Multi-omics chip based on spatial interleaved coding and its preparation method and application
Through spatial interleaving encoding technology based on 3D in situ DNA synthesis, high-resolution large-scale spatial multi-omics chips are prepared, which solves the problem of insufficient resolution and coverage in the existing technology, and realizes spatial transcriptome detection with single-cell resolution and large-scale full coverage, which is suitable for multi-omics research.
Patent Information
- Application Number
- CN202211046021.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-30
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2042-08-30
AI Technical Summary
The existing spatial transcriptome technology has shortcomings in resolution and coverage, and it is difficult to achieve efficient detection of single-cell resolution and large-scale full coverage, which limits its wide application in multiomics research.
Using 3D in situ DNA synthesis technology based on 3D inkjet in situ, high-resolution large-scale spatial multi-omics chips are prepared using spatial interleaving encoding strategies, and high-throughput analysis is performed through in situ capture strategies to achieve single-cell resolution and large-scale coverage spatial transcriptome detection.
Large-scale spatial transcriptome detection with single-cell resolution is achieved, which meets the needs of full-coverage spatial transcription map reconstruction, improves spatial resolution and gene detection rate, and is suitable for multiomic research such as cancer, microorganisms, developmental biology and other fields.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure GDA0005513567880000041
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of chip preparation, relates to a multi-omics chip, and particularly relates to a multi-omics chip based on spatial interleaved coding, and a preparation method and application thereof. Background Art
[0002] Spatial transcriptomics has become a powerful tool for studying gene expression and multi-omics analysis in complex organisms. Spatial transcriptomics is a technique that preserves the spatial location of tissues while also capturing gene transcription information at different spatial sites. It integrates techniques such as histopathology, gene microarrays, high-throughput sequencing, and bioimaging. This technique was named the 2020 Technology of the Year by Nature Methods. The spatial location of cells within tissues strongly influences their function. Spatial transcriptomics allows for high-throughput, genome-wide, and accurate capture of gene expression at the single-cell level. This allows for the generation of spatiotemporal omics maps that are crucial for studying disease mechanisms and organ development. Different spatial transcriptomics methods are evaluated based on three key dimensions: spatial resolution, gene resolution per feature point, and overall detectable regional coverage. First, smaller feature points yield higher spatial resolution, which includes regional resolution, single-cell resolution, and subcellular resolution. Second, more capture probes per feature point yield greater numbers of effectively detected genes. Finally, larger spatial transcriptomics chips or larger detection fields are more advantageous for studying large-scale tissues. Currently, the main strategies for spatial transcriptome research are divided into four categories: spatial transcriptome technology based on in situ hybridization, spatial transcriptome technology based on in situ sequencing, spatial transcriptome technology based on microdissection (LCM), and transcriptome technology based on spatial in situ capture. These technologies have their own unique advantages, but they also have shortcomings in different aspects. For example, Geo-seq, NICHE-Seq, ProximID, etc. only cut and sequence cells at specific sites, resulting in incomplete coverage. seqFISH, STARmap, FISSEQ, etc., such methods based on in situ hybridization or in situ sequencing can only obtain expression information of some but not all genes, and the gene resolution is limited. Oligonucleotide spatial barcode capture methods, such as ST, Slide-seq, DBiT-seq, Seq-Scope, etc., construct high-resolution spatial transcriptome maps by adding spatial position barcodes in situ and constructing transcriptome libraries ectopically and sequencing them; this method represents the mainstream direction of future development, but currently there are still problems with low spatial resolution and incomplete coverage. 10×GenomicsVisium is the most commercially successful spatial transcriptome chip technology. The chip size is 6.5mm×6.5mm, and the spot diameter is relatively large, reaching 55μm. It achieves regional resolution but cannot achieve single-cell resolution (the average diameter of a human cell is 10μm). The detection scale is still relatively small. In addition, there is a distance of 45μm between each point that is not covered on the tissue; therefore, the resolution is low and the position mark of the tissue section cannot be fully covered. Although spatial transcriptome technology is used in conjunction with single-cell library construction to obtain spatial maps with single-cell resolution, it is time-consuming and labor-intensive, has low throughput and is relatively expensive. Therefore, the current spatial transcriptome technology has considerable bottlenecks, which limits its widespread application.There is a need for a technology that can simultaneously meet the needs of large-scale, single-cell resolution and full-coverage spatial transcriptome chip technology with sufficient capture area, and meet the needs of more accurate three-dimensional reconstruction of transcriptional maps of full-coverage tissue sections, in order to become a tool to replace the current spatial transcriptome technology. Summary of the Invention
[0003] In order to solve the above technical problems, the purpose of the present invention is to provide a spatial multi-omics chip based on spatial interleaved coding and its preparation method and application.
[0004] The present invention is based on 3D inkjet in situ DNA synthesis technology and utilizes a spatial interleaved coding strategy to produce a high-resolution, large-scale spatial multi-omics chip, and then uses a spatial in situ capture strategy to perform high-throughput in situ transcriptome analysis, in situ epigenome analysis, in situ non-coding RNA analysis, and in situ proteome analysis on tissue sections; achieving single-cell resolution and large-scale spatial coverage while taking into account a high gene number detection rate; and can be used to construct three-dimensional full-coverage precise transcriptional maps or spatiotemporal maps of organs or tissues.
