A heterocyclic urea compound, its preparation method and use
By developing heterocyclic urea compounds as POLQ inhibitors, the problem of resistance to PARP inhibitors in existing therapeutic methods has been solved, effective inhibition of POLQ enzymes has been achieved, and potential anti-cancer effects and reduced cardiotoxicity.
Patent Information
- Application Number
- CN202210897430.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-07-30
- Filing Date
- 2022-07-28
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2042-07-28
AI Technical Summary
Existing DNA repair defect treatments have problems with drug resistance to PARP inhibitors, especially in cancer treatment. There is a lack of effective POLQ inhibitors to inhibit POLQ-mediated DNA repair pathways, resulting in cancer cells' resistance to ionizing radiation and chemotherapy drugs.
A class of heterocyclic urea compounds was developed as POLQ inhibitors, and these compounds were prepared by specific synthetic methods to inhibit the activity of POLQ enzymes, thereby blocking DNA repair pathways, especially microhomology-mediated terminal ligation pathways.
These compounds showed strong inhibitory effects on POLQ enzymes, had potential anti-cancer effects, and had no significant inhibition of hERG channels in in vitro experiments and low cardiotoxicity, providing a new possibility of treating POLQ-mediated disease.
Smart Images

Figure BDA0003769482940000011 
Figure BDA0003769482940000021 
Figure BDA0003769482940000051
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceutical technology, and more particularly, to heterocyclic urea compounds as POLQ inhibitors, and methods for preparing and using such compounds. Background Art
[0002] DNA repair defects have emerged as an effective strategy against cancer. Over the past few decades, it has become increasingly apparent that selective deficiencies in DNA repair pathways occur in 40% to 50% of a variety of tumors. DNA repair deficiencies promote tumor cell proliferation, resulting in genetic instability and / or increased mutation rates, driving tumor evolution. Cancers with DNA repair defects often rely on backup DNA repair pathways, which have been targeted and successfully developed poly(ADP-ribose) polymerase (PARP) inhibitors for the treatment of BRCA-deficient breast and ovarian cancers. However, there is still an urgent need for new treatment methods that utilize other DNA repair defects to overcome acquired and congenital resistance to PARP inhibitors (PARPi). DNA polymerase θ (POLQ) is involved in DNA repair and not only synergizes with PARP inhibitors but also has broader uses in cancer treatment. An important reason why POLQ has become a major focus of drug development is that it is essentially not expressed in normal cells but is upregulated in many cancers, whether or not accompanied by homologous recombination deficiency (HRD).
[0003] POLQ is a key component of the POLQ alt-EJ pathway, also known as the microhomology-mediated end joining (MMEJ) pathway, which is involved in DNA double-strand break repair. MMEJ can run parallel to the HR and NHEJ pathways (Truong et al., PNAS 2003, 110(19), 7720-7725). POLQ is expressed at low levels in normal tissues but is upregulated in many tumor types, such as breast, ovarian, HNSCC, and lung. POLQ inhibitors have the potential to be used in a wide range of clinical settings, particularly in HR-deficient tumors, such as breast and ovarian cancers, or in combination with DNA-damaging agents (chemotherapy and radiotherapy). Mechanistically, they can also be used in combination with PARP1 inhibitors to expand the indication.
[0004] POLQ overexpression has been observed in a large number of cancers, and the upregulated levels are associated with poor prognosis. For example, approximately 70% of breast cancers show 5-fold or more high expression of POLQ, and this high expression is observed in both HR-proficient and HR-deficient breast cancers. In addition, POLQ is highly expressed in cancer cells and confers resistance to ionizing radiation and chemotherapeutic drugs. The aberrant expression of POLQ also promotes the survival of homologous recombination-deficient cells, a feature commonly observed in cells with BRCA1 or BRCA2 gene mutations. Therefore, POLQ is considered a promising new cancer target, and novel POLQ inhibitors will become part of new anticancer therapies. Summary of the Invention
[0005] The object of the present invention is to provide a compound having a heterocyclic urea structure as a POLQ inhibitor, a preparation method of the compound, and its use in the treatment of POLQ-mediated diseases.
[0006] In the first aspect of the present invention, there is provided a compound represented by the following formula (I), or a prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, having the following structure:
[0007]
[0008] Wherein, X is selected from O and S;
[0009] W and V are each independently selected from N or C(R w ); R w represents hydrogen, halogen or C 1-6 alkyl;
[0010] A is selected from hydrogen, halogen, amino, cyano, hydroxy, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-6 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo C 1-6 alkyl, C 1-6 alkylamino, -CO-C 1-6 alkyl, -CO-C 1-6 haloalkyl, -NHCO-C 1-6 alkyl, -CH2CONR a1 R a2 ; R a1 and R a2 are each independently selected from H, C 1-6 alkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo C 1-6 alkyl;
[0011] Ring B is selected from C 6-14 aryl, 5- to 16-membered heteroaryl, and 5- to 16-membered heterocyclic group, wherein the C 6-14 aryl, 5- to 16-membered heteroaryl, and 5- to 16-membered heterocyclic group are optionally substituted with n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different; wherein n is selected from 0, 1, 2, 3, 4, and 5;
[0012] R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 alkylthio, C 1-6 hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 aryl, 5- to 10-membered heteroaryl, -C 1-6 alkyl-C 3-8 cycloalkyl, -C 1-6 alkyl-4- to 10-membered heterocyclic group, -C 1-6 alkyl-C 6-12 aryl, -C 1-6 alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 cycloalkyl, -NH-4- to 10-membered heterocyclic group, -NH-C 6-12 aryl, -NH-5- to 10-membered heteroaryl, -NH-C 1-6 alkyl-C 3-8 cycloalkyl, -NH-C 1-6 alkyl-4- to 10-membered heterocyclic group, -NH-C 1-6 alkyl-C 6-12 aryl, -NH-C 1-6 alkyl-5- to 10-membered heteroaryl, -O-C 1-6 alkyl-C 3-8 cycloalkyl, -O-C 1-6 alkyl-4- to 10-membered heterocyclic group, -O-C 1-6 alkyl-C 6-12 aryl and -O-C 1-6 alkyl-5- to 10-membered heteroaryl; wherein the C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 alkylthio, C 1-6 hydroxyalkyl, 4- to 10-membered heterocyclic group, C6-12 Aryl, 5- to 10-membered heteroaryl, -C 1-6 Alkyl-C 3-8 Cycloalkyl, -C 1-6 Alkyl-4- to 10-membered heterocyclic group, -C 1-6 Alkyl-C 6-12 Aryl, -C 1-6 Alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 Cycloalkyl, -NH-4- to 10-membered heterocyclic group, -NH-C 6-12 Aryl, -NH-5- to 10-membered heteroaryl, -NH-C 1-6 Alkyl-C 3-8 Cycloalkyl, -NH-C 1-6 Alkyl-4- to 10-membered heterocyclic group, -NH-C 1-6 Alkyl-C 6-12 Aryl, -NH-C 1-6 Alkyl-5- to 10-membered heteroaryl, -O-C 1-6 Alkyl-C 3-8 Cycloalkyl, -O-C 1-6 Alkyl-4- to 10-membered heterocyclic group, -O-C 1-6 Alkyl-C 6-12 Aryl and -O-C 1-6 Alkyl-5- to 10-membered heteroaryl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo group, -NH(C 1-3 Alkyl), -N(C 1-3 Alkyl)(C 1-3 Alkyl), -C 1-3 Alkyl-NH2, -NH-C(O)C 1-3 Alkyl, -C(O)C 1-3 Alkyl, halo-C 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 Aryl, 5- to 10-membered heteroaryl;
[0013] R1 is selected from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Hydroxyalkyl, halo-C 1-6 Alkyl, C 1-6Alkylamino, -CO-C 1-6 Alkyl, -CO-C 1-6 Haloalkyl, -NHCO-C 1-6 Alkyl, 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, C 6-12 Aryl; said C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Hydroxyalkyl, halo C 1-6 Alkyl, C 1-6 Alkylamino, -CO-C 1-6 Alkyl, -CO-C 1-6 Haloalkyl, -NHCO-C 1-6 Alkyl, 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, C 6-12 Aryl is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, nitro, oxo, -NH(C 1-3 Alkyl), -N(C 1-3 Alkyl)(C 1-3 Alkyl), -C 1-3 Alkyl-NH2, -NH-C(O)C 1-3 Alkyl, -C(O)C 1-3 Alkyl, halo C 1-6 Alkyl, -C 1-3 Alkyl-NH-C 1-3 Alkyl, -C 1-3 Alkyl-N(C 1-3 Alkyl)C 1-3 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 Aryl, 5- to 10-membered heteroaryl;
[0014] R2 and R3 are independently selected from H, C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Alkoxy, C 1-4 Haloalkoxy, C 3-8 Cycloalkyl; or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered heterocycle;
[0015] Unless otherwise specified, the heteroatoms in the above-mentioned heterocyclic group and heteroaryl group are independently selected from O, N or S, and the number of heteroatoms is 1, 2, 3 or 4.
[0016] In a first aspect of the present invention, there is provided a compound represented by the following formula (I), or a prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, which has the following structure:
[0017]
[0018] Wherein, X is selected from O and S;
[0019] W and V are each independently selected from N or C(R w ); R w represents hydrogen, halogen or C 1-6 alkyl;
[0020] A is selected from hydrogen, halogen, amino, cyano, hydroxy, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-6 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo C 1-6 alkyl, C 1-6 alkylamino, -CO-C 1-6 alkyl, -CO-C 1-6 haloalkyl, -NHCO-C 1-6 alkyl, -CH2CONR a1 R a2 ; R a1 and R a2 are each independently selected from H, C 1-6 alkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo C 1-6 alkyl;
[0021] Ring B is selected from C 6-12 aryl, 5- to 16-membered heteroaryl and 5- to 16-membered heterocyclic group, and the C 6-12 aryl, 5- to 16-membered heteroaryl and 5- to 16-membered heterocyclic group are optionally substituted by n R b ; when multiple R b appear simultaneously, each R b can be the same or different; wherein n is selected from 0, 1, 2, 3, 4 and 5;
[0022] R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-6 alkyl, C 2-6 alkenyl, C2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 Aryl, 5- to 10-membered heteroaryl, -C 1-6 Alkyl-C 3-8 Cycloalkyl, -C 1-6 Alkyl-4- to 10-membered heterocyclic group, -C 1-6 Alkyl-C 6-12 Aryl, -C 1-6 Alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 Cycloalkyl, -NH-4- to 10-membered heterocyclic group, -NH-C 6-12 Aryl, -NH-5- to 10-membered heteroaryl, -NH-C 1-6 Alkyl-C 3-8 Cycloalkyl, -NH-C 1-6 Alkyl-4- to 10-membered heterocyclic group, -NH-C 1-6 Alkyl-C 6-12 Aryl, -NH-C 1-6 Alkyl-5- to 10-membered heteroaryl, -O-C 1-6 Alkyl-C 3-8 Cycloalkyl, -O-C 1-6 Alkyl-4- to 10-membered heterocyclic group, -O-C 1-6 Alkyl-C 6-12 Aryl and -O-C 1-6 Alkyl-5- to 10-membered heteroaryl; the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 Aryl, 5- to 10-membered heteroaryl, -C 1-6 Alkyl-C 3-8 Cycloalkyl, -C 1-6 Alkyl-4- to 10-membered heterocyclic group, -C 1-6 Alkyl-C 6-12 Aryl, -C 1-6 Alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 Cycloalkyl, -NH-4- to 10-membered heterocyclic group, -NH-C 6-12 Aryl, -NH-5- to 10-membered heteroaryl, -NH-C 1-6 Alkyl-C 3-8 Cycloalkyl, -NH-C 1-6alkyl-4- to 10-membered heterocyclic group, -NH-C 1-6 alkyl-C 6-12 aryl, -NH-C 1-6 alkyl-5- to 10-membered heteroaryl, -O-C 1-6 alkyl-C 3-8 cycloalkyl, -O-C 1-6 alkyl-4- to 10-membered heterocyclic group, -O-C 1-6 alkyl-C 6-12 aryl and -O-C 1-6 alkyl-5- to 10-membered heteroaryl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NH(C 1-3 alkyl), -N(C 1-3 alkyl)(C 1-3 alkyl), -C 1-3 alkyl-NH2, -NH-C(O)C 1-3 alkyl, -C(O)C 1-3 alkyl, halo-C 1-6 alkyl, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 alkylthio, C 1-6 hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 aryl, 5- to 10-membered heteroaryl;
[0023] R1 is selected from C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo-C 1-6 alkyl, C 1-6 alkylamino, -CO-C 1-6 alkyl, -CO-C 1-6 haloalkyl, -NHCO-C 1-6 alkyl, 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, C 6-12 aryl; the C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl, halo-C 1-6 alkyl, C 1-6 alkylamino, -CO-C 1-6Alkyl, -CO-C 1-6 Halogenated alkyl, -NHCO-C 1-6 Alkyl, 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, C 6-12 The aryl is unsubstituted or substituted by one or more of the following substituents respectively: halogen, cyano, hydroxyl, amino, nitro, oxo group, -NH(C 1-3 Alkyl), -N(C 1-3 Alkyl)(C 1-3 Alkyl), -C 1-3 Alkyl-NH2, -NH-C(O)C 1-3 Alkyl, -C(O)C 1-3 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl, 4- to 10-membered heterocyclic group, C 6-12 Aryl, 5- to 10-membered heteroaryl;
[0024] R2 and R3 are independently selected from H, C 1-4 Alkyl, C 1-4 Halogenated alkyl, C 1-4 Alkoxy, C 1-4 Halogenated alkoxy, C 3-8 Cycloalkyl; or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered heterocycle;
[0025] Unless otherwise specified, the heteroatoms in the above heterocyclic groups and heteroaryls are independently selected from O, N or S, and the number of heteroatoms is 1, 2, 3 or 4.
[0026] In a preferred embodiment of the present invention, both W and V are selected from N.
[0027] In a preferred embodiment of the present invention, A is selected from hydrogen, halogen, amino, cyano, hydroxyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 1-6 Alkoxy, C 1-6 Hydroxyalkyl, halogenated C 1-6 Alkyl; more preferably, A is selected from hydrogen, halogen, amino, cyano, hydroxyl, methyl, ethyl, n-propyl, isopropyl, trifluoromethyl, difluoromethyl, monofluoromethyl, cyclopropyl, methoxy; most preferably, A is selected from hydrogen.
[0028] In a preferred embodiment of the present invention, ring B is selected from C 6-14 aryl, 5- to 14-membered heteroaryl, and 5- to 14-membered heterocyclic group, and the C 6-14 aryl, 5- to 14-membered heteroaryl, and 5- to 14-membered heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group can be the same or different; where n is selected from 0, 1, 2, 3, and 4; more preferably, ring B is selected from C6 aryl, 6- to 14-membered heteroaryl, and 6- to 14-membered heterocyclic group, and the C6 aryl, 6- to 14-membered heteroaryl, and 6- to 14-membered heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group can be the same or different; where n is selected from 0, 1, 2, and 3.
[0029] In a preferred embodiment of the present invention, ring B is selected from C 6-10 aryl, 5- to 12-membered heteroaryl, and 5- to 14-membered heterocyclic group, and the C 6-10 aryl, 5- to 12-membered heteroaryl, and 5- to 14-membered heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group can be the same or different; where n is selected from 0, 1, 2, 3, and 4; more preferably, ring B is selected from phenyl, 8- to 10-membered heteroaryl, and 9- to 14-membered heterocyclic group, the heteroatoms in the heteroaryl and heterocyclic group are independently selected from O or N, the number of heteroatoms is 1, 2, or 3, and the phenyl, 8- to 10-membered heteroaryl, and 9- to 14-membered heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group can be the same or different, where n is selected from 0, 1, 2, and 3; more preferably, ring B is selected from phenyl, 9- to 10-membered bicyclic heterocyclic group, the heteroatom in the heterocyclic group is N, the number of heteroatoms is 1 or 2, and the phenyl, 9- to 10-membered bicyclic heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group can be the same or different, where n is selected from 0, 1, and 2.
[0030] In a preferred embodiment of the present invention, ring B is selected from 6- to 12-membered bicyclic heteroaryl, 6- to 14-membered bicyclic heterocyclic group, and 12- to 14-membered tricyclic heterocyclic group, and the 6- to 12-membered bicyclic heteroaryl, 6- to 14-membered bicyclic heterocyclic group, and 12- to 14-membered tricyclic heterocyclic group are optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each Rb may be the same or different, where n is selected from 0, 1, 2, 3, and 4; more preferably, ring B is selected from 9- to 10-membered bicyclic heteroaryl, 9- to 10-membered bicyclic heterocyclic, and 14-membered tricyclic heterocyclic, and the heteroatoms in the heteroaryl and heterocyclic are independently selected from O or N, and the number of heteroatoms is 1, 2, or 3, and the 9- to 10-membered bicyclic heteroaryl, 9- to 10-membered bicyclic heterocyclic, and 14-membered tricyclic heterocyclic are optionally substituted with n R b substituents, and when multiple R b appear simultaneously, each R b may be the same or different, where n is selected from 0, 1, 2, and 3; more preferably, ring B is selected from 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic, and the heteroatoms in the heteroaryl and heterocyclic are O or N, and the number of heteroatoms is 1, 2, or 3, and the 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic are optionally substituted with n R b substituents, and when multiple R b appear simultaneously, each R b may be the same or different, where n is selected from 1, 2, and 3; more preferably, ring B is selected from 9- to 10-membered bicyclic heterocyclic, and the heteroatom in the heterocyclic is N, and the number of heteroatoms is 1, and the 9- to 10-membered bicyclic heterocyclic is optionally substituted with n R b substituents, and when multiple R b appear simultaneously, each R b may be the same or different, where n is selected from 1 and 2.
[0031] In a preferred embodiment of the present invention, ring B is selected from 9- to 10-membered bicyclic heteroaryl, and the heteroatoms in the heteroaryl are independently selected from O or N, and the number of heteroatoms is 1, 2, or 3, and the 9- to 10-membered bicyclic heteroaryl is optionally substituted with n R b substituents, and when multiple R b appear simultaneously, each R b may be the same or different, where n is selected from 1, 2, and 3.
[0032] In a preferred embodiment of the present invention, ring B is selected from 5-membered / 6-membered bicyclic fused heteroaryl, 6-membered / 5-membered bicyclic fused heteroaryl, 6-membered / 6-membered bicyclic fused heteroaryl, 5-membered / 6-membered bicyclic fused heterocyclic, 6-membered / 5-membered bicyclic fused heterocyclic, 6-membered / 6-membered bicyclic fused heterocyclic, and the heteroatoms in the heteroaryl and heterocyclic are O or N, and the number of heteroatoms is 1, 2, or 3, and the 5-membered / 6-membered bicyclic fused heteroaryl, 6-membered / 5-membered bicyclic fused heteroaryl, 6-membered / 6-membered bicyclic fused heteroaryl, 5-membered / 6-membered bicyclic fused heterocyclic, 6-membered / 5-membered bicyclic fused heterocyclic, 6-membered / 6-membered bicyclic fused heterocyclic are optionally substituted with n R b substituents, and when multiple R b appear simultaneously, each R bThey may be the same or different, where n is selected from 1, 2 and 3.
[0033] In a preferred embodiment of the present invention, ring B is selected from C 6-10 aryl, and the C 6-10 aryl is optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group may be the same or different; where n is selected from 1, 2, 3 and 4; more preferably, ring B is selected from phenyl, and the phenyl is optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group may be the same or different, where n is selected from 1, 2 and 3; more preferably, ring B is selected from phenyl, and the phenyl is optionally substituted with n R b groups. When multiple R b groups appear simultaneously, each R b group may be the same or different, where n is selected from 1 and 2.
[0034] Preferably, ring B is a monocyclic, bicyclic or tricyclic ring, and the bicyclic or tricyclic ring includes spiro rings, fused rings and bridged rings; more preferably, ring B is a monocyclic or bicyclic ring; more preferably, ring B is a bicyclic ring.
[0035] Preferably, ring B is selected from phenyl, 5-7 membered monocyclic heteroaryl, 5-7 membered monocyclic heterocyclic group, naphthyl, phenanthryl, anthracenyl, 8-14 membered bicyclic heteroaryl, 8-14 membered bicyclic heterocyclic group, 9-14 membered tricyclic heteroaryl, 9-14 membered tricyclic heterocyclic group.
[0036] Preferably, ring B is selected from 8-14 membered bicyclic fused heteroaryl, 8-14 membered bicyclic fused heterocyclic group, 9-14 membered fused tricyclic heteroaryl, 9-14 membered fused tricyclic heterocyclic group.
[0037] More preferably, ring B is selected from C6 aryl, 5-membered monocyclic heteroaryl, 6-membered monocyclic heteroaryl, 7-membered monocyclic heteroaryl, 5-membered monocyclic heterocyclic group, 6-membered monocyclic heterocyclic group, 7-membered monocyclic heterocyclic group, 6-membered / 6-membered bicyclic condensed aryl, 4-membered / 4-membered bicyclic condensed heteroaryl, 4-membered / 5-membered bicyclic condensed heteroaryl, 5-membered / 4-membered bicyclic condensed heteroaryl, 5-membered / 5-membered bicyclic condensed heteroaryl, 5-membered / 6-membered bicyclic condensed heteroaryl, 6-membered / 5-membered bicyclic condensed heteroaryl, 4-membered / 6-membered bicyclic condensed heteroaryl, 6-membered / 4-membered bicyclic condensed heteroaryl, 6-membered / 6-membered bicyclic condensed heteroaryl, 4-membered / 4-membered bicyclic condensed heterocyclic group, 4-membered / 5-membered bicyclic condensed heterocyclic group, 5-membered / 4-membered bicyclic condensed heterocyclic group, 5-membered / 5-membered bicyclic condensed heterocyclic group, 5-membered / 6-membered bicyclic condensed heterocyclic group, 6-membered / 5-membered bicyclic condensed heterocyclic group, 4-membered / 6-membered bicyclic condensed heterocyclic group, 6-membered / 4-membered bicyclic condensed heterocyclic group, 6-membered / 6-membered bicyclic condensed heterocyclic group, 5-membered / 6-membered / 6-membered tricyclic condensed heteroaryl ring, 6-membered / 5-membered / 6-membered tricyclic condensed heteroaryl ring, 6-membered / 6-membered / 5-membered tricyclic condensed heteroaryl ring, 5-membered / 5-membered / 6-membered tricyclic condensed heteroaryl ring, 5-membered / 6-membered / 5-membered tricyclic condensed heteroaryl ring, 6-membered / 5-membered / 5-membered tricyclic condensed heteroaryl ring, 6-membered / 6-membered / 6-membered tricyclic condensed heteroaryl ring, 5-membered / 6-membered / 6-membered tricyclic condensed heterocyclic group, 6-membered / 5-membered / 6-membered tricyclic condensed heterocyclic group, 6-membered / 6-membered / 5-membered tricyclic condensed heterocyclic group, 5-membered / 5-membered / 6-membered tricyclic condensed heterocyclic group, 5-membered / 6-membered / 5-membered tricyclic condensed heterocyclic group, 6-membered / 5-membered / 5-membered tricyclic condensed heterocyclic group, 6-membered / 6-membered / 6-membered tricyclic condensed heterocyclic group, 6-membered / 6-membered / 6-membered tricyclic condensed aryl. The heteroatoms in the above-mentioned heterocyclic groups and heteroaryl groups are independently selected from O, N or S, and the number of heteroatoms is 1, 2 or 3; the above-mentioned groups are optionally substituted by n Rs b substituted, when multiple Rs b appear simultaneously, each R b can be the same or different; wherein n is selected from 0, 1, 2 and 3.
[0038] Preferably, ring B is selected from the following structures, and the structures are optionally substituted by n Rs b substituted, when multiple Rs b appear simultaneously, each R b can be the same or different, wherein n is selected from 0, 1, 2 and 3:
[0039]
[0040] Even more preferably, ring B is selected from the following structures, and the structures are optionally substituted by n Rs b substituted, when multiple Rs b appear simultaneously, each R b can be the same or different, wherein n is selected from 0, 1, 2 and 3:
[0041]
[0042] More preferably, ring B is selected from the following structures, and the structures are optionally substituted by n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1, 2, and 3:
[0043]
[0044] More preferably, ring B is selected from the following structures, and the structures are optionally substituted by n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1 or 2.
[0045] Preferably, R b -ring B is selected from the following structures:
[0046]
[0047] Even more preferably, R b -ring B is selected from the following structures:
[0048]
[0049] In a preferred embodiment of the present invention, R b is selected from halogen, cyano, hydroxyl, nitro, amino, oxo, C 1-4 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-10 membered heterocyclic group, C 6-12 aryl, 5-10 membered heteroaryl, -C 1-4 alkyl-C 3-8 cycloalkyl, -C 1-4 alkyl-4-10 membered heterocyclic group, -C 1-4 alkyl-C 6-12 aryl, -C 1-4 alkyl-5-10 membered heteroaryl, -NH-C 3-8 cycloalkyl, -NH-4-10 membered heterocyclic group, -NH-C 6-12 aryl, -NH-5-10 membered heteroaryl, -NH-C 1-4 alkyl-C 3-8 cycloalkyl, -NH-C 1-4 alkyl-4-10 membered heterocyclic group, -NH-C 1-4 alkyl-C6-12 Aryl, -NH-C 1-4 Alkyl-5-10-membered heteroaryl, -O-C 1-4 Alkyl-C 3-8 Cycloalkyl, -O-C 1-4 Alkyl-4-10-membered heterocyclic group, -O-C 1-4 Alkyl-C 6-12 Aryl and -O-C 1-4 Alkyl-5-10-membered heteroaryl; the C 1-4 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-6 Cycloalkyl, C 1-4 Alkoxy, C 1-4 Alkylthio, C 1-4 Hydroxyalkyl, 4-10-membered heterocyclic group, C 6-12 Aryl, 5-10-membered heteroaryl, -C 1-4 Alkyl-C 3-8 Cycloalkyl, -C 1-4 Alkyl-4-10-membered heterocyclic group, -C 1-4 Alkyl-C 6-12 Aryl, -C 1-4 Alkyl-5-10-membered heteroaryl, -NH-C 3-8 Cycloalkyl, -NH-4-10-membered heterocyclic group, -NH-C 6-12 Aryl, -NH-5-10-membered heteroaryl, -NH-C 1-4 Alkyl-C 3-8 Cycloalkyl, -NH-C 1-4 Alkyl-4-10-membered heterocyclic group, -NH-C 1-4 Alkyl-C 6-12 Aryl, -NH-C 1-4 Alkyl-5-10-membered heteroaryl, -O-C 1-4 Alkyl-C 3-8 Cycloalkyl, -O-C 1-4 Alkyl-4-10-membered heterocyclic group, -O-C 1-4 Alkyl-C 6-12 Aryl and -O-C 1-4 Alkyl-5-10-membered heteroaryl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NH(C 1-3 Alkyl), -N(C 1-3 Alkyl)(C 1-3 Alkyl), -C(O)C 1-3 Alkyl, halo-C 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C3-8 Naphthenyl, C 1-6 Alkoxy, C 1-6 Alkylthio, C 1-6 Hydroxyalkyl.
[0050] More preferably, R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-4 alkyl, C 3-6 naphthenyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4- to 10-membered heterocyclic group, -C 1-4 alkyl-C 3-8 naphthenyl, -C 1-4 alkyl-4- to 10-membered heterocyclic group, -C 1-4 alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 naphthenyl, -NH-4- to 10-membered heterocyclic group, -NH-5- to 10-membered heteroaryl, -NH-C 1-4 alkyl-C 3-8 naphthenyl, -NH-C 1-4 alkyl-4- to 10-membered heterocyclic group, -NH-C 1-4 alkyl-5- to 10-membered heteroaryl, -O-C 1-4 alkyl-C 3-8 naphthenyl, -O-C 1-4 alkyl-4- to 10-membered heterocyclic group and -O-C 1-4 alkyl-5- to 10-membered heteroaryl; the C 1-4 alkyl, C 3-6 naphthenyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4- to 10-membered heterocyclic group, -C 1-4 alkyl-C 3-8 naphthenyl, -C 1-4 alkyl-4- to 10-membered heterocyclic group, -C 1-4 alkyl-5- to 10-membered heteroaryl, -NH-C 3-8 naphthenyl, -NH-4- to 10-membered heterocyclic group, -NH-5- to 10-membered heteroaryl, -NH-C 1-4 alkyl-C 3-8 naphthenyl, -NH-C 1-4 alkyl-4- to 10-membered heterocyclic group, -NH-C 1-4 alkyl-5- to 10-membered heteroaryl, -O-C 1-4 alkyl-C 3-8 naphthenyl, -O-C 1-4 alkyl-4- to 10-membered heterocyclic group and -O-C 1-4An alkyl-5- to 10-membered heteroaryl is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NH(C 1-3 alkyl), -N(C 1-3 alkyl)(C 1-3 alkyl), -C(O)C 1-3 alkyl, C 1-6 alkyl, C 1-6 hydroxyalkyl.
[0051] More preferably, R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4- to 6-membered heterocycloalkyl, 4- to 6-membered heterocycloalkenyl, 7- to 8-membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -NH-4- to 6-membered heterocycloalkyl, -NH-C 1-4 alkyl-4- to 6-membered heterocycloalkyl, -NH-C 1-4 alkyl-4- to 6-membered heterocycloalkenyl, -NH-C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl; the heteroatoms in the heterocycloalkyl, heterocycloalkenyl, heterocyclic group, and heteroaryl are O or N, and the number of heteroatoms is 1, 2, or 3; the C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4- to 6-membered heterocycloalkyl, 4- to 6-membered heterocycloalkenyl, 7- to 8-membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -NH-4- to 6-membered heterocycloalkyl, -NH-C 1-4 alkyl-4- to 6-membered heterocycloalkyl, -NH-C 1-4 alkyl-4- to 6-membered heterocycloalkenyl, -NH-C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NH(C1-3 alkyl), -N(C 1-3 alkyl)(C 1-3 alkyl), -C(O)C 1-3 alkyl, C 1-4 alkyl, C 1-3 hydroxyalkyl.
[0052] More preferably, R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl; the heteroatoms in the heterocycloalkyl, heterocycloalkenyl, heterocyclic group, and heteroaryl are O or N, and the number of heteroatoms is 1 or 2; the C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NHCH3, -N(CH3)(CH3), -C(O)CH3, methyl, ethyl, hydroxymethyl.
[0053] More preferably, R b is selected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4- to 10-membered heterocyclic group, -CH2-cyclopropyl, -CH2-cyclobutyl, -CH2-cyclopentyl, -CH2-4- to 6-membered heterocyclic group, -CH2-5- to 6-membered heteroaryl, -NHCH2-cyclopropyl, -NHCH2-cyclobutyl, -NHCH2-cyclopentyl, -NHCH2-4- to 6-membered heterocyclic group, -NHCH2-5- to 6-membered heteroaryl, -NH-cyclopropyl, -NH-cyclobutyl, -NH-cyclopentyl, -NH-4- to 6-membered heterocyclic group, -NH-5- to 6-membered heteroaryl, -OCH2-cyclopropyl, -OCH2-cyclobutyl, -OCH2-cyclopentyl, -OCH2-4- to 6-membered heterocyclic group, and -OCH2-5- to 6-membered heteroaryl, and the methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4- to 10-membered heterocyclic group, -CH2-cyclopropyl, -CH2-cyclobutyl, -CH2-cyclopentyl, -CH2-4- to 6-membered heterocyclic group, -CH2-5- to 6-membered heteroaryl, -NHCH2-cyclopropyl, -NHCH2-cyclobutyl, -NHCH2-cyclopentyl, -NHCH2-4- to 6-membered heterocyclic group, -NHCH2-5- to 6-membered heteroaryl, -NH-cyclopropyl, -NH-cyclobutyl, -NH-cyclopentyl, -NH-4- to 6-membered heterocyclic group, -NH-5- to 6-membered heteroaryl, -OCH2-cyclopropyl, -OCH2-cyclobutyl, -OCH2-cyclopentyl, -OCH2-4- to 6-membered heterocyclic group, and -OCH2-5- to 6-membered heteroaryl are unsubstituted or are each substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NHCH3, -N(CH3)(CH3), -C(O)CH3, methyl, ethyl, hydroxymethyl.
[0054] Preferably, R b is selected from the following structures: halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,
[0055]
[0056] and the above structures are unsubstituted or are each substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NHCH3, -N(CH3)(CH3), -C(O)CH3, methyl, ethyl, hydroxymethyl.
[0057] More preferably, R bSelected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio,
[0058] More preferably, R b Selected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio,
[0059] Most preferably, R b Selected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio,
[0060] In a preferred embodiment of the present invention, ring B is selected from 9-10 membered bicyclic heteroaryl and 9-10 membered bicyclic heterocyclic group, and the 9-10 membered bicyclic heteroaryl and 9-10 membered bicyclic heterocyclic group are optionally substituted by n R b substituents, when multiple R b appear simultaneously, each R b can be the same or different, where n is selected from 1 or 2; R b is selected from halogen, oxo, C 1-6 alkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, C 5-6 cycloalkyl, 4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl, and the C 1-6 alkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, C 5-6 cycloalkyl, 4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl is unsubstituted or is substituted by one or more of the following substituents respectively: halogen, cyano, hydroxy, C 1-4 alkyl; the heteroatoms in the heterocycloalkyl and heteroaryl are O or N, and the number of heteroatoms is 1 or 2.
[0061] In a preferred embodiment of the present invention, ring B is selected from 9-10 membered bicyclic heteroaryl and 9-10 membered bicyclic heterocyclic group, and the 9-10 membered bicyclic heteroaryl and 9-10 membered bicyclic heterocyclic group are optionally substituted by n R b substituents, when multiple R bWhen present simultaneously, each R b may be the same or different, where n is selected from 1 or 2; R b is selected from halogen, oxo group, C 1-4 alkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, C 5-6 cycloalkyl, 4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl, and the C 1-6 alkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, C 5-6 cycloalkyl, 4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, methyl; the heteroatoms in the heterocycloalkyl and heteroaryl are O or N, and the number of heteroatoms is 1 or 2.
[0062] In a preferred embodiment of the present invention, R1 is selected from 4-12 membered heterocyclic groups, 5-12 membered heteroaryl groups; the 4-12 membered heterocyclic groups and 5-12 membered heteroaryl groups are unsubstituted or are substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, -NH-C(O)C 1-3 alkyl, halo-C 1-6 alkyl, -C 1-3 alkyl-NH-C 1-3 alkyl, -C 1-3 alkyl-N(C 1-3 alkyl)C 1-3 alkyl, C 1-6 alkyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl.
[0063] Preferably, R1 is selected from 5-10 membered heterocyclic groups, 6-10 membered heteroaryl groups; the 5-10 membered heterocyclic groups and 6-10 membered heteroaryl groups are unsubstituted or are substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, -NH-C(O)C 1-3 alkyl, halo-C 1-6 alkyl, -C 1-3 alkyl-NH-C 1-3 alkyl, -C 1-3 alkyl-N(C 1-3 alkyl)C 1-3 alkyl, C 1-3 alkyl, C 3-6 cycloalkyl, C 1-3 alkoxy, C1-3 Hydroxyalkyl
[0064] More preferably, R1 is selected from 5- to 6-membered heterocycloalkyl, 9- to 10-membered bicyclic heterocyclic group, 6-membered monocyclic heteroaryl, 9- to 10-membered bicyclic heteroaryl; the heteroatoms in the heterocycloalkyl, heterocyclic group, and heteroaryl are O or N, and the number of heteroatoms is 1, 2, or 3; the 5- to 6-membered heterocycloalkyl, 9- to 10-membered bicyclic heterocyclic group, 6-membered monocyclic heteroaryl, 9- to 10-membered bicyclic heteroaryl are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, -NH-C(O)C 1-3 Alkyl, halo-C 1-3 Alkyl, -C 1-3 Alkyl-NH-C 1-3 Alkyl, -C 1-3 Alkyl-N(C 1-3 Alkyl)C 1-3 Alkyl, C 1-3 Alkyl, C 3-6 Cycloalkyl, C 1-3 Alkoxy, C 1-3 Hydroxyalkyl
[0065] More preferably, R1 is selected from 5- to 6-membered heterocycloalkyl, 5 / 6-membered bicyclic fused heterocyclic group, 6 / 5-membered bicyclic fused heterocyclic group, 6 / 6-membered bicyclic fused heterocyclic group, 6-membered monocyclic heteroaryl, 5 / 6-membered bicyclic fused heteroaryl, 6 / 5-membered bicyclic fused heteroaryl, 6 / 6-membered bicyclic fused heteroaryl; the heteroatoms in the heterocycloalkyl, heterocyclic group, and heteroaryl are O or N, and the number of heteroatoms is 1, 2, or 3; the 5- to 6-membered heterocycloalkyl, 5 / 6-membered bicyclic fused heterocyclic group, 6 / 5-membered bicyclic fused heterocyclic group, 6 / 6-membered bicyclic fused heterocyclic group, 6-membered monocyclic heteroaryl, 5 / 6-membered bicyclic fused heteroaryl, 6 / 5-membered bicyclic fused heteroaryl, 6 / 6-membered bicyclic fused heteroaryl are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, methoxy, -NH-C(O)CH3, -CH2NHCH3, trifluoromethyl, difluoromethyl, monofluoromethyl, hydroxymethyl.
