SNP Markers, Primer Sets Related to Barley Ear and Grain Morphology and Their Applications
By discovering G-A variants of HvTUB8 gene related to ear and grain morphology in barley, and developing SNP molecular markers and primer sets, the problem of regulating ear and grain morphology in the prior art was solved, and fine regulation and efficient genetic improvement of barley breeding were achieved.
Patent Information
- Application Number
- CN202210144071.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-16
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-02-16
AI Technical Summary
The prior art is difficult to effectively regulate the morphology of barley ears and grains, and lacks fine genetic improvement methods.
By constructing a saturated mutant library of self-cultivated varieties Oda Barley 934, mutant rls were screened, and a G-A variant co-isolated with the target trait was detected on the third exon of the HvTUB8 gene on chromosome 4H, and SNP molecular markers and primer sets were developed related to this site.
The fine regulation of the morphology of barley ears and grains is achieved, and efficient SNP molecular markers are provided for barley breeding, which can accurately identify individual genotypes and are used for selective molecular breeding improvement.
Smart Images

Figure CN115369181B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular genetic breeding, and specifically relates to the mapping, cloning of a regulatory gene HvTUB8 related to barley spike and grain morphology, as well as the development and application of SNP molecular markers. Background Art
[0002] Barley (Hordeum vulgare) is the fourth largest cereal crop globally and in China. It is a typical "diverse" crop with various uses such as food, feed, brewing, and health care. For example, people in the Qinghai-Tibet Plateau region of China have long taken highland barley (naked barley) as their staple food. Different from other related gramineous species, the spikelet of barley consists of a central spikelet and two lateral spikelets, forming a "triplet spikelet". According to whether the lateral spikelets in the triplet spikelet are fertile, barley is divided into two types: six-row (lateral spikelets are fertile) and two-row (lateral spikelets are sterile).
[0003] Currently, a total of 5 barley row-type regulatory genes have been cloned. Among them, VRS1 is located on chromosome 2H and encodes homeodomain-leucine zipper class I protein (HD-ZIP1); VRS2 is located on chromosome 5H and encodes a homologous gene of Arabidopsis SHORT INTERNODES (SHI) transcription factor; VRS3 (syn. INTERMEDIUM-A) is located on 1H and encodes Jumonji C-type H3K9me2 / me3 demethylase; VRS4 (syn. INTERMEDIUM-E) is located on chromosome 3H and encodes transcription factor LATERAL ORGAN BOUNDARIES (LOB); VRS5 (syn. INTERMEDIUM-C) is located on chromosome 4H and encodes transcription factor class II TCP.
[0004] During the research process of barley, the inventor constructed a saturated mutant library of the self-bred variety Ebarley 934 (which has passed the registration of non-main crop varieties by the Ministry of Agriculture and Rural Affairs of China, variety registration number: GPD barley (highland barley) (2018) 420016), and screened the mutant rls from it. Ebarley 934 is a typical two-row barley variety, and rls has spike and grain morphology significantly different from that of Ebarley 934, showing that the lateral spikelets are punctate, the awns are shorter, the glumes are thicker, and the grains are round. Summary of the Invention
[0005] In view of this, the object of the present invention is to use the mutant rls to finely map and clone the regulatory genes related to barley spike and grain traits, to identify SNP molecular markers co-segregating with the target traits, and to design primers for this mutation site to assist in the genetic improvement of barley spike and grain related traits.
[0006] To achieve the above object, the technical solution of the present invention is as follows:
[0007] The first aspect of the present invention provides an SNP molecular marker related to barley spike and grain morphology. This molecular marker is located on the third exon of the barley HvTUB8 gene with a polymorphism of G / A. The HvTUB8 gene is located on chromosome 4H, and its nucleotide sequence is as shown in SEQ ID NO.1.
[0008] The said molecular marker co-segregates with the target traits and can be used for barley breeding.
[0009] The second aspect of the present invention provides a primer set for specifically detecting the above SNP molecular marker. The primer set sequences are as follows:
[0010] HvTUB8-1061-F: AGTTGCCGATGAATGTGGAG (SEQ ID NO.2);
[0011] HvTUB8-1061-Rc: GAAGGTGACCAAGTTCATGCTAACGTCAAGTCGACGGTGT G (SEQ IDNO.3);
[0012] HvTUB8-1061-Rt: GAAGGTCGGAGTCAACGGATTCAACGTCAAGTCGACGGTGT A (SEQ IDNO.4).