[0005] The present invention provides an in situ preparation method of a spatial multi-omics chip based on spatial interleaved coding, comprising the following steps:
[0006] 1) treating a substrate with a piranha solution and then plasma cleaning the substrate to obtain a pretreated substrate;
[0007] 2) soaking the pretreated substrate in a mixture of hydrophilic silane and hydrophobic silane, and then performing evaporation or CVD surface treatment; then sequentially adding Spacer reagent and Unylinker molecule treatment to obtain a surface-treated functional patterned chip;
[0008] 3) synthesizing sequences for spatial multi-omics analysis on the surface-treated functional patterned chip using a high-throughput in situ inkjet printing synthesis platform to obtain a spatial transcriptome chip;
[0009] 4) subjecting the spatial transcriptome chip to aminolysis to remove protected bases, thereby obtaining a honeycomb-shaped full-coverage spatial transcriptome chip;
[0010] 5) performing a Capture Oligo hybridization reaction on the honeycomb-shaped full-coverage spatial transcriptome chip;
[0011] 6) extending and ligating the probes on the chip converted with the probes in step 5) using a polymerase and a ligase without 5'-3' exonuclease activity, 3'-5' exonuclease activity, and strand displacement activity;
[0012] 7) Cleaning the chip processed in step 6) to obtain a high-resolution, large-scale spatial multi-omics chip based on spatial interleaved encoding.
[0013] In the above method, the length polymorphism coding sequence generated by adjacent staggered synthesis on the surface-treated functional patterned chip is used as a spatial coordinate barcode (Spatial Coordinate ID, SCID) to perform address confirmation of the sequence of the spatial multi-omics analysis.
[0014] In the above method, the surface-treated functional patterned chip comprises three types of spot areas, namely, spot area 1, spot area 2, and spot area 3;
[0015] The 2nd area is defined as the intersection of two adjacent circular pixels, the 3rd area is defined as the intersection of three adjacent circular pixels, and the 1st area is defined as the remaining unintersected area.
[0016] The length of the spatial coordinate barcode of zone 1 is n, the length of the spatial coordinate barcode of zone 2 is 2n, and the length of the spatial coordinate barcode of zone 3 is 3n.
[0017] In the above method, step 3) includes turning on the control computer to input the following synthesis sequence into the high-throughput DNA synthesis control software in the high-throughput in situ inkjet printing synthesis platform:
[0018] The sequence of each Spot region from the 3rd end to the 5th end is a universal sequence, a spatial coding sequence (SCID), a molecular tag sequence and a bridging sequence;
[0019] On the entire surface-treated functional patterned chip, the universal sequence, the molecular tag sequence, and the bridging sequence in all the Spot sequences are the same, and universal synthesis is performed using a Flow Cell component;
[0020] The sequence of each Spot region contains a unique spatial coding sequence, and the synthesis of the spatial coding sequence portion is performed by a piezoelectric inkjet printing nested synthesis strategy.
[0021] In the above method, the control software program for the synthesis of the spatial coding sequence portion is as follows: a coordinate system is established with the center point of the circle of zone 1 of all points, and the synthesis is performed according to the odd columns for the first time, and only the X=1, 5, 9, 13, 17... columns are synthesized, where the coordinates of the X=1 row are as follows: X=1, Y=1; X=1, Y=3; X=1, Y=5; X=1, Y=7, and so on, and the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the synthesis is performed according to the odd columns for the second time, and only the X=3, 7, 11, 15, 19... rows are synthesized, where the coordinates of the X=3 row are as follows: X=3, Y=1; X=3, Y=3; X=3, Y=5; X=3, Y=7, and so on (note that the coordinates of the even rows will be offset to the right as a whole by D μm relative to the odd rows); the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the synthesis is performed according to the even columns for the third time Synthesis, only synthesizing X=2, 6, 10, 14, 18... columns, wherein the coordinates of the X=6 column are as follows X=2, Y=2; X=2, Y=4; X=2, Y=6; X=2, Y=8; X=2, Y=10, and so on; the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the fourth synthesis is performed according to the even-numbered columns, only synthesizing X=4, 8, 12, 16, 20... columns, wherein the coordinates of the X=4 column are as follows X=4, Y=2; X=4, Y=4; X=4, Y=6; X=4, Y=8; X=4, Y=10, and so on; the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection step is completed; on the surface-treated functional patterned chip, one cycle is performed for each layer of synthesis, and the above four cycles are repeated for each layer sequence of the nested synthesis strategy.