[0066] In a preferred embodiment of the present invention, R1 is selected from 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, and C 6-12 Aryl; the 4- to 12-membered heterocyclic group, 5- to 12-membered heteroaryl, and C 6-12 Aryl are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, amino, hydroxy, nitro, oxo, -NH(C 1-3 Alkyl), -N(C 1-3 Alkyl)(C 1-3 Alkyl), -C 1-3Alkyl-NH2, -NH-C(O)C 1-3 Alkyl, -C(O)C 1-3 Alkyl, halo-C 1-3 Alkyl, C 1-3 Alkyl, C 3-8 Cycloalkyl, C 1-3 Alkoxy, C 1-3 Alkylthio, C 1-3 Hydroxyalkyl.
[0067] Preferably, R1 is selected from 5- to 10-membered heterocyclic groups, 6- to 10-membered heteroaryl groups, and C 6-10 aryl groups; the 5- to 10-membered heterocyclic groups, 6- to 10-membered heteroaryl groups, and C 6-10 aryl groups are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, nitro, oxo, -NHCH3, -N(CH3)(CH3), -NH-C(O)CH3, -C(O)CH3, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, methoxy, methylthio, trifluoromethyl, difluoromethyl, monofluoromethyl.
[0068] Preferably, R1 is monocyclic, bicyclic or tricyclic, and the bicyclic or tricyclic includes spiro rings and fused rings; more preferably, ring B is monocyclic or bicyclic.
[0069] Preferably, R1 is selected from phenyl, 5- to 7-membered monocyclic heteroaryl groups, 5- to 7-membered monocyclic heterocyclic groups, naphthyl, 8- to 14-membered bicyclic heteroaryl groups, 8- to 14-membered bicyclic heterocyclic groups.
[0070] Preferably, R1 is selected from phenyl, 5- to 7-membered monocyclic heteroaryl groups, 5- to 7-membered monocyclic heterocyclic groups, naphthyl, 8- to 14-membered bicyclic fused heteroaryl groups, 8- to 14-membered bicyclic fused heterocyclic groups.
[0071] More preferably, R1 is selected from C6 aryl, 5-membered monocyclic heteroaryl, 6-membered monocyclic heteroaryl, 7-membered monocyclic heteroaryl, 5-membered monocyclic heterocyclic group, 6-membered monocyclic heterocyclic group, 7-membered monocyclic heterocyclic group, 6 / 6-membered bicyclic fused aryl, 4 / 4-membered bicyclic fused heteroaryl, 4 / 5-membered bicyclic fused heteroaryl, 5 / 4-membered bicyclic fused heteroaryl, 5 / 5-membered bicyclic fused heteroaryl, 5 / 6-membered bicyclic fused heteroaryl, 6 / 5-membered bicyclic fused heteroaryl, 4 / 6-membered bicyclic fused heteroaryl, 6 / 4-membered bicyclic fused heteroaryl, 6 / 6-membered bicyclic fused heteroaryl, 4 / 4-membered bicyclic fused heterocyclic group, 4 / 5-membered bicyclic fused heterocyclic group, 5 / 4-membered bicyclic fused heterocyclic group, 5 / 5-membered bicyclic fused heterocyclic group, 5 / 6-membered bicyclic fused heterocyclic group, 6 / 5-membered bicyclic fused heterocyclic group, 4 / 6-membered bicyclic fused heterocyclic group, 6 / 4-membered bicyclic fused heterocyclic group, 6 / 6-membered bicyclic fused heterocyclic group. The heteroatoms in the above-mentioned heterocyclic group and heteroaryl are independently selected from O, N or S, and the number of heteroatoms is 1, 2 or 3; the above-mentioned R1 group is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxyl, amino, nitro, oxo group, -NHCH3, -N(CH3)(CH3), -NH-C(O)CH3, -C(O)CH3, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, methoxy, methylthio, trifluoromethyl, difluoromethyl, monofluoromethyl.
[0072] Even more preferably, R1 is selected from the following structures, which are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxyl, amino, nitro, oxo group, -NHCH3, -N(CH3)(CH3), -NH-C(O)CH3, -C(O)CH3, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, methoxy, methylthio, trifluoromethyl, difluoromethyl, monofluoromethyl:
[0073]
[0074] Even more preferably, R1 is selected from the following structures:
[0075]
[0076] Most preferably, R1 is selected from the following structures:
[0077]
[0078] In a preferred embodiment of the present invention, R1 is selected from 6-membered monocyclic heteroaryl, 9-10-membered bicyclic heteroaryl; the heteroatoms in the heteroaryl are O or N, and the number of heteroatoms is 1, 2 or 3; the 6-membered monocyclic heteroaryl and 9-10-membered bicyclic heteroaryl are unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxyl, amino, -NH-C(O)C 1-3Alkyl, halo C 1-3 Alkyl, -C 1-3 Alkyl-NH-C 1-3 Alkyl, -C 1-3 Alkyl-N(C 1-3 Alkyl)C 1-3 Alkyl, C 1-3 Alkyl, C 3-6 Cycloalkyl, C 1-3 Alkoxy, C 1-3 Hydroxyalkyl.
[0079] Preferably, R1 is selected from 6-membered monocyclic heteroaryl, 9-membered bicyclic heteroaryl; the heteroatom in the heteroaryl is N, and the number of heteroatoms is 1 or 2; the 6-membered monocyclic heteroaryl and 9-membered bicyclic heteroaryl are unsubstituted or substituted by one or more of the following substituents: which are unsubstituted or substituted by one or more of the following substituents: halogen, hydroxy, halo C 1-3 Alkyl, -C 1-3 Alkyl-NH-C 1-3 Alkyl, -C 1-3 Alkyl-NH-C 1-3 Alkyl, C 1-3 Alkyl, C 1-3 Hydroxyalkyl.
[0080] More preferably, R1 is selected from 6-membered monocyclic heteroaryl, 5 / 6-membered bicyclic fused heteroaryl, 6 / 5-membered bicyclic fused heteroaryl, 6 / 6-membered bicyclic fused heteroaryl; the heteroatom in the heteroaryl is N, and the number of heteroatoms is 1 or 2; the 5 / 6-membered bicyclic fused heteroaryl, 6 / 5-membered bicyclic fused heteroaryl, and 6 / 6-membered bicyclic fused heteroaryl are unsubstituted or substituted by one or more of the following substituents: which are unsubstituted or substituted by one or more of the following substituents: halogen, -C 1-3 Alkyl-NH-C 1-3 Alkyl, C 1-3 Alkyl, C 1-3 Hydroxyalkyl.
[0081] More preferably, R1 is selected from the following structures Which is unsubstituted or substituted by one or more of the following substituents: fluorine, chlorine, bromine, -CH2NHCH3, methyl, hydroxymethyl.
[0082] More preferably, R1 is selected from the following structures:
[0083]
[0084] In a preferred embodiment of the present invention, R2 and R3 are independently selected from hydrogen, methyl; or R2 and R3 together with the atoms to which they are attached form a 5- or 6-membered heterocycle.
[0085] Preferably, R2 and R3 are independently selected from hydrogen and methyl; or R2 and R3 together with the atoms to which they are attached form a 5-membered heteroalkyl or 6-membered heteroalkyl group, the heteroatoms in the heteroalkyl group being N and the number of heteroatoms being 2.
[0086] More preferably, R2 and R3 are independently selected from hydrogen and methyl; or R2 and R3 together with the atoms to which they are attached form a 5-membered heteroalkyl or 6-membered heteroalkyl group, the heteroatoms in the heteroalkyl group being N and the number of heteroatoms being 2, and X is S.
[0087] In a preferred embodiment of the present invention, ring B is selected from phenyl, and the phenyl is optionally substituted with n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1, 2, and 3; R1 is selected from 5- to 10-membered bicyclic heterocyclic groups, 6- to 10-membered bicyclic heteroaryl groups; the 5- to 10-membered bicyclic heterocyclic groups and 6- to 10-membered bicyclic heteroaryl groups are unsubstituted or are each substituted with one or more of the following substituents: halogen, cyano, hydroxyl, amino, -NH-C(O)C 1-3 alkyl, halo C 1-6 alkyl, -C 1-3 alkyl-NH-C 1-3 alkyl, -C 1-3 alkyl-N(C 1-3 alkyl)C 1-3 alkyl, C 1-6 alkyl, C 3-8 cycloalkyl, C 1-6 alkoxy, C 1-6 hydroxyalkyl.
[0088] Preferably, ring B is selected from phenyl, and the phenyl is optionally substituted with n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1, 2, and 3; R1 is selected from 9- to 10-membered bicyclic heterocyclic groups, 9- to 10-membered bicyclic heteroaryl groups; the 9- to 10-membered bicyclic heterocyclic groups and 9- to 10-membered bicyclic heteroaryl groups are unsubstituted or are each substituted with one or more of the following substituents: halogen, cyano, hydroxyl, amino, -NH-C(O)C 1-3 alkyl, halo C 1-6 alkyl, -C 1-3 alkyl-NH-C 1-3 alkyl, -C 1-3 alkyl-N(C 1-3 alkyl)C 1-3 alkyl, C 1-3 alkyl, C 3-6 cycloalkyl, C1-3 alkoxy, C 1-3 hydroxyalkyl.
[0089] More preferably, ring B is selected from phenyl, and the phenyl is optionally substituted by n R b substituents, and when multiple R b substituents appear simultaneously, each R b may be the same or different, where n is selected from 1, 2, and 3; R1 is selected from 5 - membered / 6 - membered bicyclic fused heterocyclic groups, 6 - membered / 5 - membered bicyclic fused heterocyclic groups, 6 - membered / 6 - membered bicyclic fused heterocyclic groups, 5 - membered / 6 - membered bicyclic fused heteroaryl groups, 6 - membered / 5 - membered bicyclic fused heteroaryl groups, 6 - membered / 6 - membered bicyclic fused heteroaryl groups; the heteroatoms in the heterocyclic group and heteroaryl group are O or N, and the number of heteroatoms is 1, 2, or 3; the 5 - membered / 6 - membered bicyclic fused heterocyclic group, 6 - membered / 5 - membered bicyclic fused heterocyclic group, 6 - membered / 6 - membered bicyclic fused heterocyclic group, 5 - membered / 6 - membered bicyclic fused heteroaryl group, 6 - membered / 5 - membered bicyclic fused heteroaryl group, 6 - membered / 6 - membered bicyclic fused heteroaryl group is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxyl, amino, methyl, ethyl, n - propyl, isopropyl, cyclopropyl, methoxy, -NH - C(O)CH3, -CH2NHCH3, trifluoromethyl, difluoromethyl, monofluoromethyl, hydroxymethyl.
[0090] In a preferred embodiment of the present invention, ring B is selected from phenyl, and the phenyl is optionally substituted by 2 R b substituents, and when multiple R b substituents appear simultaneously, each R b may be the same or different; R b is selected from methyl, R1 is selected from pyridyl optionally substituted by one or more arbitrary C 1-3 alkyl groups.
[0091] Preferably, R b - ring B is selected from the following structures:
[0092] R1 is selected from pyridyl optionally substituted by one or more methyl groups.
[0093] In a preferred embodiment of the present invention, the compound represented by formula (I), or its prodrug, tautomer, stereoisomer, solvate, isotope derivative, or its pharmaceutically acceptable salt is selected from the following compounds:
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104] Another object of the present invention is to provide a method for preparing the compound represented by formula (I), or its prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof.
[0105] The said compound can be prepared by the following steps.
[0106] General Step 1:
[0107]
[0108] General Step 2:
[0109]
[0110] General Step 3:
[0111]
[0112] Wherein, in the above preparation method, the definitions of the substituents in the said compound are as described above.
[0113] The present invention also provides a pharmaceutical composition, which comprises the compound represented by formula (I) shown in the present invention, or its prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof.
[0114] The present invention also provides a pharmaceutical composition, which comprises the compound represented by formula (I) shown in the present invention, or its prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof, and pharmaceutically acceptable excipients.
[0115] Administration of the compounds of the present invention, or their prodrugs, tautomers, stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof, can be carried out in pure form or in the form of a suitable pharmaceutical composition by any acceptable route of administration for drugs providing similar uses. The pharmaceutical compositions of the present invention can be prepared by combining the compounds of the present invention with suitable pharmaceutically acceptable excipients. The pharmaceutical compositions of the present invention can be formulated into solid, semi-solid, liquid or gaseous preparations.
[0116] The object of the present invention also includes providing the use of the compounds represented by formula (I) shown in the present invention, or their prodrugs, tautomers, stereoisomers, solvates, isotopic derivatives, or pharmaceutically acceptable salts thereof in the preparation of drugs for treating POLQ-mediated diseases.
[0117] In some embodiments, the POLQ-mediated disease is cancer or cancer-related diseases.
[0118] Furthermore, for the use provided by the present invention, the cancer or tumor includes solid tumors and hematological tumors; the solid tumors include breast cancer, colorectal cancer, cervical cancer, ovarian cancer, prostate cancer, gastric cancer (including gastroesophageal junction cancer), esophageal cancer, head and neck cancer, lung cancer; the hematological tumors include lymphoma and leukemia.
[0119] The object of the present invention also includes providing a method for preventing and / or treating POLQ-mediated diseases, which includes administering to a patient a therapeutically effective dose of the compound represented by general formula (I), or its prodrug, tautomer, stereoisomer, solvate, isotopic derivative, or pharmaceutically acceptable salt thereof or the pharmaceutical composition of the present invention; furthermore, the POLQ-mediated disease is cancer or cancer-related diseases; furthermore, for the use provided by the present invention, the cancer or tumor includes solid tumors and hematological tumors; the solid tumors include breast cancer, colorectal cancer, cervical cancer, ovarian cancer, prostate cancer, gastric cancer (including gastroesophageal junction cancer), esophageal cancer, head and neck cancer, lung cancer; the hematological tumors include lymphoma and leukemia.
[0120] The compound represented by general formula (I) of the present invention, or its prodrug, tautomer, stereoisomer, solvate, isotopic derivative, or pharmaceutically acceptable salt thereof can be administered in combination with one, two or more other anti-cancer agents or immune checkpoint modulators for treating cancer or tumors.
[0121] Furthermore, the other anti-cancer agents or immune checkpoint modulators for treating cancer or tumors include PARP inhibitors, ATR inhibitors, ATM inhibitors, WEE1 inhibitors, topoisomerase inhibitors, and DNA damage-based chemotherapeutic drugs.
[0122] Further, the DNA damage-based chemotherapeutic agents include cisplatin, bleomycin, gemcitabine, docetaxel; the topoisomerase inhibitors include etoposide and irinotecan.
[0123] The compound represented by the general formula (I) of the present invention, or its prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof can be used in combination with one, two or more other therapeutic means (such as radiotherapy) for treating cancer or tumor.
[0124] When the compound of the present invention, or its prodrug, tautomer, stereoisomer, solvate, isotope derivative or pharmaceutically acceptable salt thereof is administered in combination with another anticancer agent or immune checkpoint inhibitor for treating cancer or tumor, the compound of the present invention or its pharmaceutically acceptable salt can provide enhanced anticancer effects.
[0125] Definitions
[0126] The terms "optionally", "optionally", "optionally" or "optionally" mean that the subsequent described event or condition may but does not necessarily occur, and the description includes the cases where the described event or condition occurs and the cases where the described event or condition does not occur.
[0127] The term "oxo group" means that two hydrogen atoms at the same substitution position are replaced by the same oxygen atom to form a double bond, i.e., =O.
[0128] Unless otherwise specified, the term "alkyl" refers to a monovalent saturated aliphatic hydrocarbon group, including straight-chain or branched-chain groups containing 1-20 carbon atoms, preferably containing 1-10 carbon atoms (i.e., C 1-10 alkyl), more preferably containing 1-8 carbon atoms (C 1-8 alkyl), still more preferably containing 1-6 carbon atoms (i.e., C 1-6 alkyl). For example, "C 1-6 alkyl" means that the group is an alkyl group and the number of carbon atoms in the carbon chain is between 1 and 6 (specifically 1, 2, 3, 4, 5 or 6). Examples include but are not limited to methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, neopentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, n-heptyl, n-octyl, etc.
[0129] Unless otherwise specified, the term "alkenyl" refers to an unsaturated aliphatic hydrocarbon group composed of carbon atoms and hydrogen atoms, which is straight-chain or branched-chain and has at least one double bond. The alkenyl can contain 2-20 carbon atoms, preferably containing 2-10 carbon atoms (i.e., C 2-10 alkenyl), more preferably containing 2-8 carbon atoms (C2-8 alkenyl), more preferably containing 2 - 6 carbon atoms (i.e., C 2-6 alkenyl), 2 - 5 carbon atoms (i.e., C 2-5 alkenyl), 2 - 4 carbon atoms (i.e., C 2-4 alkenyl), 2 - 3 carbon atoms (i.e., C 2-3 alkenyl), 2 carbon atoms (i.e., C2 alkenyl), for example, "C 2-6 alkenyl" means that the group is an alkenyl and the number of carbon atoms in the carbon chain is between 2 and 6 (specifically 2, 3, 4, 5, or 6). Non-limiting examples of alkenyl include, but are not limited to, vinyl, 1-propenyl, 2-propenyl, 1-butenyl, isobutenyl, and 1,3-butadienyl, etc.
[0130] Unless otherwise specified, the term "alkynyl" refers to a straight-chain or branched-chain unsaturated aliphatic hydrocarbon group composed of carbon atoms and hydrogen atoms and having at least one triple bond. The alkynyl may contain 2 - 20 carbon atoms, preferably containing 2 - 10 carbon atoms (i.e., C 2-10 alkynyl), more preferably containing 2 - 8 carbon atoms (C 2-8 alkynyl), still more preferably containing 2 - 6 carbon atoms (i.e., C 2-6 alkynyl), 2 - 5 carbon atoms (i.e., C 2-5 alkynyl), 2 - 4 carbon atoms (i.e., C 2-4 alkynyl), 2 - 3 carbon atoms (i.e., C 2-3 alkynyl), 2 carbon atoms (i.e., C2 alkynyl), for example, "C 2-6 alkynyl" means that the group is an alkynyl and the number of carbon atoms in the carbon chain is between 2 and 6 (specifically 2, 3, 4, 5, or 6). Non-limiting examples of alkynyl include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, and 1-butynyl, etc.
[0131] Unless otherwise specified, the term "cycloalkyl" refers to a monocyclic saturated aliphatic hydrocarbon group having a specific number of carbon atoms, preferably containing 3 - 12 carbon atoms (i.e., C 3-12 cycloalkyl), more preferably containing 3 - 10 carbon atoms (C 3-10 cycloalkyl), still more preferably 3 - 6 carbon atoms (C 3-6 cycloalkyl), 4 - 6 carbon atoms (C 4-6 cycloalkyl), 5 - 6 carbon atoms (C 5-6 cycloalkyl). Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, methylcyclopropyl, 2-ethyl-cyclopentyl, dimethylcyclobutyl, etc.
[0132] Unless otherwise specified, the term "alkoxy" refers to -O-alkyl, where the alkyl is as defined above, i.e., containing 1 to 20 carbon atoms, preferably 1 to 10 carbon atoms, more preferably 1 to 8 carbon atoms, even more preferably 1 to 6 carbon atoms (specifically 1, 2, 3, 4, 5, or 6). Representative examples include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, butoxy, 1-methylpropoxy, 2-methylpropoxy, tert-butoxy, pentyloxy, 1-methylbutoxy, 2-methylbutoxy, 3-methylbutoxy, 1,1-dimethylpropoxy, 1,2-dimethylpropoxy, 2,2-dimethylpropoxy, 1-ethylpropoxy, etc.
[0133] Unless otherwise specified, the term "alkylthio" refers to replacing the oxygen in the above "alkoxy" with sulfur, i.e., -S-alkyl, where the alkyl is as defined above, i.e., containing 1 to 20 carbon atoms, preferably 1 to 10 carbon atoms, more preferably 1 to 8 carbon atoms, even more preferably 1 to 6 carbon atoms (specifically 1, 2, 3, 4, 5, or 6). Representative examples include, but are not limited to, methylthio, ethylthio, propylthio, isopropylthio, butylthio, 1-methylpropylthio, tert-butylthio, pentylthio, 1,1-dimethylpropylthio, 1,2-dimethylpropylthio, etc.
[0134] Unless otherwise specified, the term "halogen" or "halo" refers to F, Cl, Br, I. The term "haloalkyl" refers to one, two, or more hydrogen atoms or all hydrogen atoms in the alkyl as defined above being replaced by halogen. Representative examples of haloalkyl include CCl3, CF3, CHCl2, CH2Cl, CH2Br, CH2I, CH2CF3, CF2CF3, etc.
[0135] Unless otherwise specified, the term "heterocyclic group" refers to a saturated or partially unsaturated monocyclic, bicyclic or polycyclic cyclic hydrocarbon substituent, which is a non-aromatic structure, containing 3 to 20 ring atoms, wherein 1, 2, 3 or more ring atoms are selected from N, O or S, and the remaining ring atoms are C. Preferably, it contains 3 to 12 ring atoms, more preferably 3 to 10 ring atoms, or 3 to 8 ring atoms, or 3 to 6 ring atoms, or 4 to 6 ring atoms, or 5 to 6 ring atoms. The heteroatoms are preferably 1 to 4, more preferably 1 to 3 (i.e., 1, 2 or 3). Examples of monocyclic heterocyclic groups include pyrrolidinyl, imidazolidinyl, tetrahydrofuryl, dihydropyrrolyl, piperidinyl, piperazinyl, pyranyl, etc. Bicyclic or polycyclic heterocyclic groups include spiro, fused and bridged heterocyclic groups. The bicyclic or polycyclic "heterocyclic group" includes the case where one ring is an aromatic ring and the other rings are non-aromatic rings, including spiro, fused and bridged heterocyclic groups. The heterocyclic group can be a monocyclic (monocyclic heterocyclic group) ring system, or a fused (hetero-fused or fused-hetero ring group), bridged (hetero-bridged or bridged-hetero ring group) or spiro-connected (hetero-spiro or spiro-hetero ring group) ring system, such as a bicyclic system (bicyclic heterocyclic group), and can be saturated or partially unsaturated. The bicyclic heterocyclic group can contain one or more heteroatoms in one or two rings. In some embodiments, the heterocyclic group further includes a ring system in which the heterocyclic group as defined above is fused with one or more carbocyclic groups, wherein the attachment point is on the carbocyclic group or the heterocyclic group ring; or, in some embodiments, the heterocyclic group further includes a ring system in which the heterocyclic group as defined above is fused with one or more aryl / heteroaryl groups, wherein the attachment point is on the aryl / heteroaryl or heterocyclic group ring; or, in some embodiments, a ring system in which the heterocyclic group as defined above is fused with one or more heterocyclic groups as defined above, wherein the attachment point is on any heterocyclic group ring. In the above cases, the number of members of the heterocyclic group ring system is the number of ring atoms of the fused ring system. In some embodiments, the heterocyclic group is optionally substituted, for example, unsubstituted (unsubstituted heterocyclic group) or substituted with one or more substituents (substituted heterocyclic group). Exemplary 3-membered heterocyclic groups containing 1 heteroatom include (but are not limited to) aziridinyl, oxiranyl and thiorenyl. Exemplary 4-membered heterocyclic groups containing 1 heteroatom include (but are not limited to) azetidinyl, oxetanyl and thietanyl. Exemplary 5-membered heterocyclic groups containing 1 heteroatom include (but are not limited to) tetrahydrofuryl, dihydrofuryl, tetrahydrothienyl, dihydrothienyl, pyrrolidinyl, dihydropyrrolyl and 2,5-dioxopyrrolidinyl. Exemplary 5-membered heterocyclic groups containing 2 heteroatoms include (but are not limited to) dioxolanyl, oxathiolanyl, dithiolanyl and 2-oxooxazolidinyl. Exemplary 5-membered heterocyclic groups containing 3 heteroatoms include (but are not limited to) triazolinyl, oxadiazolinyl and thiadiazolinyl.Exemplary 6-membered heterocyclic groups containing one heteroatom include (but are not limited to) piperidinyl, tetrahydropyranyl, dihydropyridinyl, and tetrahydrothianyl. Exemplary 6-membered heterocyclic groups containing two heteroatoms include (but are not limited to) piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary 6-membered heterocyclic groups containing three heteroatoms include (but are not limited to) triazinanyl, oxadiazinanyl, thiadiazinanyl, oxathiazinanyl, and dioxazinanyl. Exemplary 7-membered heterocyclic groups containing one heteroatom include (but are not limited to) azepanyl, oxepanyl, and thiepanyl. Exemplary 8-membered heterocyclic groups containing one heteroatom include (but are not limited to) azocanyl, oxocanyl, and thioocanyl. Exemplary 5-membered heterocyclic groups fused to a C6 aryl ring (also referred to herein as 5,6-bicyclic heterocyclic groups) include (but are not limited to) dihydroindolyl, iso-dihydroindolyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinone, etc. Exemplary 6-membered heterocyclic groups fused to a C6 aryl ring (also referred to herein as 6,6-bicyclic heterocyclic groups) include (but are not limited to) tetrahydroquinolinyl, tetrahydroisoquinolinyl, etc.
[0136] Unless otherwise specified, the terms "fused ring group" and "fused ring" refer to an aromatic, non-aromatic, saturated or partially unsaturated ring system formed by two or more cyclic structures sharing two adjacent atoms with each other. Exemplary examples of "fused ring" include (but are not limited to) etc.
[0137] Unless otherwise specified, the terms "fused heterocyclic group" and "fused ring heterocyclic group" refer to a non-aromatic, saturated or partially unsaturated ring system formed by two or more cyclic structures sharing two adjacent atoms with each other, the ring atoms containing one or more heteroatoms independently selected from oxygen, nitrogen, and sulfur, and the number of heteroatoms being 1, 2, 3, or more. Exemplary examples of "fused ring heterocyclic group" include (but are not limited to) etc.
[0138] Unless otherwise specified, the terms "fused ring heteroaryl group", "fused ring heteroaryl", "fused heteroaryl ring group", and "fused heteroaryl" refer to an aromatic ring system formed by two or more cyclic structures sharing two adjacent atoms with each other, the ring atoms containing one or more heteroatoms independently selected from oxygen, nitrogen, and sulfur, and the number of heteroatoms being 1, 2, 3, or more. Exemplary examples of "fused ring heteroaryl" include (but are not limited to) etc.
[0139] Unless otherwise specified, the terms "spiro group" and "spiro" refer to a saturated, monovalent aliphatic hydrocarbon group containing only one spiro carbon atom, which may contain 6 - 14 ring carbon atoms, preferably 7 - 10 ring carbon atoms. Spiro groups include 3 - membered / 5 - membered, 4 - membered / 4 - membered, 4 - membered / 5 - membered, 4 - membered / 6 - membered, 5 - membered / 5 - membered, and 5 - membered / 6 - membered spiro groups, etc., where the spiro carbon atom is counted into the ring member count of each ring. Exemplary examples of spiro groups include (but are not limited to) etc.
[0140] Unless otherwise specified, the terms "heterospiro group" and "spiroheterocyclic group" refer to a saturated, monovalent aliphatic group containing only one spiro carbon atom, which may contain 6 - 14 ring atoms, preferably 7 - 10 ring atoms, and contains 1 - 4 ring heteroatoms, preferably 1 - 3 (i.e., 1, 2, or 3) ring heteroatoms, and the heteroatoms are independently selected from N, O, and S. Heterospiro groups include 3 - membered / 5 - membered, 4 - membered / 4 - membered, 4 - membered / 5 - membered, 4 - membered / 6 - membered, 5 - membered / 5 - membered, and 5 - membered / 6 - membered heterospiro groups, etc., where the spiro carbon atom is counted into the ring member count of each ring. Exemplary examples of heterospiro groups include (but are not limited to) etc.
[0141] Unless otherwise specified, the terms "bridged ring group" and "bridged ring" refer to a polycyclic, monovalent aliphatic hydrocarbon group in which any two rings share two non - directly - connected ring carbon atoms, which may contain 5 - 20 ring carbon atoms, preferably 6 - 14 ring carbon atoms, more preferably 7 - 10 ring carbon atoms, and may contain one or more double bonds, but no ring has a completely conjugated π - electron system. Bridged ring groups include bicyclic, tricyclic, tetracyclic, or polycyclic bridged ring groups, preferably bicyclic, tricyclic, or tetracyclic bridged ring groups, more preferably bicyclic or tricyclic bridged ring groups. Exemplary examples of bridged ring groups include (but are not limited to)
[0142] Unless otherwise specified, the terms "heterobridged ring group" and "bridged ring heterocyclic group" refer to a polycyclic, monovalent aliphatic group in which any two rings share two non - directly - connected ring atoms, which may contain 5 - 14 ring atoms, preferably 6 - 14 ring atoms, more preferably 7 - 10 ring atoms, and contains 1 - 4 ring heteroatoms, preferably 1 - 3 (i.e., 1, 2, or 3) ring heteroatoms, and the heteroatoms are independently selected from N, O, and S, and may contain one or more double bonds, but no ring has a completely conjugated π - electron system. Heterobridged ring groups include bicyclic, tricyclic, tetracyclic, or polycyclic heterobridged ring groups, preferably bicyclic, tricyclic, or tetracyclic heterobridged ring groups, more preferably bicyclic or tricyclic heterobridged ring groups. Exemplary examples of heterobridged ring groups include (but are not limited to)
[0143] Unless otherwise specified, "heterocycloalkyl" refers to a monocyclic, saturated "heterocyclic group" or "heterocycle" as defined above, with the ring atoms defined as above, i.e., containing 3 to 20 ring atoms ("3-20 membered heterocycloalkyl"), the number of heteroatoms being 1 to 4 (1, 2, 3, or 4), preferably 1 to 3 (1, 2, or 3), where the heteroatoms are each independently selected from N, O, or S. Preferably, it contains 3 to 12 ring atoms ("3-12 membered heterocycloalkyl"), more preferably 3 to 10 ring atoms ("3-10 membered heterocycloalkyl"), even more preferably 3 to 8 ring atoms ("3-8 membered heterocycloalkyl"), even more preferably 4 to 7 ring atoms ("4-7 membered heterocycloalkyl"), even more preferably 5 to 10 ring atoms ("5-10 membered heterocycloalkyl"), and even more preferably 5 to 6 ring atoms ("5-6 membered heterocycloalkyl"). In certain embodiments, each instance of heterocycloalkyl is independently optionally substituted, e.g., unsubstituted (an "unsubstituted heterocycloalkyl") or substituted by one or more substituents (a "substituted heterocycloalkyl"). Some exemplary "heterocycloalkyls" have been given in the "heterocyclic group" or "heterocycle" section above, and also include, but are not limited to, aziridinyl, oxiranyl, thiiranyl, azetidinyl, oxetanyl, thietanyl, tetrahydrofuryl, oxanyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, oxathianyl, oxazolidinyl, dioxolanyl, dithianyl, thiazolidinyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, etc.
[0144] Unless otherwise specified, the term "aryl" refers to a monocyclic, bicyclic, and tricyclic aromatic carbocyclic system containing 6 to 16 carbon atoms, or 6 to 14 carbon atoms, or 6 to 12 carbon atoms, or 6 to 10 carbon atoms, preferably 6 to 10 carbon atoms, and the term "aryl" can be used interchangeably with the term "aromatic ring". Examples of aryl groups can include, but are not limited to, phenyl, naphthyl, anthracenyl, phenanthrenyl, or pyrenyl, etc.
[0145] Unless otherwise specified, the term "heteroaryl" refers to an aromatic monocyclic, bicyclic or polycyclic ring system having a 5- to 16-membered structure, preferably a 5- to 14-membered structure, a 5- to 12-membered structure, a 5- to 10-membered structure, a 5- to 8-membered structure, more preferably a 5- to 6-membered structure, in which one, two, three or more ring atoms are heteroatoms and the remaining atoms are carbon, and the heteroatoms are independently selected from O, N or S, and the number of heteroatoms is preferably one, two or three. Bicyclic or polycyclic heterocyclic groups include fused ring heteroaryls. Examples of heteroaryls include, but are not limited to, furyl, thienyl, oxazolyl, thiazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, pyrrolyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, thiodiazolyl, triazinyl, phthalazinyl, quinolinyl, isoquinolinyl, pteridinyl, purinyl, indolyl, isoindolyl, indazolyl, benzofuryl, benzothienyl, benzopyridyl, benzopyrimidinyl, benzopyrazinyl, benzimidazolyl, benzophthalazinyl, pyrrolo[2,3-b]pyridyl, imidazo[1,2-a]pyridyl, pyrazolo[1,5-a]pyridyl, pyrazolo[1,5-a]pyrimidinyl, imidazo[1,2-b]pyridazinyl, [1,2,4]triazolo[4,3-b]pyridazinyl, [1,2,4]triazolo[1,5-a]pyrimidinyl, [1,2,4]triazolo[1,5-a]pyridyl, etc.
[0146] Unless otherwise specified, the term "pharmaceutically acceptable salt" or "medicinal salt" refers to a salt that is suitable for contact with mammalian tissues, especially human tissues, within the scope of reasonable medical judgment, without excessive toxicity, irritation, allergic reaction, etc., and is commensurate with a reasonable benefit / risk ratio. Medicinally acceptable salts of amines, carboxylic acids and other types of compounds are well-known in the art. The salts can be prepared in situ during the final isolation and purification of the compounds of the present invention, or separately by reacting the free base or free acid with a suitable reagent.
[0147] Unless otherwise specified, the term "isotope derivative" means that the compounds of the present invention can exist in isotopically labeled or enriched forms, containing one or more atoms whose atomic weight or mass number is different from that of the atoms found in the largest amount in nature. Isotopes can be radioactive or non-radioactive isotopes. Isotopes commonly used for isotope labeling are: hydrogen isotopes, 2 H and 3 H; carbon isotopes: 13 C and 14 C; chlorine isotopes: 35 Cl and 37 Cl; fluorine isotope: 18 F; iodine isotopes: 123 I and 125 I; nitrogen isotopes: 13 N and15 N; oxygen isotope: 15 O, 17 O and 18 O and sulfur isotopes 35 S. These isotope-labeled compounds can be used to study the distribution of drug molecules in tissues. 3 H and 13 C, because they are easy to label and detect, they are more widely used. Some heavy isotopes, such as deuterium ( 2 H) substitution can enhance metabolic stability and prolong half-life, thereby achieving the purpose of reducing dosage and providing therapeutic advantages. Isotope-labeled compounds generally start from labeled starting materials and use known synthesis techniques to complete their synthesis like non-isotope-labeled compounds.