[0013] HvTUB8-1061-F is a universal primer. HvTUB8-1061-Rc is used to amplify the G allele, and HvTUB8-1061-Rt is used to amplify the A allele.
[0014] This primer set has good specificity and high amplification efficiency. It can be used to identify the genotype of the barley HvTUB8 gene, and can also be used for the screening and identification of barley resources and the selective molecular breeding improvement of barley spike and grain related traits.
[0015] The present invention further provides an application method of the above primer set, specifically as follows: using the above primer set to perform a PCR reaction on the genomic DNA of a barley sample to be tested, and after the amplification is completed, reading the fluorescence signal with a microplate reader to obtain the genotype of the barley sample to be tested; among them, individuals containing the homozygous A allele (i.e., A / A genotype) all show the same spike and grain morphology as the mutant rls (showing dot-shaped lateral spikelets, short awns, thick glumes, and round grains), individuals containing the homozygous G allele (i.e., G / G genotype) all show the same spike and grain morphology as the wild type, and individuals containing the heterozygous G / A allele show an intermediate type.
[0016] Preferably, the reaction system of the PCR reaction is as follows: a total of 100 μL; 2×PARMS master mix, 5 μL; HvTUB8-1061-Rc, 150 nM; HvTUB8-1061-Rt, 150 nM; HvTUB8-1061-F, 400 nM; DNA template, 10 - 100 nM; ddH2O for the remainder.
[0017] Preferably, the reaction program of the PCR reaction is as follows: 94°C, 15 min; 94°C, 20 s, 65 - 57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.
[0018] In addition, the above primer set can be used to prepare a kit for detecting the mutation of HvTUB8 gene.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0020] 1) Using the saturated mutant library constructed from the self-bred variety Ebarley 934, the mutant rls with variant spike and grain morphology was screened from it (obtained by compound treatment of Ebarley 934 with EMS and γ-Co60); through the BSA method based on RNA-seq and the map-based cloning strategy, an unreported G-A variation co-segregating with the target trait was detected in the third exon of HvTUB8 on chromosome 4H;
[0021] 2) The primer set developed based on the above locus, which contains 3 primers, and uses the PARMS technology to detect the genotype of individuals, with accurate genotyping and reliable results; using this primer set to perform PCR amplification on barley DNA, individuals containing the homozygous G allele all show the same spike and grain morphology as the wild type, individuals containing the homozygous A allele all show the same spike and grain morphology as the mutant rls, and individuals containing the heterozygous G / A allele show an intermediate type;
[0022] 3) Identification in a wide range of barley germplasms found that all germplasms contain the same G allele as Ebarley 934, while the A allele only exists in the mutant rls, indicating that rls is a new type of rare allelic variation. Therefore, it has great application potential in creating new barley (hulless barley) germplasms with target traits. Description of the Drawings
[0023] Figure 1 Comparison of phenotypes of Ebarley 934 (WT) and rls (m). Among them, a is the comparison of leaf colors of Ebarley 934 and rls; b - e are the comparisons of spikes, middle florets, lateral florets, and glumes of wild type (WT), heterozygous type (mm), and mutant type (m); f and g are the comparisons of grains of Ebarley 934 and rls.
[0024] Figure 2 Genotyping test results of SNP molecular markers for the segregating population.
[0025] Figure 3 Cloning and sequence comparison results of HvTUB8 in Ebarley 934 and rls. The G - A variation position is within the box in the figure. Detailed Implementation Modes
[0026] Next, the technical solutions of the present invention will be clearly and completely described in combination with the embodiments in the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments.
[0027] The experimental methods not specifically described in the following embodiments are conventional methods in molecular biology. The Taq enzyme and dNTP used are produced by TAKARA, and the rest are conventional biochemical reagents.
[0028] Example 1
[0029] Using the segregating populations (F2, F3, and F4, etc.) derived from the mutant rls and Yan 03174, it was found that the trait variation exhibited by the mutant rls is controlled by a semi - dominant gene.
[0030] Using the same population, genes regulating barley spike and grain morphology were finely mapped and cloned based on BSR - Seq. According to the results of BSR - seq, 14 pairs of primer sites polymorphic between the parents were evenly designed in the target interval on chromosome 4H, including Indel and SNP. Through PARMS technology, the above 14 pairs of polymorphic primers were used to analyze in F2, F3, and F4 populations, and a G - A mutation co - segregating with the target trait was discovered, specifically located in the third exon of the HvTUB8 gene (sequence as SEQ ID NO: 1).