[0022] In the above method, the substrate material is selected from at least one of a glass wafer, a quartz wafer and a silicon wafer containing a silicon dioxide layer;
[0023] In step 2), the mass ratio of the hydrophilic silane to the hydrophobic silane may be 1:5 to 150, specifically 1:9, 1:19, 1:29, 1:39, 1:49, 1:59, 1:69, 1:79, 1:89, or 1:99;
[0024] The hydrophilic silane is selected from at least one of 5,6-epoxyhexyltriethoxysilane, 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane, [8-(epoxypropyloxy)-n-octyl]trimethoxysilane, 3-glycidyloxypropyltriethoxysilane, 11-(triethoxysilyl)undecan-1-amine, 11-aminoundecyltrimethoxysilane, 3-glycidyloxypropyltrimethoxysilane, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane and 3-iodo-propyltrimethoxysilane;
[0025] The hydrophobic silane is selected from at least one of tridecafluorotetrahydrooctyl-triethoxysilane, fluorooctyltrichlorosilane, (tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane and (tridecafluoro-1,1,2,2-tetrahydrooctyl)trimethoxysilane;
[0026] The Spacer reagent is selected from at least one of pentaethylene glycol, hexaethylene glycol and PEG 800;
[0027] The Unylinker molecule is selected from at least one of the linkers shown in the following formulas (1) to (19), the photocleavable linkers shown in the following formulas (20) to (22), and the linkers shown in the following formulas (23) to (32) that can be grafted with multiple functional groups:
[0028]
[0029]
[0030] In step 5), the hybridization reaction adopts the following reaction system: comprising Bridge and Oligo dT probes (specifically 5×SSC buffer, 1 μM Capture Oligo 1, 1 μM Capture Oligo 2), and reacting at 37° C. for 30 min;
[0031] In step 6), the polymerase and ligase system used for probe extension and ligation is as follows: final concentrations of 1× rCutSmart Buffer, 200 μM dNTPs, 1 mM ATP, 0.02 U / μL Mako DNA Polymerase (3′→5′exo-) or Sulfolobus DNA Polymerase IV, 1 U / μL T4 DNA ligase or Hi-T4 DNA Ligase, and the reaction is carried out at 37°C for 30 min;
[0032] In step 7), washing was performed using 0.1× SSC buffer.
[0033] The present invention also provides the spatial multi-omics chip based on spatial interleaved coding prepared by the above method.
[0034] The present invention also provides the use of the multi-omics chip based on spatial interleaved coding in preparing any one of the following chips a) to d):
[0035] a) Single-cell resolution spatial in situ transcriptome analysis chip;
[0036] b) Single-cell resolution spatial in situ epigenomic analysis chip;
[0037] c) Single-cell resolution spatial in situ non-coding RNA analysis chip;
[0038] d) Single-cell resolution spatial in situ proteome analysis chip.
[0039] The present invention also provides an application of the spatial multi-omics chip based on spatial interleaved coding in any of the following (A1)-(A3):
[0040] (A1) Perform full-coverage, single-cell resolution, and large-scale spatial transcriptome analysis on tissue sections to investigate the spatial specificity of gene expression and generate three-dimensional transcriptional maps;
[0041] (A2) Multi-omics spatiotemporal mapping analysis based on spatial transcriptome;
[0042] (A3) Spatial transcriptomics technology.
[0043] The present invention further provides the application of the spatial multi-omics chip based on spatial interleaved coding in any of X1)-X7):
[0044] X1) Cancer research;
[0045] X2) Microbiology and infection research;
[0046] X3) Developmental biology research;
[0047] X4) Plant and agricultural research;
[0048] X6) Brain and neurodegenerative disease research;
[0049] X7) Prepare detection products in the field of diagnosis.
[0050] The present invention further provides a set of probes on a spatial transcriptome chip, which includes the set of probes described in the above method: Wafer Ligated Oligo, Capture Oligo 1, and Capture Oligo 2.
[0051] The present invention has the following beneficial effects:
[0052] The large-scale spatial transcriptome microarray chip production and experimental method with single-cell resolution provided by the present invention can meet the needs of large-scale, single-cell resolution and full coverage of more accurate three-dimensional reconstruction of spatial transcription maps. Compared with the traditional spatial transcriptome scheme, the spatial resolution is improved, and the gene detection resolution of a single cell is improved compared with the high spatial resolution spatial transcriptome scheme based on sequencing chips. At the same time, it provides a one-time full coverage detection of large-scale tissues that is not available in the current mature schemes. Therefore, the large-scale spatial transcriptome microarray chip technology with single-cell resolution of the present invention can have a wide range of application value in the fields of cancer research, microbial and infection research, developmental biology research, plant and agricultural research, brain and neurodegenerative disease research and preparation of detection products in the field of diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0053] Figure 1 Schematic diagram of SCID with adjacent interleaved coding.
[0054] Figure 2 This is a diagram showing the relationship between the centers of three adjacent ink dots in the SCID synthesis method of adjacent interleaved coding.
[0055] Figure 3 The optimal solution function relationship for minimizing the area difference between the three regions in the spatial interleaved coding strategy.
[0056] Figure 4 Design diagram of spatial transcriptome array for adjacent staggered coding.
[0057] Figure 5 Coordinate system used for in situ synthesis of adjacent staggered encoded spatial transcriptomes.
[0058] Figure 6 The X- and Y-axis relationships of the in situ synthetic coordinate system for adjacent staggered encoded spatial transcriptomes.
[0059] Figure 7 Schematic diagram of the in situ synthesis process of spatial transcriptional microarrays encoding adjacent staggered sequences.