[0148] Unless otherwise specified, the terms "solvate" and "solvate" mean a physical association of a compound of the invention with one or more solvent molecules, whether organic or inorganic. The physical association includes hydrogen bonding. In certain cases, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid, the solvate will be able to be separated. The solvent molecules in the solvate may exist in a regular arrangement and / or a disordered arrangement. The solvate may contain stoichiometric or non-stoichiometric amounts of solvent molecules. "Solvate" encompasses solution phases and separable solvates. Exemplary solvates include, but are not limited to, hydrates, ethanolates, methanolates, and isopropanolates. Solvation methods are well known in the art.
[0149] Unless otherwise specified, the term "stereoisomer" refers to compounds with the same chemical constitution but different arrangements of atoms or groups in space. Stereoisomers include enantiomers, diastereomers, conformers (rotamers), geometric isomers (cis / trans) isomers, atropisomers, etc. Any resulting mixture of stereoisomers can be separated into pure or substantially pure geometric isomers, enantiomers, diastereomers, for example, by chromatography and / or fractional crystallization based on the differences in the physical and chemical properties of the components.
[0150] Unless otherwise specified, the term "tautomer" refers to structural isomers with different energies that can be interconverted through a low energy barrier. If tautomerism is possible (such as in solution), a chemical equilibrium of tautomers can be achieved. For example, proton tautomers (also known as prototropic tautomers) include interconversions by proton migration, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers include interconversions by reorganization of some of the bonding electrons.
[0151] Unless otherwise indicated, the structural formulas described in this invention include all isomeric forms (such as enantiomers, diastereomers, and geometric isomers (or conformational isomers)): for example, the R and S configurations containing asymmetric centers, the (Z) and (E) isomers of double bonds, and the (Z) and (E) conformational isomers. Thus, single stereochemical isomers of the compounds of this invention or mixtures of their enantiomers, diastereomers, or geometric isomers (or conformational isomers) are all within the scope of this invention.
[0152] Unless otherwise specified, the term "prodrug" refers to a drug that is converted into the parent drug in vivo. Prodrugs are usually useful as they can improve certain undesirable physical or biological properties. Physical properties are generally related to solubility (excessive or insufficient lipid or water solubility) or stability, while problematic biological characteristics include too rapid metabolism or poor bioavailability, which may itself be related to physicochemical properties. For example, they can be bioavailable by oral administration while the parent cannot. The solubility of prodrugs in pharmaceutical compositions is also increased compared to the parent drug. An example of a prodrug, but not limited to this, can be any compound of this invention that is administered as an ester ("prodrug") to facilitate transport across cell membranes, where water solubility is detrimental to mobility but beneficial once inside the cell, and is subsequently metabolically hydrolyzed to the carboxylic acid, i.e., the active entity. Another example of a prodrug can be a short peptide (polyamino acid) conjugated to an acid group, where the peptide is metabolized to reveal the active moiety.
[0153] Unless otherwise specified, the term "optionally substituted" means that the hydrogen at the substitutable site of the group is either unsubstituted or substituted by one or more substituents, which are preferably selected from the following groups of substituents: halogen, hydroxyl, mercapto, cyano, nitro, amino, azido, oxo, carboxyl, C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 alkyl, C 1-6 alkoxy, C 3-10 cycloalkyl, C 3-10 cycloalkylsulfonyl, 3-10 membered heterocycloalkyl, C 6-14 aryl or 5-10 membered heteroaryl, wherein the C 2-6 alkenyl, C 2-6 alkynyl, C 1-6 alkyl, C 1-6 alkoxy, C 3-10 cycloalkyl, C 3-10 cycloalkylsulfonyl, 3-10 membered heterocycloalkyl, C 6-14 aryl or 5-10 membered heteroaryl may optionally be substituted with a substituent selected from halogen, hydroxyl, amino, cyano, C 1-6 alkyl or C 1-6substituted by one or more of alkoxy groups, and the oxo group means that two Hs at the same substitution position are replaced by the same O to form a double bond.
[0154] Unless otherwise specified, the term "treatment" encompasses any treatment of a patient's disease, disorder, and condition, including: (a) inhibiting the symptoms of the disease, disorder, and condition, i.e., preventing its progression; or (b) alleviating the symptoms of the disease, disorder, and condition, i.e., causing the disease or symptoms to subside; or (c) improving or eliminating the disease, disorder, and condition or one or more symptoms associated with the disease.
[0155] The beneficial effects of the present invention are as follows:
[0156] The present invention designs a class of compounds with novel structures, providing a new direction for the development of POLQ inhibitor drugs. In vitro enzyme activity inhibition studies show that the compounds of the present invention have strong inhibitory effects on POLQ enzyme and can be used as promising compounds for treating POLQ-mediated diseases. hERG tests indicate that the compounds of the present invention have no obvious inhibitory effect on hERG channels and have low cardiotoxicity. In addition, the present invention has studied a specific synthesis method, which has simple process, convenient operation, and is conducive to large-scale industrial production and application.
[0157] The abbreviations used in the preparation examples, examples and elsewhere in this article are:
[0158] DPPA Diphenylphosphoryl azide
[0159] TEA Triethylamine
[0160] DCM Dichloromethane
[0161] TFA Trifluoroacetic acid
[0162] XPhos 2-Dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl
[0163] DMF N,N'-Dimethylformamide
[0164] B2Pin2 Bis(pinacolato)diboron
[0165] Pd(dppf)Cl2 Dichlorobis(diphenylphosphino)ferrocene palladium(II)
[0166] Dioxane 1,4-Dioxane
[0167] MsCl Methanesulfonyl chloride
[0168] Boc2O Di-tert-butyl dicarbonate
[0169] DCE 1,2-Dichloroethane
[0170] THF Tetrahydrofuran
[0171] TBDPSCl tert-Butyldiphenylchlorosilane
[0172] DMP Dimethyl phthalate
[0173] TBAF Tetrabutylammonium fluoride
[0174] DMSO Dimethyl sulfoxide
[0175] NBS N-Bromosuccinimide
[0176] Tert-Butyl nitrite
[0177] DMAP N,N-Dimethylpyridin-4-amine
[0178] EDCl 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride
[0179] LAH Lithium aluminum hydride Detailed implementation manners
[0180] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to professionals in the field. In addition, any methods and materials similar or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials shown in the text are only for demonstration purposes.
[0181] The structure of the compound of the present invention is determined by nuclear magnetic resonance (NMR) or / and liquid chromatography-mass spectrometry (LC-MS) or / and high performance liquid chromatography (HPLC). The instrument used for NMR measurement is Wuhan Zhongke Niujin Magnetic Resonance Tecnology Co., Ltd Quantum-I, 400 MHz; the instrument used for LC-MS is Agilent, 1290 InfinityⅡ; the instrument used for HPLC is Thermo, ultimate 3000.
[0182] Preparation of HPLC Condition 1 (Ammonium bicarbonate as additive): Instrument: SHIMADZU; Pump: LC-20AP; Detector: SPD-20A; Wavelength: 214 nm & 254 nm; Column model: Ultimate XB-C18, 50 * 250 mm, 10 um (PARP-05); Mobile phase: A: 10 mM ammonium bicarbonate, B: Acetonitrile; Run time: 30 min; Flow rate: 70 mL / min.
[0183] Preparation of HPLC Condition 2 (Formic acid as additive): Instrument: SHIMADZU; Pump: LC-20AP; Detector: SPD-20A; Wavelength: 214 nm & 254 nm; Column model: Ultimate XB-C18, 50 * 250 mm, 10 um (PARP-05); Mobile phase: A: 0.1% formic acid, B: Acetonitrile; Run time: 30 min; Flow rate: 70 mL / min.
[0184] The starting materials in the examples of the present invention are known and commercially available, or can be synthesized by methods known in the art or according to such methods.
[0185] Preparation of intermediates:
[0186] Preparation of Intermediate A: 1-(6-chloropyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea
[0187]
[0188] First step: Dissolve 6-methylpyridine-3-carboxylic acid (10.00 g, 72.9 mmol, 1.0 eq) in dichloromethane (500 mL), successively add triethylamine (22.08 g, 218.7 mmol, 3.0 eq) and diphenyl phosphorazidate (26.60 g, 109.4 mmol, 1.5 eq), react overnight at room temperature, dilute with ethyl acetate (200 mL), wash the organic phase with saturated ammonium chloride aqueous solution (60 mL x 3), dry over anhydrous sodium sulfate, and concentrate under reduced pressure. The residue is separated by flash silica gel column chromatography (PE:EA = 4:1 to 1:1) to obtain Compound A1 (9.78 g, Yield: 100%). MS (ESI): m / z 135.1 (M+H) + .
[0189] Step 2: Dissolve compound A1 (5.00 g, 37.27 mmol, 1.0 eq), 6-chloropyrazin-2-amine (5.30 g, 41.00 mmol, 1.1 eq) in toluene (200 mL), displace argon, heat the reaction solution to 110 °C and stir for 6 hours. Cool the reaction solution to room temperature, concentrate under reduced pressure to remove toluene, wash with ethyl acetate, filter, and dry to obtain intermediate A 1-(6-chloropyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (6.23 g, yield: 63.4%). MS (ESI): m / z 264.0 (M+H) + .
[0190] Intermediate B: Preparation of 6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-amine
[0191]
[0192] Step 1: Dissolve 4-bromo-2-methylphenol (1.00 g, 5.35 mmol, 1.0 eq) in N,N'-dimethylformamide (20 mL), slowly add sodium hydride (235 mg, 9.63 mmol, 60% purity, 1.0 eq) at 0 °C, stir for 10 minutes, then add 3-(chloromethyl)-3-methyloxetane (709 mg, 5.89 mmol, 1.1 eq), and heat to 100 °C and stir overnight. Cool the reaction solution to room temperature, quench with ice water (50 mL), extract the aqueous phase with ethyl acetate, dry over sodium sulfate, filter, and concentrate under reduced pressure. The residue is separated by flash silica gel column chromatography (PE 100% - PE:EA = 4:1) to obtain compound B1 (1.45 g, yield: 100%). MS (ESI): m / z 271.1 (M+H) + .
[0193] Step 2: Add compound B1 (2.20 g, 8.11 mmol, 1.0 eq), bis(pinacolato)diboron (3.09 g, 12.2 mmol, 1.5 eq), potassium acetate (2.39 g, 24.3 mmol, 3.0 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (290 mg, 0.4 mmol, 0.05 eq) to dioxane (40 mL), heat to 100 °C under argon protection and stir for 16 hours. Concentrate the reaction solution under reduced pressure, and the residue is separated by flash silica gel column chromatography (PE 100% - PE:EA = 10:1) to obtain compound B2 (2.58 g, yield: 100.0%). MS (ESI): m / z 319.2 (M+H) + .
[0194] Step 3: Compound B2 (4.69 g, 14.77 mmol, 1.0 eq), 6-chloropyrazin-2-amine (1.91 g, 14.77 mmol, 1.0 eq), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (1.08 g, 1.48 mmol, 0.1 eq) and anhydrous sodium carbonate (3.13 g, 29.54 mmol, 2.0 eq) were successively added to a mixed solution of dioxane / water (200 mL / 50 mL). After purging with argon three times, the temperature was raised to 90 °C and stirred for 6 hours. After the reaction solution was cooled to room temperature, water (30 mL) was added. The aqueous phase was extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated by flash silica gel column chromatography (PE:EA = 4:1 to 1:1) to obtain intermediate B 6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-amine (2.80 g, yield: 66.6%). MS (ESI): m / z 286.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 8.22 (s, 1H), 7.86–7.74 (m, 3H), 7.05 (d, J = 9.2 Hz, 1H), 6.42 (s, 2H), 4.54 (d, J = 6.0 Hz, 2H), 4.33 (d, J = 5.6 Hz, 2H), 4.08 (s, 2H), 2.22 (s, 3H), 1.39 (s, 3H).
[0195] Intermediate C: Preparation of 6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazine-2-carboxylic acid
[0196]
[0197] 6-Chloropyrazine-2-carboxylic acid (249 mg, 1.57 mmol, 1 eq), compound B2 (500 mg, 1.57 mmol, 1 eq), sodium carbonate (332 mg, 3.14 mmol, 2 eq), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (57 mg, 0.079 mmol, 0.05 eq) were added to a mixed solution of dioxane (10 mL) and water (1 mL). After purging with nitrogen, the reaction solution was heated to 100 °C and stirred for 16 hours. After the reaction solution was cooled to room temperature, it was concentrated under reduced pressure. The residue was separated by flash silica gel column chromatography (DCM:MeOH = 1:1) to obtain intermediate C 6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazine-2-carboxylic acid (200 mg, yield: 40.8%). MS (ESI): m / z 315.1 (M+H) + .
[0198] Example 1
[0199] Synthesis of 1-(6-(1-((3-methyl-oxetan-3-yl)methyl)-1H-indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0200]
[0201] First step: 5-Bromo-1H-indole (534 mg, 2.72 mmol, 1 eq) was dissolved in N,N-dimethylformamide (20 mL), cooled to 0 °C in an ice-water bath, and sodium hydride (131 mg, 3.27 mmol, 60% purity, 1.2 eq) was added. After reacting for 30 minutes in an ice bath, 3-(chloromethyl)-3-methyloxetane (361 mg, 3.00 mmol, 1.1 eq) was added. After addition, the reaction solution was heated to 90 °C and stirred for 18 hours. The reaction solution was poured into 100 mL of ice water, extracted with ethyl acetate, and the organic phases were combined. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated by flash silica gel column chromatography (PE:EA = 10:1 - 5:1) to obtain compound 1a (570 mg, yield: 74.5%). MS(ESI): m / z 280.0 (M+H) + .
[0202] Second step: Compound 1a (310 mg, 1.11 mmol, 1 eq), potassium acetate (327 mg, 3.33 mmol, 3 eq), bis(pinacolato)diboron (423 mg, 1.67 mmol, 1.5 eq), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (40 mg, 0.055 mmol, 0.05 eq) were successively added to dioxane (10 mL). After purging with argon three times, the mixture was heated to 100 °C and reacted overnight. The reaction solution was concentrated, and the residue was separated by flash silica gel column chromatography (PE:EA = 3:1) to obtain compound 1b (355 mg, yield: 97.3%). MS(ESI): m / z 328.2 (M+H) + .
[0203] Step 3: Intermediate A (285 mg, 1.08 mmol, 1 eq), Compound 1b (354 mg, 1.08 mmol, 1 eq), and potassium carbonate (299 mg, 2.16 mmol, 2 eq) were successively added to a mixed solution of dioxane (5 mL) and water (0.5 mL). [1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium (35 mg, 0.11 mmol, 0.1 eq) was added. After replacing the gas with argon three times, the temperature was raised to 100 °C and the reaction was carried out for 18 hours. The reaction solution was cooled to room temperature, diluted with ethyl acetate (20 mL), washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was heated under reflux in 3 mL of ethanol for 30 minutes, slowly cooled to room temperature, filtered, and dried to obtain the title compound 1 1-(6-(1-((3-Methyloxetan-3-yl)methyl)-1H-indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (55 mg, yield: 11.9%). MS (ESI): m / z 429.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.96 (s, 1H), 9.77 (s, 1H), 8.87 (s, 1H), 8.85 (s, 1H), 8.53 (d, J = 2.4 Hz, 1H), 8.34 (s, 1H), 7.94–7.89 (m, 2H), 7.73 (d, J = 8.4 Hz, 1H), 7.51 (d, J = 3.2 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 6.62 (d, J = 3.2 Hz, 1H), 4.62 (d, J = 6.0 Hz, 2H), 4.46 (s, 2H), 4.23 (d, J = 5.6 Hz, 2H), 2.43 (s, 3H), 1.21 (s, 3H).
[0204] Example 2
[0205] Synthesis of 1-(6-(1-((3-Methyloxetan-3-yl)methyl)-1H-indazol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0206]
[0207] Step 1: Dissolve 3-methyl-3-oxetanemethanol (4 g, 39.17 mmol, 1 eq) and triethylamine (5.95 g, 58.76 mmol, 1.5 eq) in dichloromethane (50 mL). Slowly add methanesulfonyl chloride (4.71 g, 41.13 mmol, 1.05 eq) dropwise at 0 °C. After the addition, react at 25 °C for 2 hours. Rotate the reaction solution to dryness and pump it dry with an oil pump to obtain compound 2a (5.6 g, 31.07 mmol, 79.3%). 1 HNMR (400 MHz, CDCl3) δ 4.52 (d, J = 6.4 Hz, 2H), 4.43 (d, J = 6.4 Hz, 2H), 4.32 (s, 2H), 3.08 (s, 3H), 1.40 (s, 3H).
[0208] Step 2: Dissolve 5-bromoindazole (1 g, 5.08 mmol, 1 eq), compound 2a (1.01 g, 5.58 mmol, 1.1 eq) and potassium carbonate (2.1 g, 15.23 mmol, 3 eq) in N,N-dimethylformamide (20 mL). Heat the reaction solution to 50 °C and react for 16 hours. Dilute the reaction solution with water (100 mL). Extract the aqueous phase with ethyl acetate. Combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter, and concentrate. Separate the residue by column chromatography (PE:EA = 10:1) to obtain compound 2b (840 mg, 2.99 mmol, 58.8%). MS (ESI): m / z 281.0 (M+H) + . 1 HNMR (400 MHz, CDCl3) δ 7.86 (s, 1H), 7.78 (d, J = 1.2 Hz, 1H), 7.78 (d, J = 1.2 Hz, 1H), 7.37 (dd, J = 8.8, 1.6 Hz, 1H), 7.20 (d, J = 8.8 Hz, 1H), 4.70 (d, J = 6.0 Hz, 2H), 4.45 (s, 2H), 4.34 (d, J = 6.0 Hz, 2H), 1.15 (s, 3H).
[0209] Step 3: Dissolve compound 2b (100 mg, 0.35 mmol, 1 eq) in dioxane (5 mL), and successively add potassium acetate (70 mg, 0.71 mmol, 2 eq), bis(pinacolato)diboron (180 mg, 0.71 mmol, 2 eq), and dichlorobis[1,1'-bis(diphenylphosphino)ferrocene]palladium(II) (13 mg, 0.018 mmol, 0.05 eq). Replace nitrogen, heat the reaction solution to 90 °C and stir for 16 h. Concentrate the reaction solution under reduced pressure, and separate the residue by flash silica gel column chromatography (PE:EA = 5:1) to obtain compound 2c (116 mg, yield: 100%). MS (ESI): m / z 329.2 (M+H) + .
[0210] Step 4: Add compound 2c (120 mg, 0.37 mmol, 0.8 eq), intermediate A (120 mg, 0.46 mmol, 1 eq), dichlorobis[1,1'-bis(diphenylphosphino)ferrocene]palladium(II) (16 mg, 0.02 mmol, 0.05 eq), and sodium carbonate (97 mg, 0.91 mmol, 2 eq) successively to a mixed solvent of dioxane (5 mL) and water (0.5 mL). Replace nitrogen, heat the reaction solution to 100 °C and stir for 16 h. Concentrate the reaction solution under reduced pressure, and separate the residue by flash silica gel column chromatography (DCM:MeOH = 10:1) to obtain the title compound 2 1-(6-(1-((3-methyl oxetan-3-yl)methyl)-1H-indazol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (52 mg, yield: 32.4%). MS (ESI): m / z 430.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.76–9.75 (m, 2H), 8.95 (s, 1H), 8.92 (s, 1H), 8.54–8.52 (m, 2H), 8.26 (d, J = 0.8 Hz, 1H), 8.15 (dd, J = 8.8, 1.6 Hz, 1H), 7.92–7.89 (m, 2H), 7.24 (d, J = 8.4 Hz, 1H), 4.71–4.70 (m, 4H), 4.28 (d, J = 6.0 Hz, 2H), 2.43 (s, 3H), 1.15 (s, 3H).
[0211] Example 3
[0212] Synthesis of 1-(6-(1-((3-methyl oxetan-3-yl)methyl)-1,2,3,4-tetrahydroquinolin-6-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0213]
[0214] Step 1: 6-Bromo-1,2,3,4-tetrahydroquinoline (1.00 g, 4.71 mmol, 1 eq) was dissolved in N,N'-dimethylformamide (10 mL). Sodium hydride (302 mg, 7.54 mmol, 60% purity, 1.6 eq) was added to the above solution. After stirring at room temperature for 30 minutes, 3-(chloromethyl)-3-methyloxetane (852 mg, 7.07 mmol, 1.5 eq) was added, and the mixture was stirred overnight at room temperature. The reaction was quenched by slowly adding 25 mL of ice water. The mixture was extracted with ethyl acetate, washed once with brine (15 mL) and once with water (15 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain compound 3a (1.39 g, yield: 99.6%). MS (ESI): m / z 296.0 (M+H) + .
[0215] Step 2: Compound 3a (1.38 g, 4.66 mmol, 1 eq), bis(pinacolato)diboron (1.77 g, 6.99 mmol, 1.5 eq), 1,1'-bis(diphenylphosphino)ferrocene dichloropalladium (205 mg, 0.28 mmol, 0.06 eq), and potassium acetate (1.37 g, 13.98 mmol, 3 eq) were successively added to anhydrous dioxane (25 mL). The reaction mixture was purged with argon three times, and the reaction solution was heated to 80 °C and stirred overnight. The reaction solution was directly concentrated under reduced pressure, and the residue was separated by flash silica gel column chromatography (PE:EA = 6:1) to obtain compound 3b (950 mg, yield: 59.4%). MS (ESI): m / z 344.2 (M+H) + .
[0216] Step 3: Compound 3b (200 mg, 0.58 mmol, 1 eq), intermediate A (184.35 mg, 0.7 mmol, 1.2 eq), potassium carbonate (161.05 mg, 1.17 mmol, 2 eq) and dichloropalladium [1,1'-bis(diphenylphosphino)ferrocene] (42 mg, 0.058 mmol, 0.1 eq) were successively added to a mixed solution of dioxane (5 mL) and water (1 mL), and the mixture was heated to 90 °C and stirred overnight under an argon atmosphere. After the reaction solution was cooled, water (5 mL) was added, and the aqueous phase was extracted with dichloromethane. The organic phase was concentrated under reduced pressure. The residue was separated by flash silica gel column chromatography (DCM:MeOH = 10:1) to obtain the crude product (150 mg), which was then purified by reverse preparative chromatography pre-HPLC (0.01% FA in water, MeCN) to obtain compound 3 1-(6-(1-((3-methyl oxetane-3-yl)methyl)-1,2,3,4-tetrahydroquinolin-6-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (106.19 mg, yield: 40.7%). MS (ESI): m / z 445.3 (M+H) + . 1 HNMR (400 MHz, DMSO-d6) δ 9.95 (s, 1H), 9.64 (s, 1H), 8.67 (s, 1H), 8.66 (s, 1H), 8.49 (d, J = 2.4 Hz, 1H), 7.88 (dd, J = 8.4, 2.8 Hz, 1H), 7.74–7.62 (m, 2H), 7.20 (d, J = 8.4 Hz, 1H), 6.70 (d, J = 8.8 Hz, 1H), 4.53 (d, J = 5.6 Hz, 2H), 4.18 (d, J = 6.0 Hz, 2H), 3.50 (s, 2H), 3.28–3.21 (m, 2H), 2.77 (t, J = 6.2 Hz, 2H), 2.40 (s, 3H), 1.90–1.85 (m, 2H), 1.29 (s, 3H).
[0217] Example 4
[0218] Synthesis of 1-(6-(1-((3-methyl oxetane-3-yl)methyl)indolin-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0219]
[0220] Step 1: Dissolve 5-bromo-2,3-dihydro-1H-indole (1.00 g, 5.05 mmol, 1.0 eq) in dichloromethane (10 mL), successively add 3-methyl-3-formyl-1-oxetane (606 mg, 6.05 mmol, 1.2 eq) and acetic acid (1 mL). After the reaction mixture is stirred at room temperature for 30 minutes, add sodium triacetoxyborohydride (2.14 g, 10.10 mmol, 2.0 eq), and continue to stir at room temperature overnight. The reaction mixture is washed with saturated sodium bicarbonate solution (20 mL) and saturated sodium chloride solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue is separated by flash silica gel column chromatography (PE:DCM = 3:1 - 1:1) to obtain compound 4a (531 mg, yield: 37.3%). MS(ESI): m / z 282.0 (M+H) + .
[0221] Step 2: Add compound 4a (480 mg, 1.71 mmol, 1.0 eq), bis(pinacolato)diboron (651 mg, 2.56 mmol, 1.5 eq), potassium acetate (419 mg, 4.27 mmol, 2.5 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (125 mg, 0.17 mmol, 0.1 eq) to dioxane (4 mL) successively. Heat the mixture to 100 °C and stir for 3 hours under an argon atmosphere. After the reaction mixture is cooled to room temperature, it is filtered through diatomaceous earth and concentrated under reduced pressure. The residue is separated by preparative thin layer chromatography (PE:EA = 4:1) to obtain compound 4b (263 mg, yield: 47%). MS(ESI): m / z 330.2 (M+H) + .
[0222] Step 3: Add compound 4b (213 mg, 0.65 mmol, 1.0 eq), intermediate A (188 mg, 0.71 mmol, 1.1 eq), sodium carbonate (137 mg, 1.29 mmol, 2.0 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (47 mg, 0.06 mmol, 0.1 eq) to a mixed solution of dioxane / water (5 mL, 4 / 1) successively. Replace the atmosphere with argon three times, heat to 90 °C and stir for 3 hours. Dilute with ethyl acetate (20 mL), filter through diatomaceous earth, and concentrate the filtrate under reduced pressure. Wash with ethyl acetate (15 mL) and dry to obtain compound 4 1-(6-(1-((3-methyloxetan-3-yl)methyl)dihydroindol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (32.71 mg, yield: 11.7%). MS(ESI): m / z 431.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 10.36 (s, 1H), 9.83 (s, 1H), 8.81 (d, J = 1.6 Hz, 1H), 8.69 (s, 1H), 8.54 (d, J = 2.8 Hz, 1H), 7.89 (dd, J = 8.4, 2.8 Hz, 1H), 7.81–7.78 (m, 2H), 7.22 (d, J = 8.4 Hz, 1H), 6.62 (d, J = 9.2 Hz, 1H), 4.49 (d, J = 6.0 Hz, 2H), 4.28 (d, J = 5.6 Hz, 2H), 3.45 (t, J = 8.8 Hz, 2H), 3.36 (s, 2H), 3.04 (t, J = 8.4 Hz, 2H), 2.42 (s, 3H), 1.34 (s, 3H).
[0223] Examples 5 and 6
[0224] Synthesis of 1-(6-(1-((3-Methyloxetan-3-yl)methyl)-1H-benzo[d]imidazol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (Compound 5):
[0225] Synthesis of 1-(6-(1-((3-Methyloxetan-3-yl)methyl)-1H-benzo[d]imidazol-6-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea (Compound 6):
[0226]
[0227] The synthetic methods of Compound 5 and Compound 6 are the same as that of Example 1. In the first step, 5-bromo-1H-benzimidazole was used instead of 5-bromo-1H-indole. Two isomers were obtained in the first step reaction, and the title compounds 5 and 6 were purified by reverse preparative chromatography pre-HPLC (0.01% FA in water, MeCN) in the last step.
[0228] Compound 5: MS (ESI): m / z 430.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 9.85 (s, 1H), 9.77 (s, 1H), 8.93 (d, J = 0.4 Hz, 1H), 8.92 (s, 1H), 8.55–8.51 (m, 1H), 8.42 (d, J = 1.6 Hz, 2H), 8.04 (dd, J = 8.4, 1.6 Hz, 1H), 7.92 (dd, J = 8.4, 2.4 Hz, 1H), 7.89–7.83 (m, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.61 (d, J = 6.0 Hz, 2H), 4.55 (s, 2H), 4.26 (d, J = 6.0 Hz, 2H), 2.43 (s, 3H), 1.25 (s, 3H).
[0229] Compound 6: MS (ESI): m / z 430.2 (M+H) + . 1 1H NMR (400 MHz, DMSO-d6) δ 9.77 (s, 1H), 9.72 (s, 1H), 8.97 (s, 1H), 8.95 (s, 1H), 8.54 (d, J = 2.4 Hz, 1H), 8.44 (s, 2H), 7.98 (dd, J = 8.4, 1.6 Hz, 1H), 7.90 (dd, J = 8.4, 2.4 Hz, 1H), 7.82 (d, J = 8.4 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.62 (d, J = 6.0 Hz, 2H), 4.58 (s, 2H), 4.27 (d, J = 6.0 Hz, 2H), 2.43 (s, 3H), 1.25 (s, 3H).
[0230] Example 7
[0231] Synthesis of 1-(6-(1-((3-methyloxetan-3-yl)methyl)-2-oxo-1,2,3,4-tetrahydroquinolin-6-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0232]
[0233] The synthesis method of Compound 7 is the same as that of Example 1, and 6-bromo-1,2,3,4-tetrahydro-2-quinolinone is used instead of 5-bromo-1H-indole in the first step. Compound 7: MS (ESI): m / z 459.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 9.72 (s, 2H), 8.93 (s, 1H), 8.84 (s, 1H), 8.52 (s, 1H), 8.01–7.87 (m, 3H), 7.40 (d, J = 8.4 Hz, 1H), 7.22 (d, J = 8.4 Hz, 1H), 4.53 (d, J = 5.6 Hz, 2H), 4.16 (s, 2H), 4.06 (d, J = 5.6 Hz, 2H), 3.02–2.92 (m, 2H), 2.71–2.60 (m, 2H), 2.43 (s, 3H), 1.27 (s, 3H).
[0234] Example 8
[0235] Synthesis of 1-(6-(1-((3-methyloxetan-3-yl)methyl)-2-oxo-1,2-dihydroquinolin-6-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0236]
[0237] The synthesis method of compound 8 is the same as that of Example 1, and 6-bromoquinolin-2-one is used instead of 5-bromo-1H-indole in the first step. Compound 8: MS (ESI): m / z 457.3 (M + H) + . 1 1H NMR (400 MHz, DMSO-d6) δ 9.76 (s, 1H), 9.67 (s, 1H), 9.02 (s, 1H), 8.94 (s, 1H), 8.53 (d, J = 2.8 Hz, 1H), 8.50 (d, J = 2.0 Hz, 1H), 8.28 (dd, J = 8.8, 2.0 Hz, 1H), 8.06 (d, J = 9.6 Hz, 1H), 7.90 (dd, J = 8.4, 2.4 Hz, 1H), 7.75 (d, J = 9.2 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 6.76 (d, J = 9.6 Hz, 1H), 4.57 (d, J = 6.4 Hz, 2H), 4.40 (s, 2H), 4.09 (d, J = 6.0 Hz, 2H), 2.43 (s, 3H), 1.38 (s, 3H).
[0238] Example 9
[0239] Synthesis of 1-(6-methylpyridin-3-yl)-3-(6-(2-(tetrahydrofuran-3-yl)-1,2,3,4-tetrahydroisoquinolin-6-yl)pyrazin-2-yl)urea:
[0240]
[0241] Step 1: 6-Bromo-1,2,3,4-tetrahydroisoquinoline (400 mg, 1.89 mmol, 1 eq), dihydro-3(2H)-furanone (195 mg, 2.27 mmol, 1.2 eq), zinc chloride (26 mg, 0.189 mmol, 0.1 eq) were added to methanol (15 mL), and then sodium cyanoborohydride (226 mg, 3.78 mmol, 2 eq) was added at room temperature. Stir at room temperature for 1 hour. Pour the reaction solution into saturated sodium bicarbonate solution (100 mL), extract the aqueous phase with ethyl acetate, combine the organic phases, dry over sodium sulfate, and concentrate. The residue was separated by flash silica gel column chromatography (PE / EA = 3 / 1) to obtain compound 9a (570 mg, yield: 106.9%). MS (ESI): m / z 282.1 (M+H) + . 1 H NMR (400 MHz, CDCl3) δ 7.26–7.19 (m, 2H), 6.89 (d, J = 7.9 Hz, 1H), 4.05–3.94 (m, 2H), 3.83 (dd, J = 16.0, 8.1 Hz, 1H), 3.73 (dd, J = 8.6, 6.8 Hz, 1H), 3.65 (d, J = 14.9 Hz, 1H), 3.54 (d, J = 14.9 Hz, 1H), 3.23–3.10 (m, 1H), 2.88 (t, J = 5.8 Hz, 2H), 2.83–2.74 (m, 1H), 2.71–2.62 (m, 1H), 2.21–2.08 (m, 1H), 2.01–1.87 (m, 1H).
[0242] Step 2: At room temperature, compound 9a (580 mg, 2.06 mmol, 1 eq), bis(pinacolato)diboron (0.78 g, 3.08 mmol, 1.5 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (150 mg, 0.21 mmol, 0.1 eq) and potassium acetate (610 mg, 6.17 mmol, 3 eq) were added to 1,4-dioxane (10 mL). The mixture was heated to 100 °C and stirred for 2 hours under nitrogen protection. Concentrate the reaction solution, and the residue was separated by flash silica gel column chromatography (PE / EA = 3 / 1) to obtain compound 9b (500 mg, yield: 73.7%). MS (ESI): m / z 330.2 (M+H) + .
[0243] Step 3: Intermediate A (150 mg, 0.54 mmol, 1 eq), compound 9b (225 mg, 0.68 mmol, 1.2 eq), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (40 mg, 0.054 mmol, 0.1 eq), and sodium carbonate (180.88 mg, 1.71 mmol, 3 eq) were dissolved in dioxane (4 mL) and water (2 mL). Under nitrogen protection, the mixture was stirred at 100 °C for 2 h. Water (200 mL) was poured into the reaction solution, and the mixture was extracted with ethyl acetate. The organic phase was dried over sodium sulfate and concentrated. The residue was separated by flash silica gel column chromatography (DCM / MeOH = 10 / 1) to obtain the crude product, which was further purified by reverse preparative chromatography pre-HPLC (0.01% FA in water, MeCN) to obtain the title compound 9 (10 mg, yield: 4.1%). MS (ESI): m / z 431.3 (M+H) + . 1 H NMR (400 MHz, MeOD) δ 8.73 (s, 2H), 8.57 (d, J = 2.5 Hz, 1H), 8.04 (dd, J = 8.5, 2.6 Hz, 1H), 7.93–7.88 (m, 2H), 7.37–7.30 (m, 2H), 4.15–3.94 (m, 5H), 3.83 (dd, J = 16.0, 8.1 Hz, 1H), 3.64–3.56 (m, 1H), 3.24–3.11 (m, 4H), 2.53 (s, 3H), 2.41–2.32 (m, 1H), 2.17–2.07 (m, 1H).
[0244] Example 10
[0245] 1-(6-Methylpyridin-3-yl)-3-(6-(2-(oxetan-3-yl)-1,2,3,4-tetrahydroisoquinolin-6-yl)pyrazin-2-yl)urea
[0246]
[0247] The synthesis method of compound 10 was the same as that of Example 9, except that 3-oxetanone was used instead of dihydro-3(2H)-furanone in the first step. Compound 10: MS (ESI): m / z 417.3 (M+H) + . 11H NMR (400 MHz, MeOD) δ 8.71 (s, 1H), 8.69 (s, 1H), 8.59 (d, J = 2.5 Hz, 1H), 8.03 (dd, J = 8.5, 2.6 Hz, 1H), 7.90–7.82 (m, 2H), 7.34–7.26 (m, 2H), 4.83 (t, J = 6.7 Hz, 2H), 4.75 (t, J = 6.3 Hz, 2H), 3.83–3.76 (m, 1H), 3.67 (s, 2H), 3.09 (t, J = 6.0 Hz, 2H), 2.76 (t, J = 6.0 Hz, 2H), 2.53 (s, 3H).
[0248] Example 11
[0249] (R)-1-(6-Methylpyridin-3-yl)-3-(6-(1,2,4a,5-tetrahydro-4H-benzo[b][1,4]oxazino[4,3-d][1,4]oxazin-8-yl)pyrazin-2-yl)urea synthesis:
[0250]
[0251] First step: (S)-2-(Hydroxymethyl)morpholine hydrochloride (900 mg, 5.86 mmol, 1 eq), 1,2-difluoro-4-nitrobenzene (932 mg, 5.86 mmol, 1 eq) were dissolved in dimethyl sulfoxide (100 mL), and potassium hydroxide (1.64 g, 29.29 mmol, 4 eq) was added. The mixture was stirred at room temperature for 3 hours and then heated to 60 °C for 18 hours. After the reaction solution was cooled, it was poured into water (300 mL), and extracted with ethyl acetate. The combined organic phases were washed with water and brine (100 mL), dried over anhydrous sodium sulfate, and concentrated. The residue was separated by flash silica gel column chromatography (PE:EA = 20:1 - 5:1) to obtain compound 11a (620 mg, yield: 39.2%). MS (ESI): m / z 237.1 (M+H) + .
