Nanobodies targeting claudin 18.2 and uses thereof

Abstract

The present application provides a nanobody targeting Claudin18.2 and a nucleic acid sequence encoding the same. The present application also provides a multispecific antibody, a chimeric antigen receptor, an antibody conjugate comprising the Claudin18.2 nanobody, a pharmaceutical composition and a kit comprising the same, and the use of the same in the diagnosis / treatment / prevention of diseases associated with Claudin18.2 expression.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of immunotherapy. More specifically, the present application relates to a nanobody targeting Claudin 18.2 and its use in the prevention and / or treatment and / or diagnosis of a disease. BACKGROUND

[0002] Human CLDN18 gene can express two different isoforms, Claudin 18.1 and Claudin 18.2, which have very similar structures but quite different expression levels in tumors. In normal tissues, Claudin 18.1 is only expressed in the lung, while Claudin 18.2 is limitedly expressed in the stomach; in tumor tissues, Claudin 18.1 does not have significant high expression in the lung, while Claudin 18.2 is up-regulated in gastric cancer, esophageal cancer, pancreatic cancer and other cancer types. In addition, Claudin 18.2 gene also has abnormal activation, and is highly selectively and stably expressed in specific tumor tissues, participates in the proliferation, differentiation and migration of tumor cells, which makes it a potential effective molecular target of anti-tumor drugs.

[0003] The present application aims to provide a humanized nanobody specifically binding to Claudin 18.2 and its use in the prevention and / or treatment and / or diagnosis of a disease associated with Claudin 18.2 expression. SUMMARY

[0004] In one aspect, the present application provides a humanized nanobody specifically binding to Claudin 18.2, which consists of three complementarity determining regions CDR1, CDR2 and CDR3 and four framework regions FR1, FR2, FR3 and FR4, wherein CDR1 is as shown in SEQ ID NO: 1, CDR2 is as shown in SEQ ID NO: 2, CDR3 is as shown in SEQ ID NO: 3, FR1 is selected from SEQ ID NO: 4, 8 or a variant thereof, FR2 is selected from SEQ ID NO: 5, 9 or a variant thereof, FR3 is selected from SEQ ID NO: 6, 11, 12, 13 or a variant thereof, and FR4 is selected from SEQ ID NO: 7, 10 or a variant thereof, the variant comprising at most 3 conservative substitutions of amino acids in the FR.

[0005] In one embodiment, the humanized nanobody of the present application comprises:

[0006] (1) FR1 as shown in SEQ ID NO: 4, FR2 as shown in SEQ ID NO: 5, FR3 as shown in SEQ ID NO: 6, FR4 as shown in SEQ ID NO: 7, or a variant thereof, the variant comprising at most 3 conservative substitutions of amino acids in the FR;

[0007] (2) FR1 as set forth in SEQ ID NO: 8, FR2 as set forth in SEQ ID NO: 9, FR3 as set forth in SEQ ID NO: 6, FR4 as set forth in SEQ ID NO: 10, or a variant thereof comprising up to 3 conservative substitutions of amino acids in the FRs; or

[0008] (3) FR1 as set forth in SEQ ID NO: 4, FR2 as set forth in SEQ ID NO: 5, FR3 as set forth in SEQ ID NO: 11, 12 or 13, FR4 as set forth in SEQ ID NO: 10, or a variant thereof comprising up to 3 conservative substitutions of amino acids in the FRs.

[0009] In one embodiment, the humanized Nanobody of the present application has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 15-18, and is capable of specifically binding to Claudin 18.2 antigen.

[0010] The present application also provides a nucleic acid molecule encoding the humanized Nanobody of the present application. In one embodiment, the nucleic acid molecule has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 20-23.

[0011] The present application also provides a multispecific antibody comprising the humanized Nanobody of the present application, and one or more second antibodies or antigen binding portions thereof that specifically bind to other antigens. In one embodiment, the second antibody or antigen binding portion thereof is selected from the group consisting of a full-length antibody, Fab, Fab', (Fab')2, Fv, scFv, scFv-scFv, minibody, diabody, Nanobody or sdAb.

[0012] The present application also provides a vector comprising a nucleic acid molecule encoding the humanized Nanobody or multispecific antibody of the present application.

[0013] The present application also provides a host cell expressing the humanized Nanobody or multispecific antibody of the present application.

[0014] The present application also provides a chimeric antigen receptor comprising the humanized Nanobody or multispecific antibody of the present application, a transmembrane domain and an intracellular signaling domain.

[0015] In one embodiment, the transmembrane domain is selected from the transmembrane domain of the following proteins: TCRa chain, TCRP chain, TCRy chain, TCR5 chain, CD3 zeta subunit, CD3 epsilon subunit, CD3 gamma subunit, CD3 delta subunit, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, and CD154.

[0016] In one embodiment, the intracellular signaling domain is selected from the intracellular region of the following proteins: FcRy, FcRP, CD3y, CD35, CD3s, CD3z, CD22, CD79a, CD79b, and CD66d.