[0060] Figure 8 This is an observation diagram of the ink droplet morphology during the in-situ synthesis process of 3D inkjet printing.
[0061] Figure 9 This is the post-processing process of probes after synthesis of spatial transcriptome chip.
[0062] Figure 10 These are the experimental results of probe post-processing after synthesis of spatial transcriptome chips.
[0063] Figure 11 This is the flow chart of the spatial miRNA group experiment. DETAILED DESCRIPTION
[0064] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0065] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0066] The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0067] In the following examples, the “[Barcode][UMI]” in the sequence of Wafer Ligated Oligo refers to the literature doi:10.1126 / science.aaf2403.
[0068] The present invention provides a multi-omics chip based on spatial interleaved coding, and its preparation method and application, including the following steps: using 3D inkjet in situ DNA synthesis technology to produce a large-scale spatial transcriptome microarray chip with single-cell resolution. The spatial transcriptome microarray chip includes two strategies: a honeycomb full-coverage spatial transcriptome chip and an adjacent interleaved coding spatial transcriptome chip. The spatial in situ capture strategy is used to perform high-throughput in situ transcriptome analysis on tissue sections. This spatial transcriptome chip technology, which meets the requirements of large-scale, single-cell resolution, and full coverage with sufficient capture area, will replace the current spatial transcriptome technology and become a powerful tool in related research fields.
[0069] The design of the adjacent interleaved coded high-resolution large-scale spatial multi-omics chip provided by the present invention:
[0070] 1. The probe array on conventional spatial transcriptome chips is typically arranged in a standard XY coordinate system. The distance between two adjacent dots is greater than their diameter, meaning that the dots do not intersect, with the closest distance typically being 40-50 microns. During the analysis process, such spatial transcriptome chips cannot detect tissue information in the blank areas not covered by the probe array, and resolution cannot be improved.
[0071] 2. This application designs a new adjacent interleaved coding high-resolution large-scale spatial multi-omics chip, such as Figure 1 As shown in the figure, with each characteristic dot as the center, there are 6 dots around it that intersect with it, and the 6 dots around it also intersect with each other. The intersection of the two dots is defined as area 2. Figure 1 The middle shaded area is marked with 2. The intersection of the three dots is defined as area 3. Figure 1 The shaded part is marked with 3. The remaining central part does not intersect with any area and is defined as area 1. Figure 1 The part marked 1 in white.
[0072] 3. In order to optimize the resolution of the spatial multi-omics chip, the areas of area 1, area 2 and area 3 in the above area need to be as consistent as possible. By simulating the center distance of the three dots, such as Figure 2 As shown in the figure, the functional relationship between the optimal center distance of dots and the radius of dots is established. The line connecting the centers of three adjacent ink dots (area 1) in the figure forms an equilateral triangle, which satisfies the center distance = 2*ΔX. Figure 3 As shown, when m=1.285r, it is the optimal center distance, and the areas of zone 1, zone 2 and zone 3 are closest.
[0073] 4. Based on the above optimal center distance, the adjacent interleaved coded spatial chip dot matrix printing is simulated, such as Figure 4 As shown, black, white and gray represent the above-mentioned zones 1, 2 and 3, respectively, thereby achieving a full tissue coverage design for spatial multi-omics chip detection. Figure 5 The XY coordinate system of the adjacent interleaved coded spatial chip dot matrix is shown. This coordinate system is an asymmetric coordinate system and will be used in the subsequent inkjet printing synthesis process. The coordinate density in the horizontal axis is greater than the coordinate density in the vertical axis. Figure 6 The relationship between the coordinate values represented by the X and Y coordinate systems is explained, wherein the relationship between the X and Y coordinate values of one unit is: ΔY = ΔX*tan(60°).
[0074] Example 1: In situ synthesis of adjacent interleaved coded high-resolution large-scale spatial multi-omics chips
[0075] 1. The glass wafer was surface treated with a piranha solution (1.5 ml 30% hydrogen peroxide solution / 3.5 ml 98% concentrated sulfuric acid) and then plasma cleaned for half an hour. The surface was then soaked and cleaned with deionized water, rinsed with acetonitrile, and dried with nitrogen for later use.
[0076] 2. Then, hydrophilic silane 3-glycidyloxypropyltriethoxysilane fluorooctyltrichlorosilane (functionalization) and hydrophobic silane (active passivation) are mixed in a mass ratio of 5:95 and immersed (immersion treatment time is 0.5 to 4 hours, specifically 3 hours), and surface treatment such as evaporation or CVD is performed. Spacer is then used to extend the synthesis arm to reduce the steric hindrance of the synthesis process. Finally, Unylinker molecules are added for subsequent synthesis of oligonucleotide phosphoramidite monomer connection, which can be easily cleaved from the substrate.
