

[0378] 26.Kabat,E.A.,et al.,Sequences of proteins of immunologicalinterest.1992:DIANE publishing.

[0379] 27.Jones,P.T.,et al.,Replacing the complementarity-determiningregions in a human antibody with those from a mouse.Nature,1986.321(6069):p.522.

[0380] 28.Verhoeyen,M.and L.Riechmann,Engineering of antibodies.BioEssays,1988.8(2-3):p.74-78.

Claims

1. A molecule of a truncated form of the extracellular region of TGFβR2, the amino acid sequence of which is SEQ ID NO:

52.

2. A fusion protein comprising the molecule of claim 1 consisting of: a) a truncated form of the TGFβR2 extracellular region of claim 1; b) anti-EGFR antibodies, wherein the anti-EGFR antibody comprises i) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3 domains are SEQ ID NOs: 19, 20, and 21, respectively, and ii) a light chain variable region, whose light chain CDR1, light chain CDR2, and light chain CDR3 domains are SEQ ID NOs: 16, 17, and 18, respectively; and c) connectors, The N-terminus of the truncated form of the TGFβR2 extracellular region is connected to the C-terminus of the anti-EGFR antibody via the linker. The fusion protein according to claim 2 , wherein the linker is a G4S flexible connecting peptide.

4. An isolated EGFR binding antibody or antigen-binding fragment thereof, comprising a) a heavy chain variable region, whose heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3 domains are SEQ ID NOs: 19, 20, and 21, respectively, and b) a light chain variable region, wherein the light chain CDR1, light chain CDR2 and light chain CDR3 domains are SEQ ID NOs: 16, 17 and 18, respectively.

5. The antibody or antigen-binding fragment thereof according to claim 4, comprising a) a heavy chain variable region, the sequence of which comprises the sequence of SEQ ID NO: 28; and b) a light chain variable region, the sequence of which comprises the sequence of SEQ ID NO:

29.

6. The antibody or antigen-binding fragment thereof of claim 5, wherein the antibody further comprises: a) a heavy chain constant region, the sequence of which comprises the sequence of SEQ ID NO: 30; and / or b) a light chain constant region, the sequence of which comprises the sequence of SEQ ID NO:

31.

7. The antibody or antigen-binding fragment thereof according to claim 6, a) the heavy chain amino acid sequence comprises the sequence of SEQ ID NO: 141; and b) the light chain amino acid sequence comprises the sequence of SEQ ID NO: 23; It comprises two heavy chains and two light chains; a disulfide bond is formed between the first light chain and the first heavy chain, a disulfide bond is formed between the second light chain and the second heavy chain, and a disulfide bond is formed between the first heavy chain and the second heavy chain.

8. The antibody or antigen-binding fragment thereof according to claim 7, Binding affinity K for human EGFR protein D The values ​​were 2.92 pM-26.3 pM, Binding affinity K for human TGF-β1 protein D The values ​​were 23 pM -288.3 pM.

9. A conjugate comprising the truncated form of the TGFβR2 extracellular region of claim 1, the fusion protein of claim 2 or 3, the antibody or antigen-binding fragment thereof of any one of claims 4 to 8, and an additional therapeutic agent.

10. A nucleic acid encoding the truncated form of the TGFβR2 extracellular region according to claim 1, the fusion protein according to claim 2 or 3, the antibody or antigen-binding fragment thereof according to any one of claims 4 to 8, which is mRNA and / or DNA. An expression vector comprising the nucleic acid according to claim 10 . 12 . A host cell comprising the nucleic acid of claim 10 or the expression vector of claim 11 .

13. A method for producing a truncated form of the TGFβR2 extracellular region of claim 1, the fusion protein of claim 2 or 3, the antibody of any one of claims 4 to 8, or an antigen-binding fragment thereof, comprising culturing the host cell of claim 12 under conditions suitable for expression of the aforementioned protein molecule, and recovering the expressed product from the culture medium.

14. A pharmaceutical composition comprising a) the truncated form of the TGFβR2 extracellular region of claim 1, the fusion protein of claim 2 or 3, the antibody or antigen-binding fragment thereof of any one of claims 4 to 8, the conjugate of claim 9, the nucleic acid of claim 10, or the expression vector of claim 11; and b) a pharmaceutically acceptable carrier; and / or c) one or more additional therapeutic agents.

15. Use of the truncated form of the TGFβR2 extracellular region of claim 1, the fusion protein of claim 2 or 3, the antibody or antigen-binding fragment thereof of any one of claims 4 to 8, the conjugate of claim 9, the nucleic acid of claim 10, the expression vector of claim 11, or the pharmaceutical composition of claim 14 in the preparation of a medicament for preventing and treating head and neck cancer, gastric cancer, non-small cell lung cancer, and breast cancer.

16. A kit comprising A truncated form of the TGFβR2 extracellular region of claim 1, a fusion protein of claim 2 or 3, an antibody or antigen-binding fragment thereof of any one of claims 4 to 8, a conjugate of claim 9, a nucleic acid of claim 10, an expression vector of claim 11, or a pharmaceutical composition of claim 14.

Images