[0252] Second step: Compound 11a (560 mg, 2.37 mmol, 1 eq) and di-tert-butyl dicarbonate (776 mg, 3.56 mmol, 1.5 eq) were successively added to methanol (20 mL), and palladium on carbon (60 mg, 10%) was added. After replacing with hydrogen three times, the reaction was carried out at room temperature overnight. The reaction solution was filtered and concentrated to obtain compound 11b (660 mg, yield: 90.9%). MS (ESI): m / z 307.2 (M+H) + .
[0253] Step 3: Compound 11b (720 mg, 2.35 mmol, 1 eq) was dissolved in dichloromethane (3 mL), trifluoroacetic acid (3 mL) was added dropwise, and the mixture was stirred at room temperature for 2 h. After evaporation of the solvent, the residue was redissolved in dichloromethane (30 mL), saturated sodium bicarbonate solution (50 mL) was added, and the mixture was stirred for half an hour and then separated into layers. The organic layer was dried and evaporated. The crude product was separated by flash silica gel column chromatography (PE:EA = 5:1 - 1:1) to obtain compound 11c (360 mg, yield: 74.3%). MS (ESI): m / z 207.2 (M+H) + . 1 HNMR (400 MHz, DMSO-d6) δ 6.49 (d, J = 8.4 Hz, 1H), 6.30–5.93 (m, 2H), 4.45 (s, 1H), 4.05 (d, J = 10.4 Hz, 1H), 3.85 (d, J = 11.2 Hz, 1H), 3.74 (d, J = 9.4 Hz, 1H), 3.59–3.44 (m, 1H), 3.35 (d, J = 12.4 Hz, 2H), 3.09 (t, J = 10.5 Hz, 1H), 2.82 (d, J = 9.2 Hz, 1H).
[0254] Step 4: Compound 11c (360 mg, 1.75 mmol, 1 eq) was added to water (10 mL), hydrobromic acid (0.6 mL, 48% aqueous solution) was added, and the temperature was lowered to 0 °C in an ice bath and stirred for 0.5 h. An aqueous solution (0.5 mL) of sodium nitrite (133 mg, 1.92 mmol, 1.05 eq) was added dropwise. The reaction was carried out at 0 °C for 0.5 h, then copper(I) bromide (751 mg, 5.24 mmol, 3 eq) was added, and the reaction was carried out at 0 °C for 2 h. Saturated sodium bicarbonate solution (50 mL) was added, and the mixture was extracted with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate and concentrated. The residue was separated by flash silica gel column chromatography (PE:EA = 10:1 - 5:1) to obtain compound 11d (76 mg, yield: 16.1%). MS (ESI): m / z 270.0 (M+H) + .
[0255] Step 5: Compound 11d (75 mg, 0.28 mmol, 1 eq), potassium acetate (55 mg, 0.56 mmol, 2 eq), bis(pinacolato)diboron (106 mg, 0.42 mmol, 1.5 eq), and dichlorobis[1,1'-bis(diphenylphosphino)ferrocene]palladium(II) (8 mg, 0.03 mmol, 0.1 eq) were successively added to dioxane (2 mL). After purging with argon three times, the mixture was heated to 100 °C and reacted overnight. The reaction mixture was concentrated, and the residue was separated by flash silica gel column chromatography (PE:EA = 4:1) to obtain compound 11e (63 mg, yield: 70.9%). MS (ESI): m / z 318.2 (M+H) + .
[0256] Step 6: Intermediate A (53 mg, 0.2 mmol, 1 eq), compound 11e (63 mg, 0.2 mmol, 1 eq), and sodium carbonate (43 mg, 0.4 mmol, 2 eq) were successively added to a mixed solvent of dioxane (1 mL) and water (0.2 mL). Dichlorobis[1,1'-bis(diphenylphosphino)ferrocene]palladium(II) (5 mg, 0.02 mmol, 0.1 eq) was added. After purging with argon three times, the temperature was raised to 100 °C and the reaction was carried out for 18 h. After the reaction mixture was cooled, ethyl acetate (20 mL) was added, and it was washed once with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated and purified by preparative thin-layer chromatography (EA / PE = 9:1) to obtain the title compound 11 (25 mg, yield: 11.9%). MS (ESI): m / z 419.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 10.32 (s, 1H), 9.88 (s, 1H), 8.91 (s, 1H), 8.74 (s, 1H), 8.55–8.49 (m, 1H), 7.93–7.85 (m, 1H), 7.60 (dd, J = 8.4, 2.0 Hz, 1H), 7.47 (d, J = 2.0 Hz, 1H), 7.21 (d, J = 8.4 Hz, 1H), 7.01 (d, J = 8.8 Hz, 1H), 4.30–4.27 (m, 1H), 4.00–3.96 (m, 1H), 3.95–3.85 (m, 2H), 3.73 (d, J = 11.6 Hz, 1H), 3.66–3.56 (m, 1H), 3.27–3.14 (m, 2H), 2.79 (dd, J = 12.0, 3.6 Hz, 1H), 2.42 (s, 3H).
[0257] Example 12
[0258] (S)-1-(6-Methylpyridin-3-yl)-3-(6-(1,2,4a,5-tetrahydro-4H-benzo[b][1,4]oxazino[4,3-d][1,4]oxazin-8-yl)pyrazin-2-yl)urea Synthesis:
[0259]
[0260] The synthesis method of compound 12 is the same as that of Example 11. In the first step, (R)-2-(hydroxymethyl)morpholine hydrochloride is used instead of (S)-2-(hydroxymethyl)morpholine hydrochloride. Compound 12: MS(ESI): m / z 419.2(M+H) + . 1 H NMR(400MHz, DMSO-d6) δ 10.41(s, 1H), 9.91(s, 1H), 8.93(s, 1H), 8.74(s, 1H), 8.54(d, J = 2.4Hz, 1H), 7.88(dd, J = 8.4, 2.8Hz, 1H), 7.60(dd, J = 8.4, 2.0Hz, 1H), 7.47(d, J = 2.0Hz, 1H), 7.21(d, J = 8.4Hz, 1H), 7.01(d, J = 8.4Hz, 1H), 4.30–4.26(m, 1H), 4.00–3.96(m, 1H), 3.95–3.87(m, 2H), 3.77–3.68(m, 1H), 3.64–3.58(m, 1H), 3.25–3.16(m, 2H), 2.83–2.76(m, 1H), 2.42(s, 3H).
[0261] Example 13
[0262] 1-(6-(3-Methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-yl)-3-(pyrazolo[1,5-a]pyridin-6-yl)urea Synthesis:
[0263]
[0264] Step 1: Dissolve 6-bromopyrazolo[1,5-a]pyridine (500 mg, 2.5 mmol, 1 eq) in toluene (4 mL), and add tert-butyl carbamate (2.6 g, 22 mmol, 8.7 eq), palladium(II) acetate (62 mg, 0.28 mmol, 0.1 eq), cesium carbonate (1.6 g, 5 mmol, 2 eq) and XPhos (120 mg, 0.25 mmol, 0.1 eq). Replace nitrogen three times, and heat the reaction mixture to 110 °C and stir for 16 h. Concentrate the reaction mixture, and purify the residue by flash silica gel column chromatography (DCM:MeOH = 10:1) to obtain compound 13a (873 mg, yield: 100%). MS (ESI): m / z 234.1 (M+H) + .
[0265] Step 2: Add compound 13a (873 mg, 3.73 mmol, 1 eq) to trifluoroacetic acid (3 mL), and stir the reaction mixture at room temperature for 1 h. Concentrate the reaction mixture, and purify the residue by flash silica gel column chromatography (DCM:MeOH = 10:1) to obtain compound 13b (100 mg, yield: 20%). MS (ESI): m / z 134.1 (M+H) + .
[0266] Step 3: Dissolve intermediate C (157 mg, 0.5 mmol, 1 eq) in toluene (5 mL), and add compound 13b (100 mg, 0.75 mmol, 1.5 eq), triethylamine (152 mg, 1.5 mmol, 3 eq) and diphenylphosphoryl azide (275.2 mg, 1.0 mmol, 2 eq). Heat the mixture to 100 °C and stir for 5 h. Concentrate the reaction mixture, and purify the residue by reverse preparative chromatography pre-HPLC (0.01% FA in water, MeCN) to obtain the title compound 13 (8 mg, yield: 3.6%). MS (ESI): m / z 445.1 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.81–9.79 (m, 2H), 9.15–9.14 (m, 1H), 8.90 (s, 1H), 8.81 (s, 1H), 7.97–7.92 (m, 3H), 7.71 (dd, J = 9.6, 0.8 Hz, 1H), 7.18–7.14 (m, 1H), 7.12 (dd, J = 9.2, 2.0 Hz, 1H), 6.60 (dd, J = 2.2, 1.0 Hz, 1H), 4.56 (d, J = 5.6 Hz, 2H), 4.35 (d, J = 6.0 Hz, 2H), 4.14 (s, 2H), 2.27 (s, 3H), 1.41 (s, 3H).
[0267] Example 14
[0268] Synthesis of 1-(imidazo[1,2-a]pyridin-6-yl)-3-(6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-yl)urea:
[0269]
[0270] Imidazo[1,2-a]pyridine-6-carboxylic acid (100 mg, 0.62 mmol, 1 eq), intermediate B (194 mg, 0.68 mmol, 1.1 eq), diphenylphosphoryl azide (339 mg, 1.24 mmol, 2 eq) and triethylamine (187 mg, 1.85 mmol, 3 eq) were added to toluene (5 mL), and the mixture was stirred at 90 °C for 5 h. The reaction mixture was concentrated, and the residue was separated by flash silica gel column chromatography (DCM:MeOH = 10:1) to give the title compound 14 (7.8 mg, yield: 3.2%). MS (ESI): m / z 445.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.78 (s, 1H), 9.76 (s, 1H), 9.09–9.07 (m, 1H), 8.91 (s, 1H), 8.81 (s, 1H), 8.03 (s, 1H), 7.96–7.94 (m, 2H), 7.59–7.57 (m, 1H), 7.54–7.53 (m, 1H), 7.17–7.15 (m, 1H), 7.10 (dd, J = 9.6, 2.0 Hz, 1H), 4.56 (d, J = 5.6 Hz, 2H), 4.35 (d, J = 5.6 Hz, 2H), 4.14 (s, 2H), 2.27 (s, 3H), 1.41 (s, 3H).
[0271] Example 15
[0272] Synthesis of 1-(imidazo[1,2-a]pyridin-7-yl)-3-(6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-yl)urea:
[0273]
[0274] Compound 15 was synthesized in the same manner as in Example 14, using imidazo[1,2-a]pyridine-7-carboxylic acid instead of imidazo[1,2-a]pyridine-6-carboxylic acid. Compound 15: MS (ESI): m / z 445.1 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 10.01 (s, 1H), 9.84 (s, 1H), 8.92 (s, 1H), 8.80 (s, 1H), 8.47 (d, J = 7.2 Hz, 1H), 7.98–7.92 (m, 2H), 7.85–7.80 (m, 2H), 7.44 (s, 1H), 7.14 (d, J = 9.2 Hz, 1H), 6.90 (d, J = 7.2 Hz, 1H), 4.54 (d, J = 5.6 Hz, 2H), 4.33 (d, J = 6.0 Hz, 2H), 4.12 (s, 2H), 2.26 (s, 3H), 1.40 (s, 3H).
[0275] Example 16
[0276] Synthesis of 1-(2-methyl-2H-indazol-6-yl)-3-(6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-yl)urea:
[0277]
[0278] The synthesis method of Compound 16 is the same as that of Example 13, and 2-methyl-6-amino-2H-indazole is used instead of Compound 13b in the third step. Compound 16: MS (ESI): m / z 459.2 (M+H) + . 1 1H NMR (400 MHz, DMSO-d6) δ 10.42 (s, 1H), 9.93 (s, 1H), 9.02 (s, 1H), 8.78 (s, 1H), 8.25 (s, 1H), 7.96–7.92 (m, 3H), 7.66–7.62 (m, 1H), 7.15 (d, J = 9.2 Hz, 1H), 7.02 (dd, J = 8.8, 1.6 Hz, 1H), 4.56 (d, J = 5.6 Hz, 2H), 4.35 (d, J = 5.6 Hz, 2H), 4.13 (s, 2H), 4.12 (s, 3H), 2.28 (s, 3H), 1.41 (s, 3H).
[0279] Example 17
[0280] Synthesis of 1-(6-(4-((3-methyloxetan-3-yl)methyl)-3,4-dihydro-2H-benzo[b][1,4]oxazin-7-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0281]
[0282] Step 1: Dissolve 2-amino-5-bromophenol (2.00 g, 10.64 mmol, 1.0 eq) in 1,2-dichloroethane (50 mL), add 3-methoxypropane-3-carbaldehyde (1.06 g, 10.64 mmol, 1.0 eq), sodium cyanoborohydride (2.00 g, 31.91 mmol, 3.0 eq), and stir at room temperature for 8 hours. Pour the system into ice water, extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. The residue is separated by flash silica gel column chromatography (100% PE - PE:EA = 10:1) to obtain compound 17a (1.29 g, yield: 44.6%). MS (ESI): m / z 272.0 (M+H) + .
[0283] Step 2: Dissolve compound 17a (1 g, 3.67 mmol, 1 eq) in N,N-dimethylformamide (50 mL), add potassium carbonate (1.50 g, 11.02 mmol, 3 eq) at room temperature, and then add 1,2-dibromoethane (2.0 g, 11.02 mmol, 3 eq). Heat the mixture to 100 °C and stir overnight. Cool the mixture to room temperature, dilute with ethyl acetate (200 mL), wash with water and saturated brine, and dry the organic phase over anhydrous sodium sulfate. After concentration, the residue is separated by flash silica gel chromatography (PE:EA = 9:1) to obtain compound 17b (540 mg, yield: 49.3%). MS (ESI): m / z 298.0 (M+H) + .
[0284] Step 3: Add compound 17b (483 mg, 1.62 mmol, 1.0 eq), bis(pinacolato)diboron (617 mg, 2.43 mmol, 1.5 eq), dichlorobis[(1,1'-bis(diphenylphosphino)ferrocene)palladium(II)] (118 mg, 0.16 mmol, 0.1 eq), and potassium acetate (397 mg, 4.05 mmol, 2.5 eq) to dioxane (5 mL) in sequence. Replace the atmosphere with argon three times, heat to 100 °C and stir for 2 hours, filter through diatomaceous earth, concentrate under reduced pressure, and separate the residue by flash silica gel chromatography (PE:EA = 10:1 - 4:1) to obtain compound 17c (237 mg, yield: 42.4%). MS (ESI): m / z 346.2 (M+H) + .
[0285] Step 4: Compound 17c (227 mg, 0.66 mmol, 1.0 eq), intermediate A (191 mg, 0.72 mmol, 1.1 eq), cesium carbonate (428 mg, 1.315 mmol, 2.0 eq), and [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (48 mg, 0.07 mmol, 0.1 eq) were successively added to a mixed solution of dioxane-water (4:1, 5 mL). After purging with argon three times, the reaction was heated to 100 °C for 2 hours. After the system was cooled to room temperature, it was extracted with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate, concentrated under reduced pressure, washed with methanol, filtered, the filter cake was collected, and dried in vacuo to obtain the title compound 17 (177.77 mg, yield: 60.3%). MS (ESI): m / z 447.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.86 (s, 1H), 9.65 (s, 1H), 8.75 (s, 1H), 8.70 (s, 1H), 8.50 (s, 1H), 7.90 (d, J = 8.4 Hz, 1H), 7.53 (d, J = 8.0 Hz, 1H), 7.44 (s, 1H), 7.22 (d, J = 8.0 Hz, 1H), 6.87 (d, J = 8.8 Hz, 1H), 4.55 (d, J = 5.2 Hz, 2H), 4.23 (d, J = 6.0 Hz, 4H), 3.53 (s, 2H), 3.36 (s, 2H), 2.43 (s, 3H), 1.32 (s, 3H).
[0286] Example 18
[0287] Synthesis of 1-(6-(4-((3-methyloxetan-3-yl)methyl)-3-oxo-3,4-dihydro-2H-benzo[b][1,4]oxazin-7-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0288]
[0289] Step 1: 7-Bromo-2H-benzo[b][1,4]oxazin-3(4H)-one (301 mg, 1.32 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL). Sodium hydride (60%, 106 mg, 2.64 mmol, 2 eq) was added under an ice bath. After maintaining the reaction for 30 minutes, 3-(chloromethyl)-3-methyloxetane (175 mg, 1.45 mmol, 1.1 eq) was added. After addition, the temperature was raised to 80 °C and the reaction was carried out for 18 hours. After cooling the reaction solution, it was poured into ice water (50 mL). The aqueous phase was extracted with ethyl acetate, and the organic phases were combined. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was separated by flash silica gel chromatography (PE:EA = 10:1 - 5:1) to obtain compound 19a (160 mg, yield: 38.8%). MS(ESI): m / z 312.0 (M+H) + .
[0290] Step 2: Compound 19a (160 mg, 0.51 mmol, 1 eq), potassium acetate (100 mg, 1.02 mmol, 2 eq), bis(pinacolato)diboron (194 mg, 0.77 mmol, 1.5 eq), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (15 mg, 10%) were successively added to dioxane (5 mL). After purging with argon three times, the mixture was heated to 100 °C and reacted overnight. The reaction solution was separated by flash silica gel chromatography (EA:PE = 3:20 - 3:10) to obtain compound 19b (150 mg, yield: 82.4%). MS(ESI): m / z 360.2 (M+H) + .
[0291] Step 3: Intermediate A (74 mg, 0.28 mmol, 1 eq), compound 19b (151 mg, 0.42 mmol, 1.5 eq), and sodium carbonate (60 mg, 0.56 mmol, 2 eq) were successively added to a mixed solvent of dioxane (5 mL) and water (0.5 mL). [1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium (15 mg, 10%) was added. After purging with argon three times, the temperature was raised to 100 °C and the reaction was carried out for 3 hours. After cooling the reaction solution, ethyl acetate (20 mL) was added. The organic phase was washed once with saturated brine (10 mL), dried over anhydrous sodium sulfate, filtered, and concentrated by rotary evaporation. The crude product was purified by flash silica gel chromatography (EA), and then further purified by preparative Pre-HPLC (C18, 0.01% HCOOH in water, MeCN) to obtain the title compound 19 (30 mg, yield: 23.3%). MS(ESI): m / z 461.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 9.74 (s, 1H), 9.71 (s, 1H), 8.97 (s, 1H), 8.87 (s, 1H), 8.52 (d, J = 2.4 Hz, 1H), 7.89 (dd, J = 8.4, 2.8 Hz, 1H), 7.79 (dd, J = 8.4, 2.0 Hz, 1H), 7.76 (d, J = 2.0 Hz, 1H), 7.50 (d, J = 8.8 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.77 (s, 2H), 4.54 (d, J = 6.0 Hz, 2H), 4.17 (s, 2H), 4.10 (d, J = 6.0 Hz, 2H), 2.43 (s, 3H), 1.30 (s, 3H).
[0292] Example 19
[0293] Synthesis of 1-(6-{1-[trans-2-hydroxy-5-chloropentyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0294]
[0295] First step: Zinc chloride (1.62 g, 11.89 mmol, 2 eq) was dissolved in water (20 mL), and a solution of 5-bromo-2,3-dihydroindole (1.77 g, 8.92 mmol, 1.5 eq) and 1,2-epoxypentane (500 mg, 5.94 mmol, 1 equiv) in acetonitrile (10 mL) was slowly added thereto. Under nitrogen protection, the temperature was raised to 90 °C and stirred for 2 hours. The reaction solution was diluted with ethyl acetate (50 mL), extracted and separated into layers, and the organic phase was concentrated to obtain a crude product. The crude product was separated and purified by flash silica gel chromatography (EA% = 0 - 30%) to obtain compound 49a (900 mg, yield: 53.7%). MS (ESI): m / z 282.1 (M + H) + . 1 1H NMR (400 MHz, CDCl3) δ 7.16–7.09 (m, 2H), 6.41 (d, J = 8.9 Hz, 1H), 4.24 (q, J = 6.8 Hz, 1H), 3.70 (dd, J = 15.3, 8.2 Hz, 1H), 3.48–3.31 (m, 2H), 2.95 (t, J = 8.3 Hz, 2H), 2.05–1.76 (m, 4H), 1.71–1.58 (m, 3H).
[0296] Step 2: In a 100 mL flask, add compound 49a (900 mg, 3.19 mmol, 1 eq), bis(pinacolato)diboron (1.21 g, 4.78 mmol, 1.5 eq), potassium acetate (939 mg, 9.57 mmol, 3 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (233 mg, 0.32 mmol, 0.1 eq) and dioxane (20 mL). Under nitrogen protection, heat the mixture to 100 °C and stir for 2 hours. Dilute the reaction mixture with water (100 mL) and ethyl acetate (300 mL), separate the layers, dry the organic layer over anhydrous sodium sulfate, and concentrate. Purify by flash silica gel chromatography (EA% = 0 - 70%) to obtain compound 49b (500 mg, yield: 47.6%). MS(ESI): m / z 330.2 (M+H) + .
[0297] Step 3: Add compound 49b (100 mg, 0.304 mmol, 1 eq), intermediate A (160.17 mg, 0.608 mmol, 2 eq), sodium carbonate (64.12 mg, 0.608 mmol, 2 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (44.59 mg, 0.0609 mmol, 0.2 eq) to a mixture of dioxane (5 mL) and water (0.5 mL). Replace the nitrogen, heat the reaction mixture to 100 °C and stir for 16 hours. Cool the reaction mixture to room temperature, filter, concentrate the filtrate by rotary evaporation, dissolve it in 10 mL of N,N-dimethylformamide and filter again, then send it for preparative treatment. Purify the residue by reverse preparative chromatography Prep-HPLC to obtain the title compound 49 (18.80 mg, yield: 14.4%). MS(ESI): m / z 430.5 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 10.05 (s, 1H), 9.72 (s, 1H), 8.73 (s, 1H), 8.72 (s, 1H), 8.59 (d, J = 2.4 Hz, 1H), 7.98–7.95 (m, 1H), 7.84–7.76 (m, 2H), 7.32 (d, J = 8.4 Hz, 1H), 6.66 (d, J = 8.4 Hz, 1H), 4.93 (s, 1H), 4.17–4.10 (m, 1H), 3.81–3.75 (m, 1H), 3.64–3.57 (m, 2H), 3.04 (t, J = 8.4 Hz, 2H), 2.49 (s, 3H), 1.96–1.84 (m, 2H), 1.80–1.73 (m, 1H), 1.69–1.53 (m, 3H)
[0298] Example 20
[0299] Synthesis of 1-(6-{1-[trans-4-hydroxypyrrolidin-3-yl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0300]
[0301] First step: Add 5-bromoindoline (1.00 g, 5.05 mmol, 1 eq) and THF (20 mL) into a 50 mL single-necked flask. Add sodium hydride (60%, 404 mg, 10.10 mmol, 2 eq) under an ice bath, stir for 20 minutes, and then add tert-butyl 6-oxa-3-azabicyclo[3.1.0]hexane-3-carboxylate (1.40 g, 7.57 mmol, 1.5 eq). React at 95 °C for 6 hours. Quench the reaction with water, extract with ethyl acetate, combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel chromatography (PE:EA = 10:1 - 4:1) to obtain compound 50a (1.175 g, yield: 60.7%). MS(ESI): m / z 383.1 (M+H) + . 1 H NMR(400MHz,CDCl3)δ7.15(s,2H),6.37(d,J=8.9Hz,1H),4.39(dd,J=10.7,5.2Hz,1H),3.90(dd,J=11.7,5.5Hz,1H),3.73–3.69(m,2H),3.55–3.21(m,4H),2.96(t,J=8.3Hz,2H),2.35(s,1H),1.46(s,9H).
[0302] Second step: Add compound 50a (500 mg, 1.30 mmol, 1 eq), bis(pinacolato)diboron (398 mg, 1.57 mmol, 1.2 eq), Pd(dppf)Cl2 (191 mg, 0.26 mmol, 0.2 eq), potassium acetate (512 mg, 5.22 mmol, 4 eq) and 1,4-dioxane (30 mL) into a 100 mL single-necked flask. Evacuate and refill the reaction system with nitrogen three times, and stir at 90 °C for 8 hours. Dilute with water, filter, extract the filtrate with ethyl acetate, combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel chromatography (PE:EA = 4:1 - 3:1) to obtain compound 50b (299 mg, yield: 43.4%). MS(ESI): m / z 431.4 (M+H) + .
[0303] Step 3: Compound 50b (279 mg, 0.65 mmol, 1 eq), intermediate A (167.2 mg, 0.65 mmol, 1 eq), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (92.83 mg, 0.13 mmol, 0.2 eq) and anhydrous sodium carbonate (137.73 mg, 1.3 mmol, 2 eq) were successively added to a mixed solution of dioxane / water (15 mL / 1.5 mL). Under nitrogen protection, the temperature was raised to 100 °C and stirred for 16 h. The organic layer was washed with saturated brine (30 mL), and then dried over anhydrous sodium sulfate. The insoluble substances were removed by filtration, and the organic phase was concentrated under reduced pressure to obtain the crude product. The crude product was separated by flash silica gel chromatography (PE:EA = 4:1), and the obtained fractions were concentrated under reduced pressure to remove the solvent, obtaining compound 50c (200 mg, yield: 57.9%). MS (ESI): m / z 531.8 (M+H) + .
[0304] Step 4: 4M Hydrochloric acid in dioxane (4 mL, 1 mmol, 2.63 eq) was added to a solution of compound 50c (200 mg, 0.38 mmol, 1 eq) in dichloromethane (5 mL). Under nitrogen protection, the mixture was stirred at 25 °C for 2 h. The reaction solution was concentrated, and the residue was purified by reverse preparative chromatography Prep-HPLC to obtain the title compound 50 (59 mg, yield: 36.0%). MS (ESI): m / z 432.2 (M+H) + . 1 H NMR (400 MHz, MeOD) δ 8.55 (s, 1H), 8.52–8.49 (m, 2H), 8.43 (s, 1H), 8.07–8.04 (m, 1H), 7.79–7.76 (m, 2H), 7.29 (d, J = 8.4 Hz, 1H), 6.74 (d, J = 8.4 Hz, 1H), 4.61–4.60 (m, 1H), 4.11–4.08 (m, 1H), 3.74–3.69 (m, 1H), 3.58–3.47 (m, 4H), 3.28 (d, J = 2.4 Hz, 1H), 3.09 (t, J = 8.4 Hz, 2H), 2.50 (s, 3H).
[0305] Example 21
[0306] Synthesis of 1-(6-(1-((3-hydroxyoxetan-3-yl)methyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0307]
[0308] Step 1: A solution of 3-oxetanone (2.1 g, 29.1 mmol) in anhydrous tetrahydrofuran (100 mL) was cooled to 0 °C under nitrogen protection, maintaining the internal temperature below 10 °C. Vinylmagnesium bromide (1 M in THF, 50 mL, 50.0 mmol) was added dropwise. The reaction mixture was stirred for 10 minutes, then allowed to warm to room temperature and stirred for 2 hours. The reaction mixture was poured into saturated ammonium chloride (200 mL). The mixture was stirred for 5 minutes, the layers were separated, and the aqueous layer was extracted with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give the crude product. The crude product was separated by flash silica gel chromatography (PE / EA = 3 / 2) to give compound 52a (600 mg, yield: 20.6%). 1 H NMR (400 MHz, CDCl3) δ 6.36–6.26 (m, 1H), 5.47–5.40 (m, 1H), 5.30–5.27 (m, 1H), 4.74–4.68 (m, 4H), 3.55 (s, 1H).
[0309] Step 2: At -78 °C, a solution of compound 52a (450 mg, 4.49 mmol) in dichloromethane (5 mL) and methanol (45 mL) was bubbled with ozone for 20 minutes, then triphenylphosphine (3.0 g) was added. The mixture was stirred at -78 °C for 6 hours. After completion of the reaction, the temperature was raised to room temperature, and the mixture was filtered. The filtrate was concentrated under reduced pressure to remove the excess reagents to give compound 52b (3.2 g, crude), which was used directly in the next step.
[0310] Step 3: To a 100 mL flask were successively added compound 52b (2.06 g, 20.2 mmol, 20.0 eq), 5-bromo-2,3-dihydro-1H-indole (200 mg, 1.01 mmol, 1.0 eq), dichloromethane (30 mL) and glacial acetic acid (0.2 mL), and then the mixture was stirred at room temperature for 30 minutes. Sodium triacetoxyborohydride (428.03 mg, 2.02 mmol, 2.0 eq) was added to the reaction solution, and then the mixture was stirred at room temperature for 30 minutes. After completion of the reaction, water (2 mL) was added to quench the reaction, and the excess reagents were removed by concentration under reduced pressure to give the crude product. The crude product was separated by flash silica gel chromatography (PE / EA = 3 / 2) to give compound 52c (180 mg, yield: 62%). MS (ESI): m / z 283.8 (M+H) + . 11H NMR (400 MHz, CDCl3) δ 7.27–7.15 (m, 2H), 6.46 (d, J = 8.4 Hz, 1H), 4.73 (d, J = 7.2 Hz, 2H), 4.57 (d, J = 7.2 Hz, 2H), 3.43 (s, 2H), 3.37 (t, J = 8.4 Hz, 2H), 3.10 (s, 1H), 3.00 (t, J = 8.4 Hz, 2H).
[0311] Step 4: Under nitrogen protection, add compound 52c (198 mg, 0.7 mmol, 1.0 eq), 4,4,5,5 - tetramethyl - 1,3,2 - dioxaborolane - 2 - ylboronic acid (265.42 mg, 1.05 mmol, 1.5 eq), potassium acetate (136.77 mg, 1.39 mmol, 2.0 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (51.57 mg, 0.105 mmol, 0.1 eq) and dioxane (5 mL) to a 500 mL flask in sequence. Stir the mixture at 100 °C for 3 hours. After the reaction is completed, cool it to room temperature and concentrate under reduced pressure to remove the excess reagents to obtain the crude product. The crude product is separated by flash silica gel chromatography (PE / EA = 1 / 1) to obtain compound 52d (150 mg, yield: 64%). MS (ESI): m / z 332.0 (M + H) + . 1 1H NMR (400 MHz, CDCl3) δ 7.59 (d, J = 8.0 Hz, 1H), 7.57 (s, 1H), 6.59 (d, J = 8.0 Hz, 1H), 4.74 (d, J = 7.2 Hz, 2H), 4.59 (d, J = 7.2 Hz, 2H), 3.51 (s, 2H), 3.39 (t, J = 8.4 Hz, 2H), 3.08 (s, 1H), 3.02 (t, J = 8.4 Hz, 2H), 1.33 (s, 12H).
[0312] Step 5: Under nitrogen protection, sodium carbonate (82.67 mg, 0.79 mmol, 2.0 eq) was added to a solution of compound 52d (129.17 mg, 0.39 mmol, 1.0 eq), intermediate A (92.55 mg, 0.35 mmol, 0.9 eq) and [1,1'-bis(diphenylphosphino)ferrocene] palladium dichloride (20.43 mg, 0.035 mmol, 0.01 eq) in dioxane (3 mL) and water (0.3 mL). The resulting mixture was reacted at 100 °C for 3 h. After the reaction was complete, it was cooled to room temperature. The reaction solution was diluted with water (50 mL), and the mixture was extracted with ethyl acetate. The organic layer was washed with saturated brine (150 mL) and then dried over anhydrous sodium sulfate. The insoluble matter was removed by filtration, and the organic phase was concentrated under reduced pressure to obtain the crude product. The crude product was separated by flash silica gel chromatography (DCM / MeOH = 10 / 1) to obtain the title compound 52 (80 mg, yield: 45%). MS (ESI): m / z 432.8 (M+H) + . 1 HNMR (400 MHz, DMSO-d6) δ 9.98 (s, 1H), 9.70 (s, 1H), 8.72 (d, J = 8.8 Hz, 2H), 8.53 (d, J = 2.4 Hz, 1H), 7.94–7.89 (m, 1H), 7.83–7.79 (m, 2H), 7.25 (d, J = 8.4 Hz, 1H), 6.70 (d, J = 8.4 Hz, 1H), 5.95 (s, 1H), 4.53–4.43 (m, 4H), 3.61 (t, J = 8.4 Hz, 2H), 3.46 (s, 2H), 3.04 (t, J = 8.4 Hz, 2H), 2.45 (s, 3H).
[0313] Example 22
[0314] Synthesis of 1-[6-(1-{[3-(hydroxymethyl)oxetan-3-yl]methyl}-2,3-dihydro-1H-indol-5-yl)pyrazin-2-yl]-3-(6-methylpyridin-3-yl)urea:
[0315]
[0316] The first step: Dissolve 3,3 - bis(hydroxymethyl)-1 - oxetane (1 g, 8.46 mmol, 1 eq) in tetrahydrofuran (60 mL), stir at 0 °C, add sodium hydride (60%, 338 mg, 8.46 mmol, 1 eq), stir at room temperature for 30 minutes under nitrogen protection, then add tert - butyldiphenylchlorosilane (2.33 g, 8.46 mmol, 1.0 eq) at 0 °C, and stir at room temperature for 1 hour. Quench with water and extract 3 times with dichloromethane, then concentrate under reduced pressure. The residue is separated by flash silica gel chromatography (100% PE ~ PE:EA = 63:37) to obtain compound 53a (2.0 g, yield: 66.2%). 1 H NMR (400 MHz, CDCl3) δ 7.71–7.65 (m, 4H), 7.40–7.47 (m, 6H), 4.50–4.39 (m, 4H), 3.95 (s, 4H), 2.46 (s, 1H), 1.09 (s, 9H).
[0317] The second step: Dissolve compound 53a (1.0 g, 0.28 mmol, 1 eq) in dichloromethane (5 mL), then add Dess - Martin periodinane (2.37 g, 5.60 mmol, 2 eq) and stir at 0 °C for 1 hour. Transfer the reaction solution with dichloromethane and directly dry it on a rotary evaporator to obtain compound 53b (0.90 g). 1 H NMR (400 MHz, DMSO - d6) δ 9.84 (s, 1H), 7.65–7.61 (m, 5H), 7.51–7.47 (m, 5H), 4.68 (d, J = 6.4 Hz, 2H), 4.45 (d, J = 6.4 Hz, 2H), 4.17 (s, 2H), 1.00 (s, 9H).
[0318] The third step: Dissolve 5 - bromo - 2,3 - dihydro - 1H - indole (335 mg, 1.69 mmol, 1 eq) in dichloromethane (6 mL), add compound 53b (0.90 g, 2.54 mmol, 1.5 eq) and acetic acid (0.6 mL) at 0 °C, displace nitrogen and stir at 30 °C for 30 minutes, then add sodium triacetoxyborohydride (716 mg, 3.38 mmol, 2 eq), and stir at 30 °C for 17 hours. Filter and concentrate the reaction solution, mix with sample, and separate by flash silica gel chromatography (PE:EA = 79:21) to obtain compound 53c (800 mg, yield: 88.0%). MS (ESI): m / z 535.8 (M + H) + .
[0319] Step 4: Dissolve compound 53c (800 mg, 1.49 mmol, 1 eq), bis(pinacolato)diboron (757 mg, 2.98 mmol, 2 eq), potassium acetate (366 mg, 3.74 mmol, 2.5 eq) and dichloride [1,1'-bis(diphenylphosphino)ferrocene] palladium (218 mg, 0.299 mmol, 0.2 eq) in 1,4-dioxane (8 mL). After replacing nitrogen, stir at 100 °C for 4 hours. Filter through diatomaceous earth, and separate the filtrate by flash silica gel chromatography (PE:EA = 4:1) to obtain compound 53d (600 mg, yield: 68.9%). MS (ESI): m / z 583.8 (M+H) + .