[0077] 3. The functional patterned chip that has undergone the above surface treatment is placed on the Input Station of the DYHOW high-throughput in situ synthesis platform. Turn on the device for a series of pre-processing. Turn on the control computer and input the synthesis sequence into the high-throughput DNA synthesis control software. Each Spot contains a unique spatial coding sequence, which is a universal sequence, a spatial coding sequence (SCID), a molecular tag sequence, and a bridging sequence from the 3rd end to the 5th end. Except for the spatial coding sequence (SCID) part, the sequences of other parts are the same on the entire chip, and the Flow Cell component is used for universal synthesis. For the synthesis of the spatial coding sequence part, a coordinate system is established with the center point of zone 1 of all points, such as Figure 7 As shown, the first synthesis is performed according to the odd-numbered columns, and only the columns X=1, 5, 9, 13, 17... are synthesized. The coordinates of the row X=1 are as follows: X=1, Y=1; X=1, Y=3; X=1, Y=5; X=1, Y=7, and so on. The other points in the entire coordinate system are set to null values, and after coupling, the oxidative deprotection and other steps are completed. The second synthesis is performed according to the odd-numbered columns, and only the rows X=3, 7, 11, 15, 19... are synthesized. The coordinates of the row X=3 are as follows: X=3, Y=1; X=3, Y=3; X=3, Y=5; X=3, Y=7, and so on. (Note that the coordinates of the even-numbered rows are offset Dμm to the right relative to the odd-numbered rows.) The other points in the entire coordinate system are set to null values, and after coupling, the oxidative deprotection and other steps are completed. The third synthesis was performed according to the even-numbered columns, synthesizing only the columns X=2, 6, 10, 14, 18, etc. The coordinates of the column X=6 were as follows: X=2, Y=2; X=2, Y=4; X=2, Y=6; X=2, Y=8; X=2, Y=10, and so on. All other points in the entire coordinate system were set to null values, and after coupling, the oxidative deprotection and other steps were completed. The fourth synthesis was performed according to the even-numbered columns, synthesizing only the columns X=4, 8, 12, 16, 20, etc. The coordinates of the column X=4 were as follows: X=4, Y=2; X=4, Y=4; X=4, Y=6; X=4, Y=8; X=4, Y=10, and so on. All other points in the entire coordinate system were set to null values, and after coupling, the oxidative deprotection and other steps were completed. Compared with the ordinary synthesis process, each layer of synthesis is cycled once. For the nested synthesis strategy, the sequence of each layer repeats the above four cycles. For example, if the spatial coding of point X=1, Y=1 is ATCGT, the spatial coding of point X=2, Y=1 is TCGAC, and the spatial coding of point X=1, Y=2 is GACTA, then the spatial interleaved coding of 2n corresponding to the 2 areas of their intersection is AGTACCGTTA, ATTCCGGATC, GTACCGTAAC, and the spatial interleaved coding of 3n corresponding to the 3 areas is AGTTACCCGGTATAC.
[0078] 4. Finally, after aminolysis to remove the protected bases, a honeycomb-shaped full-coverage spatial transcriptome chip can be obtained.
[0079] 5. Use the synthesized spatial transcriptome chip to perform Capture Oligo hybridization for probe conversion, such as Figure 9 Prepare a reaction system with a final concentration of 5× SSC buffer (1x SSC buffer: 150 mM sodium chloride, 15 mM trisodium citrate, pH 7.0), 1 μM Capture Oligo 1, and 1 μM Capture Oligo 2 (adjust the volume based on the chip size) and incubate at 37°C for 30 min.
[0080] 6. Probe extension and connection, e.g. Figure 9 As shown. Prepare a reaction system with a final concentration of 1× rCutSmart Buffer (50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg / ml Recombinant Albumin, 25℃, pH 7.9), 200μM dNTPs, 1mM ATP, 0.02U / μL Sulfolobus DNA PolymeraseⅣ, and 1U / μL Hi-T4 DNA Ligase. For the negative control, do not add Sulfolobus DNA PolymeraseⅣ and Hi-T4 DNA Ligase, and react at 37℃ for 30min. Figure 10 shown. Figure 10 Figures 1 and 2 represent duplicates of the Sulfolobus DNA Polymerase IV + Hi-T4 DNA Ligase system; 3 and 4 are corresponding negative controls. The desired target band is 87 bp, the probe template is 63 bp long, Capture Oligo 1 is 22 bp, and Capture Oligo 2 is 39 bp. The top bands in lanes 1 and 2 clearly indicate the reversed probe molecule containing the spatial barcode and UMI structure.
[0081] 7. Chip Cleaning: Rinse the chip twice with 0.1× SSC and remove any liquid from the chip surface with a pipette. Treat the chip with Nuclease-free water (NF-H2O) containing RNase Inhibitor (RI) (2 U / μL RI, prepared immediately before use) for 1-2 minutes and remove the liquid with a pipette. Rinse with Nuclease-free water (NF-H2O) without RNase Inhibitor (RI) and remove the liquid with a pipette. Remove any remaining liquid from the chip surface with absorbent paper and air-dry at 37°C.
[0082] Wafer Ligated Oligo
[0083] 3'GATGTGCTGCGAGAAGGCTAGA[Barcode][UMI][AACAGAAGGATTCTG]5'
[0084] Capture Oligo1
[0085] 5'CTACACGACGCTCTTCCGATCT3'
[0086] Capture Oligo 2
[0087] 5'TTGTCTTCTAAGACTTTTTTTTTTTTTTTTTTTTVN3'.
