A nucleic acid polypeptide nanopharmaceutical composition for treating and preventing human papillomavirus infection

Abstract

The present invention discloses a nucleic acid polypeptide nanopharmaceutical composition for the treatment and prevention of human papillomavirus infection. Small interfering nucleic acid siRNA molecules used to inhibit and treat various diseases caused by HPV infection block the viral replication life cycle by targeting and inhibiting the expression of HP16 / 18 key genes, reduce viral infection and ultimately eliminate the virus. The pharmaceutical composition based on the siRNA molecule includes siRNA molecules and another molecule, including siRNA molecules that inhibit PD-1 / PD-L1, small molecule compounds that fight HPV infection, therapeutic mRNA / neoantigen vaccines, etc. The siRNA molecules are coupled to other anti-HPV drugs through specific chemical bonds to form new coupled molecules. The composition also includes a pharmaceutically acceptable polypeptide polymer nano-introduction carrier, and the carrier is preferably a histidine-lysine polypeptide polymer nano-carrier.

Description

Technical Field

[0001] The present invention belongs to the technical field of new drugs, and in particular relates to a nucleic acid polypeptide nanopharmaceutical composition for treating and preventing human papillomavirus infection. Background Art

[0002] HPV and cervical cancer

[0003] Human papillomavirus (HPV) is a group of enveloped DNA viruses, with more than 100 different species, and is the most common sexually transmitted (ST) infection in adults worldwide. In 1976, Harald zur Hausen from Germany hypothesized that HPV plays an important role in inducing cervical cancer tissue [1]. In 1983 and 1984, zurHausen and his collaborators identified HPV 16 and HPV 18 in cervical cancer [2-4]. For this, zur Hausen was awarded the 2008 Nobel Prize in Physiology or Medicine. It is estimated that more than 80% of American women aged 50 years will be infected with at least one HPV strain [5]. In addition, there are 490,000 new cases of cervical cancer each year worldwide, resulting in 270,000 deaths. In the United States, 250,000 to 1 million women develop cervical atypical hyperplasia each year, which will lead to 11,000 further development of cervical cancer and 4,000 deaths [6]. Of the 19 “high-risk” HPVs that cause cervical cancer, HPV 16 and HPV 18 have approximately a 70% chance of causing cervical cancer [7].

[0004] HPV has an 8 kb circular genome containing three major genomic domains, namely the early genes (E6, E7, E1, E2, E4 and ES), the late genes (L1 and L2), and the long control region (LCR) between L1 and L6. Figure 1 The typical HPV genome structure is given, and the medically important HPV-16 is used as a model. Early transcription terminates at position 4215, encoding 6 early genes, and late transcription terminates at position 7221, encoding two late genes. E6 and E7 are early transcribed cancer transforming proteins because they can inactivate the tumor suppressor protein p53 (inactivated by E6) and pRb

[0005] (Inactivated by E7) inactivated[8].

[0006] Although the US FDA has approved two HPV vaccines (described in detail below), there is still a huge demand for HPV treatment. Despite this, there is still a lack of effective treatment measures on the market [9]. The present invention describes a therapy for treating HPV using a complex composed of siRNA and histidine-lysine polymers.

[0007] HPV vaccine

[0008] In 2006, the US FDA approved Gardasil, an HPV vaccine produced by Merck, which consists of a hollow virus-like particle (VLP) assembled from recombinant HPV coat proteins. Gardasil targets HPV 16, 18, 6, and 11 and is intended for use in women and girls. Later, based on extended studies, Gardasil was also effective in preventing genital warts in men. The FDA approved the use of Gardasil in men and boys on October 16, 2009. In October 2009, the FDA also approved a second HPV vaccine, Cervarix, which targets HPV 16 and HPV 18 and is produced by GlaxoSmithKline

[10] . In June 2015, Merck & Co. received great news in terms of European regulation. Its super HPV vaccine Gardasil 9 (9-valent HPV vaccine) was approved by the European Commission. The vaccine is the successor of Gardasil 4 (4-valent vaccine), covers 9 genotypes of HPV, and has the potential to prevent about 90% of cervical, vulvar, vaginal and anal cancers. Previously, the FDA approved Gardasil 9 in December 2014. The industry predicts that Gardasil 9 will replace Gardasil 4 as the world's best-selling HPV vaccine, with peak sales reaching US$1.9 billion.

[0009] Development of siRNA and new therapies targeting HPV16 and HPV18

[0010] RNA interference was initially discovered in plants, but was soon shown to be a universal process across lower and higher organisms. It is an efficient process that induces the formation of double-stranded RNA and leads to the recognition, binding, and degradation of specific target messenger RNAs

[15] . In recent years, RNAi has been applied not only to various biological studies but also to the development of various therapeutics

[16] . To date, at least 15 RNAi therapeutics have been developed and are in different stages of clinical trials or have completed clinical trials

[17] .

[0011] After in silico screening of some candidate siRNA sequences targeting HPV16 E7 and HPV18 E7 was performed by computer software, these sequences were chemically synthesized, and the biological functions of the candidate small interfering nucleic acid sequences were further verified and screened using in vitro cell systems and in vivo HPV animal models. In vitro cytological experiments confirmed that the exogenous introduction of the corresponding HPV16E7 and HPV18 E7 siRNAs at the same time could significantly inhibit the mRNA expression level of the target gene, and a good therapeutic effect was obtained in the corresponding cottontail rabbit animal model. Therefore, the use of chemically synthesized HPV16 E7 and HPV18 E7 modified siRNA-small molecule coupling to treat HPV and HIV and / or HSV infections has created a new treatment method, which is a new type of drug different from traditional small molecules or monoclonal antibody drugs, with a clear mechanism of action, a clear target, and a unique and effective introduction system.

[0012] Histidine-Lysine Branched Peptides (HKP) for In Vivo siRNA Delivery

[0013] Although RNAi provides a very attractive technology for developing innovative therapeutics, many projects have failed. The failure of most projects is attributed to the stability of siRNA

[16] . Naked siRNA must be modified to avoid degradation or packaged with other molecules to facilitate siRNA entry into cells or functionalize siRNA to reduce target gene expression

[18] . Therefore, the development of delivery methods has become one of the most important areas of siRNA therapy research and development

[19] .

[0014] Histidine-Lysine Co-polymer (HKP) is a positively charged branched polymer ( Figure 2 ), which has been successfully used for in vivo delivery of plasmid DNA and siRNA. We have developed HKP for in vivo delivery of nucleic acids in various tissue types, including skin scars, liver, lungs, tumors, eyes, and brain. Summary of the invention

[0015] The technical problem to be solved by the present invention is to provide a pharmaceutical composition that can be used to prepare a targeted drug for treating HPV infection.

[0016] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0017] A nucleic acid polypeptide nano drug composition, characterized by comprising siRNA of HPV16-E7 and HPV18-E7, conjugates of these siRNAs and small molecule drugs, a pharmaceutically acceptable carrier suitable for in vivo drug delivery, and a nano drug composed of the carrier and nucleic acid.

[0018] The invention comprises siRNA targeting HPV16 E7 and HPV18 E7, and a vector suitable for in vivo introduction, wherein the vector is a histidine-lysine branched polypeptide (HKP) or a modified product thereof.

[0019] Specifically, the HPV16 E7 siRNA includes HPV16 E7 siRNA-45#, and the sequence of the HPV16E7siRNA-45# is 5'-GCACCCUGGGCAUCCUGUGCCCCAU-3'.

[0020] Specifically, the HPV16 E7-45# siRNA is double-stranded and easily degraded, and needs to be dissolved in RNase-free treated water, and can be encapsulated by adding a positively charged carrier to improve stability.

[0021] The composition comprises a pharmaceutically acceptable carrier, which can be selected from the group consisting of, but not limited to, saline, sugar solution, polypeptide, polymer, lipid, cream gel, micellar material, metal nanoparticles, dendrimer and HK polymer.

[0022] The positively charged carrier is histidine-lysine branched polypeptide (HKP).

[0023] Such copolymers are described in U.S. Patent Nos. 7070807B2, 7163695B2 and 7772201B2, the entire contents of which are incorporated herein by reference. Preferably, the HKP carrier is H3K4b, H3K(+H)4b, H2K4b or H3K(+N)4b, which HKPs have a lysine backbone with four branches containing multiple repeats of histidine, lysine or asparagine.

[0024] Specifically, the HPV16 E7 siRNA includes HPV16-CRPV E7 siRNA-43#, and the sequence of the HPV16-CRPV E7 siRNA-43# is 5'-GGAAGACCUGCUGAUGGGCACCCU-3'.

[0025] More specifically, the HPV16-CRPV E7 siRNA-43# is a siRNA sequence designed based on the mRNA homologous sequences of CRPVE7 (i.e., cotton rabbit papillomavirus) and HPV16 E7.

[0026] Specifically, the HPV18 E7 siRNA includes HPV18 E7 siRNA-44#, and the sequence of the HPV18E7siRNA-44# is 5'-GCUCAGCAGACGACCUUCGAGCAUU-3'.

[0027] Specifically, the HPV18 E7 siRNA includes HPV18 E7 siRNA-46#, and the sequence of the HPV18E7siRNA-46# is 5'-GCUGUUUCUGAACACCCUGUCCUUU-3'.