[0320] Step 5: Add compound 53d (300 mg, 0.51 mmol, 1 eq), intermediate A (135 mg, 0.51 mmol, 1 eq), sodium carbonate (109 mg, 1.028 mmol, 2 eq), dichloride [1,1'-bis(diphenylphosphino)ferrocene] palladium (75 mg, 0.103 mmol, 0.2 eq) to a mixed solution of dioxane (10 mL) and water (1 mL). Replace nitrogen, heat the reaction solution to 100 °C and stir for 16 hours. Cool the reaction solution to room temperature, filter, and evaporate to dryness under reduced pressure to obtain compound 53e (300 mg, yield: 85.2%), which is directly used for the next step. MS (ESI): m / z 684.8 (M+H) + .
[0321] Step 6: Dissolve compound 53e (250 mg, 0.365 mmol, 1 eq) and tetrabutylammonium fluoride (0.73 mL, 0.73 mmol, 2 eq) in tetrahydrofuran (10 mL). Stir at room temperature under nitrogen protection for 2 hours. Concentrate, dissolve in 10 mL of N,N-dimethylformamide and filter, and purify by reverse preparative chromatography Pre-HPLC to obtain the title compound 53 (61.19 mg, yield: 37.0%). MS (ESI): m / z 447.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 9.93 (s, 1H), 9.67 (s, 1H), 8.72 (s, 1H), 8.69 (s, 1H), 8.51 (d, J = 2.4 Hz, 1H), 7.90–7.88 (m, 1H), 7.80–7.77 (m, 2H), 7.23 (d, J = 8.4 Hz, 1H), 6.63 (d, J = 8.8 Hz, 1H), 5.02–4.98 (m, 1H), 4.42–4.37 (m, 4H), 3.67 (d, J = 5.2 Hz, 2H), 3.49 (t, J = 8.4 Hz, 2H), 3.41 (s, 2H), 3.03 (t, J = 8.4 Hz, 2H), 2.43 (s, 3H).
[0322] Example 23
[0323] Synthesis of 1-(6-(1-((3-methyloxetan-3-yl)methyl)-2,3-dihydro-1H-indol-5-yl)pyrazin-2-yl)-3-(pyrazolo[1,5-a]pyridin-6-yl)urea:
[0324]
[0325] First step: To a solution of compound 4b (2.5 g, 7.59 mmol, 1.0 eq) in 1,4-dioxane (30 mL) and water (3 mL), add 6-chloropyrazine-2-carboxylic acid (1.44 g, 9.11 mmol, 1.2 eq), sodium carbonate (2.01 g, 18.9 mmol, 2.5 eq), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane complex (648 mg, 0.8 mmol, 0.1 eq). Stir at 100 °C for 3 h under nitrogen protection, filter by suction, and concentrate. The residue is separated by flash silica gel column chromatography (DCM / MeOH = 10 / 1) to obtain compound 59a (1.1 g, yield: 44.5%). MS (ESI): m / z 326.0 (M+H) + .
[0326] Second step: To a solution of compound 59a (110 mg, 0.34 mmol, 1.0 eq) in toluene (10 mL), add compound 13b (50 mg, 0.37 mmol, 1.1 eq), triethylamine (105 mg, 1.03 mmol, 3.0 eq), and diphenyl phosphorazidate (189 mg, 0.69 mmol, 2.0 eq). Stir at 100 °C for 15 h under nitrogen protection. Concentrate the reaction mixture, and purify the residue by reverse preparative chromatography Prep-HPLC to obtain the title compound 59 (15 mg, yield: 9.7%). MS (ESI): m / z 456.3 (M+H) + .1 1H NMR (400 MHz, DMSO-d6) δ 9.93 (s, 1H), 9.74 (s, 1H), 9.16 (s, 1H), 8.76 (s, 1H), 8.72 (s, 1H), 7.95 (d, J = 2.4 Hz, 1H), 7.82–7.81 (m, 2H), 7.73 (d, J = 9.6 Hz, 1H), 7.12 (dd, J = 9.6, 2.0 Hz, 1H), 6.65–6.63 (m, 1H), 6.62–6.61 (m, 1H), 4.51 (d, J = 5.6 Hz, 2H), 4.31 (d, J = 5.6 Hz, 2H), 3.48 (t, J = 8.4 Hz, 2H), 3.39 (s, 2H), 3.07 (t, J = 8.4 Hz, 2H), 1.36 (s, 3H).
[0327] Example 24
[0328] Synthesis of 1-(6-(1-((3-methyloxetan-3-yl)methyl)-2,3-dihydro-1H-indol-5-yl)pyrazin-2-yl)-3-(4,5,6,7-tetrahydropyrazolo[1,5-a]pyridin-6-yl)urea:
[0329]
[0330] First step: To a solution of 6-bromopyrazolo[1,5-a]pyridine (2.5 g, 12.69 mmol, 1.0 eq), dimethyl sulfoxide (1.66 g, 21.19 mmol, 1.67 eq) and triethylamine (3.85 g, 38.07 mmol, 3.0 eq) in methanol (50 mL) was added bis(triphenylphosphine)palladium(II) dichloride (891 mg, 3.807 mmol, 0.1 eq). The reaction mixture was stirred at 100 °C under carbon monoxide (16 atm) for 16 h. After completion of the reaction, the reaction mixture was cooled to 25 °C. The reaction mixture was concentrated and separated by flash silica gel chromatography (PE / EA = 1 / 1) to obtain compound 60a (2.0 g, yield: 89%). MS (ESI): m / z 177.0 (M+H) + . 1 1H NMR (400 MHz, CDCl3) δ 9.20 (s, 1H), 8.22 (d, J = 2.0 Hz, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.62–7.55 (m, 1H), 6.76 (s, 1H), 3.90 (s, 3H).
[0331] Step 2: Aqueous solution of sodium hydroxide (794.69 mg, 19.87 mmol, 3.0 eq) in water (5 mL) was added to a solution of compound 60a (700 mg, 3.97 mmol, 1.0 eq) in methanol (5 mL). The reaction mixture was stirred at 110 °C for 1 hour. After completion of the reaction, the reaction mixture was cooled to 25 °C. Methanol was removed by rotary evaporation under reduced pressure, and the residue was diluted with water (20 mL). The pH of the reaction mixture was adjusted to 4 with 1 M dilute hydrochloric acid. The precipitate was filtered, and the filter cake was washed with water and dried by rotary evaporation to obtain compound 60b (500 mg, yield: 77%). 1 HNMR (400 MHz, DMSO-d6) δ 13.29 (s, 1H), 9.15 (s, 1H), 8.19 (d, J = 2.0 Hz, 1H), 7.77 (d, J = 4.0 Hz, 1H), 7.60–7.55 (m, 1H), 6.74 (s, 1H).
[0332] Step 3: Palladium on carbon (140 mg, 10% wet palladium on carbon) was added to a solution of compound 60b (500 mg, 3.08 mmol, 1.0 eq) in methanol (5 mL). The reaction mixture was stirred at 40 °C under hydrogen for 16 hours. After completion of the reaction, the reaction mixture was cooled to 25 °C. The reaction mixture was filtered through a layer of diatomaceous earth, and the filtrate was dried by rotary evaporation to obtain compound 60c (500 mg, yield: 97%). 1 HNMR (400 MHz, DMSO-d6) δ 12.82 (s, 1H), 7.34 (d, J = 1.6 Hz, 1H), 6.02–5.94 (m, 1H), 4.27–4.20 (m, 1H), 4.15–4.07 (m, 1H), 3.11–3.00 (m, 1H), 2.87–2.69 (m, 2H), 2.17–2.05 (m, 1H), 1.94–1.81 (m, 1H).
[0333] Step 4: Compound 4b (2 g, 6.07 mmol, 1 eq) was added to a mixed solvent of 1,4-dioxane (30 mL) and water (3 mL) in a 100 mL single-necked flask. Then 6-chloropyrazin-2-amine (1.97 g, 15.17 mmol, 2.5 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (500 mg, 0.60 mmol, 0.1 eq), and sodium carbonate (1.28 g, 12.12 mmol, 2.0 eq) were added. After the reaction system was purged with nitrogen, it was stirred at 100 °C for 16 hours. The reaction mixture was filtered, concentrated, and loaded onto a column for flash silica gel chromatography (PE:EA = 1:1) to obtain compound 60d (1.5 g, yield: 83.4%). MS (ESI): m / z 297.0 (M+H) + .
[0334] Step 5: Diphenyl phosphorazidate (112.15 mg, 0.68 mmol, 2.0 eq) was added to a toluene (4 mL) solution of compound 60c (100 mg, 0.34 mmol, 1.0 eq), compound 60d (112.14 mg, 0.68 mmol, 2.0 eq) and triethylamine (102.22 mg, 1.02 mmol, 3.0 eq). The reaction mixture was stirred at 100 °C under nitrogen for 16 h. After completion of the reaction, the reaction mixture was cooled to 25 °C. The mixture was filtered and the filtrate was concentrated in vacuo to obtain the crude product, which was separated and purified by preparative reverse-phase HPLC to give the title compound 60 (30 mg, yield: 19.4%). MS (ESI): m / z 459.8 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.41 (s, 1H), 8.61 (s, 1H), 8.59 (s, 1H), 7.93 (d, J = 6.0 Hz, 1H), 7.69–7.67 (m, 1H), 7.65–7.60 (m, 1H), 7.40 (d, J = 2.0 Hz, 1H), 6.56 (d, J = 8.4 Hz, 1H), 6.05 (d, J = 1.6 Hz, 1H), 4.48 (d, J = 5.6 Hz, 2H), 4.36–4.25 (m, 4H), 4.05–4.00 (m, 1H), 3.43 (t, J = 8.4 Hz, 2H), 3.36–3.34 (m, 2H), 3.01 (t, J = 8.4 Hz, 2H), 2.92–2.85 (m, 2H), 2.10–2.04 (m, 1H), 2.03–1.93 (m, 1H), 1.32 (s, 3H).
[0335] Example 25
[0336] Synthesis of 1-(1H-indazol-6-yl)-3-(6-(3-methyl-4-((3-methyloxetan-3-yl)methoxy)phenyl)pyrazin-2-yl)urea:
[0337]
[0338] Compound 70 was synthesized in the same manner as in Example 13, with 6-aminoindazole replacing compound 13b in the third step. Compound 70: MS (ESI): m / z 445.2 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 12.89 (s, 1H), 10.02 (s, 1H), 9.73 (s, 1H), 8.90 (s, 1H), 8.80 (s, 1H), 8.06 (s, 1H), 7.98–7.94 (m, 3H), 7.70 (d, J = 8.4 Hz, 1H), 7.17 (d, J = 9.2 Hz, 1H), 6.96 (dd, J = 8.8, 1.6 Hz, 1H), 4.56 (d, J = 5.6 Hz, 2H), 4.35 (d, J = 5.6 Hz, 2H), 4.14 (s, 2H), 2.28 (s, 3H), 1.42 (s, 3H).
[0339] Example 26
[0340] Synthesis of 1-(6-(3-methyl-4-(methyl((1-methyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)amino)phenyl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0341]
[0342] First step: 2-Chloropyridine-3-carbaldehyde (2.00 g, 14.13 mmol, 1 eq) was dissolved in 3 M hydrochloric acid (4 mL), 30% hydrogen peroxide (0.5 mL) was added, and the mixture was stirred at 100 °C under microwave for 2 hours. LCMS showed that the reaction was complete. The reaction solution was adjusted to pH 7 with solid sodium bicarbonate, and a solid precipitated. The solid was filtered and recrystallized with a small amount of ethanol to obtain compound 109a (1.20 g, yield: 69%). MS (ESI): m / z 124.1 (M+H) + .
[0343] Second step: Compound 109a (1.70 g, 13.81 mmol, 1 eq) was dissolved in N,N-dimethylformamide (20 mL), cesium carbonate (9.00 g, 27.62 mmol, 2 eq) was added, and after stirring for 20 minutes, methyl iodide (3.92 mL, 27.62 mmol, 2 eq) was added. The mixture was stirred at room temperature overnight. LCMS showed that the reaction was complete. The reaction solution was directly concentrated to dryness under reduced pressure, mixed with silica gel, and separated by flash silica gel chromatography (DCM:MeOH = 10:1) to obtain compound 109b (1.10 g, yield: 58.1%). MS (ESI): m / z 138.1 (M+H) + .
[0344] Step 3: Compound 109b (1.10 g, 8.02 mmol, 1 eq) and 4-bromo-2-methylaniline (2.98 g, 16.04 mmol, 2 eq) were dissolved in methanol (20 mL), and sodium cyanoborohydride (960 mg, 16.04 mmol, 2 eq) was added in batches. The mixture was stirred at room temperature overnight. LCMS showed that the reaction was complete. The reaction solution was separated by flash silica gel chromatography (DCM:MeOH = 10:1) to obtain compound 109c (1.3 g, yield: 52.8%). MS (ESI): m / z 307.0 (M+H) + .
[0345] Step 4: Compound 109c (300 mg, 0.98 mmol, 1 eq) and cesium carbonate (636 mg, 1.95 mmol, 2 eq) were dissolved in N,N-dimethylformamide (3 mL). The mixture was stirred at room temperature for 30 minutes, and methyl iodide (208 mg, 1.46 mmol, 1.5 eq) was added dropwise. The mixture was stirred at room temperature overnight. LCMS showed that the reaction was complete. The reaction solution was directly concentrated to dryness under reduced pressure and separated by flash silica gel chromatography (PE:EA = 10:1) to obtain compound 109d (150 mg, yield: 45.2%). MS (ESI): m / z 321.0 (M+H) + .
[0346] Step 5: Compound 109d (130 mg, 0.4 mmol, 1 eq), bis(pinacolato)diboron (154 mg, 0.61 mmol, 1.5 eq), potassium acetate (80 mg, 0.81 mmol, 2 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (30 mg, 0.04 mmol, 0.1 eq) were successively added to dioxane (5 mL). The mixture was stirred at 100 °C under argon protection overnight. LCMS showed that the reaction was complete. The reaction solution was directly concentrated to dryness under reduced pressure and then separated by flash silica gel chromatography (PE:EA = 1:1) to obtain compound 109e (80 mg, yield: 53.7%). MS (ESI): m / z 369.3 (M+H) + .
[0347] Step 6: Compound 109e (80 mg, 0.22 mmol, 1 eq), intermediate A (52 mg, 0.2 mmol, 0.9 eq), cesium carbonate (142 mg, 0.43 mmol, 2 eq) and dichlorobis (diphenylphosphino) ferrocene palladium (II) (16 mg, 0.022 mmol, 0.1 eq) were successively added to a mixed solution of dioxane (5 mL) and water (0.5 mL). The mixture was stirred at 100 °C overnight under argon protection. LCMS showed that the reaction was complete. After filtration, the reaction solution was purified by silica gel preparative plate (EA:PE = 9:1, UV254 nm) to obtain the crude product, which was further purified by reverse preparative chromatography Pre-HPLC to obtain the title compound 109 (3.61 mg, yield: 3.5%). MS (ESI): m / z 470.2 (M+H) + . 1 H NMR (400 MHz, DMSO-d6) δ 9.97 (s, 1H), 9.78 (s, 1H), 8.88 (s, 1H), 8.79 (s, 1H), 8.53 (d, J = 2.4 Hz, 1H), 7.92–7.85 (m, 3H), 7.63 (dd, J = 6.8, 2.0 Hz, 1H), 7.44 (dd, J = 6.8, 2.0 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 7.18 (d, J = 8.4 Hz, 1H), 6.24 (t, J = 6.8 Hz, 1H), 3.97 (s, 2H), 3.46 (s, 3H), 2.71 (s, 3H), 2.43 (s, 3H), 2.34 (s, 3H).
[0348] Example 27
[0349] Synthesis of 1-(6-(3-methyl-4-(methyl((1-methyl-1H-pyrazol-3-yl)methyl)amino)phenyl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0350]
[0351] Step 1: 1-Methyl-1H-pyrazole-3-carbaldehyde (5.00 g, 45.41 mmol, 1.0 eq) and 4-bromo-2-methylaniline (8.45 g, 45.41 mmol, 1.0 eq) were dissolved in methanol (200 mL). Sodium cyanoborohydride (7.13 g, 113.52 mmol, 2.5 eq) was added portionwise under an ice-water bath. The mixture was warmed to room temperature and stirred overnight. LCMS monitoring showed the formation of the product. The reaction system was concentrated under reduced pressure and separated by flash silica gel chromatography (PE:EA = 10:1 - 4:1) to obtain compound 111a (1.47 g, yield: 11.6%). MS (ESI): m / z 280.0 (M+H)+ .
[0352] Step 2: Compound 111a (150 mg, 0.54 mmol, 1 eq) was added to N,N-dimethylformamide (5 mL). After purging with argon, sodium hydride (60%, 43 mg, 1.087 mmol, 2 eq) was added under an ice bath. After reacting with heat preservation for half an hour, methyl iodide (152 mg, 1.07 mmol, 2 eq) was added. After sealing the tube, the temperature was raised to 90 °C and reacted for 3 hours. After the reaction solution was cooled to room temperature, water (30 mL) was added to quench the reaction. It was extracted with ethyl acetate, washed with water, washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated by rotary evaporation. The crude product was separated by flash silica gel column chromatography (PE:EA = 10:1 - 3:1) to obtain compound 111b (150 mg, yield: 71%). MS (ESI): m / z 294.0 (M+H) + .
[0353] Step 3: Compound 111b (135 mg, 0.46 mmol, 1 eq), potassium acetate (135 mg, 1.38 mmol, 3 eq), bis(pinacolato)diboron (175 mg, 0.69 mmol, 1.5 eq), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (14 mg, 10%) were successively added to dioxane (5 mL). After purging with argon three times, the mixture was heated to 100 °C and reacted for 18 hours. The formation of the product was monitored by LCMS. After the reaction solution was cooled, it was filtered through diatomaceous earth. After mixing with silica gel, it was separated by flash silica gel column chromatography (PE:EA = 3:20 - 3:10) to obtain compound 111c (140 mg, yield: 81%). MS (ESI): m / z 342.2 (M+H) + .
[0354] Step 4: Intermediate A (61 mg, 0.23 mmol, 1 eq), compound 111c (118 mg, 0.35 mmol, 1.5 eq), and sodium carbonate (73 mg, 0.69 mmol, 3 eq) were successively added to a mixed solvent of dioxane (1.8 mL) and water (0.2 mL). [1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium (10 mg, 10%) was added. After purging with argon three times, the temperature was raised to 100 °C and reacted for 5 hours. The complete reaction of the raw materials was monitored by LCMS. The reaction solution was added with ethyl acetate (10 mL) and saturated brine (10 mL) and washed once, dried over anhydrous sodium sulfate, filtered and concentrated by rotary evaporation. The crude product was purified by reverse preparative chromatography Pre-HPLC to obtain the title compound 111 (5 mg, yield: 4.9%). MS (ESI): m / z 443.3 (M+H) + . 11H NMR (400 MHz, DMSO-d6) δ 9.87 (s, 1H), 9.75 (s, 1H), 8.86 (s, 1H), 8.79 (s, 1H), 8.53 (s, 1H), 7.94–7.83 (m, 3H), 7.59 (d, J = 2.4 Hz, 1H), 7.24 (d, J = 8.4 Hz, 1H), 7.16 (d, J = 8.4 Hz, 1H), 6.09 (d, J = 2.4 Hz, 1H), 4.03 (s, 2H), 3.79 (s, 3H), 2.67 (s, 3H), 2.43 (s, 6H).
[0355] Example 28
[0356] Synthesis of 1-(6-methylpyridin-3-yl)-3-{6-[1-(pyrrolidin-3-yl)-2,3-dihydro-1H-indol-5-yl]pyrazin-2-yl}urea hydrochloride:
[0357]
[0358] First step: Dissolve 5-bromoindoline (2.00 g, 10.1 mmol, 1 equiv.), 1-tert-butoxycarbonylpyrrolidin-3-one (2.81 g, 15.15 mmol, 1.5 equiv.) in methanol (100 mL). After stirring the reaction at room temperature for 2 hours, add acetic acid (3 mL), and then add sodium cyanoborohydride (3.02 g, 50.49 mmol, 5 equiv.) in portions. Stir the reaction system overnight. LCMS shows that the reaction is complete. Rotate off the solvent, dissolve in water, extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, concentrate, and separate by flash silica gel column chromatography to obtain compound 114a (3.3 g, yield: 89%). MS (ESI): m / z 367.19 (M+H) + ; 1 1H NMR (400 MHz, CDCl3) δ 7.14 (s, 2H), 6.33 (d, J = 8.8 Hz, 1H), 4.10–3.93 (m, 1H), 3.76–3.46 (m, 2H), 3.44–3.25 (m, 4H), 2.94 (t, J = 8.3 Hz, 2H), 2.17–1.96 (m, 2H), 1.44 (s, 9H).
[0359] Step 2: Add compound 114a (1.00 g, 2.72 mmol, 1 equiv.), bis(pinacolato)diboron (830 mg, 3.27 mmol, 1.2 equiv.), Pd(dppf)Cl2 (398 mg, 0.55 mmol, 0.2 equiv.), and potassium acetate (1.069 g, 10.89 mmol, 4 equiv.) to 1,4-dioxane (30 mL). The reaction system was evacuated and refilled with nitrogen three times, and stirred at 90 °C for 8 hours. The solvent was evaporated, dissolved in water, extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, concentrated, and separated by flash silica gel chromatography (PE:EA = 20:1 - 10:1) to obtain compound 114b (612 mg, yield: 54%). MS (ESI): m / z 415.42 (M+H) + ; 1 1H NMR (400 MHz, CDCl3): δ 7.67–7.48 (m, 2H), 6.48 (t, J = 9.6 Hz, 1H), 4.34–4.14 (m, 1H), 3.75–3.50 (m, 2H), 3.50–3.29 (m, 4H), 2.96 (t, J = 8.3 Hz, 2H), 2.20–2.05 (m, 2H), 1.45 (s, 9H), 1.35–1.29 (m, 12H).
[0360] Step 3: Add 114b (512 mg, 1.24 mmol, 1 equiv.), intermediate A, Pd(dppf)Cl2 (342 mg, 0.12 mmol, 0.1 equiv.), potassium carbonate (342 mg, 2.47 mmol, 2 equiv.), 1,4-dioxane (20 mL) and water (5 mL) to a 100 mL single-necked flask. The reaction system was evacuated and refilled with nitrogen three times, and stirred at 90 °C for 4 hours. The solvent was evaporated, dissolved in water, extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, concentrated, and prepared by reverse preparative chromatography pre-HPLC to obtain compound 114c (330 mg, yield: 50%). MS (ESI): m / z 516.38 (M+H) + ; 11H NMR (400 MHz, DMSO-d6) δ 8.54 (s, 2H), 8.39 (s, 1H), 8.02 (d, J = 8.7 Hz, 1H), 7.80–7.70 (m, 2H), 7.28 (d, J = 8.6 Hz, 1H), 6.65 (d, J = 8.3 Hz, 1H), 4.31 (d, J = 7.7 Hz, 1H), 3.70–3.49 (m, 4H), 3.40 (dd, J = 11.1, 6.4 Hz, 2H), 3.05 (t, J = 8.1 Hz, 2H), 2.49 (d, J = 9.1 Hz, 3H), 2.17 (d, J = 8.6 Hz, 2H), 1.48 (d, J = 2.3 Hz, 9H).
[0361] Step 4: Add compound 114c (100 mg, 0.19 mmol, 1 equiv.) and ethyl acetate solution of hydrogen chloride (4 M, 10 mL) into a 10 mL single-necked flask, stir at room temperature for 2 hours. LCMS shows that the reaction is complete. Filter, wash the filter cake with ethyl acetate (20 mL), and dry to obtain the title compound 114 (39.40 mg, yield: 46%). MS (ESI): m / z 416.39 (M + H) + ; 1 1H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 10.07 (s, 1H), 9.51 (d, J = 31.3 Hz, 2H), 9.07–8.89 (m, 2H), 8.79 (s, 1H), 8.31 (dd, J = 8.7, 2.3 Hz, 1H), 7.85 (dd, J = 18.3, 8.2 Hz, 3H), 6.70 (d, J = 8.4 Hz, 1H), 4.50–4.45 (m, 1H), 3.64–3.48 (m, 2H), 3.47–3.28 (m, 2H), 3.19 (m, 2H), 3.03 (t, J = 8.3 Hz, 2H), 2.69 (s, 3H), 2.26–1.97 (m, 2H).
[0362] Example 29
[0363] Synthesis of 3-(6-chloropyridin-3-yl)-1-(6-{1-[(3-methyloxan-3-yl)methyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)urea:
[0364]
[0365] Step 1: To a solution of 5-bromo-2,3-dihydro-1H-indole (1 g, 5.05 mmol, 1.0 equiv.) in dichloromethane (20 mL), add 3-methyloxetan-3-carbaldehyde (606 mg, 6.06 mmol, 1.2 equiv.), glacial acetic acid (0.1 mL, 1.67 mmol, 0.33 equiv.), and sodium triacetoxyborohydride (2.13 g, 10.1 mmol, 2.0 equiv.). Stir at 25 °C for 15 h under nitrogen protection. LCMS shows that the reaction is complete. Quench the reaction mixture by adding water (30 mL), extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate. Purify the residue by flash silica gel chromatography (PE / EtOAc = 8 / 1) to obtain compound 115a (1.4 g, yield: 98%). MS (ESI): m / z 283.8 (M+H) + ; 1 H NMR (400 MHz, CDCl3): δ 7.17 - 7.15 (m, 2H), 6.32 (d, J = 8.0 Hz, 1H), 4.60 (d, J = 5.6 Hz, 2H), 4.45 (d, J = 5.6 Hz, 2H), 3.40 (t, J = 8.4 Hz, 2H), 3.24 (s, 2H), 3.00 (t, J = 8.4 Hz, 2H), 1.43 (s, 3H).
[0366] Step 2: To a solution of compound 115a (1.4 g, 4.96 mmol, 1.0 equiv.) in 1,4-dioxane (20 mL), add bis(pinacolato)diboron (1.9 g, 7.44 mmol, 1.5 equiv.), potassium acetate (1.2 g, 12.4 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (397 mg, 0.49 mmol, 0.1 equiv.). Stir at 100 °C for 3 h under nitrogen protection. LCMS shows that the reaction is complete. Cool to room temperature, add water (30 mL) to the reaction mixture, extract with ethyl acetate, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate. Purify the residue by flash silica gel chromatography (PE / EtOAc = 3 / 1) to obtain compound 115b (900 mg, yield: 55%). MS (ESI): m / z 330.0 (M+H) + ; 11H NMR (400 MHz, CDCl3): δ 7.55 (d, J = 7.8 Hz, 1H), 7.51 (s, 1H), 6.41 (d, J = 7.8 Hz, 1H), 4.57 (d, J = 5.8 Hz, 2H), 4.40 (d, J = 5.8 Hz, 2H), 3.40 (t, J = 8.4 Hz, 2H), 3.29 (s, 2H), 3.00 (t, J = 8.4 Hz, 2H), 1.37 (s, 3H), 1.31 (s, 12H).
[0367] Step 3: To a solution of compound 115b (2.5 g, 7.59 mmol, 1.0 equiv.) in 1,4-dioxane (30 mL) and water (3 mL), add 6-chloropyrazine-2-carboxylic acid (1.44 g, 9.11 mmol, 1.2 equiv.), sodium carbonate (2.01 g, 18.9 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane complex (648 mg, 0.8 mmol, 0.1 equiv.). Stir at 100 °C for 3 h under a nitrogen atmosphere. LCMS indicates complete reaction. Filter and concentrate the filtrate. Purify the residue by flash silica gel column chromatography (DCM / MeOH = 10 / 1) to obtain compound 115c (1.1 g, yield: 44.5%). MS (ESI): m / z 326.0 (M + H) + 。
[0368] Step 4: To a solution of compound 115c (50 mg, 0.15 mmol, 1.0 equiv.) in toluene (Tol, 2 mL), add 6-chloropyridin-3-amine (24 mg, 0.18 mmol, 1.2 equiv.), triethylamine (47 mg, 0.46 mmol, 3.0 equiv.), and diphenyl phosphorazidate (85 mg, 0.31 mmol, 2.0 equiv.). Stir at 100 °C for 15 h under a nitrogen atmosphere. LCMS indicates complete reaction. Concentrate the reaction mixture and purify the residue by reverse preparative chromatography Prep-HPLC to obtain the title compound 115 (12 mg, yield: 17.3%). MS (ESI): m / z 451.2 (M + H) + ; 11H NMR (400 MHz, DMSO): δ 10.07 (s, 1H), 9.77 (s, 1H), 8.76 (s, 1H), 8.73 (s, 1H), 8.52 (d, J = 2.8 Hz, 1H), 8.08 (dd, J = 8.8, 2.8 Hz, 1H), 7.82 - 7.80 (m, 2H), 7.51 (d, J = 8.8 Hz, 1H), 6.64 (d, J = 9.2 Hz, 1H), 4.51 (d, J = 5.6 Hz, 2H), 4.30 (d, J = 5.6 Hz, 2H), 3.47 (t, J = 8.0 Hz, 2H), 3.42 (s, 2H), 3.08 (d, J = 8.0 Hz, 2H), 1.35 (s, 3H).
[0369] Example 30
[0370] Synthesis of 1-(6-{7-methoxy-1-[(3-methyloxetan-3-yl)methyl]-1H-indazol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0371]
[0372] First step: To acetonitrile (10 mL) of 2-methoxy-6-methylaniline (1.0 g, 7.29 mmol, 1.0 equiv.) was added N-bromosuccinimide (1.69 g, 9.48 mmol, 1.3 equiv.), and the mixture was stirred at 25 °C for 15 h. LCMS showed that the reaction was complete. Water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash silica gel column chromatography (PE / EtOAc = 5 / 1) to obtain compound 116a (650 mg, yield 41.3%). MS (ESI): m / z 215.8 (M + H) + ; 1 1H NMR (400 MHz, CDCl3): δ 6.86 (d, J = 1.2 Hz, 1H), 6.81 (d, J = 2.0 Hz, 1H), 3.85 (s, 3H), 2.16 (s, 3H).
[0373] Step 2: To a solution of compound 116a (500 mg, 2.31 mmol, 1.0 equiv.) in toluene (20 mL) were added glacial acetic acid (972 mg, 16.2 mmol, 7.0 equiv.), potassium acetate (1.8 g, 18.5 mmol, 8.0 equiv.), and tert-butyl nitrite (358 mg, 3.47 mmol, 1.5 equiv.). The mixture was stirred at 25 °C for 15 h under a nitrogen atmosphere. LCMS indicated the completion of the reaction. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layers were combined, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash silica gel chromatography (PE / EtOAc = 3 / 1) to afford compound 116b (200 mg, yield: 38%). MS (ESI): m / z 229.0 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.96 (s, 1H), 7.47 (d, J = 1.2 Hz, 1H), 6.82 (s, 1H), 3.97 (s, 3H).
[0374] Step 3: To a solution of compound 116b (180 mg, 0.79 mmol, 1.0 equiv.) in N,N-dimethylformamide (5 mL) was added sodium hydride (80 mg, 2.0 mmol, 2.5 equiv., purity 60%) at 0 °C, followed by 3-(chloromethyl)-3-methyloxetane (144 mg, 1.19 mmol, 1.5 equiv.). The mixture was stirred at 25 °C for 15 h under a nitrogen atmosphere. LCMS indicated the completion of the reaction. Water (20 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layers were combined, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash silica gel chromatography (PE / EtOAc = 3 / 1) to afford compound 116c (90 mg, yield: 36.5%). MS (ESI): m / z 310.8 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.85 (s, 1H), 7.42 (d, J = 1.2 Hz, 1H), 6.78 (d, J = 1.2 Hz, 1H), 4.79 (s, 2H), 4.76 (d, J = 6.0 Hz, 2H), 4.33 (d, J = 6.0 Hz, 2H), 3.94 (s, 3H), 1.20 (s, 3H).
[0375] Step 4: To a solution of compound 116c (200 mg, 0.64 mmol, 1.0 equiv.) in 1,4-dioxane (20 mL), bis(pinacolato)diboron (243 mg, 0.96 mmol, 1.5 equiv.), potassium acetate (157 mg, 1.6 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (49 mg, 0.06 mmol, 0.1 equiv.) were added. The mixture was stirred at 100 °C for 3 h under nitrogen protection. LCMS showed that the reaction was complete. Water (30 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layers were combined, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash silica gel column chromatography (PE / EtOAc = 3 / 1) to give compound 116d (190 mg, yield: 82.5%). MS (ESI): m / z 359.0 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.97 (s, 1H), 7.87 (s, 1H), 7.11 (s, 1H), 4.87 (s, 2H), 4.83 (d, J = 6.0 Hz, 2H), 4.36 (d, J = 6.0 Hz, 2H), 4.02 (s, 3H), 1.39 (s, 12H), 1.26 (s, 3H).
[0376] Step 5: To a solution of compound 116d (190 mg, 0.53 mmol, 1.0 equiv.) in 1,4-dioxane (10 mL) and water (2 mL), intermediate A (168 mg, 0.64 mmol, 1.2 equiv.), sodium carbonate (140 mg, 1.32 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (40 mg, 0.05 mmol, 0.1 equiv.) were added. The mixture was stirred at 100 °C for 15 h under nitrogen protection. LCMS showed that the reaction was complete. The mixture was filtered, and the filtrate was concentrated. The residue was purified by reverse preparative chromatography Prep-HPLC to give the title compound 116 (45 mg, yield: 18.9%). MS (ESI): m / z 460.3 (M+H) + ; 11H NMR (EN1079-081-P) (400 MHz, DMSO): δ 9.66 - 9.64 (m, 2H), 8.93 (s, 1H), 8.88 (s, 1H), 8.48 (d, J = 2.8 Hz, 1H), 8.15 (s, 1H), 8.05 (s, 1H), 7.84 (dd, J = 8.4, 2.8 Hz, 1H), 7.50 (d, J = 1.2 Hz, 1H), 7.20 (d, J = 8.4 Hz, 1H), 4.78 (s, 2H), 4.60 (d, J = 6.0 Hz, 2H), 4.18 (d, J = 6.0 Hz, 2H), 4.00 (s, 3H), 2.38 (s, 3H), 1.09 (s, 3H).
[0377] Example 31
[0378] Synthesis of 1-(6-{1-[2-(dimethylamino)ethyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea formate:
[0379]
[0380] First step: Dissolve 5-bromo-2,3-dihydro-1H-indole (500 mg, 2.52 mmol, 1 equiv.), 2-(dimethylamino)acetaldehyde hydrochloride (405.57 mg, 3.28 mmol, 1.3 equiv.), and zinc chloride (34.41 mg, 0.25 mmol, 0.1 equiv.) in methanol (10 mL), stir at room temperature for 2 hours. LCMS shows that the reaction is complete. Pour the reaction solution into saturated NaHCO3 (200 mL), extract with ethyl acetate, combine the organic phases, dry with sodium sulfate, filter, and concentrate the filtrate to obtain the crude product. The crude product is separated by flash silica gel chromatography (PE / EtOAc = 3 / 1 - DCM / MeOH = 10 / 1) to obtain compound 117a (260 mg, yield: 38.3%). MS (ESI): m / z 269.10 (M + H) + ; 1 1H NMR (400 MHz, CDCl3) δ 7.19–7.10 (m, 2H), 6.34 (d, J = 8.8 Hz, 1H), 3.40 (t, J = 8.4 Hz, 2H), 3.20 (t, J = 7.0 Hz, 2H), 2.95 (t, J = 8.3 Hz, 2H), 2.61 (t, J = 7.0 Hz, 2H), 2.37 (s, 6H).