[0088] The reagents used in the above experiments and their sources are shown in Table 1.
[0089] Table 1 Reagents and their sources
[0090]
[0091] Example 2: High-resolution large-scale spatial transcriptome chip experimental method
[0092] 1. Sample Preparation: Successful sample preparation is crucial for a successful spatial transcriptomics experiment, and the key is to minimize RNA degradation in the tissue. First, when collecting fresh samples, note their spatial orientation. Rinse with PBS to remove any residual blood, and blot excess liquid from the tissue surface with laboratory paper to prevent the formation of ice crystals after freezing. Using pre-chilled forceps or a spatula, completely immerse the tissue in isopentane that has been pre-chilled in liquid nitrogen for 15 minutes until completely frozen (~1 minute). Mark the orientation of the tissue sample on the embedding cassette. Flatten the bottom of the cassette with cooled OCT (freeze on dry ice). Place the frozen tissue in the center of the cassette and continue pouring OCT to completely cover the tissue sample (avoiding any bubbles around the tissue). Immediately place the cassette containing the tissue and OCT on dry ice powder until completely frozen (approximately 30 minutes or more). Place the cassette in a sealed bag and transport on dry ice. The tissues were embedded in OCT and quickly frozen in isopentane pre-cooled with liquid nitrogen (stored at -80°C before slicing). The tissue sections were cut into 10 μm thick sections using a freezing microtome. The maximum slice size was 150 × 150 mm, while the conventional microtome could only support 50 × 80 mm.
[0093] 2. Tissue Sectioning: Set the cryostat chamber temperature to -20°C and the cryostat to -10°C. Prior to sectioning, the OCT-embedded tissue block must be equilibrated in the cryostat chamber for at least 30 minutes. Mount the OCT-embedded tissue block on the specimen stage and remove excess OCT by cryosectioning until the tissue is visible. Larger tissue samples can be segmented during sectioning, creating smaller samples to cover the capture area. Ten tissue sections were subjected to RNA extraction and quality control to confirm RNA integrity (RIN > 7). For most tissue types, a section thickness of 10 μm is recommended. If cracks appear on the section, the cryostat is too cold. If wrinkles appear on the section, the cryostat is too hot; adjust the temperature accordingly. Once the desired tissue section is obtained, gently brush the perimeter of the OCT with the cryostat brush, carefully smoothing it. Place the section on a pre-equilibrated chip. Immediately place your finger on the back of the chip for a few seconds to ensure the entire tissue section adheres to the chip. Then, immediately place the section on a stainless steel freezer to freeze the section. Do not remove the slide from the cryostat at any time during sectioning and tissue placement. Cover exposed tissue with OCT and freeze, then store in a sealed container at -80°C.
[0094] 3. Patch staining: Tissue sections were placed on a spatial transcriptome chip and fixed with methanol. After H&E staining, microscopic imaging was performed. The chip was placed on a thermal cycler adapter and incubated at 37°C for 1 minute. The chip was then completely immersed in pre-chilled methanol and incubated at -20°C for 30 minutes. 500 μl of isopropanol was added and incubated at room temperature for 1 minute. The reagents on the chip were removed, the chip was air-dried, 1 ml of hematoxylin was added, and the chip was incubated at room temperature for 7 minutes. The reagents on the chip were removed, and the chip was immersed in water several times. 1 ml of Bluing Buffer was added and incubated at room temperature for 2 minutes. The reagents on the chip were removed and the chip was immersed in water 5 times. 1 ml of eosin mixture was added and incubated at room temperature for 1 minute. The reagents on the chip were removed and the chip was immersed in water 15 times. Air-dried until the tissue was opaque. After incubating the chip at 37°C for 5 minutes, bright field imaging experiments were performed.
[0095] 4. Tissue Permeabilization: Place the chip in the chip box. Do not add permeabilization enzyme to the positive and negative controls. Add 70 μl of permeabilization enzyme to the well with the longest gradient time and place it on a PCR adapter at 37°C. After 6 minutes, add 70 μl of permeabilization enzyme to the well with the second longest gradient time and incubate on a PCR adapter at 37°C. Repeat this process until the shortest incubation time is reached. Remove the permeabilization enzyme from each well and add 100 μl of 0.1X SSC to all wells except the positive control. Remove the 0.1X SSC from each well. Add 50 μl of Fluorescent RT Master Mix to each well and place it in a preheated PCR machine (set conditions) to start cDNA synthesis. Aspirate the Fluorescent RT Master Mix from the wells and add 100 μl of 0.1X SSC to each well. Aspirate the 0.1X SSC from each well. Add 70 μl of Tissue Removal Mix to each well, then incubate on the PCR instrument adapter and aspirate the Tissue Removal Mix from the well. Remove the chip from the chip box and immerse it in preheated 2×SSC-0.1% SDS 15 times, 15 times in 0.2×SSC, and 15 times in 0.1×SSC. Centrifuge for 30 seconds on a slide rotator to confirm that there is no remaining tissue on the chip. Explore efficient tissue permeabilization conditions that fully permeabilize the tissue without causing tissue RNA diffusion. Treat with 0.1% Pepsin dissolved in 0.01M HCl for different times (3min-30min) for permeabilization. Remove the permeabilization enzyme and wash with 0.1×SSC before performing fluorescent labeling reverse transcription. Scan and image using a digital slide scanner. Determine the optimal permeabilization conditions based on fluorescence intensity and diffusion.