[0028] Specifically, the siRNA molecules include HPV16-CRPV E7 siRNA-43# and HPV18 E7 siRNA-44#. The HPV16-CRPV E7 siRNA-43# and HPV18 E7 siRNA-44# are mixed into a dual-target siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0029] Specifically, the siRNA molecules include HPV16-CRPV E7 siRNA-43# and HPV18 E7 siRNA-46#. The HPV16-CRPV E7 siRNA-43# and HPV18 E7 siRNA-46# are mixed into a dual-target siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0030] Specifically, the siRNA molecules include HPV16 E7 siRNA-45# and HPV18 E7 siRNA-44#. The HPV16 E7 siRNA-45# and HPV18 E7 siRNA-44# are mixed into a dual-target siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0031] Specifically, the siRNA molecules include HPV16 E7 siRNA-45# and HPV18 E7 siRNA-46#. The HPV16 E7 siRNA-45# and HPV18 E7 siRNA-46# are mixed into a dual-target siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0032] Specifically, the siRNA molecules include HPV16-CRPV E7 siRNA-43#, HPV18 E7 siRNA-44#, and HPV18 E7 siRNA-46#. The HPV16-CRPV E7 siRNA-43#, HPV18E7 siRNA-44#, and HPV18 E7 siRNA-46# are mixed into a dual-target multi-effect siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0033] Specifically, the siRNA molecules include HPV16 E7 siRNA-45#, HPV18 E7siRNA-44#, and HPV18E7 siRNA-46#. The HPV16 E7 siRNA-45#, HPV18 E7siRNA-44#, and HPV18 E7 siRNA-46# are mixed into a dual-target multi-point siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0034] Specifically, the siRNA molecules include HPV18 E7 siRNA-44#, HPV16-CRPV E7siRNA-43#, and HPV16 E7 siRNA-45#. The HPV18 E7 siRNA-44#, HPV16-CRPV E7 siRNA-43#, and HPV16 E7siRNA-45# are mixed into a dual-target multi-point siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0035] Specifically, the siRNA molecules include HPV18 E7 siRNA-46#, HPV16-CRPV E7siRNA-43#, and HPV16 E7 siRNA-45#. The HPV18 E7 siRNA-46#, HPV16-CRPV E7siRNA-43#, and HPV16 E7siRNA-45# are mixed into a dual-target multi-point siRNA cocktail, which can be used to enhance its anti-HPV, HIV and / or HSV infection effect.

[0036] A pharmaceutical composition for preventing or treating HPV infection, wherein the active ingredients of the pharmaceutical composition include an siRNA molecule that inhibits HPV replication and another molecule, wherein the other molecule includes one or more of an siRNA molecule that inhibits human immune regulation-related genes, an anti-HPV small molecule compound, a cervical cancer mRNA vaccine, or an anti-HPV monoclonal antibody.

[0037] The other siRNA molecule that inhibits human immune regulation-related genes mentioned above is an siRNA molecule that inhibits immune checkpoints, including but not limited to: siRNA molecules that inhibit PD-1, siRNA molecules that inhibit PD-L1, siRNA molecules that inhibit LAG-3, siRNA molecules that inhibit TIM-3, siRNA molecules that inhibit VISTA, siRNA molecules that inhibit TIGIT, and siRNA molecules that inhibit CTLA-4 / B7.

[0038] The above-mentioned anti-HPV small molecule compound is selected from one or more of Cidofovir and Brincidofovir, or one or more of Artesunate and Dihydroartemisinin.

[0039] The above-mentioned cervical cancer mRNA vaccine is a messenger RNA vaccine that uses HPV gene fragments to encode specific proteins to induce the human body to form a protective effect against HPV infection.

[0040] The above-mentioned anti-HPV monoclonal antibody is a therapeutic antibody drug for treating various diseases caused by HPV infection.

[0041] In the composition of the present invention, the histidine-lysine branched polypeptide (HKP) is a positively charged branched histidine-lysine polymer, which is used for nucleic acid conduction in various tissue types.

[0042] Specifically, the modified histidine-lysine branched polypeptide is a branched histidine-lysine polymer (HKP+H) with an additional histidine, which is used for nucleic acid conduction in various tissue types and induces extremely low immune and inflammatory responses.

[0043] Specifically, the histidine-lysine branched polypeptide adopts H3K4b, which is composed of three lysine cores and four branches, and the four branches all include a large number of repeated histidine and lysine. The specific structure is shown in Figure 2 .

[0044] Specifically, the modified histidine-lysine branched polypeptide adopts H3K(+H)4b, and its specific structure is to add a histidine to the branch of H3K4b, that is, the structure of H3K(+H)4b is to add a histidine to the branch of H3K4b. Figure 2 The side chain R in is replaced by R=KHHHKHHHHHHHHHHKHHK.

[0045] A nucleic acid polypeptide nano drug composition comprises a pharmaceutically acceptable carrier, wherein the carrier is mixed with siRNA molecules at a specific nitrogen-phosphorus ratio (N:P) to form a nano drug of a specific size.

[0046] A nano drug combination formed by HKP and siRNA drugs or siRNA drug-based compositions, wherein the HKP carries a positive charge, while siRNA, siRNA and siRNA compositions, siRNA and mRNA vaccine compositions, etc. carry a negative charge, and when an HKP aqueous solution is mixed with siRNA or a siRNA drug-based composition at a specific mass ratio (e.g., 4:1), nanoparticles are self-assembled. The average diameter of the nanoparticles is in the range of 50-300 nanometers, and more preferably, the size of the nanoparticles is 80-150 nanometers.

[0047] Specifically, the N:P mass ratio of the vector to the small nucleic acid molecule siRNA is between 16:1 and 1:8.

[0048] Preferably, the N:P mass ratio of the vector to the small nucleic acid molecule siRNA is greater than or equal to 4:1.

[0049] Specifically, a single siRNA molecule binds to mRNA encoded by an HPV gene, wherein the 20-40 nucleotide pair of HPV16 or HPV18 is inserted into the end of the E7 gene of cottontail rabbit Papilloma Virus in the same "reading frame" to form a fusion protein, and the 20-40 nucleotide pair can serve as the attack sequence site of the siRNA.

[0050] Specifically, the fusion virus formed by the fusion protein can infect the skin of cottontail rabbits and form normal infection scars. The changes in the infection scars will become an indicator of the efficacy of small interfering nucleic acid therapy.

[0051] The HKP of the present invention is commissioned to an outsourcing company and synthesized according to the patented technology owned by the inventor. Figure 3 The specific steps of HKP synthesis are described in detail.

[0052] A use of the small interfering nucleic acid pharmaceutical composition in the preparation of a targeted drug for treating HPV infection.

[0053] The second aspect of the present invention provides a pharmaceutical composition for preventing or treating HPV virus infection, wherein the active ingredients of the pharmaceutical composition include siRNA molecules targeting HPV virus and small molecule compounds against HPV virus.

[0054] Specifically, the nucleotide analogs that inhibit HPV virus are selected from one or more of Cidofovir and Brincidofovir.

[0055] Specifically, the artemisinin derivative is selected from one or more of artesunate and dihydroartemisinin.

[0056] Specifically, small nucleic acid siRNA includes special 2'-OMe, 2'-F, 2'-MOE, sulfur-modified phosphate backbone, base modification, antisense and sense 5' end modification and other chemically modified small nucleic acids to improve the stability of small nucleic acid siRNA and reduce the off-target effect and immune response of small nucleic acid siRNA.

[0057] Specifically, the modified small nucleic acid siRNA includes 19+2 double-stranded and 21+23 double-stranded structures with special asymmetric structures. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 A. HPV genome. Bottom is an amplification of the E7 gene, with three sequences to be inserted into the cotton tail rabbit genome marked in black.

[0059] Figure 1 B. siRNA targeting the wild-type E7 gene of HPV 16, and the hybrid E7 gene from HPV 16 and CRPV. Red indicates the CRPV sequence used to replace the corresponding HPV 16 segment. The yellow region in the CRPV E7 siRNA indicates the result of codon optimization.

[0060] Figure 1 C. Gene structure of chimeric human rabbit papillomavirus (cH-RPV). Three epitope sequences A, B and C from HPV 16 E7 gene were inserted into the same reading frame at the end of CRPV E7 gene.

[0061] Figure 2 .Schematic diagram of the structure of a histidine-lysine branched polypeptide and a side chain modified with the addition of a histidine, wherein R represents the amino acid sequence of the four branched side chains.

[0062] Figure 3 .Synthesis steps of HKP.

[0063] Figure 4 .The process of complex formation between siRNA and HKP; cottontail rabbit skin infection papillomavirus model (SIRAM).

[0064] Figure 5 .Screening results of HPV 16E7 siRNA in SiHa cells (real-time fluorescence quantitative method was used to detect the mRNA expression of the target gene).

[0065] Figure 6 .Screening results of HPV-CRPV16 E7 siRNA in SiHa cells (real-time fluorescence quantitative method was used to detect the mRNA expression of the target gene).

[0066] Figure 7 .Screening results of HPV 18E7 siRNA in Hela cells (real-time fluorescence quantitative method was used to detect the mRNA expression of the target gene).

[0067] Figure 8 .The Western method was used to detect the inhibitory effect of siRNA on the protein expression level of HPV16 E7 gene in SiHa cells. Western blot (left) and quantitative data (right) showed that siRNA can effectively reduce the expression of E7 protein, and the knockdown effect order is -45>-43>-44>-37, which is consistent with the results of real-time fluorescence quantitative experiment.

[0068] Fig. 9 . is the therapeutic effect of siRNA (CRPV-43) in the cH-RPV cottontail rabbit model. The results show that the siRNA has a good inhibitory effect on the growth of rabbit skin warts (L). The data is shown on the right (R).

[0069] Fig.10 .Data summary of different siRNA treatments for cH-RPV, and highlighting the effective siRNAs.

[0070] Fig.11 .To detect the effect of combined use of HPV16 and HPV18 siRNA by real-time fluorescence quantitative method in vitro1. HPV16-CRPV-43#siRNA and HPV18-44#siRNA or HPV18-46#siRNA were transfected into Siha cells, and the ratio of the two siRNAs was 1:2, 1:1, and 2:1. Then, the expression of the corresponding target gene (HPV16E7) mRNA was detected by real-time quantitative PCR to determine the combined effect of the two siRNAs.

[0071] Fig.12.To detect the effect of combined use of HPV16 and HPV18 siRNA by real-time fluorescence quantitative method in vitro2. HPV16-45#siRNA and HPV18-44#siRNA or HPV18-46#siRNA were transfected into Siha cells, and the ratio of the two siRNAs was 1:2, 1:1, and 2:1. Then, the expression of the corresponding target gene (HPV16E7) mRNA was detected by real-time quantitative PCR to determine the combined effect of the two siRNAs.