[0381] Step 2: Add compound 117a (200 mg, 0.74 mmol, 1 equiv.), bis(pinacolato)diboron (283.02 mg, 1.11 mmol, 1.5 equiv.), potassium acetate (218.75 mg, 2.23 mmol, 3 equiv.) and Pd(dppf)Cl2 (51.22 mg, 0.07 mmol, 0.1 equiv.) to dioxane (6 mL). Protect with nitrogen, heat to 100 °C and stir for 2 h. Dilute the reaction solution with 50 mL of ethyl acetate, filter, concentrate the filtrate to obtain the crude product, and separate the crude product by flash silica gel chromatography (ethyl acetate / petroleum ether = 0 - 90%, then methanol / dichloromethane = 0 - 11%) to obtain compound 117b (100 mg, crude product). MS(ESI): m / z 317.2(M + H) + .
[0382] Step 3: Add compound 117b (100 mg, 0.32 mmol, 1 equiv.), intermediate A (91.71 mg, 0.35 mmol, 1.1 equiv.), sodium carbonate (67.83 mg, 0.64 mmol, 2.0 eq.) and dichloride [1,1'-bis(diphenylphosphino)ferrocene] palladium (23.39 mg, 0.03 mmol, 0.1 equiv.) to the mixed solution of dioxane and water (5 mL, 4:1) in turn. Replace with nitrogen 3 times, heat to 100 °C and stir for 3 h. Cool to room temperature, dilute with ethyl acetate (50 mL), filter, concentrate the filtrate to obtain the crude product, and purify the crude product through a C18 column (acetonitrile / water = 0 - 80%, the aqueous phase contains 0.1% wt formic acid) to obtain the title compound 117 (15 mg, yield: 11.2%). MS(ESI): m / z 418.2(M + H) + ; 1 H NMR(400 MHz, MeOD) δ8.56(s, 1H), 8.53(s, 1H), 8.52(s, 1H), 8.44(s, 1H), 8.03(dd, J = 8.4, 2.7 Hz, 1H), 7.78(d, J = 9.9 Hz, 2H), 7.28(d, J = 8.5 Hz, 1H), 6.73(d, J = 8.2 Hz, 1H), 3.54(t, J = 8.4 Hz, 2H), 3.47(t, J = 6.5 Hz, 2H), 3.10(dd, J = 10.7, 6.7 Hz, 4H), 2.71(s, 6H), 2.50(s, 3H).
[0383] Example 32
[0384] Synthesis of 1-(6-(1-(2-Hydroxypropyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0385]
[0386] First step: Dissolve 5-bromoindoline (1.00 g, 5.0 mmol, 1.0 equiv.) in anhydrous THF (10 mL) solution. Under nitrogen protection, add sodium hydride (0.4 g, 10.0 mmol, 60% Purity, 2 equiv.) at 0 °C. After stirring for 10 min, slowly add propylene oxide (0.44 g, 7.5 mmol, 1.5 equiv.). Raise the temperature to room temperature and stir for 16 hours. Cool the reaction solution to room temperature, quench with ice water (10 mL). Extract the aqueous phase with ethyl acetate, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate. The residue is separated by flash silica gel chromatography (PE:EA = 5:1) to obtain compound 118a (800 mg, yield: 61.5%). 1 1H NMR (400 MHz, DMSO-d6) δ 7.13 (s, 1H), 7.09 (d, J = 8.4 Hz 1H), 6.39 (d, J = 8.4 Hz, 1H), 4.69 (d, J = 4.4 Hz, 1H), 3.97–3.78 (m, 1H), 3.55–3.40 (m, 2H), 2.96 - 2.88 (m, 4H), 1.14–1.07 (d, J = 6.0 Hz, 3H).
[0387] Second step: Add compound 118a (871 mg, 3.43 mmol, 1.1 equiv.), potassium acetate (611 mg, 6.24 mmol, 2.0 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (226 mg, 0.31 mmol, 0.1 equiv.) to 1,4-dioxane (10 mL) solution. Stir and react at 100 °C for 16 hours under nitrogen protection. Concentrate the reaction solution under reduced pressure. The residue is separated by flash silica gel chromatography (PE:EA = 5:1) to obtain compound 118b (700 mg, yield: 73.9%). MS (ESI): m / z 304.0 (M+H) + .
[0388] Step 3: To a solution of compound 118b (200 mg, 0.66 mmol, 1.0 equiv.) in dioxane (10 mL), an aqueous solution (2 mL) of intermediate A (192 mg, 0.73 mmol, 1.1 equiv.) and sodium carbonate (140 mg, 1.32 mmol, 2.0 equiv.) was added. Under nitrogen protection, [1,1'-bis(diphenylphosphino)ferrocene] palladium dichloride (51.2 mg, 0.07 mmol, 0.1 equiv.) was added, and the reaction was stirred at 100 °C for 16 h. LCMS showed that the reaction was complete. The reaction solution was cooled to room temperature, concentrated, and the residue was added to water (20 mL). The mixture was extracted with ethyl acetate, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated, and the residue was separated by flash silica gel column chromatography (PE / EtOAc = 1 / 9) to obtain 100 mg of the crude title compound 118. The title compound 118 (42.53 mg, 0.105 mmol, yield 16.9%) was further separated and purified by reverse preparative chromatography Pre-HPLC. MS (ESI): m / z 405.2 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.99 (s, 1H), 9.69 (s, 1H), 8.69 (s, 1H), 8.67 (s, 1H), 8.56 (s, 1H), 7.93 (d, J = 8.8 Hz, 1H), 7.79 - 7.71 (m, 2H), 7.30 (d, J = 8.0 Hz, 1H), 6.55 (d, J = 8.0 Hz, 1H), 4.73 (s, 1H), 3.93 - 3.88 (m, 1H), 3.58 (t, J = 8.4 Hz, 2H), 3.09 - 3.04 (m, 2H), 3.01 (t, J = 8.8 Hz, 2H), 2.48 (s, 3H), 1.11 (d, J = 6.4 Hz, 3H).
[0389] Example 33
[0390] (S)-1-(6-(1-((3-Methyloxan-3-yl)methyl)-1H-indol-5-yl)pyrazin-2-yl)-3-(piperidin-3-yl)urea synthesis:
[0391]
[0392] Step 1: In a 100 mL single-necked flask, compound 60d (500 mg, 1.69 mmol, 1 equiv.) was added to a toluene (10 mL) solvent, followed by (3S)-1-[(tert-butoxy)carbonyl]piperidine-3-carboxylic acid (580.2 mg, 2.53 mmol, 1.5 eq), diphenylphosphoryl azide (927.5 mg, 3.37 mmol, 2.0 eq), and triethylamine (511.5 mg, 5.05 mmol, 3.0 eq). After purging the reaction system with nitrogen, it was stirred at 100 °C for 16 hours. LCMS showed that the reaction was complete. The reaction solution was filtered, concentrated, and loaded onto a column, and separated by flash silica gel chromatography (PE:EA = 1:1) to obtain compound 119a (370 mg, yield 42.0%). MS(ESI): m / z 523.0 (M+H) + .
[0393] Step 2: In a 100 mL single-necked flask, compound 119a (100 mg, 0.19 mmol, 1 equiv.) was added to a dichloromethane (10 mL) solvent, and trifluoroacetic acid (2 mL, 17.54 mmol, 183.3 eq) was added dropwise. After purging the reaction system with nitrogen, it was stirred at 25 °C for 1 hour to obtain a red-brown liquid. LCMS showed that the reaction was complete. The reaction solution was dried, then dissolved in N,N-dimethylformamide, and purified by reverse preparative chromatography Pre-HPLC (formic acid as an additive) to obtain the title compound 119 (54.52 mg, yield 69.4%). MS(ESI): m / z 423.4 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.54 (s, 1H), 8.61 (s, 1H), 8.52 (s, 1H), 8.22 - 8.12 (m, 1H), 7.81 - 7.74 (m, 2H), 6.61 (d, J = 8.4 Hz, 1H), 4.50 (d, J = 5.6 Hz, 2H), 4.30 (d, J = 5.6 Hz, 2H), 3.90–3.80 (m, 2H), 3.37 (s, 2H), 3.22 - 3.14 (m, 2H), 3.08–2.92 (m, 3H), 2.83–2.69 (m, 2H), 1.96 - 1.86 (m, 1H), 1.82 - 1.71 (m, 1H), 1.66–1.48 (m, 2H), 1.35 (s, 3H).
[0394] Example 34
[0395] Synthesis of 1-(6-{1-[(3-methyloxetan-3-yl)methyl]-1H,2H,3H-pyrrolo[2,3-b]pyridin-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea
[0396]
[0397] Step 1: To a solution of 5-bromo-1H,2H,3H-pyrrolo[2,3-b]pyridine (500 mg, 2.52 mmol, 1.0 equiv.) in N,N'-dimethylformamide (10 mL) was added sodium hydride (202 mg, 60% purity, 5.05 mmol, 2.0 equiv.). After stirring at room temperature for 30 min, 3-chloromethyl-3-methyloxetane (454 mg, 3.77 mmol, 1.5 equiv.) was added, and the mixture was stirred at 25 °C for 15 h. LCMS showed that the reaction was complete. Ice water (10 mL) was slowly added to quench the reaction, and the mixture was extracted with ethyl acetate. The combined organic phases were washed successively with saturated sodium chloride solution and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was purified by flash silica gel column chromatography (eluent: PE / EA = 3 / 1) to give compound 120a (450 mg, yield: 63.3%). MS (ESI): m / z 282.9 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.87 (d, J = 1.2 Hz, 1H), 7.26 (d, J = 1.2 Hz, 1H), 4.64 (d, J = 6.0 Hz, 2H), 4.42 (d, J = 6.0 Hz, 2H), 3.57–3.53 (m, 4H), 3.03 (t, J = 8.4 Hz, 2H), 1.39 (s, 3H).
[0398] Step 2: To a solution of compound 120a (300 mg, 1.03 mmol, 1.0 equiv.) in 1,4-dioxane (15 mL) were added bis(pinacolato)diboron (404 mg, 1.59 mmol, 1.5 equiv.), potassium acetate (260 mg, 2.65 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (80 mg, 0.1 mmol, 0.1 equiv.). The mixture was stirred at 100 °C for 3 h under a nitrogen atmosphere. LCMS showed that the reaction was complete. The mixture was filtered and concentrated to give crude compound 120b (310 mg, yield: 70.8%) which was directly used in the next step. MS (ESI): m / z 249.0 (M+H) + .
[0399] Step 3: To a solution of compound 120b (300 mg, 1.21 mmol, 1.0 equiv.) in 1,4-dioxane (10 mL) and water (1 mL), add intermediate A (383 mg, 1.45 mmol, 1.2 equiv.), sodium carbonate (320 mg, 3.02 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane complex (97 mg, 0.12 mmol, 0.1 equiv.). Stir at 100 °C for 15 h under a nitrogen atmosphere. LCMS indicates complete reaction. Filter and concentrate the filtrate. Purify the residue by reverse preparative chromatography Prep-HPLC to afford the title compound 120 (11 mg, yield: 2.1%). MS (ESI): m / z 432.3 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 11.57 (s, 1H), 9.15 (s, 1H), 8.73 (s, 1H), 8.66 (d, J = 2.4 Hz, 1H), 8.60 (s, 1H), 8.46 (s, 1H), 8.18 (s, 1H), 7.94 (dd, J = 8.8, 2.4 Hz, 1H), 7.19 (d, J = 8.4 Hz, 1H), 4.19 (d, J = 12.8 Hz, 1H), 4.02 - 3.96 (m, 3H), 3.44 - 3.43 (m, 1H), 3.40 (s, 2H), 3.35 - 3.32 (m, 2H), 3.23 (d, J = 12.8 Hz, 1H), 2.42 (s, 3H), 1.05 (s, 3H).
[0400] Example 35
[0401] Synthesis of 3-(6-methylpyridin-3-yl)-1-{6-[1-(oxazolidin-3-yl)-2,3-dihydro-1H-indol-5-yl]pyrazin-2-yl}urea:
[0402]
[0403] Step 1: 5-Bromo-2,3-dihydro-1H-indole (500 mg, 2.52 mmol, 1 equiv.), oxazolidin-3-one (326 mg, 3.79 mmol, 1.5 equiv.), zinc chloride (34 mg, 0.24 mmol, 0.1 equiv.) were added to methanol (10 ml, 100.0%). Sodium cyanoborohydride (302 mg, 4.71 mmol, 2 equiv.) was added at room temperature, and the mixture was stirred at room temperature for 1 hour. LCMS showed that the reaction was complete. The reaction mixture was quenched by pouring it into saturated sodium bicarbonate solution (100 mL), extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated in vacuo to obtain the crude product, which was separated by flash silica gel chromatography (PE / EtOAc = 3 / 1) to give compound 121a (600 mg, yield: 88.8%). MS (ESI): m / z 268.10 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.20–7.12 (m, 2H), 6.36 (d, J = 8.1 Hz, 1H), 4.19 (ddd, J = 14.9, 7.5, 4.4 Hz, 1H), 4.24-4.15 (m, 1H), 4.07-3.98 (m, 1H), 3.89–3.84 (m, 1H), 3.79 (dd, J = 15.7, 8.4 Hz, 1H), 3.46 (dd, J = 16.6, 8.2 Hz, 1H), 3.38 (dd, J = 16.6, 8.2 Hz, 1H), 2.94 (t, J = 8.3 Hz, 1H), 2.25-2.13 (m, 1H), 2.07–1.94 (m, 1H).
[0404] Step 2: Compound 121a (600 mg, 2.24 mmol, 1 equiv.), bis(pinacolato)diboron (852.31 mg, 3.36 mmol, 1.5 equiv.), Pd(dppf)Cl2 (80 mg), KOAc (700 mg) were dissolved in 1,4-dioxane (10 ml, 100%). The reaction was carried out at 100 °C for 2 hours under nitrogen protection. LCMS showed that the reaction was complete. The reaction mixture was poured into water (100 mL), extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated in vacuo to obtain the crude product, which was separated by flash silica gel chromatography (PE / EtOAc = 3 / 1) to give compound 121b (400 mg, yield: 56.7%). MS (ESI): m / z 316.24 (M+H) +; 1H NMR (EN1084-59-P1A, CDCl3, 400 MHz) δ 7.56 (d, J = 7.9 Hz, 1H), 7.51 (s, 1H), 6.47 (d, J = 7.9 Hz, 1H), 4.36–4.25 (m, 1H), 4.06 - 3.96 (m, 1H), 3.93 (dd, J = 9.4, 4.0 Hz, 1H), 3.85 (dd, J = 9.4, 6.6 Hz, 1H), 3.79 (dd, J = 15.6, 8.3 Hz, 1H), 3.52–3.46 (m, 1H), 3.44–3.36 (m, 1H), 2.95 (t, J = 8.4 Hz, 2H), 2.26 - 2.13 (m, 1H), 2.09–1.92 (m, 1H), 1.31 (s, 12H).
[0405] Step 3: Compound 121b (200 mg, 0.63 mmol, 1 eq), intermediate A (167.3 mg, 0.63 mmol, 1 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (92.7 mg, 0.13 mmol, 0.2 eq) and anhydrous sodium carbonate (134.5 mg, 1.27 mmol, 2 eq) were successively added to a mixed solution of dioxane / water (20 mL / 2 mL). Under nitrogen protection, the temperature was raised to 100 °C and stirred for 16 h. LCMS showed that the reaction was complete. The reaction solution was concentrated, and the residue was purified by reverse preparative chromatography Prep-HPLC to obtain the title compound 121 (62.42 mg, yield: 23.6%). MS (ESI): m / z 417.0 (M + H) + ; 1 1H NMR (400 MHz, DMSO-d6) δ 9.94 (s, 1H), 9.67 (s, 1H), 8.73 (s, 1H), 8.69 (s, 1H), 8.52 (d, J = 2.4 Hz, 1H), 7.90 (dd, J = 8.4, 2.8 Hz, 1H), 7.80 - 7.78 (m, 2H), 7.26 (d, J = 8.4 Hz, 1H), 6.68 (d, J = 8.4 Hz, 1H), 4.43 - 4.37 (m, 1H), 3.91–3.89 (m, 1H), 3.83–3.75 (m, 2H), 3.71 - 3.65 (m, 1H), 3.53–3.44 (m, 2H), 2.98 (t, J = 8.4 Hz, 2H), 2.43 (s, 3H), 2.19 - 2.13 (m, 1H), 2.01–1.90 (m, 1H).
[0406] Example 36
[0407] (Synthesis of 1-{6-[1-(2-methylpropyl)-2,3-dihydro-1H-indol-5-yl]pyrazin-2-yl}-3-(6-methylpyridin-3-yl)urea:
[0408]
[0409] Step 1: 5-Bromo-2,3-dihydro-1H-indole (1.00 g, 5.07 mmol, 1 eq) was dissolved in dichloromethane (15 mL). 2-Methylpropanal (402 mg, 5.58 mmol, 1.1 eq) and acetic acid (1 mL) were added to the above mixture. After stirring at 25 °C for 30 min, sodium triacetoxyborohydride (2.15 g, 10.14 mmol, 2 eq) was added to the reaction solution, and the mixture was stirred at room temperature for 16 h. LCMS showed that the reaction was complete. The mixture was extracted with dichloromethane, washed with brine and water, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. It was purified by flash silica gel column chromatography (PE:EA = 5:1) to obtain compound 122a (1.1 g, yield: 85.7%). MS(ESI): m / z 254.9 (M+H) + .
[0410] Step 2: Compound 122a (450 mg, 1.77 mmol, 1.5 eq), potassium acetate (290 mg, 2.95 mmol, 2.5 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (173 mg, 0.24 mmol, 0.2 eq) were successively added to dioxane (4 mL). The temperature was raised to 100 °C and stirred for 3 h under nitrogen protection. LCMS showed that the reaction was complete. After the reaction system was cooled to room temperature, it was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure. It was separated by flash silica gel column chromatography (PE:EA = 4:1) to obtain compound 122b (243 mg, yield: 68.3%). MS(ESI): m / z 302.0 (M+H) + .
[0411] Step 3: Compound 122b (100 mg, 0.33 mmol, 1.0 eq), intermediate A (87.53 mg, 0.33 mmol, 1 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (48.53 mg, 0.66 mmol, 0.2 eq) and anhydrous sodium carbonate (70.37 mg, 0.66 mmol, 2.0 eq) were successively added to a mixed solution of dioxane / water (10 mL / 1 mL). Under nitrogen protection, the temperature was raised to 100 °C and stirred for 16 h. LCMS showed that the reaction was complete. The reaction solution was concentrated, and the residue was purified by reverse preparative chromatography Prep-HPLC to obtain the title compound 122 (16.13 mg, yield: 12.1%). MS(ESI): m / z 403.0 (M+H)+ ; 1 H NMR (400 MHz, DMSO-d6) δ 9.96 (s, 1H), 9.67 (s, 1H), 8.70 (s, 1H), 8.68 (s, 1H), 8.53 (d, J = 2.4 Hz, 1H), 7.91 (dd, J = 8.4, 2.8 Hz, 1H), 7.78 - 7.76 (m, 2H), 7.26 (d, J = 8.0 Hz, 1H), 6.56 (d, J = 8.4 Hz, 1H), 3.49 (t, J = 8.8 Hz, 2H), 3.03 (t, J = 8.8 Hz, 2H), 2.94 (d, J = 7.2 Hz, 2H), 2.44 (s, 3H), 1.99 - 1.94 (m, 1H), 0.94 (d, J = 6.4 Hz, 6H).
[0412] Example 37
[0413] Synthesis of 1-(6-(1-(3-methyloxetan-3-carbonyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0414]
[0415] First step: Add 3-methyl-3-carboxy-1-oxetane (100 mg, 0.86 mmol, 1 equiv.) to a solvent of N,N-dimethylformamide (6 mL), then add 5-bromo-2,3-dihydro-1H-indole (255.85 mg, 1.29 mmol, 1.5 equiv.), N,N-dimethylpyridin-4-amine (126.25 mg, 1.03 mmol, 1.2 eq), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (294.12 mg, 1.89 mmol, 2.2 eq). After replacing the reaction system with nitrogen, stir at 25 °C for 16 hours. LCMS shows that the reaction is complete. Filter and concentrate the reaction solution, and separate it by flash silica gel chromatography (PE:EA = 1:1) to obtain compound 123a (110 mg, yield: 43.2%). MS (ESI): m / z 295.8 (M+H) + .
[0416] Step 2: Compound 123a (110 mg, 0.37 mmol, 1 equiv.) was added to a solvent of 1,4-dioxane (8 mL), followed by bis(pinacolato)diboron (188.64 mg, 0.74 mmol, 2.0 equiv.), potassium acetate (91 mg, 0.93 mmol, 2.5 eq), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (27 mg, 0.037 mmol, 0.1 eq). After the reaction system was purged with nitrogen, it was stirred at 100 °C for 3 hours. LCMS showed that the reaction was complete. The reaction solution was filtered and concentrated, and separated by flash silica gel chromatography (PE:EA = 1:1) to obtain compound 123b (120 mg, yield: 94.5%). MS (ESI): m / z 344.0 (M+H) + .
[0417] Step 3: Compound 123b (120 mg, 0.35 mmol, 1 equiv.) was added to a mixed solvent of 1,4-dioxane (8 mL) and water (0.8 mL), followed by 3-(6-chloropyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea (138 mg, 0.52 mmol, 1.5 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (26 mg, 0.035 mmol, 0.1 eq), and sodium carbonate (74 mg, 0.70 mmol, 2.0 eq). After the reaction system was purged with nitrogen, it was stirred at 100 °C for 16 hours. LCMS showed that the reaction was complete. The reaction solution was filtered through diatomaceous earth and concentrated, and purified by reverse preparative chromatography Pre-HPLC to obtain the target compound 123 (9.11 mg, yield: 6%). MS (ESI): m / z 445.6 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.80 - 9.73 (m, 2H), 8.92 (s, 1H), 8.82 (s, 1H), 8.51 (d, J = 2.4 Hz, 1H), 8.01 (s, 1H), 7.98 - 7.94 (m, 1H), 7.91 - 7.87 (m, 1H), 7.64 - 7.52 (m, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.99 (d, J = 6.0 Hz, 1H), 4.29 (d, J = 5.6 Hz, 1H), 3.88 (t, J = 8.2 Hz, 1H), 3.22 (t, J = 8.0 Hz, 1H), 2.43 (s, 3H), 1.71 (s, 3H).
[0418] Example 38
[0419] Synthesis of 1-{6-[1-(2-hydroxy-2-methylpropyl)-2,3-dihydro-1H-indol-5-yl]pyrazin-2-yl}-3-(6-methylpyridin-3-yl)urea:
[0420]
[0421] Step 1: Add 5-bromoindoline (1 g, 5.05 mmol, 1 equiv.) and THF (20 mL, 100%) to a 50 mL single-necked flask. Add sodium hydride (404 mg, 10.10 mmol, 2 equiv.) under an ice bath, stir for 2 minutes, then add methyloxirane (546 mg, 7.57 mmol, 1.5 equiv.). React at room temperature overnight. LCMS shows that the reaction is complete. Quench the reaction by adding water (30 mL), extract with ethyl acetate, combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, concentrate by filtration, concentrate the filtrate, and purify by flash silica gel column chromatography (PE:EA = 10:1 - 5:1) to obtain compound 124a (1109 mg, yield: 90.4%). MS (ESI): m / z 270.11 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 7.13 (dd, J = 8.3, 2.1 Hz, 1H), 6.40 (d, J = 8.3 Hz, 1H), 3.52 (t, J = 8.5 Hz, 2H), 3.06–2.91 (m, 4H), 1.28 (s, 6H).
[0422] Step 2: Add compound 124a (500 mg, 1.85 mmol, 1 equiv.), bis(pinacolato)diboron (563.96 mg, 2.22 mmol, 1.2 equiv.), Pd(dppf)Cl2 (271 mg, 0.37 mmol, 0.2 equiv.), potassium acetate (726.51 mg, 7.4 mmol, 4 equiv.) and 1,4-dioxane (40 mL) to a 100 mL single-necked flask. Evacuate and refill the reaction system with nitrogen three times, then stir at 90 °C for 8 hours. LCMS shows that the reaction is complete. Rotavap the solvent, dissolve in water, extract with ethyl acetate, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and purify by flash silica gel column chromatography (PE:EA = 20:1 - 10:1) to obtain compound 124b (152 mg, yield: 26%). MS (ESI): m / z 318.25 (M+H) + ; 11H NMR (400 MHz, CDCl3) δ 7.56 (d, J = 7.9 Hz, 1H), 7.53 (s, 1H), 6.53 (d, J = 7.9 Hz, 1H), 3.56 (t, J = 8.5 Hz, 2H), 3.05 (s, 2H), 3.01 (t, J = 8.5 Hz, 2H), 1.32 (s, 12H), 1.29 (s, 6H).
[0423] Step 3: Compound 124b (123 mg, 0.39 mmol, 1.0 eq), intermediate A (102.24 mg, 0.39 mmol, 1.0 eq), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (56.74 mg, 0.078 mmol, 0.2 eq) and anhydrous sodium carbonate (82.19 mg, 0.78 mmol, 2.0 eq) were successively added to a mixed solution of dioxane / water (10 mL / 1 mL). After purging with nitrogen three times, the temperature was raised to 100 °C and stirred for 16 h. LCMS showed that the reaction was complete. The reaction solution was concentrated, and the residue was purified by reverse preparative chromatography Prep-HPLC to obtain the title compound 124 (53.7 mg, yield 33.5%). MS (ESI): m / z 419.3 (M+H) + ; 1 1H NMR (400 MHz, DMSO-d6) δ 10.00 (s, 1H), 9.68 (s, 1H), 8.69 (s, 1H), 8.68 (s, 1H), 8.53 (d, J = 2.8 Hz, 1H), 7.93 - 7.90 (m, 1H), 7.77 - 7.76 (m, 2H), 7.25 (d, J = 8.4 Hz, 1H), 6.59 (d, J = 8.8 Hz, 1H), 4.48 (s, 1H), 3.66 (t, J = 8.8 Hz, 2H), 3.06–3.02 (m, 3H), 2.44 (s, 3H), 1.18 (s, 6H).
[0424] Example 39
[0425] Synthesis of 3-(6-{1-[(3-methyloxetan-3-yl)methyl]-2,3-dioxo-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea:
[0426]
[0427] Step 1: Add 5-bromo-2,3-dihydro-1H-indole-2,3-dione (2.0 g, 8.85 mmol, 1 equiv.), potassium carbonate (1.47 g, 10.62 mmol, 1.2 equiv.) and N,N-dimethylformamide (20 mL). After purging with nitrogen, stir at 70 °C for 1 hour. Then add potassium iodide (734.42 mg, 4.42 mmol, 0.5 equiv.) and 3-(chloromethyl)-3-methyloxetane (1.28 g, 10.62 mmol, 1.2 equiv.), and stir at 70 °C for 1.5 hours. Cool the reaction mixture to room temperature, then add water (20 mL), extract with ethyl acetate. Combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel chromatography (PE:EA = 3:1) to obtain compound 125a (1.4 g, yield: 51%). MS (ESI): m / z 312.0 (M+H) + .
[0428] Step 2: Dissolve compound 125a (100 mg, 0.32 mmol, 1 equiv.) in 1,4-dioxane (2 mL), add bis(pinacolato)diboron (106.44 mg, 0.42 mmol, 1.3 equiv.), potassium acetate (94 mg, 0.96 mmol, 3.0 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (12 mg, 0.02 mmol, 0.05 equiv.). After purging with nitrogen, stir at 100 °C for 3 hours. Cool the reaction mixture to room temperature, then filter, and rotary evaporate the filtrate to obtain crude compound 125b (110 mg, yield: 94%). MS (ESI): m / z 358.3 (M+H) + . Without purification, directly use for the next step.
[0429] Step 3: Dissolve compound 125b (110 mg, 0.31 mmol, 1 equiv.) in 1,4-dioxane (1 mL) / water (0.1 mL), add intermediate A (73.08 mg, 0.28 mmol, 0.9 equiv.), sodium carbonate (82 mg, 0.78 mmol, 2.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (22 mg, 0.03 mmol, 0.1 equiv.). After purging with nitrogen, stir at 100 °C for 2 hours. LCMS shows that the reaction is complete. Cool the reaction mixture to room temperature, filter, and purify by reverse preparative chromatography Pre-HPLC to obtain the title compound 125 (7.79 mg, yield: 5.5%). MS (ESI): m / z 459.1 (M+H) + ; 11H NMR (400 MHz, DMSO-d6) δ 9.76 (s, 1H), 9.57 (s, 1H), 9.00 (s, 1H), 8.92 (s, 1H), 8.53 (d, J = 2.4 Hz, 1H), 8.42–8.35 (m, 1H), 8.27 (d, J = 1.6 Hz, 1H), 7.95–7.85 (m, 1H), 7.45 (d, J = 8.4 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.61 (d, J = 6.0 Hz, 2H), 4.21 (d, J = 6.0 Hz, 2H), 3.93 (s, 2H), 2.43 (s, 3H), 1.37 (s, 3H).
[0430] Example 40
[0431] Synthesis of 3-(6-{1-[(3-methyloxetan-3-yl)methyl]-2-oxo-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea:
[0432]
[0433] First step: Take a microwave tube, add compound 125a (600 mg, 1.93 mmol, 1 equiv.) and hydrazine hydrate (6.0 mL), then after purging with nitrogen, heat with microwave at 120 °C and stir for 1 hour. After cooling the reaction solution to room temperature, add water (10 mL) for dilution, extract with ethyl acetate, combine the organic phases, wash with saturated brine (20 mL × 3), dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and purify by flash silica gel column chromatography (PE:EA = 1:1) to obtain compound 126a (180 mg, yield: 31.5%). MS (ESI): m / z 297.8 (M+H) + .
[0434] Second step: Dissolve compound 126a (100 mg, 0.34 mmol, 1 equiv.) in 1,4-dioxane (2 mL), add bis(pinacolato)diboron (111.47 mg, 0.44 mmol, 1.3 equiv.), potassium acetate (100 mg, 1.02 mmol, 3.0 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (12 mg, 0.02 mmol, 0.05 equiv.), after purging with nitrogen, stir at 100 °C for 3 hours. LCMS shows that the reaction is complete. Cool the reaction solution to room temperature, then filter, and rotary evaporate the filtrate to obtain the crude product of compound 126b (110 mg, yield: 94.3%). MS (ESI): m / z 344.0 (M+H) +。It is directly used for the next step without further purification.
[0435] Step 3: Dissolve compound 126b (110 mg, 0.32 mmol, 1 equiv.) in 1,4-dioxane (1 mL, 90.91%) / water (0.1 mL, 9.09%). Add intermediate A (76.05 mg, 0.29 mmol, 0.9 equiv.), sodium carbonate (85 mg, 0.8 mmol, 2.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene] palladium dichloride (22 mg, 0.03 mmol, 0.1 equiv.). After purging with nitrogen, stir at 100 °C for 2 hours. LCMS shows that the reaction is complete. Cool the reaction solution to room temperature, filter, concentrate the filtrate, and separate and purify it by reverse preparative chromatography Pre-HPLC to obtain the title compound 126 (46.8 mg, yield: 32%). MS (ESI): m / z 445.1 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.73 (s, 1H), 9.71 (s, 1H), 8.92 (s, 1H), 8.83 (s, 1H), 8.54 (d, J = 2.4 Hz, 1H), 8.05–8.00 (m, 2H), 7.95–7.85 (m, 1H), 7.30–7.20 (m, 2H), 4.60 (d, J = 6.0 Hz, 2H), 4.19 (d, J = 6.0 Hz, 2H), 3.89 (s, 2H), 3.74 (s, 2H), 2.44 (s, 3H), 1.33 (s, 3H).
[0436] Example 41
[0437] Synthesis of 1-(6-(1-((1-methyl-1H-pyrazol-3-yl)methyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0438]
[0439] Step 1: Add 5-bromo-2,3-dihydro-1H-indole (500 mg, 2.52 mmol, 1 equiv.), 1-methyl-1H-pyrazole-3-carbaldehyde (416.96 mg, 3.79 mmol, 1.5 equiv.), and zinc chloride (34.41 mg, 0.25 mmol, 0.1 equiv.) to methanol (10 mL). Add sodium cyanoborohydride (302.03 mg, 5.05 mmol, 2 equiv.) at room temperature and stir at room temperature for 1 hour. LCMS shows that the reaction is complete. Pour the reaction solution into saturated sodium bicarbonate solution (100 mL) to quench the reaction. Extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, and rotary evaporate the filtrate to obtain the crude product. Purify by flash silica gel column chromatography (PE / EtOAc = 3 / 1) to obtain compound 127a (600 mg, yield: 88.8%). MS (ESI): m / z = 2.231 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.27 (d, J = 2.2 Hz, 1H), 7.15–7.11 (m, 2H), 6.48–6.43 (m, 1H), 6.12 (d, J = 2.2 Hz, 1H), 4.23 (s, 2H), 3.87 (s, 3H), 3.37 (t, J = 8.4 Hz, 2H), 2.92 (t, J = 8.4 Hz, 2H).
[0440] Step 2: Dissolve compound 127a (600 mg, 2.05 mmol, 1 equiv.), bis(pinacolato)diboron (782.24 mg, 3.08 mmol, 1.5 equiv.), Pd(dppf)Cl2 (150 mg), and potassium acetate (604.62 mg, 6.16 mmol, 3 equiv.) in dioxane (10 mL). React at 90 °C for 3 hours under nitrogen protection. LCMS shows that the reaction is complete. Pour the reaction solution into water (100 mL), extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate to obtain the crude product. Purify by flash silica gel column chromatography (PE / EtOAc = 3 / 1) to obtain compound 127b (650 mg, yield: 93.5%). MS (ESI): m / z 340.30 (M+H) + ; 11H NMR (CDCl3, 400 MHz) δ 7.57 (d, J = 7.9 Hz, 1H), 7.50 (s, 1H), 7.25 (d, J = 2.1 Hz, 1H), 6.59 (d, J = 7.9 Hz, 1H), 6.11 (d, J = 2.2 Hz, 1H), 4.32 (s, 2H), 3.86 (s, 3H), 3.41 (t, J = 8.4 Hz, 2H), 2.94 (t, J = 8.4 Hz, 2H), 1.31 (s, 12H).
[0441] Step 3: Dissolve intermediate A (150 mg, 0.54 mmol, 1 equiv.), compound 127b (289.48 mg, 0.85 mmol, 1.5 equiv.), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (40 mg), and sodium carbonate (180.88 mg, 1.71 mmol, 3 equiv.) in dioxane (4 mL) and water (2 mL). Under nitrogen protection, stir at 100 °C for 3 hours. LCMS shows that the reaction is complete. Pour the reaction solution into water (200 mL), filter through diatomaceous earth, and wash the diatomaceous earth with ethyl acetate; soak the diatomaceous earth in dichloromethane (30 mL) and methanol (8 mL), filter by suction, dry the organic phase with anhydrous sodium sulfate, filter, concentrate the filtrate to obtain the crude product, and separate and purify it by flash silica gel chromatography (DCM / MeOH = 10 / 1) to obtain the title compound 127 (78.41 mg). MS (ESI): m / z 441.36 (M + H) + ; 1 1H NMR (400 MHz, DMSO-d6) δ 9.95 (s, 1H), 9.67 (s, 1H), 8.71 (s, 1H), 8.68 (s, 1H), 8.51 (s, 1H), 7.89 (d, J = 6.8 Hz, 1H), 7.83–7.71 (m, 2H), 7.59 (s, 1H), 7.22 (d, J = 8.3 Hz, 1H), 6.75 (d, J = 8.2 Hz, 1H), 6.13 (s, 1H), 4.31 (s, 2H), 3.79 (s, 3H), 3.46 (t, J = 8.3 Hz, 2H), 2.97 (t, J = 8.0 Hz, 2H), 2.42 (s, 3H).