[0096] 5. Library construction: First, reverse transcription is performed based on the first strand of Oligo dT hybridization, then TSO is added for template conversion primer binding, followed by transcription extension, and then the second strand synthesis primer is added for second strand synthesis. Next, denaturation and cDNA amplification are performed, and the amplified product is subjected to Tn5 transposase sequencing library construction technology. The library is sequenced on the machine
[0097] 6. Data Analysis: Map library sequencing results to tissue spatial locations and construct a tissue spatial transcriptome map. Raw data processing: Data quality inspection removes low-quality data (spatial coding sequence base mismatch greater than 1, UMI containing N or 2 bases with a quality <10), uses STAR to map the remaining reads to the reference genome (mm10) and annotates with handleBam, extracts UMIs (base mismatch no greater than 1); Spatial cluster analysis: After data normalization using Scanpy, use Squidpy to determine spatial locations and annotate using eHistology Kaufman Annotations or AllenBrainAtlas based on cluster-specific markers.
[0098] Example 3: High-resolution large-scale non-coding RNA (miRNA) chip experimental method
[0099] 1. Sample and pretreatment are the same as in Example 2. Subsequently, a miRNA paired probe group (miRNA Oligo 1 and miRNA Oligo 2) is added for hybridization. The probes on both sides hybridize to the two ends of the miRNA. The gap in the middle is filled into a complete chain by ligase. The 3 ends of the complete chain contain a Poly A tail. The tissue is then permeabilized and reverse transcribed using the PolyT end on the spatial transcriptome chip. Then, the primers for Reads1 and Reads (known sequences, see Illumina Adapter Sequences) are used for amplification library construction technology. The amplified library contains the full-field sequence of the miRNA. It is used for downstream high-throughput sequencing.
[0100] miRNA Oligo 1
[0101] 3'AAAAAAAAAAAAAAAAAAAAAA+miRNA5' end reverse complementary sequence 5'
[0102] miRNA Oligo 2
[0103] 3'miRNA3' end reverse complementary sequence +TCTAGCCTTCTCGTGTGCAGAC 5'.
Claims
1. An in situ preparation method for a spatially interleaved multi-omics chip, comprising the following steps: 1) treating the substrate surface with a piranha solution and then plasma cleaning the substrate to obtain a pretreated substrate; 2) soaking the pretreated substrate in a mixture of hydrophilic silane and hydrophobic silane, and then performing evaporation or CVD surface treatment; Then, Spacer reagent and Unylinker molecule treatment are added in sequence to obtain a surface-treated functional patterned chip; 3) synthesizing sequences for spatial multi-omics analysis on the surface-treated functional patterned chip using a high-throughput in situ inkjet printing synthesis platform to obtain a spatial transcriptome chip; The surface-treated functional patterned chip comprises three types of spot areas, namely, spot area 1, spot area 2, and spot area 3; The 2nd area is defined as the intersection of two adjacent circular pixels, the 3rd area is defined as the intersection of three adjacent circular pixels, and the 1st area is defined as the remaining unintersected area. The length of the spatial coordinate barcode of region 1 is n, the length of the spatial coordinate barcode of region 2 is 2n, and the length of the spatial coordinate barcode of region 3 is 3n, where n is the number of bases; Step 3) includes turning on the control computer and inputting the following synthesis sequence into the high-throughput DNA synthesis control software in the high-throughput in-situ inkjet printing synthesis platform: The sequence of each Spot region is a universal sequence, a spatial coding sequence, a molecular tag sequence and a bridging sequence from the 3rd end to the 5th end; On the entire surface-treated functional patterned chip, the universal sequence, molecular tag sequence, and bridge sequence in all Spot sequences are the same, and universal synthesis is performed using a Flow Cell component; The sequence of each Spot region contains a unique spatial coding sequence, and the synthesis of the spatial coding sequence portion is performed by a piezoelectric inkjet printing nested synthesis strategy; 4) The spatial transcriptome chip is subjected to aminolysis to remove protected bases, thereby obtaining a honeycomb-shaped full-coverage spatial transcriptome chip; 5) performing a Capture Oligo hybridization reaction on the honeycomb-shaped full-coverage spatial transcriptome chip; 6) extending and ligating the probes on the chip converted with the probes in step 5) using a polymerase and a ligase without 5'-3' exonuclease activity, 3'-5' exonuclease activity, or strand displacement activity; 7) Cleaning the chip processed in step 6) to obtain a spatial multi-omics chip based on spatial interleaved coding.
2. The method according to claim 1, wherein: The surface-treated functional patterned chip utilizes length polymorphism coding sequences generated by adjacent staggered synthesis as spatial coordinate barcodes to perform address confirmation of sequences for spatial multi-omics analysis.