[0072] Fig.13 The real-time fluorescence quantitative method was used in vitro to detect the effect of the combined use of HPV16 and HPV18 siRNAs 3. HPV18-44#siRNA and HPV16-CRPV-43#siRNA or HPV16-45#siRNA were transfected into Hela cells, and the ratio of the two siRNAs was 1:2, 1:1, and 2:1. Then, the real-time quantitative PCR method was used to detect the expression of the corresponding target gene (HPV18E7) ​​mRNA, thereby determining the combined effect of the two siRNAs.

[0073] Fig.14 The real-time fluorescence quantitative method was used in vitro to detect the effect of the combined use of HPV16 and HPV18 siRNAs 4. HPV18-46#siRNA and HPV16-CRPV-43#siRNA or HPV16-45#siRNA were transfected into Hela cells, and the ratio of the two siRNAs was 1:2, 1:1, and 2:1. Then, the real-time quantitative PCR method was used to detect the expression of the corresponding target gene (HPV18E7) ​​mRNA, thereby determining the combined effect of the two siRNAs.

[0074] Fig.15 It is a coupling method for siRNA molecules and nucleotide analogs. The molecules contain amino, hydroxyl and phosphate active groups. They are molecularly modified to produce phosphoramidite monomers suitable for solid phase synthesis, which can be directly used for siRNA connection.

[0075] Fig.16 It is a coupling method for siRNA molecules and artemisinin derivatives. The molecules contain carboxylic acid or hydroxyl active groups, and siRNA can be connected through addition reaction.

[0076] Fig.17 A general way to couple other drug molecules to one end of siRNA is shown. Through the phosphate group, specific small molecules for treating HPV infection can be attached to siRNA molecules that inhibit HPV replication.

[0077] Fig.18A is a schematic diagram of the modification of the phosphate backbone or base, and B shows the modification at different sites of siRNA to form special asymmetric structures such as 19+2 double strands and 21+23 double strands. DETAILED DESCRIPTION

[0078] The present invention is further described in detail below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments.

[0079] Example 1. Preparation of effective siRNA duplexes targeting HPV 16-E7, HPV 18-E7 and cH-RPV-E7

[0080] In preliminary studies, we have demonstrated that 25mer siRNAs are most effective in inhibiting the expression of specific genes. To ensure the efficacy of each siRNA in knocking down the target gene, several key features of the siRNA should be considered during computer design and subsequent in vitro and in vivo experiments:

[0081] (1) Have optimal thermodynamic properties to bind to the target sequence;

[0082] (2) be of sufficient length to bind to RISC;

[0083] (3) immunostimulatory motifs have been removed (or added);

[0084] (4) Minimize the possibility of "off-target";

[0085] (5) Through patent search, there is no conflict with current patents;

[0086] (6) Multiple sequences do not interact when mixed in a cocktail.

[0087] In the present invention, we designed siRNA targeting conserved gene sequences, and the conserved sequences targeted are shared by as many HPV types as possible to increase the wide applicability of siRNA. In addition, our preliminary results have shown that 25mer siRNA is more effective than 21mer siRNA. We used 25mer siRNA to design siRNA targeting the early gene E7. The specific siRNA sequence is as follows:

[0088] Design sequence of HPV18E7 siRNA:

[0089] HPV18E7-31:GCAUGGACCUAAGGCAACAUUGCAA

[0090] HPV18E7-34:GGUUGACCUUCUAUGUCACGAGCAA

[0091] HPV18E7-36: GCAAUUAAGCGACUCAGAGGAAGAA

[0092] HPV18E7-38: CGAUGAAAUAGAUGGAGUUAAUCAU

[0093] HPV18E7-39: CGAGCCGAACCACAACGUCACACAA

[0094] HPV18E7-43: GCCAGAAUUGAGCUAGUAGUAGAAA

[0095] HPV18E7-44: GCUCAGCAGACGACCUUCGAGCAUU

[0096] HPV18E7-46: GCUGUUUCUGAACACCCUGUCCUUU

[0097] Design sequences of HPV16E7 siRNA:

[0098] HPV16E7-34: GCATGGAGATACACCTACATTGCAT

[0099] HPV16E7-35: GGAGATACACCTACATTGCATGAAT

[0100] HPV16E7-36: GCATGAATATATGTTAGATTTGCAA

[0101] HPV16E7-37: GGACAGAGCCCATTACAATATTGTA

[0102] HPV16E7-38: GCCCATTACAATATTGTAACCTTTT

[0103] HPV16E7-39: GCAAGTGTGACTCTACGCTTCGGTT

[0104] HPV16E7-40: GCGTACAAAGCACACACGTAGACAT

[0105] HPV16E7-41: CGTACAAAGCACACACGTAGACATT

[0106] HPV16E7-42: GCACACACGTAGACATTCGTACTTT

[0107] HPV16E7-43: GGAAGACCTGTTAATGGGCACACTA

[0108] HPV16E7-44: CCTGTTAATGGGCACACTAGGAATT

[0109] HPV16E7-45:GCACACTAGGAATTGTGTGCCCCAT

[0110] siRNA design sequence for E7 gene in cH-RPV (chimeric human rabbit papillomavirus):

[0111] CRPE7-36:5'-GCAUGAAUAUAUGUUGGAUCUGCA-3'

[0112] CRPE7-37:5'-GGACAGAGCCCACUACAACAUCGU-3'

[0113] CRPE7-38:5'-GCCCACUACAACAUCGUGACCUUUU-3'

[0114] CRPE7-43:5'-GGAAGACCUGCUGAUGGGCACCCU-3'

[0115] CRPE7-44:5'-CCUGCUGAUGGGCACCCUGGGCAU-3'

[0116] CRPE7-45:5'-GCACCCUGGGCAUCCUGUGCCCCAU-3'

[0117] Example 2. Screening of siRNA in cell lines carrying HPV genes ( Figure 5 , 6, 7)

[0118] SiHa is a cervical cancer cell line that contains the HPV 16 genome and expresses the oncogene protein E7. The SiHa cell line was used to screen the function of siRNA targeting the E7 gene in HPV 16 and cH-RPV strains. SiHa cells were cultured in RPMI 1640 medium with 10% FBS, 100U / ml penicillin, 100μg / ml streptomycin in an incubator at 37°C with 10% CO2. siRNA was transfected into the cells using LipofectAmine 2000 according to the manufacturer's instructions. The cells were collected and the gene expression level of E7 was evaluated by qRT-PCR. In addition, the same cell samples were used for ELISA and Western analysis. Figure 5 , 6The results show that HPV16E7siRNA-37#-40#-41#-42#-44# has better effects, and cH-RPVE7siRNA-36#-43#-45# has better effects.

[0119] Similarly, HeLa cervical cancer cells were fused with the HPV 18 genome to screen for siRNA targeting HPV18 gene expression. Cells were cultured in a matrix similar to that described above. siRNA transfection, qRT-PCR, ELISA, and Western followed the same process. Figure 7 The results showed that HPV18E7 siRNA-39#-44#-46# had a better effect.

[0120] Example 3. Western method confirms the siRNA sequence that can effectively knock down the expression of E7 protein

[0121] We further investigated the effect of cH-RPVE7 gene siRNA in inhibiting E7 protein expression by Western immunoblotting. Figure 8 In the figure, Western blot (top) and quantitative data (bottom) show that the efficacy of siRNA in reducing E7 protein expression is as follows: -45>-43>-44>-37, which is consistent with the results of qRT-PCR analysis.

[0122] Example 4. Effect of siRNA in the skin infection rabbit animal model (SIRAM)

[0123] The cottontail rabbit breed used in the experiment was CRPV / NZW. In order to detect the therapeutic effect of siRNA, we previously conducted verification in an in vitro cell screening system, such as Fig. 9 Six different wild-type and hybrid viruses were inoculated into the skin of NZW rabbits as shown. Each animal wore an Elizabeth collar to avoid interference with the treatment site by other animals.

[0124] Six animals were used in the preliminary study. Each animal (L1-R1, L2-R2, L3-R3, L4-R4, L5-R5, and L6-R6) was infected with six different viruses, such as Fig. 9As shown. Two weeks after infection, the left side of the papilloma was treated with the corresponding test siRNA, NCsiRNA and Cidovofir (a small molecule inhibitor of viral infection), and the local treatment was continued for 5 consecutive days. The growth of the papilloma was monitored from the third week until the end of the experiment at the end of the fifth week. At the same time, photos were taken and recorded. The right side is the non-treated control of the left treated site. If the siRNA is effective, we will observe smaller or no papilloma at all on the left side. The virus infecting the L5-R5 site is more active than the virus infecting L2-R2, L3-R3 and L4-R4. L1-R1 infected with wild-type CRPV serves as a specific control for siRNA. Therefore, if an epitope-specific siRNA is effective, it should not affect the L1-R1 site, but will have an effect on the site infected with the virus containing the epitope, such as L5-R5.

[0125] The viruses are described below:

[0126] L1-R1, wt CRPV DNA 5ug / site;

[0127] L2-R2, CRPV, containing HPV 16E7 / A 82-90 fusion virus;

[0128] L3-R3, CRPV, containing HPV 16E7 / B 45-57 fusion virus;

[0129] L4-R4, CRPV, containing HPV 16E7 / C 11-20 fusion virus;

[0130] LS-RS, CRPV, HPV 16E7 / 82-90 fusion virus containing L2;

[0131] L6-R6, CRPV, contains tandem repeats of HPV 16E7.

[0132] Two weeks after the papilloma appeared on the skin or the virus was infected, we used different siRNAs to treat the papilloma to evaluate the efficacy of these siRNAs. The following are the siRNAs used in animals:

[0133] Rabbit #3270, siRNA-CRPC-37

[0134] Rabbit #3271, siRNA-CRPC-43

[0135] Rabbit #3272, siRNA-CRPC-44

[0136] Rabbit #3273, siRNA-CRPC-45

[0137] rabbit #3274, siRNA-NC;

[0138] Rabbit #3275, Cidofovir, positive control

[0139] In this experiment, CRPV-43 treatment inhibited the growth of papilloma ( Fig. 9 ).