[0031] Based on this site, PARMS primer pairs were developed, including HvTUB8-1061-F, HvTUB8-1061-Rc and HvTUB8-1061-Rt, with the sequences being:
[0032] HvTUB8-1061-F (universal primer): AGTTGCCGATGAATGTGGAG;
[0033] HvTUB8-1061-Rc (for amplification of G allele):
[0034] GAAGGTGACCAAGTTCATGCTAACGTCAAGTCGACGGTGT G ;
[0035] HvTUB8-1061-Rt (for amplification of A allele):
[0036] GAAGGTCGGAGTCAACGGATTCAACGTCAAGTCGACGGTGT A .
[0037] Example 2
[0038] The application method of the SNP molecular marker developed in Example 1 can refer to the following steps:
[0039] 1. DNA Extraction
[0040] Barley genomic DNA was extracted from mutant rls, salt03174, and offspring segregation populations of mutant rls and salt03174 for testing according to conventional methods in the art.
[0041] 2. Detect the genotype of the sample by PARMS method
[0042] The primers developed in Example 1 were used to perform a PCR reaction on the barley genomic DNA to be tested, wherein the PCR amplification reaction system was as follows:
[0043]
[0044] The PCR amplification reaction conditions are as follows:
[0045]
[0046] 3. Genotyping
[0047] After PCR was completed, a TECAN infinite M1000 microplate reader was used to read the fluorescence signal. Then, the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive genotyping map. According to different colors, the genotype results were output. For example, Figure 2 As shown, the green dots (upper left) represent that the tested sample carries the same allele as rls (i.e., the A allele), the blue dots (lower right) represent that the tested sample carries the same allele as the wild-type Ebarley 934 and Yan 03174 (i.e., the G allele), and the red dots (middle) represent that the tested sample carries a heterozygous allele (i.e., the G / A allele).
[0048] 4. Association analysis with target traits
[0049] The phenotypes and genotypes of each tested sample were analyzed. The results showed that individuals with the homozygous G allele all exhibited the same spike and grain morphology as the wild type, individuals with the homozygous A allele all exhibited the same spike and grain morphology as the mutant rls, and individuals with the heterozygous G / A allele showed an intermediate type (showing the same grains as the wild type, but the lateral spikelets, awn length, and lemma were between the wild type and the mutant), as Figure 1 shown.
[0050] Example 3
[0051] Sequencing verification of the specific SNP in the third exon of barley HvTUB8 in Ebarley 934 and rls Primers were designed according to the HvTUB8 gene sequence, including
[0052] HvTUB8_CDS_F: ATGAGGGAGATCCTGCACA (SEQ ID NO.5);
[0053] HvTUB8_CDS_R: GATAATCATACGGATGATTTCGC (SEQ ID NO.6)
[0054] Using the genomic DNA of Ebarley 934 and rls as templates for amplification, after obtaining the target fragment, sequencing and comparison were carried out. The results also showed that Ebarley 934 contained the G-type allele, while rls contained the A-type allele (as Figure 3 ).
[0055] Furthermore, genotype identification was carried out in barley germplasm resources using the above markers, and the presence of the A allele was not detected, indicating that the A allele is a new rare allelic variation type obtained by compound treatment of barley with EMS and γ-Co60.