3. The method according to claim 1, wherein: The control software program for the synthesis of the spatial coding sequence portion is as follows: a coordinate system is established with the center point of the circle of zone 1 of all points, and the first synthesis is performed according to the odd columns, and only the X=1, 5, 9, 13, 17... columns are synthesized, wherein the coordinates of the X=1 row are as follows X=1, Y=1; X=1, Y=3; X=1, Y=5; X=1, Y=7, and so on, and the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the second synthesis is performed according to the odd columns, and only the X=3, 7, 11, 15, 19... rows are synthesized, wherein the coordinates of the X=3 row are as follows X=3, Y=1; X=3, Y=3; X=3, Y=5; X=3, Y=7, and so on; the other points of the entire coordinate system are set to null values, and after coupling, the oxidation deprotection and other steps are completed; the third synthesis is performed according to the even columns, and only the X=2, 6, 10, 14,18... columns, where the coordinates of column X=6 are as follows: X=2,Y=2; X=2,Y=4; X=2,Y=6; X=2,Y=8; X=2,Y=10, and so on; the other points of the entire coordinate system are set to null values, and the oxidation deprotection and other steps are completed after coupling; the fourth synthesis is performed according to the even-numbered columns, and only the X=4, 8, 12, 16, 20... columns are synthesized, where the coordinates of column X=4 are as follows: X=4,Y=2; X=4,Y=4; X=4,Y=6; X=4,Y=8; X=4,Y=10, and so on; the other points of the entire coordinate system are set to null values, and the oxidation deprotection and other steps are completed after coupling; the other points of the entire coordinate system are set to null values, and the oxidation deprotection step is completed after coupling; on the surface-treated functional patterned chip, each layer is synthesized in one cycle, and the above four cycles are repeated for each layer sequence of the nested synthesis strategy.
4. The method according to any one of claims 1 to 3, characterized in that: The substrate material is selected from at least one of a glass wafer, a quartz wafer and a silicon wafer containing a silicon dioxide layer; In step 2), the mass ratio of the hydrophilic silane to the hydrophobic silane is 1:5-150; The hydrophilic silane is selected from at least one of 5,6-epoxyhexyltriethoxysilane, 3-[2-(2-aminoethylamino)ethylamino]propyl-trimethoxysilane, [8-(epoxypropyloxy)-n-octyl]trimethoxysilane, 3-glycidyloxypropyltriethoxysilane, 11-(triethoxysilyl)undecan-1-amine, 11-aminoundecyltrimethoxysilane, 3-glycidyloxypropyltrimethoxysilane, N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, 11-acetoxyundecyltriethoxysilane, n-decyltriethoxysilane, (3-aminopropyl)trimethoxysilane, (3-aminopropyl)triethoxysilane and 3-iodo-propyltrimethoxysilane; The hydrophobic silane is selected from at least one of tridecafluorotetrahydrooctyl-triethoxysilane, fluorooctyltrichlorosilane, (tridecafluoro-1,1,2,2-tetrahydrooctyl)trichlorosilane and (tridecafluoro-1,1,2,2-tetrahydrooctyl)trimethoxysilane; The Spacer reagent is selected from at least one of pentaethylene glycol, hexaethylene glycol and PEG 800; The Unylinker molecule is selected from at least one of the following linkers: (1) to (19), (20) to (22) photo-cleavable linkers, and (23) to (32) linkers capable of grafting multiple functional groups: In step 5), the hybridization reaction adopts the following reaction system: comprising Bridge and Oligo dT probes, and reacting at 37°C for 30 min; In step 6), the polymerase and ligase system used for probe extension and ligation is as follows: final concentrations of 1× rCutSmart Buffer, 200 μM dNTPs, 1 mM ATP, 0.02 U / μL Mako DNA Polymerase (3′ →5′ exo-) or Sulfolobus DNA Polymerase IV, 1 U / μL T4 DNA ligase or Hi-T4 DNA Ligase, and the reaction is carried out at 37°C for 30 min. In step 7), washing was performed using 0.1× SSC buffer.
5. The method according to any one of claims 1 to 4 is used to prepare the multi-omics chip based on spatial interleaved coding.
6. Use of the spatially interleaved coding multi-omics chip according to claim 5 in preparing any one of the following chips a) to d): a) Spatial in situ transcriptome analysis chip with single-cell resolution; b) Spatial in situ epigenomic profiling chip with single-cell resolution; c) Spatial in situ non-coding RNA analysis chip with single-cell resolution; d) Single-cell resolution spatial in situ proteome analysis chip.
7. Use of the multi-omics chip based on spatial interleaved coding according to claim 5 in any of the following (A1)-(A3): (A1) Perform full-coverage, single-cell resolution, and large-scale spatial transcriptome analysis on tissue sections to investigate the spatial specificity of gene expression and generate three-dimensional transcriptional maps; (A2) Analyze multi-omics spatiotemporal maps based on spatial transcriptome; (A3) Spatial transcriptomics technology.
8. Application of the spatial multi-omics chip based on spatial interleaved coding according to claim 5 in any of X1) to X2): X1) Plant and agricultural research; X2) Preparation of test products in the field of diagnostics.
Citation Information
Patent Citations
Biochip and manufacturing method and application thereof
CN113166974A
Tissue three-dimensional space omics method based on three-coordinate space positioning
CN114854839A