[0140] The ability of siRNA to inhibit the growth of hybrid human rabbit papillomavirus (cH-RPV) is summarized in Fig.10 .

[0141] Example 5. Experiments on the combined action of HPV16-18 siRNA on cells in vitro

[0142] Two siRNAs with relatively good transfection effects were selected from the HPV16 and HPV18 siRNAs respectively, and then the HPV16-18 siRNAs were mixed in different proportions and transfected into Siha cells (specifically expressing HPV16) and Hela cells (specifically expressing HPV18) at the same time. Then, real-time quantitative PCR was used to detect the expression of the corresponding target gene (HPV16E7 and HPV18E7) ​​mRNA to determine the combined effect of the two siRNAs.

[0143] Cell preparation: Prepare Hela cells and Siha cells the day before, 12-well cell culture plates, 2 × 10 5 cells / well.

[0144] Sample grouping:

[0145]

[0146] Experimental methods:

[0147] Conventional 4-hour cell transfection method (modified appropriately according to the Lipofectamine 2000 product manual);

[0148] Reverse transcription (RT)-real-time quantitative (Realtime) PCR technology.

[0149] Gene knockout experiments can be evaluated by detecting changes in mRNA in cells treated with siRNA and amplifying RNA isolated from the corresponding cells using RT-PCR. Selecting appropriate upstream and downstream primers is the initial step in evaluating target gene knockout and selecting appropriate cell lines. The primer sequences used for RT-PCR analysis are:

[0150] HPV16 PCR primer sequences are as follows:

[0151] HPV16-1:

[0152] 16E6-1F(191-461):GGAATCCATATGCTGTATGT (PCR product length: 270 bp)

[0153] 16E6-1B(191-461):CTACGTGTTCTTGATGATCT

[0154] HPV16-2:

[0155] 16E6-2F(278-448):CAACATTAGAACAGCAATAC (PCR product length: 170 bp)

[0156] 16E6-2B(278-448):ATGATCTGCAACAAGACATA

[0157] HPV16-E7-1:

[0158] 16E7-1F(21-43):ATTGCATGAATATATGTTAGATT (PCR product length: 250 bp)

[0159] 16E7-1B(248-270):CACAATTCCTAGTGTGCCCATTA

[0160] HPV18 PCR primer sequences are as follows:

[0161] HPV18-1:

[0162] 18E6-1F(65-84):ACACTTCACTGCAAGACATA (PCR product length: 196 bp)

[0163] 18E6-1B:(241-260):CCATACACAGAGTCTGAATA

[0164] HPV18-2:

[0165] 18E6-2F(107-126):AGACAGTATTGGAACTTACA (PCR product length: 151 bp)

[0166] 18E6-2B(238-257):TACACAGAGTCTGAATAATG

[0167] HPV18-E7-1:

[0168] 18E7-1F(38-54):TGCATTTAGAGCCCCAA (PCR product length: 253 bp)

[0169] 18E7-1B(275-291):CACAAAGGACAGGGTGT

[0170] Total RNA was extracted from cell culture or tumor tissue using RNeasy mini kit (Qiagen, California) according to the manufacturer's instructions. For RT-PCR, the first cDNA strand was synthesized using a cDNA synthesis kit (GE Healthcare, Chicago, IL) according to the manufacturer's instructions. The PCR reaction was started with a lower number of cycles, from 25, 30 to 35, to avoid possible amplification plateaus. PCR analysis was performed using a Geneamp 9700 thermal cycler and Taqman (ABI, CA). Amplified products were analyzed by gel electrophoresis.

[0171] The PCR primer sequences for the expression of the E7 gene in HPV-16 in the SiHa cell line are as follows:

[0172] 16E7-Forward:ATTGCATGAATATATGTTAGATT

[0173] 16E7-Reverse:CACAATTCCTAGTGTGCCCATTA;

[0174] The PCR primer sequences for the expression of the E7 gene in HPV-18 in the HeLa cell line are as follows:

[0175] 18E7-1Forward:TGCATTTAGAGCCCCAA

[0176] 18E7-1Reverse:CACAAAGGACAGGGTGT.

[0177] Result analysis:

[0178] exist Figure 11-13 From the results, a preliminary conclusion can be made: the pairing effect (siha cells) of HPV16 siRNA (CRPE43#) and HPV18 siRNA (46#) is relatively good.

[0179] Example 6. Conjugation of anti-HPV siRNA and small molecule drugs

[0180] Fig.15The coupling mode and structure of siRNA molecules and small molecule drugs such as nucleotide analogs are shown. Both cidofovir and brincidofovir are nucleotide analogs, and both contain amino, hydroxyl and phosphoric acid active groups in the molecules. General nucleic acid chemistry professionals can perform molecular transformation on them to make phosphoramidite monomers suitable for solid phase synthesis. The phosphoramidite monomers obtained by this transformation can be directly used in the solid phase synthesis of siRNA and insert one or more cidofovir or brincidofovir at any position of siRNA.

[0181] Fig.16 The coupling mode and structure of siRNA molecules and artemisinin derivatives are shown. Artesunate and dihydroartemisinin are both derivatives of artemisinin, and their molecules contain carboxylic acid or hydroxyl active groups. They can be connected to the end or side chain of siRNA through common means such as addition reaction and condensation reaction. In addition, different molecules can be effectively connected to one end of siRNA through the phosphate group ( Fig.17 ).

[0182] Example 7. Modification of siRNA

[0183] Including special 2'-OMe, 2'-F, 2'-MOE, sulfur-modified phosphate backbone, base modification ( Fig.18 A), chemically modified small nucleic acids such as antisense and sense 5' end modifications improve the stability of small nucleic acid siRNA and reduce the off-target effect and immune response of small nucleic acid siRNA.

[0184] Modified small nucleic acid siRNA includes special asymmetric structures of 19+2 double strands, 21+23 double strands, etc. ( Fig.18 B).

[0185] The above detailed description of the present invention is intended to enable persons familiar with the art to understand the contents of the present invention and implement them. It does not limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

[0186] References

[0187] 1. Giesman L and Hausen HZ. Human papillomavirus DNA: physical mapping and genetic heterogeneity. Proceedings of the National Academy of Sciences of the United States of America, 1976. 73(4): 1310-3.

[0188] 2. Bantel-Skaar L and Zurhausen H. DNA characterization of a defective human parvovirus isolated from genital sites. Virology, 1984. 134(1): 52-63.

[0189] 3. Crawford L. Human papillomavirus and cervical neoplasms. Nature, 1984. 310(5972):16.

[0190] 4. Giesman L, et al. Presence of human papillomavirus in genital tumors. Journal of Dermatology, 1984. 83(1 Suppl): 26s-28s.

[0191] 5. Kahn JA, HPV vaccines for preventing cervical intraepithelial neoplasia. New England Journal of Medicine, 2009. 361(3): 271-8.

[0192] 6. Information from the FDA and CDC about Gardasil and its safety.

[0193] 7. Trottier H. and Burchell AN. Epidemiology of mucosal human papillomavirus infection and related diseases. Public Health Genomics, 2009. 12(5-6): 291-307.

[0194] 8. Heiner K et al. Expression of the HPV16 E7 oncogene in normal human epithelial cells induces molecular changes that mediate epithelial-to-mesenchymal transition. Virology 2009 Aug 15 [cited 391 1]; 2009 / 06 / 26:[57-63]. Available from:

[0195] http: / / www.ncbi.nlm.nih.gov / entrez / query.fcgi? cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=19552933.

[0196] 9. Information from the FDA and CDC about Gardasil and its safety.

[0197] 10. http: / / www.fda.gov / BiologicsBloodVaccines / Vaccines / ApprovedProducts / ucm172678.ht m.

[0198] 11. Kohot T, Stewart A. “New report examines laws that would force HPV vaccination on young women.” Jacobs Institute for Women’s Health, George Washington University.

[0199] http: / / www.jiwh.org / content.cfm?sectionid=167

[0200] 12. One in four American teenage girls has received the cervical cancer vaccine.”

[0201] http: / / www.washingtonpost.com / wpdyn / content / article / 2008 / 10 / 09 / AR2008100901452.html?sub=new2.

[0202] 13. Marketing of Cervarix in Kenya.

[0203] 14. “Information from the FDA and CDC about Gardasil and its safety.”

[0204] 15. Sharp PA, RNA interference—2001. Progress in Gene Research, 2001. 15(5): 485-90.

[0205] 16. Li L and Shen Y. Overcoming obstacles to developing effective and safe siRNA therapeutics. Expert Opinion in Biotherapy, 2009. 9(5): 609-19.

[0206] 17. http: / / www.clinicaltrials.gov / ct2 / results? term=siRNA.

[0207] 18. Li BJ et al., Application of siRNA in the prevention and treatment of SARS coronavirus in rhesus monkeys. Nature Medicine, 2005. 11(9): 944-51.