[0056] As described above, it is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered by the protection scope of the present invention. SEQUENCE LISTING <110> Hubei Academy of Agricultural Sciences, Institute of Food Crops <120> SNP Markers, Primer Sets and Their Applications Related to Barley Ear and Grain Morphology <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 1589 <212> DNA <213> Hordeum vulgare <400> 1 atgagggaga tcctgcacat ccagggcggg cagtgcggga accagatcgg ggccaagttc 60 tgggaggtgg tgtgcgcgga gcacgggatc gaccccaccg gccgctacgc cggcgacacc 120 gacctgcagc tcgagcgcgt caacgtctac tacaacgagg cctcctgcgg ccgcttcgtg 180 ccccgcgccg tcctcatgga cctcgagccc ggcaccatgg actccgtccg ctccggcccc 240 tacggcggca tcttccgccc cgacaacttc gtcttcggcc agtccggcgc cggcaacaac 300 tgggccaagg gacactacac cgagggcgcc gagctcatcg actccgtcct cgacgtcgtc 360 cgcaaggagg ccgagaactg cgactgcctc caaggtctct gctttttttt cttcttcttc 420 tcctgttcct ctgttccgtt catccgtcct ccgcgccggc ggcgtggatc tggaccggag 480 gagaaatggt ggctgacgga tctgtgcggg tgcaggtttc caggtgtgcc actcgctggg 540 cggcggcacg gggtccggca tgggcacgct gctcatctcc aagatccggg aggagtaccc 600 ggaccgcatg atgctcacct tctccgtctt cccctcgccc aaggtctccg acaccgtcgt 660 cgagccctac aacgccaccc tctccgtcca ccagctcgtc gagaacgccg acgagtgcat 720 ggtgctcgac aacgaggcgc tctacgacat ctgcttccgc accctcaagc tcacaacacc 780 gagctgtaag aagcacccac actcccgatt gctgccgttt actctgtttt tgtctgattg 840 ctgatccgtg atgcccactg atcaatcaat gaactgatga gtgccgttga ttgaattgtc 900 gaacaacagt cggcgacctg aaccacctca tctcggccac catgagcggg gtcacctgct 960 gcctgcgctt cccggggcag ctcaactcgg acctccgcaa gctggccgtg aacctcatcc 1020 cgttcccgcg gctgcacttc ttcatggtgg gcttcgcgcc gctgacctcg cgcggcagcc 1080 agcagtaccg cgcgctcacc gtgcccgagc tcacccagca gatgtgggac gccaagaaca 1140 tgatgtgcgc ggccgaccct cgccacggcc gctacctcac cgcctcggcc atgttccggg 1200 gcaagatgag caccaaggag gtggacgagc agatgctgaa cgtgcagaac aagaactcga 1260 gctacttcgt ggagtggatc cccaacaacg tcaagtcgac ggtgtgcgac atcccgccga 1320 cgggcctcaa gatggcctcc acattcatcg gcaactcgac gtccatccag gagatgttcc 1380 ggcgcgtgag cgagcagttc acggccatgt accggcgcaa ggccttcctg cactggtaca 1440 cgggtgaggg catggacgag atggagttca ccgaggccga gagcaacatg aacgacctgg 1500 tgtccgagta ccagcagtac caggacgcca ccgccgacga ggagggcgag tacgaggacg 1560 aggaggacga cgccgacctc caggactag 1589 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 agttgccgat gaatgtggag 20 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <400> 3 gaaggtgacc aagttcatgc taacgtcaag tcgacggtgt g 41 <210> 4 <211> 42 <212> DNA <213> Artificial sequence <400> 4 gaaggtcgga gtcaacggat tcaacgtcaa gtcgacggtg ta 42 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <400> 5 atgagggaga tcctgcaca 19 <210> 6 <211> 23 <212> DNA <213> Artificial sequence <400> 6 gataatcata cggatgattt cgc 23
Claims
1. A primer set for specifically detecting SNP molecular markers related to the morphology of barley ears and grains, characterized in that, The SNP molecular marker is located in barley HvTUB8 on the third exon of the gene and the polymorphism is G / A. The HvTUB8 nucleotide sequence of the gene is shown in SEQ ID NO.1, and the primer set sequences are as follows: HvTUB8-1061-F: AGTTGCCGATGAATGTGGAG; HvTUB8-1061-Rc: GAAGGTGACCAAGTTCATGCTAACGTCAAGTCGACGGTGTG; HvTUB8-1061-Rt: GAAGGTCGGAGTCAACGGATTCAACGTCAAGTCGACGGTGTA.
2. Use of the primer set according to claim 1 in the breeding of Ebarley 934 and its mutants and progeny populations.
3. Use of the primer set according to claim 1 in allele detection of E barley 934 and its mutants and progeny populations HvTUB8 and / or selective breeding of spike and grain traits.
4. The application according to claim 3, characterized in that Perform a PCR reaction on the genomic DNA of the barley sample to be tested using the primer set according to claim 1. After the amplification is completed, read the fluorescence signal with a microplate reader to obtain the genotype of the barley sample to be tested; among them, the A / A genotype is characterized by dot-shaped lateral spikelets, short awns, thick glumes, and round grains.
5. The application according to claim 4, wherein The reaction system of the PCR reaction is as follows: a total of 100 μL; 2×PARMS master mix, 5 μL; HvTUB8-1061-Rc, 150 nM; HvTUB8-1061-Rt, 150 nM; HvTUB8-1061-F, 400 nM; DNA template, 10 - 100 nM; ddH2O for the remainder.
6. The application according to claim 4, wherein The reaction program of the PCR reaction is as follows: 94°C, 15 min; 94°C, 20 s, 65 - 57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.
7. A detection kit, characterized in that, Comprising the primer set according to claim 1.