[0442] Example 42
[0443] Synthesis of 1-(6-(1-((1H-pyrazol-3-yl)methyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0444]
[0445] The synthesis method of compound 128 is the same as that of Example 127. In the first step, 1H-pyrazole-3-carbaldehyde is used instead of 1-methyl-1H-pyrazole-3-carboxaldehyde. Compound 128: MS(ESI): m / z 427.36(M+H) + ; 1 H NMR(400MHz, DMSO-d6) δ 12.58(brs, 1H), 9.93(s, 1H), 9.67(s, 1H), 8.72(s, 1H), 8.69(s, 1H), 8.52(d, J = 2.6Hz, 1H), 7.89(dd, J = 8.4, 2.6Hz, 1H), 7.82–7.75(m, 2H), 7.59(s, 1H), 7.23(d, J = 8.4Hz, 1H), 6.77(d, J = 8.3Hz, 1H), 6.17(d, J = 2.1Hz, 1H), 4.38(s, 2H), 3.46(t, J = 8.5Hz, 2H), 2.98(t, J = 8.4Hz, 2H), 2.43(s, 3H).
[0446] Example 43
[0447] Synthesis of 1-(6-(1-((1-methyl-1H-pyrazol-5-yl)methyl)indol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0448]
[0449] The synthesis method of compound 129 is the same as that of Example 127. In the first step, 1-methyl-1H-pyrazole-5-carbaldehyde is used instead of 1-methyl-1H-pyrazole-3-carboxaldehyde. Compound 129: MS(ESI): m / z 441.33(M+H) + ; 1 H NMR(400MHz, MeOD) δ 8.58(s, 1H), 8.56(d, J = 2.4Hz, 1H), 8.46(s, 1H), 8.03(dd, J = 8.5, 2.7Hz, 1H), 7.80(d, J = 5.8Hz, 2H), 7.40(d, J = 1.9Hz, 1H), 7.30(d, J = 8.4Hz, 1H), 6.79(d, J = 8.8Hz, 1H), 6.26(d, J = 1.9Hz, 1H), 4.45(s, 2H), 3.88(s, 3H), 3.40(t, J = 8.4Hz, 2H), 3.07(t, J = 8.3Hz, 2H), 2.50(s, 3H).
[0450] Example 44
[0451] Synthesis of 1-(6-(1-isobutyl-1H-indazol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0452]
[0453] First step: Place 5-bromo-1H-indazole (200 mg, 1.02 mmol, 1.0 equiv.) and potassium carbonate (211 mg, 1.53 mmol, 1.5 equiv.) in a two-neck reaction flask, then add 10 mL of DMF, and finally dropwise add bromoisobutane (210 mg, 1.53 mmol, 1.5 equiv.) under stirring. The reaction solution is heated to 120 °C and stirred for 16 hours. The reaction solution is cooled to room temperature, 10 mL of distilled water is added, and then extracted with ethyl acetate. The organic phases are combined, dried over anhydrous sodium sulfate, filtered, and the filtrate is concentrated. The residue is purified by flash silica gel column chromatography (PE:EA = 10:1) to obtain compound 130a (154 mg, yield: 59.9%). MS(ESI): m / z 252.8(M + H) + ; 1 H NMR(400 MHz, CDCl3): δ 7.93(d, J = 0.8 Hz, 1H), 7.86(dd, J = 2.0, 0.4 Hz, 1H), 7.43(dd, J = 8.8, 2.0 Hz, 1H), 7.28(d, J = 8.8 Hz, 1H), 4.15(d, J = 7.2 Hz, 2H), 2.38 - 2.27(m, 1H), 0.91(d, J = 6.8 Hz, 6H).
[0454] Second step: Add compound 130a (130 mg, 0.52 mmol, 1.0 equiv.), bis(pinacolato)diboron (197 mg, 0.77 mmol, 1.5 equiv.), potassium acetate (101 mg, 1.03 mmol, 2.0 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (37 mg, 0.05 mmol, 0.1 equiv.) to a dioxane (10 mL) solution, and stir and react at 100 °C for 5 hours under nitrogen protection. The reaction solution is cooled to room temperature, concentrated under reduced pressure, and the residue is separated by flash silica gel column chromatography (PE:EA = 10:1) to obtain compound 130b (89 mg, yield: 57.5%). MS(ESI): m / z 301.0(M + H) + ; 11H NMR (400 MHz, CDCl3): δ 8.27 (s, 1H), 8.00 (s, 1H), 7.78 (d, J = 8.4 Hz, 1H), 7.38 (d, J = 8.4 Hz, 1H), 4.17 (d, J = 7.2 Hz, 2H), 2.34 - 2.29 (m, 1H), 1.37 (s, 12H), 0.91 (d, J = 6.8 Hz, 6H).
[0455] Step 3: Under nitrogen protection, to a solution of compound 130b (70 mg, 0.24 mmol, 1.0 equiv.) in 1,4 - dioxane (10 mL), add intermediate A (71 mg, 0.27 mmol, 1.1 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (17.1 mg, 0.023 mmol, 0.1 equiv.), and finally add an aqueous solution (1 mL) of sodium carbonate (59 mg, 0.49 mmol, 2.0 equiv.). Heat the reaction mixture to 100 °C and stir for 16 hours. LCMS shows that the reaction is complete. Cool the reaction mixture to room temperature, concentrate it, add water (20 mL) to the residue, extract with ethyl acetate, combine the organic phases, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate the residue by flash silica gel chromatography (DCM:MeOH = 15:1) to obtain the title compound 130 (35.54 mg, yield: 36.8%). MS (ESI): m / z 402.2 (M + H) + ; 1 1H NMR (400 MHz, CDCl3): δ 9.86 (s, 1H), 9.84 (s, 1H), 8.94 (s, 1H), 8.89 (s, 1H), 8.53–8.51 (m, 2H), 8.21 (s, 1H), 8.11 (d, J = 8.8 Hz, 1H), 7.89 (dd, J = 8.0, 2.4 Hz, 1H), 7.85 (d, J = 8.8 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 4.26 (d, J = 7.2 Hz, 2H), 2.42 (s, 3H), 2.28 - 2.21 (m, 1H), 0.87 (d, J = 6.4 Hz, 6H).
[0456] Example 45
[0457] Synthesis of 1-{6-[1-(2 - cyano - 2,2 - dimethylethyl)-2,3 - dihydro - 1H - indol - 5 - yl]pyrazin - 2 - yl}-3-(6 - methylpyridin - 3 - yl)urea:
[0458]
[0459] Step 1: Dissolve 5-bromo-1-[(3-{[(tert-butyldiphenylsilyl)oxy]methyl}oxolan-3-yl)methyl]-2,3-dihydro-1H-indole (180 mg, 0.64 mmol, 1 eq), bis(pinacolato)diboron (327.45 mg, 1.29 mmol, 2 eq), potassium acetate (158.19 mg, 1.61 mmol, 2.5 eq) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (II) (93.66 mg, 0.128 mmol, 0.2 eq) in 3 mL of 1,4-dioxane. After displacing nitrogen, stir at 85 °C for 3 hours. LCMS shows that the reaction is complete. Filter through diatomaceous earth, concentrate the filtrate, and separate by flash silica gel chromatography (PE:EA = 100:1 to 90:10) to obtain compound 131a (162 mg, yield: 77.6%). MS(ESI): m / z 327.2 (M+H) + .
[0460] Step 2: Add compound 131a (50 mg, 0.153 mmol, 1 eq), intermediate A (80.82 mg, 0.307 mmol, 2 eq), sodium carbonate (32.54 mg, 0.307 mmol, 2 eq), [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (II) (22.46 mg, 0.0307 mmol, 0.2 eq) to a mixed solution of dioxane (2 mL) and water (0.2 mL). After displacing nitrogen, heat the reaction solution to 100 °C and stir for 16 hours. Cool the reaction solution to room temperature, filter, concentrate the filtrate by rotary evaporation, dissolve it in 3 mL of N,N-dimethylformamide and filter again, and then purify by reverse preparative chromatography pre-HPLC to obtain the title compound 131 (37.1 mg, yield: 25.7%). MS(ESI): m / z 428.2 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.93 (s, 1H), 9.69 (s, 1H), 8.75 (s, 1H), 8.72 (s, 1H), 8.54 (d, J = 2.4 Hz, 1H), 7.92 (dd, J = 8.4, 2.4 Hz, 1H), 7.82 - 7.78 (m, 2H), 7.27 (d, J = 8.4 Hz, 1H), 6.78 (d, J = 9.2 Hz, 1H), 3.69 (t, J = 8.8 Hz, 2H), 3.36 (s, 2H), 3.08 (t, J = 8.4 Hz, 2H), 2.44 (s, 3H), 1.40 (s, 6H).
[0461] Example 46
[0462] Synthesis of 3-(6-{7-Fluoro-1-[(3-methyloxetan-3-yl)methyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea:
[0463]
[0464] First step: Add 7-fluoro-1H-indole (3 g, 22.2 mmol, 1 equiv.) to acetic acid (22 mL), and add sodium cyanoborohydride (2.79 g, 44.4 mmol, 2 equiv.) in batches. React at room temperature overnight. LCMS shows that the reaction is complete. Pour the reaction system into NaOH solution (2 M, 270 ml), extract with ethyl acetate, wash the organic phase with saturated brine, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel column chromatography (PE) to obtain compound 132a (1914 mg, yield: 62.9%). MS (ESI): m / z 138.07 (M+H) + ; 1 1H NMR (400 MHz, CDCl3) δ 6.90 (dd, J = 7.3, 0.9 Hz, 1H), 6.82–6.77 (m, 1H), 6.63 (ddd, J = 8.1, 7.4, 4.7 Hz, 1H), 3.61 (t, J = 8.4 Hz, 2H), 3.07 (t, J = 8.4 Hz, 2H).
[0465] Second step: Add compound 132a (1.5 g, 10.94 mmol, 1 equiv.) to acetonitrile (80 mL), and dropwise add a solution of N-bromosuccinimide (1.95 g, 10.94 mmol, 1 equiv.) in acetonitrile (15 mL) under ice bath. React at room temperature for 2 hours. LCMS shows that the reaction is complete. Rotate to dry the solvent, and separate by flash silica gel column chromatography (PE:EA = 33:1) to obtain compound 132b (1.97 g, yield: 83.4%). MS (ESI): m / z 216.04 (M+H) + ; 1 1H NMR (400 MHz, CDCl3) δ 7.01 (dd, J = 1.6, 0.8 Hz, 1H), 6.99–6.91 (m, 1H), 3.62 (t, J = 8.5 Hz, 2H), 3.06 (t, J = 8.5 Hz, 2H).
[0466] Step 3: Add compound 132b (500 mg, 2.31 mmol, 1 equiv.), 3-methyloxetan-3-carbaldehyde (348 mg, 3.47 mmol, 1 equiv.), and acetic acid (1 mL) to methanol (20 mL), and then add sodium cyanoborohydride (727 mg, 11.57 mmol, 5 equiv.) portionwise. Stir the reaction system at room temperature overnight. LCMS shows that the reaction is complete. Quench the reaction by adding water (50 mL), rotary evaporate the organic solvent, then extract with ethyl acetate. Combine the organic phases, dry over anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify by flash silica gel column chromatography to obtain compound 132c (304 mg, yield: 43.8%). 1 H NMR (400 MHz, CDCl3) δ 7.03–6.84 (m, 2H), 4.61 (d, J = 5.8 Hz, 2H), 4.38 (d, J = 5.8 Hz, 2H), 3.46 (s, 2H), 3.37 (t, J = 8.7 Hz, 2H), 3.02 (t, J = 8.6 Hz, 2H), 1.42 (s, 3H).
[0467] Step 4: Add compound 132c (304 mg, 1.01 mmol, 1 equiv.), bis(pinacolato)diboron (309 mg, 1.22 mmol, 1.2 equiv.), Pd(dppf)Cl2 (148 mg, 0.203 mmol, 0.2 equiv.), and potassium acetate (398 mg, 4.05 mmol, 4 equiv.) to 1,4-dioxane (20 mL). Flush the reaction system with nitrogen three times and stir at 90 °C for 8 hours. LCMS shows that the reaction is complete. Rotary evaporate the solvent, dilute with water, extract with ethyl acetate. Combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter and concentrate. Purify by flash silica gel column chromatography (PE:EA = 33:1~20:1) to obtain compound 132d (200 mg, yield: 56.9%). MS (ESI): m / z 348.28 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.03 (s, 1H), 6.94 (s, 1H), 4.64 (d, J = 5.7 Hz, 2H), 4.37 (d, J = 5.7 Hz, 2H), 3.39 (s, 2H), 3.23 (t, J = 8.7 Hz, 2H), 2.96 (t, J = 8.6 Hz, 2H), 2.25 (s, 3H), 1.49 (s, 3H).
[0468] Step 5: Add compound 132d (100 mg, 0.288 mmol, 1 equiv.), intermediate A (84 mg, 0.32 mmol, 1.1 equiv.), Pd(dppf)Cl2 (21 mg, 0.029 mmol, 0.1 equiv.), and potassium carbonate (80 mg, 0.58 mmol, 2 equiv.) to 1,4-dioxane (6 mL) and water (1.5 mL). The reaction system was evacuated and filled with nitrogen three times, and stirred at 90 °C for 4 h. LCMS showed that the reaction was complete. The solvent was evaporated, and the title compound 132 (51 mg, yield: 39.5%) was obtained by flash silica gel chromatography (DCM:MeOH = 15:1). MS (ESI): m / z 449.32 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.74 (s, 1H), 9.66 (s, 1H), 8.80 (s, 1H), 8.73 (s, 1H), 8.51 (s, 1H), 7.89 (d, J = 8.5 Hz, 1H), 7.64 (d, J = 13.0 Hz, 2H), 7.23 (d, J = 8.3 Hz, 1H), 4.52 (d, J = 5.5 Hz, 2H), 4.27 (d, J = 5.5 Hz, 2H), 3.54 (s, 2H), 3.47 (t, J = 8.6 Hz, 2H), 3.09 (t, J = 8.5 Hz, 2H), 2.43 (s, 3H), 1.36 (s, 3H).
[0469] Example 47
[0470] Synthesis of 3-{imidazo[1,2-a]pyridin-7-yl}-1-(6-{1-[(3-methyloxetan-3-yl)methyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)urea:
[0471]
[0472] Under nitrogen protection and stirring conditions, add triethylamine (187.21 mg, 1.85 mmol, 3.0 eq.) to a toluene (5.0 mL) solution of compound 60d (182.77 mg, 0.62 mmol, 1.0 eq.), imidazo[1,2-a]pyridine-7-carboxylic acid (150 mg, 0.93 mmol, 1.5 eq.), and diphenylphosphoryl azide (254.57 mg, 0.93 mmol, 1.5 eq.). The reaction solution was stirred at 110 °C for 16 h. LCMS showed that the reaction was complete. The solvent was evaporated, and separated by TLC plate (dichloromethane:methanol = 8:1, R fPurification (when the purity was 0.5) gave the title compound 133 (8.63 mg, yield: 3.2%). MS (ESI): m / z 456.2 (M + H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 10.04 (s, 1H), 9.68 (s, 1H), 8.77 (s, 1H), 8.71 (s, 1H), 8.49 (d, J = 7.6 Hz, 1H), 7.83 - 7.80 (m, 4H), 7.46 (s, 1H), 6.93 - 6.88 (m, 1H), 6.63 (d, J = 8.8 Hz, 1H), 4.50 (d, J = 5.6 Hz, 2H), 4.29 (d, J = 5.6 Hz, 2H), 3.47 (t, J = 8.8 Hz, 2H), 3.37 (s, 2H), 3.06 (t, J = 8.4 Hz, 2H), 1.34 (s, 3H).
[0473] Example 48
[0474] Synthesis of 1-(6-(1-(2-Hydroxypropyl)-1H-indazol-5-yl)pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0475]
[0476] The synthesis method of compound 134 was the same as that of Example 118, and 5-bromo-1H-indazole was used instead of 5-bromoindoline in the first step. Compound 134: MS (ESI): m / z 404.2 (M + H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.76 (s, 2H), 8.94 (s, 1H), 8.91 (s, 1H), 8.52 (d, J = 2.8 Hz, 1H), 8.51 (s, 1H), 8.20 (s, 1H), 8.11 (dd, J = 8.8, 1.6 Hz, 1H), 7.91 (dd, J = 8.4, 2.6 Hz, 1H), 7.84 (d, J = 8.8 Hz, 1H), 7.24 (d, J = 8.4 Hz, 1H), 4.92 (d, J = 4.8 Hz, 1H), 4.41–4.31 (m, 2H), 4.14 - 4.08 (m, 1H), 2.43 (s, 3H), 1.10 (d, J = 6.4 Hz, 3H).
[0477] Example 49
[0478] Synthesis of 1-(6-{1-[(3S,4S)-4-hydroxy-1-methylpyrrolidin-3-yl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0479]
[0480] Compound 50 (30 mg, 0.07 mmol, 1 equiv.), sodium triacetoxyborohydride (42 mg, 0.198, 3 eq), and aqueous formaldehyde solution (0.3 mL, 37 wt.% in H2O) were successively added to a methanol solution (3 mL) under nitrogen protection and stirred at 25 °C for 1 hour. LCMS showed that the reaction was complete, and the title compound 135 (4.91 mg, yield: 15.7%) was obtained by flash silica gel column chromatography. MS (ESI): m / z 446.3 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6): δ 9.95 (s, 1H), 9.67 (s, 1H), 8.72 (s, 1H), 8.68 (s, 1H), 8.51 (d, J = 2.4 Hz, 1H), 7.90 - 7.88 (m, 1H), 7.78 - 7.76 (m, 2H), 7.23 (d, J = 8.4 Hz, 1H), 6.71 (d, J = 8.4 Hz, 1H), 5.18 (s, 1H), 4.25 - 4.23 (m, 1H), 3.92 - 3.88 (m, 1H), 3.57 - 3.52 (m, 2H), 2.98 (t, J = 8.4 Hz, 2H), 2.87 - 2.83 (m, 1H), 2.72 - 2.62 (m, 2H), 2.43 (s, 3H), 2.28 - 2.25 (m, 1H), 2.23 (s, 3H).
[0481] Example 50
[0482] Synthesis of 3-(6-{7-methyl-1-[(3-methyloxetan-3-yl)methyl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea:
[0483]
[0484] Step 1: Add 7-methyl-1H-indole (2 g, 15.25 mmol, 1 equiv.) to acetic acid (15 mL), and add sodium cyanoborohydride (1.92 g, 30.49 mmol, 2 equiv.) in portions. React at room temperature overnight. LCMS shows that the reaction is complete. Pour the reaction solution into an aqueous NaOH solution (190 mL, 2 M) to quench the reaction. Extract with ethyl acetate. Wash the organic phase with saturated brine, dry over anhydrous sodium sulfate, filter and concentrate. Separate by flash silica gel column chromatography (PE:EA = 33:1) to obtain compound 136a (1678 mg, yield: 91.8%). MS (ESI): m / z 134.12 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.01 (d, J = 7.3 Hz, 1H), 6.88 (d, J = 7.5 Hz, 1H), 6.68 (t, J = 7.4 Hz, 1H), 3.58 (t, J = 8.4 Hz, 2H), 3.07 (t, J = 8.4 Hz, 2H), 2.16 (s, 3H).
[0485] Step 2: Add compound 136a (1.678 g, 12.60 mmol, 1 equiv.) to acetonitrile (80 mL). Dropwise add a solution of N-bromosuccinimide (2.24 g, 12.60 mmol, 1 equiv.) in acetonitrile (30 mL) under an ice bath. React at room temperature for 2 hours. LCMS shows that the reaction is complete. Rotate to dry the solvent. Obtain compound 136b (1401 mg, yield: 52.4%) by flash column chromatography. MS (ESI): m / z 212.06 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.07 (s, 1H), 6.98 (s, 1H), 3.58 (m, 2H), 3.05 (m, 2H), 2.09 (s, 3H).
[0486] Step 3: Add compound 136b (1.2 g, 5.66 mmol, 1 equiv.) and 3-methyloxetan-3-carbaldehyde (850 mg, 8.49 mmol, 1.5 equiv.) to methanol (50 mL). Add sodium cyanoborohydride (711 mg, 11.32 mmol, 2 equiv.) in portions. React at room temperature for 4 hours. LCMS shows that the reaction is complete. Add water (50 mL) to quench the reaction. Rotate to dry the organic solvent. Extract with ethyl acetate. Combine the organic phases, dry over anhydrous sodium sulfate, filter. Concentrate the filtrate. Separate the residue by flash silica gel column chromatography to obtain compound 136c (587 mg, yield: 35%). MS (ESI): m / z 296.11 (M+H) + ; 11H NMR (400 MHz, CDCl3) δ 7.03 (s, 1H), 6.94 (s, 1H), 4.64 (d, J = 5.7 Hz, 2H), 4.37 (d, J = 5.7 Hz, 2H), 3.39 (s, 2H), 3.23 (t, J = 8.7 Hz, 2H), 2.96 (t, J = 8.6 Hz, 2H), 2.25 (s, 3H), 1.49 (s, 3H).
[0487] Step 4: Add compound 136c (323 mg, 1.09 mmol, 1 equiv.), bis(pinacolato)diboron (332 mg, 1.31 mmol, 1.2 equiv.), Pd(dppf)Cl2 (160 mg, 0.218 mmol, 0.2 equiv.), and potassium acetate (428 mg, 4.36 mmol, 4 equiv.) to 1,4-dioxane (20 mL). The reaction system was evacuated and refilled with nitrogen three times, and stirred at 90 °C for 8 h. LCMS showed that the reaction was complete. After evaporating the solvent, the residue was dissolved in water and extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered and concentrated, and separated by flash silica gel chromatography (PE:EA = 20:1 - 15:1) to obtain compound 136d (174 mg, yield: 46%). MS (ESI): m / z 344.36 (M+H) + ; 1 1H NMR (400 MHz, CDCl3) δ 7.39 (s, 1H), 7.32 (s, 1H), 4.65 (d, J = 5.7 Hz, 2H), 4.38 (d, J = 5.8 Hz, 2H), 3.53 (s, 2H), 3.31–3.19 (m, 2H), 2.97 (t, J = 8.7 Hz, 2H), 2.30 (s, 3H), 1.48 (s, 3H), 1.32 (s, 12H).
[0488] Step 5: Add compound 136d (174 mg, 0.51 mmol, 1 equiv.), intermediate A (147 mg, 0.56 mmol, 1.1 equiv.), Pd(dppf)Cl2 (37 mg, 0.05 mmol, 0.1 equiv.), and potassium carbonate (140 mg, 1.01 mmol, 2 equiv.) to 1,4-dioxane (8 mL) and water (2 mL). The reaction system was evacuated and refilled with nitrogen three times, and stirred at 90 °C for 4 h. LCMS showed that the reaction was complete. After evaporating the solvent, it was separated by flash silica gel chromatography (DCM:MeOH = 15:1) to obtain the title compound 136 (103 mg, yield: 45.7%). MS (ESI): m / z 445.37 (M+H) + ; 11H NMR (400 MHz, DMSO-d6) δ 10.01 (s, 1H), 9.72 (s, 1H), 8.70 (s, 1H), 8.69 (s, 1H), 8.53 (d, J = 2.5 Hz, 1H), 7.90 (dd, J = 8.4, 2.7 Hz, 1H), 7.64 (s, 1H), 7.58 (s, 1H), 7.24 (d, J = 8.4 Hz, 1H), 4.56 (s, 1H), 4.54 (s, 1H), 4.28 (s, 1H), 4.26 (s, 1H), 3.55 (s, 2H), 3.30 (t, J = 8.7 Hz, 2H), 3.00 (t, J = 8.7 Hz, 2H), 2.43 (s, 3H), 2.34 (s, 3H), 1.41 (s, 3H).
[0489] Example 51
[0490] Synthesis of 1-(6-methylpyridin-3-yl)-3-(6-(1-((3-methyltetrahydrofuran-3-yl)methyl)indol-5-yl)pyrazin-2-yl)urea:
[0491]
[0492] First step: Under nitrogen protection, a solution of benzyl 3-methyloxazolidine-3-carboxylate (1 g, 4.54 mmol, 1.0 equiv.) in tetrahydrofuran (10 mL) was slowly added dropwise to a solution of lithium aluminum hydride (431 mg, 11.4 mmol, 2.5 equiv.) in tetrahydrofuran (10 mL) at -78 °C in a dry ice / acetone bath. The temperature was slowly raised to 25 °C and the reaction was stirred for 24 hours. LCMS showed that the reaction was complete. Water (20 mL) was slowly added dropwise, and the mixture was extracted with ethyl acetate. The organic phase was dried over sodium sulfate, concentrated, and the residue was separated by flash silica gel chromatography (PE / EA = 1 / 1) to obtain compound 137a (700 mg, yield: 74.8%). 1 1H NMR (400 MHz, CDCl3): δ 7.40–7.30 (m, 5H), 4.70 (s, 2H), 3.93–3.84 (m, 2H), 3.73 (d, J = 8.4 Hz, 1H), 3.49 (s, 2H), 3.39 (d, J = 8.4 Hz, 1H), 1.90–1.85 (m, 1H), 1.67–1.63 (m, 1H), 1.15 (s, 3H).
[0493] Step 2: In a solution of compound 137a (1.2 g, 5.82 mmol, 1.0 equiv.) in ethanol (10 mL), 10% palladium on carbon (200 mg) was added under N2 protection. The reaction was stirred at 25 °C for 15 hours under H2 (15 psi). LCMS showed that the reaction was complete. The reaction solution was filtered, the filtrate was concentrated, and the residue was separated by flash silica gel chromatography to obtain compound 137b (450 mg, yield: 66.6%). 1 H NMR (400 MHz, CDCl3): δ 3.93–3.81 (m, 2H), 3.73 (d, J = 8.8 Hz, 1H), 3.51 (s, 2H), 3.39 (d, J = 8.8 Hz, 1H), 1.90 - 1.83 (m, 1H), 1.65–1.62 (m, 1H), 1.13 (s, 3H).
[0494] Step 3: In a solution of compound 137b (200 mg, 1.72 mmol, 1.0 equiv.) in dichloromethane (10 mL), Dess-Martin reagent (1.46 g, 3.33 mmol, 2.0 equiv.) was added. The reaction was stirred at 25 °C for 2 hours. LCMS showed that the reaction was complete. The reaction solution was filtered, the filtrate was concentrated, and the residue was purified by flash silica gel chromatography (PE / EA = 1 / 1) to obtain compound 137c (30 mg, yield: 15.1%). 1 H NMR (400 MHz, CDCl3): δ 9.57 (s, 1H), 4.09 (d, J = 9.2 Hz, 1H), 3.95–3.85 (m, 2H), 3.47 (d, J = 9.2 Hz, 1H), 2.35–2.28 (m, 1H), 1.75–1.69 (m, 1H), 1.24 (s, 3H).
[0495] Step 4: In a solution of compound 137c (150 mg, 1.31 mmol, 1.0 equiv.) in dichloromethane (5 mL), 5-bromoindole (260 mg, 1.31 mmol, 1.0 equiv.), glacial acetic acid (8 mg, 0.13 mmol, 0.1 equiv.), and sodium triacetoxyborohydride (610 mg, 2.62 mmol, 2.0 equiv.) were added. The reaction was stirred at 25 °C for 15 hours. LCMS showed that the reaction was complete. The reaction solution was concentrated, and the residue was separated by flash silica gel chromatography (PE / EA = 2 / 1) to obtain compound 137d (35 mg, yield: 9.0%). MS (ESI): m / z 298.0 (M+H) + .
[0496] Step 5: To a solution of compound 137d (50 mg, 0.17 mmol, 1.0 equiv.) in 1,4-dioxane (10 mL), add bis(pinacolato)diboron (64 mg, 0.25 mmol, 1.5 equiv.), potassium acetate (42 mg, 0.43 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (14 mg, 0.02 mmol, 0.1 equiv.). Stir at 100 °C for 3 h under a nitrogen atmosphere. LCMS indicates completion of the reaction. Filter the reaction mixture, concentrate the filtrate, and purify the residue by flash silica gel column chromatography (PE / EA = 3 / 1) to afford compound 137e (40 mg, yield: 69.0%). MS (ESI): m / z 343.4 (M+H) + .
[0497] Step 6: To a solution of compound 137e (40 mg, 0.12 mmol, 1.0 equiv.) in 1,4-dioxane (10 mL) and water (1 mL), add intermediate A (37 mg, 0.14 mmol, 1.2 equiv.), sodium carbonate (31 mg, 0.29 mmol, 2.5 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) dichloromethane complex (8 mg, 0.01 mmol, 0.1 equiv.). Stir at 100 °C for 3 h under a nitrogen atmosphere. LCMS indicates completion of the reaction. Filter the reaction mixture and concentrate the filtrate. Purify the residue by reverse preparative chromatography pre-HPLC to afford the title compound 137 (20 mg, yield: 34.3%). MS (ESI): m / z 444.8 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6): δ 9.95 (s, 1H), 9.68 (s, 1H), 8.72 (s, 1H), 8.69 (s, 1H), 8.54 (d, J = 2.4 Hz, 1H), 7.92 (dd, J = 8.4, 2.8 Hz, 1H), 7.79 - 7.77 (m, 2H), 7.26 (d, J = 8.4 Hz, 1H), 6.60 (d, J = 8.8 Hz, 1H), 3.88 - 3.76 (m, 2H), 3.59 - 3.52 (m, 3H), 3.39 - 3.37 (m, 1H), 3.17 - 3.11 (m, 2H), 3.05 (t, J = 8.8 Hz, 2H), 2.44 (s, 3H), 1.88 - 1.78 (m, 1H), 1.74 - 1.65 (m, 1H), 1.13 (s, 3H).
[0498] Example 52
[0499] Synthesis of 1-(6-(hydroxymethyl)pyridin-3-yl)-3-(6-(1-((3-methyloxetan-3-yl)methyl)indol-5-yl)pyrazin-2-yl)urea:
[0500]
[0501] Step 1: To a solution of methyl 6-(hydroxymethyl)nicotinate (500 mg, 2.99 mmol, 1.0 eq.) and imidazole (610.91 mg, 8.97 mmol, 3.0 eq.) in N,N-dimethylformamide (5.0 mL) was added tert-butyldiphenylchlorosilane (1.23 g, 4.49 mmol, 1.5 eq.). The reaction mixture was stirred at 30 °C for 16 h. LCMS showed that the reaction was complete. After concentration, the reaction mixture was purified by flash silica gel chromatography (ethyl acetate / petroleum ether = 1 / 10) to give compound 138a (1.0 g, yield: 82%). 1 1H NMR (400 MHz, CDCl3) δ 9.07 (d, J = 1.6 Hz, 1H), 8.35 (dd, J = 8.4, 2.0 Hz, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.75–7.60 (m, 4H), 7.46–7.42 (m, 1H), 7.42–7.40 (m, 1H), 7.37–7.30 (m, 4H), 4.92 (s, 2H), 3.95 (s, 3H), 1.14 (s, 9H).
[0502] Step 2: To a solution of compound 138a (200 mg, 0.49 mmol, 1.0 eq.) in tetrahydrofuran (3.0 mL) and methanol (3.0 mL) was added a solution of lithium hydroxide monohydrate (62.14 mg, 1.47 mmol, 3.0 eq.) in water (3.0 mL). The reaction mixture was stirred at 0 °C for 2 h. The reaction process was monitored by TLC plate (ethyl acetate / petroleum ether = 1 / 10, R f = 0.4, starting material disappeared). After the reaction was complete, the reaction mixture was concentrated to give the crude product of compound 138b (300 mg). MS (ESI): m / z 391.8 (M+H) + .
[0503] Step 3: Under nitrogen protection and stirring conditions, triethylamine (193.6 mg, 1.9 mmol, 5.0 eq.) was added to a toluene (5.0 mL) solution of compound 138b (150 mg, 0.38 mmol, 1.0 eq.) and compound 60d (105.43 mg, 0.38 mmol, 1.0 eq.). The reaction mixture was stirred at 110 °C for 16 h. LCMS showed that the reaction was complete. The reaction mixture was cooled to room temperature. After concentration, the residue was purified by flash silica gel chromatography (ethyl acetate / petroleum ether = 1 / 1) to obtain compound 138c (35 mg, yield: 13%). MS (ESI): m / z 684.8 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 11.93 (s, 1H), 9.48 (s, 1H), 8.56 (s, 1H), 8.49 (d, J = 2.4 Hz, 1H), 8.41 (dd, J = 8.4, 2.4 Hz, 1H), 8.20 (s, 1H), 7.73–7.66 (m, 7H), 7.43–7.36 (m, 6H), 6.56 (d, J = 8.4 Hz, 1H), 4.87 (s, 2H), 4.60 (d, J = 6.0 Hz, 2H), 4.45 (d, J = 6.0 Hz, 2H), 3.53 (t, J = 8.6 Hz, 2H), 3.37 (s, 2H), 3.14 (t, J = 8.6 Hz, 2H), 1.43 (s, 3H), 1.15 (s, 9H).
[0504] Step 4: Under nitrogen protection, tetrabutylammonium fluoride in THF solution (0.08 mL, 0.08 mmol, 2.0 eq.) was added to a THF (1.0 mL) solution of compound 138c (30 mg, 0.04 mmol, 1.0 equiv.). The reaction mixture was stirred at 20 °C for 1 h. LCMS showed that the reaction was complete. The reaction mixture was filtered, and the filtrate was concentrated and purified by reverse preparative chromatography pre-HPLC to obtain the title compound 138 (11.46 mg, yield: 64.2%). MS (ESI): m / z 446.8 (M+H) + ; 11H NMR (400 MHz, DMSO-d6): δ 10.04 (s, 1H), 9.72 (s, 1H), 8.74 (s, 1H), 8.70 (s, 1H), 8.63 (s, 1H), 8.05 (dd, J = 8.4, 2.0 Hz, 1H), 7.81 - 7.76 (m, 2H), 7.51 (d, J = 8.8 Hz, 1H), 6.63 (d, J = 8.8 Hz, 1H), 4.57 (s, 2H), 4.49 (d, J = 6.0 Hz, 2H), 4.29 (d, J = 5.6 Hz, 2H), 3.50 - 3.36 (m, 4H), 3.04 (t, J = 8.4 Hz, 2H), 1.34 (s, 3H).
[0505] Example 53
[0506] Synthesis of 1-(6-((methylamino)methyl)pyridin-3-yl)-3-(6-(1-((3-methyloxetan-3-yl)methyl)indolin-5-yl)pyrazin-2-yl)urea:
[0507]
[0508] First step: Methyl 6-formylpyridine-3-carboxylate (500 mg, 3.03 mmol, 1 equiv.) was added to methanol (20 mL), then methylamine hydrochloride (224.86 mg, 3.33 mmol, 1.1 equiv.) was added. After stirring for five minutes, sodium cyanoborohydride (382 mg, 6.06 mmol, 2 equiv.) was added. After purging with nitrogen, the mixture was stirred at 30 °C for ten minutes. Saturated aqueous ammonium chloride solution (10 mL) was added, then di-tert-butyl dicarbonate (1.98 g, 9.08 mmol, 3 equiv.) was added, and the mixture was stirred at 30 °C for 8 hours. Water (10 mL) and ethyl acetate (30 mL) were added to the reaction mixture. After liquid separation, the organic phase was washed with saturated brine, concentrated, and then separated by flash silica gel chromatography (PE:EA = 5:1) to obtain compound 139a (320 mg, yield: 37.7%). MS (ESI): m / z 281.0 (M + H) + .
[0509] Second step: Compound 139a (320 mg, 1.14 mmol, 1 equiv.) was dissolved in methanol (5 mL) / tetrahydrofuran (5 mL). Then lithium hydroxide monohydrate (143.5 mg, 3.42 mmol, 3 equiv.) dissolved in water (2.5 mL) was added to the above system. After purging with nitrogen, the mixture was stirred at 30 °C for 1 hour. The reaction mixture was directly evaporated to dryness to obtain the crude product of compound 139b (lithium salt). MS (ESI): m / z 267.0 (M + H) +.Directly used for the next step.