[0208] 19. Xie FY, Woodall MC and Lu PY. Drug discovery and therapeutic development using in vivo siRNA delivery. Drug Discovery Today, 2006. 11(1-2): 67-73. Sequence Listing <110> Sirna Pharmaceuticals Sino Biopharmaceutical Technology (Suzhou) Co., Ltd. Sino Biopharmaceutical Technology (Guangzhou) Co., Ltd. <120> A nucleic acid polypeptide nanopharmaceutical composition for treating and preventing human papillomavirus infection <160> 286 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> RNA <213> Artificial sequence <400> 1 gcauggaccu aaggcaacau ugcaa 25 <210> 2 <211> 25 <212> RNA <213> Artificial sequence <400> 2 gguugaccuu cuaugucacg agcaa 25 <210> 3 <211> 25 <212> RNA <213> Artificial sequence <400> 3 gcaauuaagc gacucagagg aagaa 25 <210> 4 <211> 25 <212> RNA <213> Artificial sequence <400> 4 cgaugaaaua gauggaguua aucau 25 <210> 5 <211> 25 <212> RNA <213> Artificial sequence <400> 5 cgagccgaac cacaacguca cacaa 25 <210> 6 <211> 25 <212> RNA <213> Artificial sequence <400> 6 gccagaauug agcuaguagu agaaa 25 <210> 7 <211> 25 <212> RNA <213> Artificial sequence <400> 7 gcucagcaga cgaccuucga gcauu 25 <210> 8 <211> 25 <212> RNA <213> Artificial sequence <400> 8 gcuguuucug aacacccugu ccuuu 25 <210> 9 <211> 25 <212> RNA <213> Artificial sequence <400> 9 gcauggagau acaccuacau ugcau 25 <210> 10 <211> 25 <212> RNA <213> Artificial sequence <400> 10 ggagauacac cuacauugca ugaau 25 <210> 11 <211> 25 <212> RNA <213> Artificial sequence <400> 11 gcaugaauau auguuagaauu ugcaa 25 <210> 12 <211> 25 <212> RNA <213> Artificial sequence <400> 12 ggacagagcc cauuacaaua uugua 25 <210> 13 <211> 25 <212> RNA <213> Artificial sequence <400> 13 gcccauuacaauauuguaaccuuuu 25 <210> 14 <211> 25 <212> RNA <213> Artificial sequence <400> 14 gcaaguguga cucuacgcuu cgguu 25 <210> 15 <211> 25 <212> RNA <213> Artificial sequence <400> 15 gcguacaaag cacacacgua gacau 25 <210> 16 <211> 25 <212> RNA <213> Artificial sequence <400> 16 cguacaaagc acacacguag acauu 25 <210> 17 <211> 25 <212> RNA <213> Artificial sequence <400> 17 gcacacacgu agacauucgu acuuu 25 <210> 18 <211> 25 <212> RNA <213> Artificial sequence <400> 18 ggaagaccug uuaaugggca cacua 25 <210> 19 <211> 25 <212> RNA <213> Artificial sequence <400> 19 ccuguuaaug ggcacacuag gaauu 25 <210> 20 <211> 25 <212> RNA <213> Artificial sequence <400> 20 gcacacuagg aauugugugccccau 25 <210> twenty one <211> twenty four <212> RNA <213> Artificial sequence <400> twenty one gcaugaauau auguuggauc ugca 24 <210> twenty two <211> twenty four <212> RNA <213> Artificial sequence <400> twenty two ggacagagcc cacuacaaca ucgu 24 <210> twenty three <211> 25 <212> RNA <213> Artificial sequence <400> twenty three gcccacuaca acaucgugaccuuuu 25 <210> twenty four <211> twenty four <212> RNA <213> Artificial sequence <400> twenty four ggaagaccug cugaugggca cccu 24 <210> 25 <211> twenty four <212> RNA <213> Artificial sequence <400> 25 ccugcugaug ggcacccugg gcau 24 <210> 26 <211> 25 <212> RNA <213> Artificial sequence <400> 26 gcacccuggg cauccuggccccau 25 <210> 27 <211> 25 <212> RNA <213> Artificial sequence <400> 27 cccacaggag cgacccagaa aguua 25 <210> 28 <211> 25 <212> RNA <213> Artificial sequence <400> 28 cgacccagaa aguuaccaca guuau 25 <210> 29 <211> 25 <212> RNA <213> Artificial sequence <400> 29 ccacaguuau gcacagagcu gcaaa 25 <210> 30 <211> 25 <212> RNA <213> Artificial sequence <400> 30 cgacgugagg uauaugacuu ugcuu 25 <210> 31 <211> 25 <212> RNA <213> Artificial sequence <400> 31 gggaauccau augcuguaug ugaua 25 <210> 32 <211> 25 <212> RNA <213> Artificial sequence <400> 32 gcaauacaac aaaccguugu gugau 25 <210> 33 <211> 25 <212> RNA <213> Artificial sequence <400> 33 cgguggaccg gucgauguau gucuu 25 <210> 34 <211> 25 <212> RNA <213> Artificial sequence <400> 34 cgauguaugu cuuguugcag aucau 25 <210> 35 <211> 25 <212> RNA <213> Artificial sequence <400> 35 gguacggga uguaauggau gguuu 25 <210> 36 <211> 25 <212> RNA <213> Artificial sequence <400> 36 cggguauggc aauacugaag uggaa 25 <210> 37 <211> 25 <212> RNA <213> Artificial sequence <400> 37 gcugcauuug gacuuacacc cagua 25 <210> 38 <211> 25 <212> RNA <213> Artificial sequence <400> 38 ggagacacgc cagaauggau acaaa 25 <210> 39 <211> 25 <212> RNA <213> Artificial sequence <400> 39 ggauugugca acaaugugua gacau 25 <210> 40 <211> 25 <212> RNA <213> Artificial sequence <400> 40 ggugcagcua acacagguaa aucau 25 <210> 41 <211> 25 <212> RNA <213> Artificial sequence <400> 41 ggauguaaag cauagaccau uggua 25 <210> 42 <211> 25 <212> RNA <213> Artificial sequence <400> 42 cgauggagac ucuuugccaa cguuu 25 <210> 43 <211> 25 <212> RNA <213> Artificial sequence <400> 43 ggagacucuu ugccaacguu uaaau 25 <210> 44 <211> 25 <212> RNA <213> Artificial sequence <400> 44 gcuauuuauu acaaggccag agaaa 25 <210> 45 <211> 25 <212> RNA <213> Artificial sequence <400> 45 ggaagugcag uuugauggag acaua 25 <210> 46 <211> 25 <212> RNA <213> Artificial sequence <400> 46 gggucaaguu gacuauuaug guuua 25 <210> 47 <211> 25 <212> RNA <213> Artificial sequence <400> 47 ggaaguucau gcgggugguc aggua 25 <210> 48 <211> 25 <212> RNA <213> Artificial sequence <400> 48 cgacccauac caaagccguc gccuu 25 <210> 49 <211> 25 <212> RNA <213> Artificial sequence <400> 49 ccaagaucag agccagacac cggaa 25 <210> 50 <211> 25 <212> RNA <213> Artificial sequence <400> 50 ggcauuggac aggacuaau guaaa 25 <210> 51 <211> 25 <212> RNA <213> Artificial sequence <400> 51 gcaacgaagu auccucuccu gaaau 25 <210> 52 <211> 25 <212> RNA <213> Artificial sequence <400> 52 cgaaguaucc ucuccugaaa uuauu 25 <210> 53 <211> 25 <212> RNA <213> Artificial sequence <400> 53 cgacccauac caaagccguc gccuu 25 <210> 54 <211> 25 <212> RNA <213> Artificial sequence <400> 54 gccgucgccu ugggcaccga agaaa 25 <210> 55 <211> 25 <212> RNA <213> Artificial sequence <400> 55 ggcaccgaag aaacacagacgacua 25 <210> 56 <211> 25 <212> RNA <213> Artificial sequence <400> 56 gcaccgaaga aacacagacg acuau 25 <210> 57 <211> 25 <212> RNA <213> Artificial sequence <400> 57 ccaagaucag agccagacac cggaa 25 <210> 58 <211> 25 <212> RNA <213> Artificial sequence <400> 58 cgugcaucgg cuacccaacu uuaua 25 <210> 59 <211> 25 <212> RNA <213> Artificial sequence <400> 59 ggguacaggc ggacgcacug gguau 25 <210> 60 <211> 25 <212> RNA <213> Artificial sequence <400> 60 cccagaugua ucaggauuua guauu 25 <210> 61 <211> 25 <212> RNA <213> Artificial sequence <400> 61 cgcccagugg cacgccuagg auuau 25 <210> 62 <211> 25 <212> RNA <213> Artificial sequence <400> 62 ccacucccacuaaacuuauu acaua 25 <210> 63 <211> 25 <212> RNA <213> Artificial sequence <400> 63 gcagccucac cuacuucuau uaaua 25 <210> 64 <211> 25 <212> RNA <213> Artificial sequence <400> 64 ccagggucuc cacaauauac aauua 25 <210> 65 <211> 25 <212> RNA <213> Artificial sequence <400> 65 ggcugccuag ugaggccacu gucua 25 <210> 66 <211> 25 <212> RNA <213> Artificial sequence <400> 66 gcugguuugg gccuguguag guguu 25 <210> 67 <211> 25 <212> RNA <213> Artificial sequence <400> 67 gcagcaaaug caggugugga uaaua 25 <210> 68 <211> 25 <212> RNA <213> Artificial sequence <400> 68 cccauguacc aauguugcag uaaau 25 <210> 69 <211> 25 <212> RNA <213> Artificial sequence <400> 69 gggucuacug caaauuuagc caguu 25 <210> 70 <211> 25 <212> RNA <213> Artificial sequence <400> 70 ggaggcacac uagaagauac uuaua 25 <210> 71 <211> 25 <212> RNA <213> Artificial sequence <400> 71 ccucaucuac cucuacaacu gcuaa 25 <210> 72 <211> 25 <212> RNA <213> Artificial sequence <400> 72 gcaagacaua gaaauaaccugugua 25 <210> 73 <211> 25 <212> RNA <213> Artificial sequence <400> 73 ccuguguaua uugcaagaca guauu 25 <210> 74 <211> 25 <212> RNA <213> Artificial sequence <400> 74 cccaugcugc augccauaaauguau 25 <210> 75 <211> 25 <212> RNA <213> Artificial sequence <400> 75 ggugccugcg gugccagaaa ccguu 25 <210> 76 <211> 25 <212> RNA <213> Artificial sequence <400> 76 ccagaaaccg uugaauccag cagaa 25 <210> 77 <211> 25 <212> RNA <213> Artificial sequence <400> 77 gggcacuaua gaggccagug ccauu 25 <210> 78 <211> 25 <212> RNA <213> Artificial sequence <400> 78 ccgagcacgacaggaacgacuccaa 25 <210> 79 <211> 25 <212> RNA <213> Artificial sequence <400> 79 ggaacgacuc caacgacgca gagaa 25 <210> 80 <211> 25 <212> RNA <213> Artificial sequence <400> 80 gggcacgggu uguaacggcu gguuu 25 <210> 81 <211> 25 <212> RNA <213> Artificial sequence <400> 81 ggcaauguau guaguggcgg cagua 25 <210> 82 <211> 25 <212> RNA <213> Artificial sequence <400> 82 ggguuacagc uauauuugga guaaa 25 <210> 83 <211> 25 <212> RNA <213> Artificial sequence <400> 83 gcuauauuug gaguaaaccc aacaa 25 <210> 84 <211> 25 <212> RNA <213> Artificial sequence <400> 84 ccuuauuagc agacagcaac agcaa 25 <210> 85 <211> 25 <212> RNA <213> Artificial sequence <400> 85 cguguuggac auacuuugau accua 25 <210> 86 <211> 25 <212> RNA <213> Artificial sequence <400> 86 ggaagaggaa gaugcagaca ccgaa 25 <210> 87 <211> 25 <212> RNA <213> Artificial sequence <400> 87 cgaaggaaac ccuuucggaa cguuu 25 <210> 88 <211> 25 <212> RNA <213> Artificial sequence <400> 88 gcaagggaac auggcauacagacau 25 <210> 89 <211> 25 <212> RNA <213> Artificial sequence <400> 89 ggaauacaga accuacucacugcuu 25 <210> 90 <211> 25 <212> RNA <213> Artificial sequence <400> 90 ggacagugug uauuauauga cugau 25 <210> 91 <211> 25 <212> RNA <213> Artificial sequence <400> 91 cgguauccgc uacucagcuu guuaa 25 <210> 92 <211> 25 <212> RNA <213> Artificial sequence <400> 92 gguaacacua cgccuauaau acauu 25 <210> 93 <211> 25 <212> RNA <213> Artificial sequence <400> 93 ggaauacuga cuguaacua ccua 25 <210> 94 <211> 25 <212> RNA <213> Artificial sequence <400> 94 cgacacggua uccgcuacuc agcuu 25 <210> 95 <211> 25 <212> RNA <213> Artificial sequence <400> 95 gguauccgcu acucagcuug uuaaa 25 <210> 96 <211> 25 <212> RNA <213> Artificial sequence <400> 96 cgcuacucag cuuguuaaac agcua 25 <210> 97 <211> 25 <212> RNA <213> Artificial sequence <400> 97 gcauuguggaccugucaacccacuu 25 <210> 98 <211> 25 <212> RNA <213> Artificial sequence <400> 98 ccacuucucg gugcagcuac accua 25 <210> 99 <211> 25 <212> RNA <213> Artificial sequence <400> 99 cggaaacucuguagugguaacacua 25 <210> 100 <211> 25 <212> RNA <213> Artificial sequence <400> 100 gccaucugucuguaugug cguau 25 <210> 101 <211> 25 <212> RNA <213> Artificial sequence <400> 101 gcauggguau uggguauuuguguaua 25 <210> 102 <211> 25 <212> RNA <213> Artificial sequence <400> 102 cccugccaca gcauucacag uauau 25 <210> 103 <211> 25 <212> RNA <213> Artificial sequence <400> 103 gccacagcau ucacaguauauguau 25 <210> 104 <211> 25 <212> RNA <213> Artificial sequence <400> 104 ccacagcauu cacaguauau guauu 25 <210> 105 <211> 25 <212> RNA <213> Artificial sequence <400> 105 gcccauguua cuauugcaua uacau 25 <210> 106 <211> 25 <212> RNA <213> Artificial sequence <400> 106 gcaaacgggc uucgguaacu gacuu 25 <210> 107 <211> 25 <212> RNA <213> Artificial sequence <400> 107 ggguacauuccauugggugggcguu 25 <210> 108 <211> 25 <212> RNA <213> Artificial sequence <400> 108 ggguuugaua uaacaucugc gggua 25 <210> 109 <211> 25 <212> RNA <213> Artificial sequence <400> 109 cccuacaucu ggaacacaug gguau 25 <210> 110 <211> 25 <212> RNA <213> Artificial sequence <400> 110 ccuaccaaca agugucagug gcuaa 25 <210> 111 <211> 25 <212> RNA <213> Artificial sequence <400> 111 gcaacuaugu uuacccgcag cggua 25 <210> 112 <211> 25 <212> RNA <213> Artificial sequence <400> 112 cggaggacaa ugacuuguuu gauau 25 <210> 113 <211> 25 <212> RNA <213> Artificial sequence <400> 113 ccuccucuug ggaugugccuguaua 25 <210> 114 <211> 25 <212> RNA <213> Artificial sequence <400> 114 ccugccucua cacaguauau uggua 25 <210> 115 <211> 25 <212> RNA <213> Artificial sequence <400> 115 gggugcaguu accugaccca aauaa 25 <210> 116 <211> 25 <212> RNA <213> Artificial sequence <400> 116 ggauauggug ccauggacuu uagua 25 <210> 117 <211> 25 <212> RNA <213> Artificial sequence <400> 117 ccucugacuc ccaguuguuu aauaa 25 <210> 118 <211> 25 <212> RNA <213> Artificial sequence <400> 118 gguagauacc acucccagua ccaau 25 <210> 119 <211> 25 <212> RNA <213> Artificial sequence <400> 119 ccacucccag uaccaauuua acaau 25 <210> 120 <211> 25 <212> RNA <213> Artificial sequence <400> 120 ccaacuacua guuuggugga uacau 25 <210> 121 <211> 25 <212> RNA <213> Artificial sequence <400> 121 ccacuacguc uucuaaaccu gccaa 25 <210> 122 <211> 25 <212> RNA <213> Artificial sequence <400> 122 ccuguugcug uggaugugac agcaa 25 <210> 123 <211> 25 <212> RNA <213> Artificial sequence <400> 123 ggacagugga uauggcuauu cugaa 25 <210> 124 <211> 25 <212> RNA <213> Artificial sequence <400> 124 cgaggaagau ggaagcaaua gccaa 25 <210> 125 <211> 25 <212> RNA <213> Artificial sequence <400> 125 ggaagcaaua gccaagcguu uagau 25 <210> 126 <211> 25 <212> RNA <213> Artificial sequence <400> 126 ggaaguaugu uauggcagca caguu 25 <210> 127 <211> 25 <212> RNA <213> Artificial sequence <400> 127 cccuuuaguccuguaacuccugcuu 25 <210> 128 <211> 25 <212> RNA <213> Artificial sequence <400> 128 ccuuuagucc uguaacuccu gcuuu 25 <210> 129 <211> 25 <212> RNA <213> Artificial sequence <400> 129 ccugcuuuac cuacaggcccuguuu 25 <210> 130 <211> 25 <212> RNA <213> Artificial sequence <400> 130 ggcggccuag cgacagcacaguaua 25 <210> 131 <211> 25 <212> RNA <213> Artificial sequence <400> 131 gcggccuagc gacagcacag uauau 25 <210> 132 <211> 25 <212> RNA <213> Artificial sequence <400> 132 gcaugaauau auguuagaauu ugcaa 25 <210> 133 <211> twenty four <212> RNA <213> Artificial sequence <400> 133 gcaugaauau auguuggauc ugca 24 <210> 134 <211> 25 <212> RNA <213> Artificial sequence <400> 134 ggacagagcc cauuacaaua uugua 25 <210> 135 <211> twenty four <212> RNA <213> Artificial sequence <400> 135 ggacagagcc cacuacaaca ucgu 24 <210> 136 <211> 25 <212> RNA <213> Artificial sequence <400> 136 gcccauuaca auaccguaaccuuuu 25 <210> 137 <211> 25 <212> RNA <213> Artificial sequence <400> 137 gcccacuaca acaucgugaccuuuu 25 <210> 138 <211> 25 <212> RNA <213> Artificial sequence <400> 138 ggaagaccug uuaaugggca cacua 25 <210> 139 <211> twenty four <212> RNA <213> Artificial sequence <400> 139 ggaagaccug cugaugggca cccu 24 <210> 140 <211> 25 <212> RNA <213> Artificial sequence <400> 140 ccuguuaaug ggcacacuag gaauu 25 <210> 141 <211> twenty four <212> RNA <213> Artificial sequence <400> 141 ccugcugaug ggcacccugg gcau 24 <210> 142 <211> 25 <212> RNA <213> Artificial sequence <400> 142 gcacacuagg aauugugugccccau 25 <210> 143 <211> 25 <212> RNA <213> Artificial sequence <400> 143 gcacccuggg cauccuggccccau 25 <210> 144 <211> 25 <212> RNA <213> Artificial sequence <400> 144 uugcaauguu gccuuagguc caugc 25 <210> 145 <211> 25 <212> RNA <213> Artificial sequence <400> 145 uugcucguga cauagaaggu caacc 25 <210> 146 <211> 25 <212> RNA <213> Artificial sequence <400> 146 uucuuccucu gagucgcuua auugc 25 <210> 147 <211> 25 <212> RNA <213> Artificial sequence <400> 147 augauuaacu ccaucuauuu caucg 25 <210> 148 <211> 25 <212> RNA <213> Artificial sequence <400> 148 uugugacg uugugguucg gcucg 25 <210> 149 <211> 25 <212> RNA <213> Artificial sequence <400> 149 uuucuacuac uagcucaauu cuggc 25 <210> 150 <211> 25 <212> RNA <213> Artificial sequence <400> 150 aaugcucgaaggucgucugcugagc 25 <210> 151 <211> 25 <212> RNA <213> Artificial sequence <400> 151 aaaggacagg guguucagaa acagc 25 <210> 152 <211> 25 <212> RNA <213> Artificial sequence <400> 152 augcaaugua gguguaucuc caugc 25 <210> 153 <211> 25 <212> RNA <213> Artificial sequence <400> 153 auucaugcaauguagguguaucucc 25 <210> 154 <211> 25 <212> RNA <213> Artificial sequence <400> 154 uugcaaaucu aacauauauu caugc 25 <210> 155 <211> 25 <212> RNA <213> Artificial sequence <400> 155 uacaauauug uaaugggcuc ugucc 25 <210> 156 <211> 25 <212> RNA <213> Artificial sequence <400> 156 aaaagguuac aauauuguaaugggc 25 <210> 157 <211> 25 <212> RNA <213> Artificial sequence <400> 157 aaccgaagcg uagagucacacuugc 25 <210> 158 <211> 25 <212> RNA <213> Artificial sequence <400> 158 augucuacgu gugugcuuug uacgc 25 <210> 159 <211> 25 <212> RNA <213> Artificial sequence <400> 159 aaugucuacgugugugcuuuguacg 25 <210> 160 <211> 25 <212> RNA <213> Artificial sequence <400> 160 aaaguacgaaugucuacguguggc 25 <210> 161 <211> 25 <212> RNA <213> Artificial sequence <400> 161 uaagugugccc auuaacaggu cuucc 25 <210> 162 <211> 25 <212> RNA <213> Artificial sequence <400> 162 aauuccuagu gugcccauua acagg 25 <210> 163 <211> 25 <212> RNA <213> Artificial sequence <400> 163 auggggcacacaauuccuagugugc 25 <210> 164 <211> twenty four <212> RNA <213> Artificial sequence <400> 164 ugcagaucca acauauauuc augc 24 <210> 165 <211> twenty four <212> RNA <213> Artificial sequence <400> 165 acgauguugu agugggcucu gucc 24 <210> 166 <211> 25 <212> RNA <213> Artificial sequence <400> 166 aaaaggucac gauguuguag ugggc 25 <210> 167 <211> twenty four <212> RNA <213> Artificial sequence <400> 167 agggugccca ucagcagguc uucc 24 <210> 168 <211> twenty four <212> RNA <213> Artificial sequence <400> 168 augcccaggg ugcccaucag cagg 24 <210> 169 <211> 25 <212> RNA <213> Artificial sequence <400> 169 auggggcaca ggaugcccag guggc 25 <210> 170 <211> 25 <212> RNA <213> Artificial sequence <400> 170 uaacuuucug ggucgcuccu guggg 25 <210> 171 <211> 25 <212> RNA <213> Artificial sequence <400> 171 auaacugugguaacuuucugggucg 25 <210> 172 <211> 25 <212> RNA <213> Artificial sequence <400> 172 uuugcagcucugugcauaacugugg 25 <210> 173 <211> 25 <212> RNA <213> Artificial sequence <400> 173 aagcaaaguc auauaccuca cgucg 25 <210> 174 <211> 25 <212> RNA <213> Artificial sequence <400> 174 uaucacauac agcauaugga uuccc 25 <210> 175 <211> 25 <212> RNA <213> Artificial sequence <400> 175 aucacacaac gguuuguugu auugc 25 <210> 176 <211> 25 <212> RNA <213> Artificial sequence <400> 176 aagacauaca ucgaccgguc caccg 25 <210> 177 <211> 25 <212> RNA <213> Artificial sequence <400> 177 augaucugca acaagacaua caucg 25 <210> 178 <211> 25 <212> RNA <213> Artificial sequence <400> 178 aaaccaucca uuacaucccg uaccc 25 <210> 179 <211> 25 <212> RNA <213> Artificial sequence <400> 179 uuccacuucaguauugccauacccg 25 <210> 180 <211> 25 <212> RNA <213> Artificial sequence <400> 180 uacugggugu aaguccaaau gcagc 25 <210> 181 <211> 25 <212> RNA <213> Artificial sequence <400> 181 uuuguaucca uucuggcgug ucucc 25 <210> 182 <211> 25 <212> RNA <213> Artificial sequence <400> 182 augucuacac auguugcac aaucc 25 <210> 183 <211> 25 <212> RNA <213> Artificial sequence <400> 183 augauuuacc uguguuagcu gcacc 25 <210> 184 <211> 25 <212> RNA <213> Artificial sequence <400> 184 uaccaauggu cuaugcuuua caucc 25 <210> 185 <211> 25 <212> RNA <213> Artificial sequence <400> 185 aaacguuggc aaagaguucuc caucg 25 <210> 186 <211> 25 <212> RNA <213> Artificial sequence <400> 186 auuuaaacgu uggcaaagag ucucc 25 <210> 187 <211> 25 <212> RNA <213> Artificial sequence <400> 187 uuucucuggccuuguaauaaauagc 25 <210> 188 <211> 25 <212> RNA <213> Artificial sequence <400> 188 uaugucucca ucaaacugca cuucc 25 <210> 189 <211> 25 <212> RNA <213> Artificial sequence <400> 189 uaaaccauaa uagucaacuu gaccc 25 <210> 190 <211> 25 <212> RNA <213> Artificial sequence <400> 190 uaccugacca cccgcaugaa cuucc 25 <210> 191 <211> 25 <212> RNA <213> Artificial sequence <400> 191 aaggcgacgg cuuugguaug ggucg 25 <210> 192 <211> 25 <212> RNA <213> Artificial sequence <400> 192 uuccggugucuggcucugaucuugg 25 <210> 193 <211> 25 <212> RNA <213> Artificial sequence <400> 193 uuuacauuau guccugucca augcc 25 <210> 194 <211> 25 <212> RNA <213> Artificial sequence <400> 194 auuucaggag aggauacuucguugc 25 <210> 195 <211> 25 <212> RNA <213> Artificial sequence <400> 195 aauaauuuca ggagaggaua cuucg 25 <210> 196 <211> 25 <212> RNA <213> Artificial sequence <400> 196 aaggcgacgg cuuugguaug ggucg 25 <210> 197 <211> 25 <212> RNA <213> Artificial sequence <400> 197 uuucuucggu gcccaaggcg acggc 25 <210> 198 <211> 25 <212> RNA <213> Artificial sequence <400> 198 uagucgucuguguuucuucggugcc 25 <210> 199 <211> 25 <212> RNA <213> Artificial sequence <400> 199 auagucgucu guguuucuuc ggugc 25 <210> 200 <211> 25 <212> RNA <213> Artificial sequence <400> 200 uuccggugucuggcucugaucuugg 25 <210> 201 <211> 25 <212> RNA <213> Artificial sequence <400> 201 uauaaaguug gguagccgau gcacg 25 <210> 202 <211> 25 <212> RNA <213> Artificial sequence <400> 202 auacccagug cguccgccug uaccc 25 <210> 203 <211> 25 <212> RNA <213> Artificial sequence <400> 203 aauacuaaau ccugauacau cuggg 25 <210> 204 <211> 25 <212> RNA <213> Artificial sequence <400> 204 auaauccuag gcgugccacu gggcg 25 <210> 205 <211> 25 <212> RNA <213> Artificial sequence <400> 205 uauguaauaa guuuaguggg aggugg 25 <210> 206 <211> 25 <212> RNA <213> Artificial sequence <400> 206 uauuaauaga aguaggugag gcugc 25 <210> 207 <211> 25 <212> RNA <213> Artificial sequence <400> 207 uaauuguaua uuguggagacccugg 25 <210> 208 <211> 25 <212> RNA <213> Artificial sequence <400> 208 uagacagugg ccucacuagg cagcc 25 <210> 209 <211> 25 <212> RNA <213> Artificial sequence <400> 209 aacaccuaca caggcccaaa ccagc 25 <210> 210 <211> 25 <212> RNA <213> Artificial sequence <400> 210 uauuauccac accugcauuu gcugc 25 <210> 211 <211> 25 <212> RNA <213> Artificial sequence <400> 211 auuuacugca acauugguac auggg 25 <210> 212 <211> 25 <212> RNA <213> Artificial sequence <400> 212 aacuggcuaaauuugcaguagaccc 25 <210> 213 <211> 25 <212> RNA <213> Artificial sequence <400> 213 uauaaguauc uucuagugg ccucc 25 <210> 214 <211> 25 <212> RNA <213> Artificial sequence <400> 214 uuagcaguug uagagguagaugagg 25 <210> 215 <211> 25 <212> RNA <213> Artificial sequence <400> 215 uacacagguu auuucuaugu cuugc 25 <210> 216 <211> 25 <212> RNA <213> Artificial sequence <400> 216 aauacugucu ugcaauauac acagg 25 <210> 217 <211> 25 <212> RNA <213> Artificial sequence <400> 217 auacauuuau ggcaugcagc auggg 25 <210> 218 <211> 25 <212> RNA <213> Artificial sequence <400> 218 aacgguuucu ggcaccgcag gcacc 25 <210> 219 <211> 25 <212> RNA <213> Artificial sequence <400> 219 uucugcugga uucaacgguuucugg 25 <210> 220 <211> 25 <212> RNA <213> Artificial sequence <400> 220 aauggcacug gccucuauag ugccc 25 <210> 221 <211> 25 <212> RNA <213> Artificial sequence <400> 221 uuggagucgu uccugucgug cucgg 25 <210> 222 <211> 25 <212> RNA <213> Artificial sequence <400> 222 uucucugcgu cguuggaguc guucc 25 <210> 223 <211> 25 <212> RNA <213> Artificial sequence <400> 223 aaaccagccg uuacaacccg ugccc 25 <210> 224 <211> 25 <212> RNA <213> Artificial sequence <400> 224 uacugccgcc acuacauaca uugcc 25 <210> 225 <211> 25 <212> RNA <213> Artificial sequence <400> 225 uuuacuccaa auauagcugu aaccc 25 <210> 226 <211> 25 <212> RNA <213> Artificial sequence <400> 226 uuguuggguu uacuccaaau auagc 25 <210> 227 <211> 25 <212> RNA <213> Artificial sequence <400> 227 uugcuguugcugucugcuaauaagg 25 <210> 228 <211> 25 <212> RNA <213> Artificial sequence <400> 228 uagguaucaa aguaugucca acacg 25 <210> 229 <211> 25 <212> RNA <213> Artificial sequence <400> 229 uucggugucu gcaucuuccucuucc 25 <210> 230 <211> 25 <212> RNA <213> Artificial sequence <400> 230 aaacguuccg aaaggguuuccuucg 25 <210> 231 <211> 25 <212> RNA <213> Artificial sequence <400> 231 augucuguau gccauguucccuugc 25 <210> 232 <211> 25 <212> RNA <213> Artificial sequence <400> 232 aagcagugag uagguucugu aucc 25 <210> 233 <211> 25 <212> RNA <213> Artificial sequence <400> 233 aucagucaua uaauacacac ugucc 25 <210> 234 <211> 25 <212> RNA <213> Artificial sequence <400> 234 uuaacaagcugaguagcggauaccg 25 <210> 235 <211> 25 <212> RNA <213> Artificial sequence <400> 235 aauguauuau aggcguagug uuacc 25 <210> 236 <211> 25 <212> RNA <213> Artificial sequence <400> 236 uaugguaugu uacagucagu auucc 25 <210> 237 <211> 25 <212> RNA <213> Artificial sequence <400> 237 aagcugagua gcggauaccg ugucg 25 <210> 238 <211> 25 <212> RNA <213> Artificial sequence <400> 238 uuuaacaagcugaguagcgg auacc 25 <210> 239 <211> 25 <212> RNA <213> Artificial sequence <400> 239 uagcuguuua acaagcugag uagcg 25 <210> 240 <211> 25 <212> RNA <213> Artificial sequence <400> 240 aaguggguug acagguccac aaugc 25 <210> 241 <211> 25 <212> RNA <213> Artificial sequence <400> 241 uagguguagc ugcaccgaga aggugg 25 <210> 242 <211> 25 <212> RNA <213> Artificial sequence <400> 242 uaguguuacc acuacagagu uuccg 25 <210> 243 <211> 25 <212> RNA <213> Artificial sequence <400> 243 auacgcacac auacagacag auggc 25 <210> 244 <211> 25 <212> RNA <213> Artificial sequence <400> 244 uauacacaaa uaccaauacc caugc 25 <210> 245 <211> 25 <212> RNA <213> Artificial sequence <400> 245 auauacugg aaugcugugg caggg 25 <210> 246 <211> 25 <212> RNA <213> Artificial sequence <400> 246 auacauauac ugugaaugcu guggc 25 <210> 247 <211> 25 <212> RNA <213> Artificial sequence <400> 247 aauacauaua cugugaaugcugugg 25 <210> 248 <211> 25 <212> RNA <213> Artificial sequence <400> 248 auguauaugc aauaguaaca ugggc 25 <210> 249 <211> 25 <212> RNA <213> Artificial sequence <400> 249 aagucaguua ccgaagcccg uuugc 25 <210> 250 <211> 25 <212> RNA <213> Artificial sequence <400> 250 aacgcccacc caauggaaug uaccc 25 <210> 251 <211> 25 <212> RNA <213> Artificial sequence <400> 251 uacccgcagauguuauaucaaaccc 25 <210> 252 <211> 25 <212> RNA <213> Artificial sequence <400> 252 auacccaugu guuccaagaug uaggg 25 <210> 253 <211> 25 <212> RNA <213> Artificial sequence <400> 253 uuagccacug acacuuguug guagg 25 <210> 254 <211> 25 <212> RNA <213> Artificial sequence <400> 254 uaccgcugcg gguaaacua guugc 25 <210> 255 <211> 25 <212> RNA <213> Artificial sequence <400> 255 auaucaaaca agucauuguccuccg 25 <210> 256 <211> 25 <212> RNA <213> Artificial sequence <400> 256 uauacaggca caucccaagaggagg 25 <210> 257 <211> 25 <212> RNA <213> Artificial sequence <400> 257 uaccaauaua cuguguagag gcagg 25 <210> 258 <211> 25 <212> RNA <213> Artificial sequence <400> 258 uuauuugggu cagguaacug caccc 25 <210> 259 <211> 25 <212> RNA <213> Artificial sequence <400> 259 uacuaaaguc cauggcacca uaucc 25 <210> 260 <211> 25 <212> RNA <213> Artificial sequence <400> 260 uuauuaaaca acugggaguc agagg 25 <210> 261 <211> 25 <212> RNA <213> Artificial sequence <400> 261 gguagauacc acucccagua ccaau 25 <210> 262 <211> 25 <212> RNA <213> Artificial sequence <400> 262 auuguuaaau uggguacuggg aggugg 25 <210> 263 <211> 25 <212> RNA <213> Artificial sequence <400> 263 auguauccac caaacuaguaguugg 25 <210> 264 <211> 25 <212> RNA <213> Artificial sequence <400> 264 uuggcagguu uagaagacgu agugg 25 <210> 265 <211> 25 <212> RNA <213> Artificial sequence <400> 265 uugcugucac auccacagca acagg 25 <210> 266 <211> 25 <212> RNA <213> Artificial sequence <400> 266 uucagaauag ccauauccacugucc 25 <210> 267 <211> 25 <212> RNA <213> Artificial sequence <400> 267 uuggcuauugcuuccaucuuccucg 25 <210> 268 <211> 25 <212> RNA <213> Artificial sequence <400> 268 aucuaaacgc uuggcuauug cuucc 25 <210> 269 <211> 25 <212> RNA <213> Artificial sequence <400> 269 aacugugcugccuaaacauacuucc 25 <210> 270 <211> 25 <212> RNA <213> Artificial sequence <400> 270 aagcaggagu uacaggacua aaggg 25 <210> 271 <211> 25 <212> RNA <213> Artificial sequence <400> 271 aaagcaggag uuacaggacu aaagg 25 <210> 272 <211> 25 <212> RNA <213> Artificial sequence <400> 272 aaacagggccuguagguaaa gcagg 25 <210> 273 <211> 25 <212> RNA <213> Artificial sequence <400> 273 uauacugugc ugucgcuagg ccgcc 25 <210> 274 <211> 25 <212> RNA <213> Artificial sequence <400> 274 auauacug cugucgcuag gccgc 25 <210> 275 <211> 25 <212> RNA <213> Artificial sequence <400> 275 uugcaaaucu aacauauauu caugc 25 <210> 276 <211> twenty four <212> RNA <213> Artificial sequence <400> 276 ugcagaucca acauauauuc augc 24 <210> 277 <211> 25 <212> RNA <213> Artificial sequence <400> 277 uacaauauug uaaugggcuc ugucc 25 <210> 278 <211> twenty four <212> RNA <213> Artificial sequence <400> 278 acgauguugu agugggcucu gucc 24 <210> 279 <211> 25 <212> RNA <213> Artificial sequence <400> 279 aaaagguuac gguauuguaa ugggc 25 <210> 280 <211> 25 <212> RNA <213> Artificial sequence <400> 280 aaaaggucac gauguuguag ugggc 25 <210> 281 <211> 25 <212> RNA <213> Artificial sequence <400> 281 uaagugugccc auuaacaggu cuucc 25 <210> 282 <211> twenty four <212> RNA <213> Artificial sequence <400> 282 agggugccca ucagcagguc uucc 24 <210> 283 <211> 25 <212> RNA <213> Artificial sequence <400> 283 aauuccuagu gugcccauua acagg 25 <210> 284 <211> twenty four <212> RNA <213> Artificial sequence <400> 284 augcccaggg ugcccaucag cagg 24 <210> 285 <211> 25 <212> RNA <213> Artificial sequence <400> 285 auggggcacacaauuccuagugugc 25 <210> 286 <211> 25 <212> RNA <213> Artificial sequence <400> 286 auggggcaca ggaugcccag guggc 25