[0510] Step 3: Add compound 60d (350 mg, 1.18 mmol, 1 equiv.), compound 139b (314.48 mg), and triethylamine (596 mg, 5.9 mmol, 5 equiv.) to toluene (5 mL), then dropwise add diphenylphosphoryl azide (325 mg, 1.18 mmol, 1 equiv.). After purging with nitrogen, stir at 110 °C for 4 hours. The reaction mixture was separated and purified by reverse preparative chromatography (Pre-HPLC) to obtain compound 139c (70 mg, yield: 10.6%). MS (ESI): m / z 560.8 (M+H) + .
[0511] Step 4: Dissolve compound 139c (70 mg, 0.13 mmol, 1 equiv.) in dichloromethane (3 mL), then dropwise add trifluoroacetic acid (1 mL), and then stir at 30 °C for half an hour at room temperature. The reaction mixture was filtered, and the filtrate was separated and purified by reverse preparative chromatography (pre-HPLC) to obtain the title compound 139 (4.54 mg, yield: 7.3%). MS (ESI): m / z 460.2 (M+H) + ; 1 HNMR (400 MHz, DMSO-d6) δ 10.02 (s, 1H), 9.75 (s, 1H), 8.93 (s, 1H), 8.79 (s, 1H), 8.77 (d, J = 2.4 Hz, 1H), 8.72 (s, 1H), 8.10–8.00 (m, 1H), 7.85–7.75 (m, 2H), 7.48 (d, J = 8.0 Hz, 1H), 6.62 (d, J = 8.0 Hz, 1H), 4.55–4.45 (m, 2H), 4.32–4.28 (m, 2H), 4.26 (s, 2H), 3.46 (t, J = 8.0 Hz, 2H), 3.37 (s, 2H), 3.04 (t, J = 8.0 Hz, 2H), 2.63 (s, 3H), 1.34 (s, 3H).
[0512] Example 54
[0513] Synthesis of 1-methyl-3-(6-(1-((3-methyloxan-3-yl)methyl)indol-5-yl)pyrazin-2-yl)-1-(6-methylpyridin-3-yl)urea:
[0514]
[0515] Step 1: Under nitrogen protection, dissolve 6-methylpyridin-3-amine (1.00 g, 9.25 mmol, 1 equiv.) and formaldehyde (833.09 mg, 27.74 mmol, 3 equiv.) in 20 mL of methanol. Then add sodium methoxide (2.49 g, 46.24 mmol, 5 equiv.) to the reaction mixture in portions, and then heat the mixture to 50 °C and stir for 16 h. Then, under an ice bath, add sodium borohydride (1.05 g, 27.74 mmol, 3 equiv.) to the reaction mixture in portions, and then stir at 30 °C for 5 h. LCMS shows that the reaction is complete. Add 20 mL of water to quench the reaction, then extract with ethyl acetate. Combine the organic phases, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel column chromatography (DCM:MeOH = 19:1) to obtain compound 140a (450 mg, yield: 39.8%). MS (ESI): m / z 123.2 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 7.80 (d, J = 2.8 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.79 (dd, J = 8.4, 2.8 Hz, 1H), 5.58 (s, 1H), 2.65 (d, J = 5.2 Hz, 3H), 2.28 (s, 3H).
[0516] Step 2: Under nitrogen protection, place compound 140a (50.00 mg, 0.41 mmol, 1 equiv.) and 4-nitrophenylcarbonyl chloride (164.98 mg, 0.82 mmol, 2 equiv.) in a 25 mL two-necked flask, then add 5 mL of THF, and finally add triethylamine (207.07 mg, 2.05 mmol, 5 equiv.) dropwise to the reaction mixture. Stir at 30 °C for 3 h. LCMS shows that the reaction is complete. Concentrate the reaction mixture and purify by TLC large plate (PE:EA = 1:2) to obtain compound 140b (80 mg, yield: 67.9%). MS (ESI): m / z 287.8 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 8.54 - 8.52 (m, 1H), 8.24 - 8.22 (m, 2H), 7.56 (s, 1H), 7.26–7.21 (m, 3H), 3.41 (s, 3H), 2.59 (s, 3H).
[0517] Step 3: Under nitrogen protection, dissolve compound 60d (70.00 mg, 0.24 mmol, 1 equiv.) in 2 mL of DMF, then add sodium hydride (30.00 mg, 0.71 mmol, 3 equiv., 60%) to the reaction solution. After stirring for 5 minutes, add compound 140b (81.42 mg, 0.28 mmol, 1.2 equiv.) to the reaction solution and stir at 30 °C for 5 hours. LCMS shows that the reaction is complete. Add two drops of water to quench the reaction solution, and purify it by reverse preparative chromatography pre-HPLC to obtain the title compound 140 (5.38 mg, yield: 5.1%). MS (ESI): m / z 445.2 (M + H) + ; 1 H NMR (400 MHz, MeOD) δ 8.84 (s, 1H), 8.45 (s, 1H), 8.36 (d, J = 2.4 Hz, 1H), 7.64 (dd, J = 8.4, 2.4 Hz, 1H), 7.57 (d, J = 8.8 Hz, 2H), 7.29 (d, J = 8.3 Hz, 1H), 6.40 (d, J = 8.0 Hz, 1H), 4.52 (d, J = 6.0 Hz, 2H), 4.30 (d, J = 6.0 Hz, 2H), 3.37 (t, J = 8.4 Hz, 2H), 3.27 (s, 3H), 3.22 - 3.20 (m, 2H), 2.91 (t, J = 8.4 Hz, 2H), 2.47 (s, 3H), 1.30 (s, 3H).
[0518] Example 55
[0519] Synthesis of 1-(6-{1-[(3S,4R)-4-hydroxyoxazolidin-3-yl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-3-(6-methylpyridin-3-yl)urea:
[0520]
[0521] Step 1: Dissolve 5-bromo-2,3-dihydro-1H-indole (2 g, 10.1 mmol, 1 equiv.) in tetrahydrofuran (40 mL). Add sodium hydride (60%, 808 mg, 20.2 mmol, 2.0 equiv.) under ice bath and stir for 30 minutes. Then add 3,6-dioxabicyclo[3.1.0]hexane (1.3 g, 15.15 mmol, 1.5 equiv.). After purging with nitrogen, heat the reaction mixture to 90 °C and stir for 6 hours. LCMS shows that the reaction is complete. Add water (10 mL) to quench the reaction mixture, then extract with ethyl acetate. Combine the organic phases, wash with saturated brine, dry over anhydrous sodium sulfate, filter, concentrate the filtrate, and separate by flash silica gel column chromatography (PE:EA = 1:1) to obtain compound 141a (2.4 g, yield: 83.6%). MS (ESI): m / z = 286.0 (M+H) + ; 1 H NMR (400 MHz, CDCl3) δ 7.19–7.12 (m, 2H), 6.45–6.39 (m, 1H), 4.50–4.40 (m, 1H), 4.15–4.02 (m, 2H), 4.01–3.95 (m, 1H), 3.94–3.88 (m, 1H), 3.72 (dd, J = 10.8, 3.2 Hz, 1H), 3.52 - 3.36 (m, 2H), 2.94 (t, J = 8.4 Hz, 2H).
[0522] Step 2: Dissolve compound 141a (1 g, 3.52 mmol, 1 equiv.) in 1,4-dioxane (15 mL). Add bis(pinacolato)diboron (1.34 g, 5.28 mmol, 1.5 equiv.), potassium acetate (862 mg, 8.8 mmol, 2.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (256 mg, 0.35 mmol, 0.1 equiv.). After purging with nitrogen, stir the reaction mixture at 100 °C for 3 hours. LCMS shows that the reaction is complete. Filter the reaction mixture, concentrate the filtrate, and separate by flash silica gel column chromatography (PE:EA = 10:1) to obtain compound 141b (1.3 g, yield: 66.1%). MS (ESI): m / z 332.2 (M+H) + .
[0523] Step 3: Compound 141b (100 mg, 0.3 mmol, 1 equiv.), intermediate A (119.42 mg, 0.45 mmol, 1.5 equiv.), [1,1'-bis(diphenylphosphino)ferrocene] dichloropalladium (44 mg, 0.06 mmol, 0.2 eq), and anhydrous sodium carbonate (96 mg, 0.90 mmol, 3.0 eq) were successively added to a mixed solution of dioxane / water (10 mL / 1 mL), protected by nitrogen, heated to 100 °C and stirred for 16 h. LCMS showed that the reaction was complete. The reaction solution was concentrated, and the residue was purified by reverse preparative chromatography Prep-HPLC to obtain the title compound 141 (22 mg, yield: 17.0%). MS (ESI): m / z 432.8 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) (EN1078-156-P): δ 9.98 (s, 1H), 9.67 (s, 1H), 8.73 (s, 1H), 8.70 (s, 1H), 8.51 (d, J = 2.8 Hz, 1H), 7.91–7.88 (m, 1H), 7.81–7.78 (m, 2H), 7.24 (d, J = 8.8 Hz, 1H), 6.71 (d, J = 8.0 Hz, 1H), 5.39 (d, J = 4.0 Hz, 1H), 4.26–4.25 (m, 1H), 3.98–3.88 (m, 4H), 3.57–3.44 (m, 3H), 2.98 (t, J = 8.4 Hz, 2H), 2.42 (s, 3H).
[0524] Example 56
[0525] Synthesis of 3-{6-[2-(2-Hydroxypropyl)-2H-indazol-5-yl]pyrazin-2-yl}-1-(6-methylpyridin-3-yl)urea:
[0526]
[0527] Step 1: Compound 134a (200 mg, 0.787 mmol, 1.0 equiv.), bis(pinacolato)diboron (299.92 mg, 1.181 mmol, 1.5 equiv.), potassium acetate (231.71 mg, 2.361 mmol, 3.0 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (86.41 mg, 0.118 mmol, 0.15 equiv.) were added to a solution of dioxane (10 mL). Under nitrogen protection, the mixture was stirred at 100 °C for 16 h. LCMS showed that the reaction was complete. The mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain the crude product of compound 142a (400 mg). MS (ESI): m / z 303.0 (M+H) + . Without further purification, it was directly used in the next step.
[0528] Step 2: To a solution of compound 142a (200 mg, 0.662 mmol, 1 equiv.) in 1,4-dioxane (10 mL), intermediate A (261.78 mg, 0.993 mmol, 1.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (96.88 mg, 0.066 mmol, 0.1 equiv.) were added. Finally, an aqueous solution (1 mL) of sodium carbonate (140.33 mg, 1.324 mmol, 2 equiv.) was added. The mixture was stirred at 100 °C for 16 h under nitrogen protection. LCMS showed that the reaction was complete. The reaction mixture was cooled to room temperature, filtered by suction, concentrated, and the residue was separated and purified by preparative HPLC to obtain the title compound 142 (2.88 mg, yield: 1.5%). MS (ESI): m / z 404.2 (M+H) + ; 1 H NMR (400 MHz, DMSO-d6) δ 9.81 (s, 1H), 9.78 (s, 1H), 8.94 (s, 1H), 8.89 (s, 1H), 8.56 (d, J = 2.8 Hz, 1H), 8.51 - 8.49 (m, 2H), 7.99 - 7.90 (m, 2H), 7.76 (d, J = 9.2 Hz, 1H), 7.28 (d, J = 8.8 Hz, 1H), 5.05 (s, 1H), 4.46 - 4.30 (m, 2H), 4.18 - 4.15 (m, 1H), 2.45 (s, 3H), 1.11 (d, J = 6.4 Hz, 3H).
[0529] Example 57
[0530] Synthesis of 3-{6-[1-(2-Hydroxycyclopentyl)-2,3-dihydro-1H-indol-5-yl]pyrazin-2-yl}-1-[(3S)-piperidin-3-yl]urea
[0531]
[0532] Step 1: Add 6-bromopyrazin-2-amine (900 mg, 5.17 mmol, 1 equiv.), (3S)-1-[(tert-butoxy)carbonyl]piperidine-3-carboxylic acid (2.37 g, 10.34 mmol, 2 equiv.), diphenylphosphoryl azide (2.8 g, 10.34 mmol, 2 equiv.), and triethylamine (1.57 g, 15.51 mmol, 3.0 equiv.) to toluene (15 mL). After purging with nitrogen, stir at 110 °C for 4 hours. LCMS shows that the reaction is complete. Concentrate the reaction solution, dissolve it in dichloromethane (10 mL), and separate it by flash silica gel column chromatography (PE:EA = 1:1) to obtain compound 143a (460 mg, yield: 21.4%). MS(ESI): m / z 344.0 (M+H) + .
[0533] Step 2: Dissolve compound 143a (100 mg, 0.25 mmol, 1 equiv.) in 1,4-dioxane (1 mL) / water (0.1 mL), add compound 49b (90.48 mg, 0.27 mmol, 1.1 equiv.), sodium carbonate (22 mg, 0.425 mmol, 1.7 equiv.), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (7 mg, 0.018 mmol, 0.07 equiv.). After purging with nitrogen, stir at 100 °C for 3 hours. LCMS shows that the reaction is complete. Filter the reaction solution, concentrate the filtrate, and purify it by TLC plate (DCM:MeOH = 20:1) to obtain compound 143b (30 mg, yield: 9.5%). MS(ESI): m / z 523.2 (M+H) + .
[0534] Step 3: Dissolve compound 143b (30 mg, 0.06 mmol, 1 equiv.) in dichloromethane (2 mL), slowly add trifluoroacetic acid (0.4 mL). After purging with nitrogen, stir at 25 °C for 1 hour. LCMS shows that the reaction is complete. Concentrate the reaction solution, and separate and purify it by reverse preparative chromatography pre-HPLC to obtain the title compound 143 (5.56 mg, 0.01 mmol, yield 22.7%). MS(ESI): m / z 423.3 (M+H) + ; 11H NMR (400 MHz, CD3OD) δ 8.52 (s, 1H), 8.47 (s, 1H), 8.25 (s, 1H), 7.66 (d, J = 8.4 Hz, 1H), 7.62 (s, 1H), 6.62 (d, J = 8.0 Hz, 1H), 4.30–4.20 (m, 1H), 4.10–3.95 (m, 1H), 3.90–3.75 (m, 1H), 3.65–3.45 (m, 3H), 3.10–2.95 (m, 4H), 2.30–2.12 (m, 1H), 2.09–1.91 (m, 3H), 1.90–1.59 (m, 6H).
[0535] Example 58
[0536] Synthesis of 3-(6-{1-[(4R)-4-hydroxyoxazol-3-yl]-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-[(3S)-piperidin-3-yl]urea:
[0537]
[0538] First step: Dissolve compound 143a (100 mg, 0.25 mmol, 1 equiv.) in 1,4-dioxane (1 mL) / water (0.1 mL), add compound 141b (91.02 mg, 0.27 mmol, 1.1 equiv.), sodium carbonate (66 mg, 0.63 mmol, 2.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (22 mg, 0.03 mmol, 0.1 equiv.). After purging with nitrogen, stir at 100 °C for 3 hours. LCMS shows that the reaction is complete. Filter the reaction mixture, concentrate the filtrate, and purify by TLC plate (DCM:MeOH = 20:1) to obtain compound 144a (30 mg, yield: 11.8%). MS (ESI): m / z 525.2 (M+H) + .
[0539] Second step: Dissolve compound 144a (30 mg, 0.06 mmol, 1 equiv.) in dichloromethane (2 mL), slowly add trifluoroacetic acid (0.4 mL). After purging with nitrogen, stir at 25 °C for 1.5 hours. LCMS shows that the reaction is complete. Filter the reaction mixture and purify by reverse preparative chromatography pre-HPLC to obtain the title compound 144 (7.9 mg, yield: 30.5%). MS (ESI): m / z 425.3 (M+H) + ; 11H NMR (400 MHz, CD3OD) δ 8.52 (s, 1H), 8.51 (s, 1H), 8.31 (s, 1H), 7.71 (d, J = 8.4 Hz, 1H), 7.68 (s, 1H), 6.69 (d, J = 8.4 Hz, 1H), 4.38 (s, 1H), 4.12–4.05 (m, 2H), 4.04–3.95 (m, 3H), 3.71–3.67 (m, 1H), 3.66–3.57 (m, 1H), 3.55–3.47 (m, 2H), 3.06–2.94 (m, 4H), 2.25–2.15 (m, 1H), 2.10–2.00 (m, 1H), 1.94–1.69 (m, 2H).
[0540] Example 59
[0541] Synthesis of (3-(6-{1-[(3-methyloxetan-3-yl)methyl]-2-oxo-2,3-dihydro-1H-indol-5-yl}pyrazin-2-yl)-1-[(3S)-piperidin-3-yl]urea:
[0542]
[0543] First step: Dissolve compound 143a (210 mg, 0.52 mmol, 1 equiv.) in dichloromethane (2 mL), slowly add trifluoroacetic acid (0.4 mL) dropwise. After purging with nitrogen, stir at 20 °C for 1 hour. LCMS shows that the reaction is complete. Concentrate the reaction solution in vacuo to obtain the crude product of compound 145a (120 mg, yield: 66.3%), which is directly used in the next step without further purification. MS (ESI): m / z 302.1 (M+H) + .
[0544] Second step: Dissolve compound 126b (100 mg, 0.29 mmol, 1 equiv.) in 1,4-dioxane (2 mL) / water (0.2 mL), add compound 145a (104.94 mg, 0.35 mmol, 1.2 equiv.), sodium carbonate (77 mg, 0.73 mmol, 2.5 equiv.) and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (22 mg, 0.03 mmol, 0.1 equiv.). After purging with nitrogen, stir at 100 °C for 3 hours. LCMS shows that the reaction is complete. After filtering the reaction solution, purify it by reverse preparative chromatography pre-HPLC to obtain the title compound 145 (10.99 mg, yield: 8.6%). MS (ESI): m / z 437.3 (M+H) + ; 11H NMR (400 MHz, DMSO-d6) δ 9.63 (s, 1H), 8.72 (s, 1H), 8.63 (s, 1H), 8.29 (s, 1H), 8.20 (s, 1H), 8.09–8.03 (m, 2H), 7.24 (d, J = 8.0 Hz, 1H), 4.59 (d, J = 6.0 Hz, 2H), 4.18 (d, J = 5.6 Hz, 2H), 3.88 (s, 2H), 3.83–3.78 (m, 1H), 3.73 (s, 2H), 3.07–2.96 (m, 1H), 2.85–2.72 (m, 2H), 2.70–2.60 (m, 1H), 1.85–1.62 (m, 2H), 1.60–1.40 (m, 2H), 1.32 (s, 3H).
[0545] Biological Test Evaluation
[0546] The present invention will be further described and explained below in combination with test examples, but these examples are not intended to limit the scope of the present invention.
[0547] Test Example 1
[0548] 1. Experimental Purpose:
[0549] The purpose of this experiment is to detect the ability of the inventive compound to inhibit the activity of PolQ polymerase. The template and primer were mixed at a ratio of 1:1.1, heat-treated at 95 °C for 5 minutes in a reaction buffer, slowly cooled, and then treated with the compound at different concentrations. After incubation at room temperature, the fluorescence was measured at the 525 / 598 nm module on an Envision instrument, and the data was read. The IC50 value was obtained by four-parameter fitting of the data, and thus the biological activity of the compound was calculated.
[0550] 2. Experimental Materials and Equipment:
[0551] 1) Materials
[0552] · Primer [P]: 5′-GACGGGAAGG-3′ (Sangon Biotech)
[0553] · Template [T]: 5-TAMRA-CCTTCCTCCCGTGTCTTGTACCTTCCCGTCAGGAGGAAGG-BHQ-3′ (Sangon Biotech)
[0554] · DNA-polymerase: POL theta (Shanghai ChemPartner)
[0555] 2) Reagents & Manufacturers:
[0556] · dNTP (10 mM),
[0557] · MgCl2, Thermo Fisher #R0971;
[0558] · NaCl, Sigma #10708976001
[0559] · BSA, Sigma #10%
[0560] · DTT, Sigma #10197777001;
[0561] 3) Consumables:
[0562] · Assay plate: 384-well microplate (Cat#4514), store at RT
[0563] · Compound plate: 96-well plate - V bottom (Haimen Qunchao, Cat#FPT019), store at RT
[0564] · Compound plate: 384-LDV plate (LABCYTE, Cat#LP-0200), store at RT
[0565] 4) Equipment:
[0566] · Liquid handler: Echo (LABCYTE Echo550)
[0567] · Plate reader: Envision multiple plate reader (Perkin Elmer)
[0568] · Cell counter: Counter star (Count star-IC-1000)
[0569] · CO2 incubator: MCO-15AC (Thermo Fisher)
[0570] · Pipette: RAININ Multichannel.Pipette: 0.2 - 10μL, 5 - 50μL, 20 - 300μL
[0571] · Centrifuge: Thermo Centrifuge ST 40R
[0572] · Water purification system: Millipore Milli-Q Reference system
[0573] · Refrigerator: Haier - 20 - degree freezer
[0574] 3. Experimental procedures
[0575] The polymerase active fragment of PolQ (amino acids 1 - 987) was expressed and purified in the SF9 insect cell line, aliquoted, and stored at - 80 °C in a refrigerator. The reaction was carried out in a 1× buffer system (20 mM Tris pH 7.8, 10 mM MgCl2, 50 mM KCl, 1 mM DTT, 0.01% Tween - 20, and 0.01% BSA).
[0576] The compound powder was dissolved in DMSO to a concentration of 10 mM. The compound was serially diluted 3 - fold, with 11 test concentrations. 150 nl of the compound was transferred to a 384 - well reaction plate (Corning 4514) using ECHO. The highest final concentration of the compound in the reaction system was 10 μM. 150 nL of DMSO was added to the positive control and negative control respectively. The content of DMSO in the final reaction system was 1%.
[0577] The template
[0578] 5 - TAMRA - CCTTCCTCCCGTGTCTTGTACCTTCCCGTCAGGAGGAAGG - BHQ - 3′ (SEQ ID NO3) and the primer 5′ - GACGGGAAGG - 3′ (SEQ ID NO3) were mixed at a ratio of 1:1.1, heat - treated in a reaction buffer (10 mM Tris (pH 8.0), 100 mM NaCl, and H2O) at 95 °C for 5 minutes, and cooled slowly. 10 μL of the mixture of PolQ protein and dNTP was added to the reaction plate (the final concentration of PolQ protein was 2.5 nM, and the final concentration of dNTP was 48 μM), and incubated at room temperature for 15 minutes. A DNA mixture was prepared (the final reaction system was 96 nM), and 5 μL was transferred to the reaction plate and incubated at room temperature for 60 minutes. After incubation, the fluorescence intensity was measured at the 525 / 598 nm module on Envision and the data was recorded. The IC50 value of the compound was determined by a four - parameter dose - response equation.
[0579] 4. Experimental results:
[0580]
[0581]
[0582] Note: A represents IC50 < 100 nM.
[0583] The above data indicate that the compounds of this application have a strong inhibitory effect on the POLQ enzyme.
[0584] Test Example 2 hERG Test
[0585] 1. Experimental Method
[0586] 1.1 Compound Storage
[0587] After receiving the compound, the compound administrator dissolves the powder in 100% DMSO to prepare a 20 mM stock solution.
[0588] 1.2 Cell Culture and Treatment
[0589] CHO cells stably expressing hERG are cultured in a 35 mm diameter cell culture dish and placed in an incubator at 37 °C and 5% CO2. On the day of the experiment, the cell culture medium is aspirated, washed once with extracellular fluid, and then 0.25%
[0590] Trypsin-EDTA solution is added and digested at room temperature for 3 - 5 minutes. The digestion solution is aspirated, the cells are resuspended with extracellular fluid, and then transferred to an experimental dish for electrophysiological recording for standby.
[0591] 1.3 Compound Preparation
[0592] Dilute the compound stock solution with 100% DMSO, that is, take 10 μL of the compound stock solution and add it to 20 μL of DMSO, and serially dilute it 3 times to obtain an intermediate concentration.
[0593] Then take 10 μL of the compound intermediate concentration and add it to 4990 μL of extracellular fluid, and dilute it 500 times to obtain the final concentration to be tested.
[0594] Preparation of positive control compound Cisapride: Take 10 μL of 150 μM cisapride DMSO stock solution and add it to 4990 μL of extracellular fluid, and dilute it 500 times to obtain the final concentration to be tested of 300 nM. The DMSO content in the final test concentration does not exceed 0.2%, and DMSO at this concentration has no effect on the hERG potassium channel.
[0595] 1.4 Electrophysiological Recording Process
[0596] CHO cells stably expressing the hERG potassium channel were used to record hERG potassium channel currents at room temperature using the whole-cell patch clamp technique. The glass microelectrode was pulled from a glass electrode blank (BF150-86-10, Sutter) using a puller. The tip resistance after perfusion with the electrode internal solution was approximately 2 - 5 MΩ. The glass microelectrode was inserted into the amplifier probe and then connected to the patch clamp amplifier. The clamping voltage and data recording were controlled and recorded by the pClamp 10 software through a computer. The sampling frequency was 10 kHz, and the filtering frequency was 2 kHz. After obtaining the whole-cell recording, the cell was clamped at -80 mV. The step voltage to induce the hERG potassium current (IhERG) was given a 2-s depolarizing voltage from -80 mV to +20 mV, then repolarized to -50 mV, and returned to -80 mV after 1 s. This voltage stimulation was given every 10 s. After determining that the hERG potassium current was stable (1 minute), the drug administration process was started. Each test concentration of the compound was given for at least 1 minute, and at least 2 cells were tested for each concentration (n≥2).
[0597] 1.5 Data processing
[0598] Data analysis and processing were performed using pClamp 10, GraphPad Prism 5, and Excel software. The degree of inhibition of hERG potassium current (peak value of the hERG tail current induced at -50 mV) by different compound concentrations was calculated using the following formula: Inhibition%=[1-(I / Io)]×100%
[0599] Where, Inhibition% represents the inhibition percentage of the compound on the hERG potassium current, and I and Io represent the amplitudes of the hERG potassium current after and before drug addition, respectively.
[0600] The IC50 of the compound was calculated by fitting using the following equation with GraphPad Prism 5 software: Y=Bottom+(Top-Bottom) / (1+10^((LogIC50-X)*HillSlope))
[0601] Where, X is the Log value of the test concentration of the test article, Y is the inhibition percentage at the corresponding concentration, and Bottom and Top are the minimum and maximum inhibition percentages, respectively.
[0602] 2. Experimental results:
[0603] The test results showed that the compound of this application had an IC 50 value greater than 30 μM and had no obvious inhibitory effect on the hERG channel within the detection concentration range of this test, which could reflect to a certain extent that the compound of this application had low cardiotoxicity and had positive significance for the safety evaluation of drugs.
Claims
1. A compound represented by the following formula (I), or a pharmaceutically acceptable salt thereof, having the following structure: Among them, X is selected from O and S; W and V are each independently selected from N; A is selected from hydrogen; Ring B is selected from phenyl, 9-10 membered bicyclic heteroaryl and 9-10 membered bicyclic heterocyclic group, wherein the heteroatoms in the heteroaryl and heterocyclic group are O or N, and the number of heteroatoms is 1, 2 or 3; wherein, n is selected from 0, 1, 2 and 3; R b Selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl; the heteroatoms in the heterocycloalkyl, heterocycloalkenyl, heterocyclic group, heteroaryl are O or N, and the number of heteroatoms is 1, 2 or 3; the C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NH(C 1-3 alkyl), -N(C 1-3 alkyl)(C 1-3 alkyl), -C(O)C 1-3 alkyl, C 1-4 alkyl, C 1-3 hydroxyalkyl; R1 is selected from the following structures: The above structure is unsubstituted or substituted by one or more of the following substituents: halogen, cyano, hydroxy, amino, -NH-C(O)C 1-3 alkyl, halo-C 1-3 alkyl, -C 1-3 alkyl-NH-C 1-3 alkyl, -C 1-3 alkyl-N(C 1-3 alkyl)C 1-3 alkyl, C 1-3 alkyl, C 3-6 cycloalkyl, C 1-3 alkoxy, C 1-3 hydroxyalkyl; R2 and R3 are independently selected from H; Provided that ring B and R1 are not both monocyclic at the same time.
2. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from phenyl, 5-membered / 6-membered bicyclic fused heteroaryl, 6-membered / 5-membered bicyclic fused heteroaryl, 6-membered / 6-membered bicyclic fused heteroaryl, 5-membered / 6-membered bicyclic fused heterocyclic group, 6-membered / 5-membered bicyclic fused heterocyclic group, 6-membered / 6-membered bicyclic fused heterocyclic group. The heteroatoms in the above-mentioned heterocyclic groups and heteroaryl groups are independently selected from O or N, and the number of heteroatoms is 1, 2 or 3. The above groups are optionally substituted by n Rs b substituted, and when multiple Rs b appear simultaneously, each R b can be the same or different; where n is selected from 0, 1, 2 and 3.
3. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from 9- to 10-membered bicyclic heterocyclic groups, the heteroatom in the heterocyclic group is N, the number of heteroatoms is 1, and the 9- to 10-membered bicyclic heterocyclic group is optionally substituted by n Rs b When multiple Rs b appear simultaneously, each R b may be the same or different, where n is selected from 0, 1, and 2.
4. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from phenyl, said phenyl being optionally substituted with n Rs b When multiple Rs b occur simultaneously, each R b may be the same or different, where n is selected from 0, 1, and 2.
5. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from the following structures, which are optionally substituted with n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different; where n is selected from 0, 1, 2, and 3:
6. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, R b - Ring B is selected from the following structures:
7. The compound according to claim 6, or a pharmaceutically acceptable salt thereof, wherein, R b Selected from halogen, cyano, hydroxy, nitro, amino, oxo, C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl; the heteroatoms in the heterocycloalkyl, heterocycloalkenyl, heterocyclic group, and heteroaryl are O or N, and the number of heteroatoms is 1 or 2; the C 1-4 alkyl, C 5-6 cycloalkyl, C 1-4 alkoxy, C 1-4 alkylthio, C 1-4 hydroxyalkyl, 4-6 membered heterocycloalkyl, 4-6 membered heterocycloalkenyl, 7-8 membered bicyclic heterocyclic group, -C 1-4 alkyl-C 3-6 cycloalkyl, -C 1-4 alkyl-4-6 membered heterocycloalkyl, -C 1-4 alkyl-5-6 membered heteroaryl, -NH-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkyl, -NH-C 1-4 alkyl-4-6 membered heterocycloalkenyl, -NH-C 1-4 alkyl-5-6 membered heteroaryl, -O-C 1-4 alkyl-4-6 membered heterocycloalkyl is unsubstituted or is substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NHCH3, -N(CH3)(CH3), -C(O)CH3, methyl, ethyl, hydroxymethyl.
8. The compound according to claim 7, or a pharmaceutically acceptable salt thereof, wherein, R b Selected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4-6-membered heterocycloalkyl, 4-6-membered heteroalkenyl, 7-8-membered bicyclic heterocyclic group, -CH2-cyclopropyl, -CH2-cyclobutyl, -CH2-cyclopentyl, -CH2-4-6-membered heterocycloalkyl, -CH2-5-6-membered heteroaryl, -NHCH2-4-6-membered heterocycloalkyl, -NHCH2-5-6-membered heteroaryl, -NH-4-6-membered heterocycloalkyl, -NH-5-6-membered heteroaryl, and -OCH2-4-6-membered heterocycloalkyl, wherein the methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4-6-membered heterocycloalkyl, -CH2-cyclopropyl, -CH2-cyclobutyl, -CH2-cyclopentyl, -CH2-4-6-membered heterocycloalkyl, -CH2-5-6-membered heteroaryl, -NHCH2-4-6-membered heterocycloalkyl, -NHCH2-5-6-membered heteroaryl, -NH-4-6-membered heterocycloalkyl, -NH-5-6-membered heteroaryl, and -OCH2-4-6-membered heterocycloalkyl are unsubstituted or are each independently substituted by one or more of the following substituents: halogen, cyano, hydroxy, nitro, oxo, -NHCH3, -N(CH3)(CH3), -C(O)CH3, methyl, ethyl, hydroxymethyl.
9. The compound according to claim 7, or a pharmaceutically acceptable salt thereof, wherein, R b selected from halogen, cyano, hydroxy, nitro, amino, oxo, methyl, ethyl, n-propyl, isopropyl, methoxy, methylthio, 10. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic group, and the 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic group are optionally substituted by n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1 or 2; R b is selected from halogen, oxo group, C 1-4 alkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, C 5-6 cycloalkyl, 4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl, and the C 1-4 alkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, C 5-6 cycloalkyl, 4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl are unsubstituted or are each independently substituted by one or more of the following substituents: halogen, cyano, hydroxy, C 1-4 alkyl; the heteroatoms in the heterocycloalkyl and heteroaryl are O or N, and the number of heteroatoms is 1 or 2.
11. The compound according to claim 10, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic group, and the 9- to 10-membered bicyclic heteroaryl and 9- to 10-membered bicyclic heterocyclic group are optionally substituted by n Rs b When multiple Rs b appear simultaneously, each R b can be the same or different, where n is selected from 1 or 2; R b is selected from halogen, oxo group, C 1-4 alkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, C 5-6 cycloalkyl, 4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl, and the C 1-4 alkyl, -C 1-4 alkyl-4- to 6-membered heterocycloalkyl, C 5-6 cycloalkyl, 4- to 6-membered heterocycloalkyl, -C 1-4 alkyl-5- to 6-membered heteroaryl, -O-C 1-4 alkyl-4- to 6-membered heterocycloalkyl are unsubstituted or are each independently substituted by one or more of the following substituents: halogen, cyano, hydroxy, methyl; the heteroatoms in the heterocycloalkyl and heteroaryl are O or N, and the number of heteroatoms is 1 or 2.
12. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, R1 is selected from the following structures:
13. The compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, Ring B is selected from phenyl, which is optionally substituted by two Rs b substituted, and when multiple Rs b appear simultaneously, each R b may be the same or different; R b is selected from methyl, R1 is selected from pyridyl optionally substituted by one or more arbitrary substituents in C 1-3 alkyl.
14. The compound according to claim 13, or a pharmaceutically acceptable salt thereof, wherein, R b - Ring B is selected from the following structures: R1 is selected from pyridyl groups optionally substituted by one or more of methyl groups.
15. A compound selected from those described below, or a pharmaceutically acceptable salt thereof:
16. A pharmaceutical composition comprising the compound according to any one of claims 1 to 15, or a pharmaceutically acceptable salt thereof.
17. Use of the compound according to any one of claims 1 to 15, or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 16 in the manufacture of a medicament for the treatment of a disease mediated by POLQ.
18. The use according to claim 17, wherein The disease mediated by POLQ is a tumor-related disease.
19. The use according to claim 18, wherein, The tumor is selected from solid tumors and hematological tumors.
20. The use according to claim 19, wherein The solid tumor is selected from breast cancer, colorectal cancer, cervical cancer, ovarian cancer, prostate cancer, gastric cancer, esophageal cancer, head and neck cancer, lung cancer; the hematological tumor is selected from lymphoma and leukemia.
21. Use of the compound according to any one of claims 1 to 15, or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 16 in the manufacture of a medicament for use in combination with one, two or more other anti-cancer agents or immune checkpoint modulators or with a treatment modality for the treatment of tumors.
22. The use according to claim 21, wherein The other anti-tumor agents or immune checkpoint modulators for the treatment of tumors are selected from PARP inhibitors, ATR inhibitors, ATM inhibitors, WEE1 inhibitors, topoisomerase inhibitors and DNA damage-based chemotherapeutic agents; the treatment modality is radiotherapy.
23. The composition according to claim 22, wherein, The DNA damage-based chemotherapeutic agents are selected from cisplatin, bleomycin, gemcitabine, docetaxel; the topoisomerase inhibitors are selected from etoposide, irinotecan.
Citation Information
Patent Citations
Quinoline derivatives as PI3 kinase inhibitors
CN101754759A
Indazole inhibitors of the wnt signal pathway and therapeutic uses thereof
CN105037355A
An Anti-cancer stemness drug
CN111093659A
Aryl and heteroaryl urea CHK1 inhibitors for use as radiosensitizers and chamosensitizers
CN1507436A
Urea derivatives as CB1 allosteric modulators
WO2020264176A1