Claims

1. A nucleic acid polypeptide nano drug composition, characterized in that: The nucleic acid polypeptide nano drug composition comprises siRNA of HPV16-E7, siRNA of HPV18-E7 and a pharmaceutically acceptable carrier suitable for in vivo drug delivery. The siRNA of HPV16-E7 is human HPV16-CRPV-E7 siRNA-43#, and its sequence is: Sense strand: 5'-GGAAGACCUGCUGAUGGGCACCCU-3', Antisense strand: 5'-AGGGUGCCCAUCAGCAGGUCUUCC-3', The HPV18-E7 siRNA is HPV18-E7 siRNA-46#, and its sequence is: Sense strand: 5'-GCUGUUUCUGAACACCCUGUCCUUU-3', Antisense strand: 5′-AAAGGACAGGGUGUUCAGAAACAGC-3′; The pharmaceutically acceptable carrier is a polypeptide carrier.

2. The nucleic acid polypeptide nano drug composition according to claim 1, characterized in that: The ratio of the HPV16-E7 siRNA to the HPV18-E7 siRNA is 1:2, or 1:1, or 2:

1.

3. The nucleic acid polypeptide nano drug composition according to claim 1, characterized in that: The polypeptide carrier is a positively charged histidine-lysine branched polypeptide, the histidine-lysine branched polypeptide is H3K4b or H3K(+H)4b, and the H3K4b has the following structure: , where R=KHHHKHHHKHHHKHHHK, K is L-lysine, and H in R is L-arginine; The structure of H3K(+H)4b is that the side chain R in the structure of H3K4b adopts R= KHHHKHHHHHHHHHHKHH for replacement.

4. The nucleic acid polypeptide nano drug composition according to claim 1, characterized in that: The N:P mass ratio of the pharmaceutically acceptable carrier to all siRNAs in the nucleic acid polypeptide nanomedicine composition is between 16:1 and 1:

8.

5. The nucleic acid polypeptide nano drug composition according to claim 1, characterized in that: The nucleic acid polypeptide nano drug composition is a nanoparticle with a particle size of 50-300 nm.

6. The nucleic acid polypeptide nano drug composition according to claim 1, characterized in that: The HPV16-E7 siRNA and HPV18-E7 siRNA have specific chemical modifications, including one or more of 2'-OMe, 2'-F, 2'-MOE, sulfur-modified phosphate backbone, and base modification.

Images