[0017] In one embodiment, the chimeric antigen receptor of the application further comprises one or more costimulatory domains selected from the costimulatory signaling domain of the following proteins: CD94, LTB, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CLAUDIN 18.2, CD8, CD18, CD27, CD28, CD30, CD40, CD54, CD83, CD134 (OX40), CD137 (4-1BB), CD270 (HVEM), CD272 (BTLA), CD276 (B7-H3), CD278 (ICOS), CD357 (GITR), DAP10, LAT, NKG2C, SLP76, PD-1, LIGHT, TRIM, and ZAP70.

[0018] The application also provides an engineered immune cell comprising the chimeric antigen receptor described above. In one embodiment, the engineered immune cell is selected from a T cell, an NK cell, an NKT cell, a macrophage, a dendritic cell. In one embodiment, the engineered immune cell further comprises a second chimeric antigen receptor targeting other tumor antigens. In one embodiment, the engineered immune cell further comprises a cytokine selected from IL7, XCL1, XCL2, or a combination thereof.

[0019] The present application also provides an antibody conjugate comprising the humanized nanobody or the multispecific antibody of the present application and a second functional structure, wherein the second functional structure is selected from the group consisting of an Fc, a radioisotope, a half-life extending moiety, a detectable label, and a drug. In one embodiment, the half-life extending moiety is selected from the group consisting of a binding structure for albumin, a binding structure for transferrin, a polyethylene glycol molecule, a recombinant polyethylene glycol molecule, human serum albumin, a fragment of human serum albumin, and a white polypeptide binding human serum albumin; the detectable label is selected from the group consisting of a fluorophore, a chemiluminescent compound, a bioluminescent compound, an enzyme, an antibiotic resistance gene, and a contrast agent; and the drug is selected from the group consisting of a cytotoxin and an immunomodulator.

[0020] The present application also provides a diagnostic kit comprising the humanized nanobody, the multispecific antibody, the chimeric antigen receptor, the antibody conjugate, or the engineered immune cell of the present application.

[0021] The present application also provides a pharmaceutical composition comprising the humanized nanobody, the multispecific antibody, the chimeric antigen receptor, the antibody conjugate, or the engineered immune cell of the present application, and one or more pharmaceutically acceptable excipients.

[0022] The present application also provides a method of treating and / or preventing and / or diagnosing a disease associated with CLAUDIN18.2 expression, comprising administering the humanized nanobody, the multispecific antibody, the chimeric antigen receptor, the antibody conjugate, the engineered immune cell, or the pharmaceutical composition of the present application. In one embodiment, the disease associated with CLAUDIN18.2 expression is selected from the group consisting of esophageal cancer, gastrointestinal cancer, pancreatic cancer, thyroid cancer, colorectal cancer, kidney cancer, lung cancer (e.g., non-small cell lung cancer), liver cancer, gastric cancer, gastroesophageal junction (GEJ) adenocarcinoma, head and neck cancer, bladder cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, testicular cancer, germ cell cancer, bone cancer, skin cancer, thymus cancer, cholangiocarcinoma, gallbladder cancer, melanoma, mesothelioma, lymphoma, myeloma (e.g., multiple myeloma), sarcoma, glioblastoma, leukemia, teratocarcinoma, neuroblastoma, glioma, rectal cancer, endometrial cancer, adrenal cancer, brain cancer, colon cancer, head and neck cancer, lymph node cancer, ear-nose-throat (ENT) cancer, preferably selected from the group consisting of gastric cancer, gastroesophageal junction (GEJ) adenocarcinoma, esophageal cancer, gastrointestinal cancer, pancreatic cancer, lung cancer. DETAILED DESCRIPTION

[0024] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the application belongs.

[0025] Claudin18.2 humanized nanobody

[0026] As used herein, the term "nanobody" refers to a single immunoglobulin variable domain (V H , V HH , or V L ) polypeptide that specifically binds an antigen with three complementarity determining regions (CDRs). They are capable of binding to an antigen without the presence of the corresponding CDR-containing light / heavy chain partner or other parts of an intact antibody. Nanobodies have been reported from antibodies of only heavy chains in camels naturally lacking light chains as well as nanobodies with human heavy chain domains (Muyldermans 2001, Holliger 2005), as well as single V H domains identified in a murine V H domain library amplified from genomic DNA of the spleen of immunized mice (Ward et al., 1989, Nature 341:544-546). Nanobodies typically have the following structure from N-terminus to C-terminus: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, where FR1 to FR4 refer to framework regions 1 to 4, respectively, and CDR1 to CDR3 refer to complementarity determining regions 1 to 3.

[0027] The term "complementarity determining region" or "CDR" is well known to those skilled in the art and used interchangeably to refer to non-contiguous amino acid sequences within the variable region of an antibody that impart antigen specificity and / or binding affinity. The term "framework region" or "FR" is also known in the art to refer to the non-CDR portions of the variable region of an antibody, whose sequences are generally more conserved.

[0028] The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using a number of numbering schemes well known in the art, including: Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5thEd. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732-745 (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, Jan 2003; 27(1):55-77 (“IMGT” numbering scheme); Honegger A and Pluckthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, Jun 8 2001; 309(3):657-70 (“Aho” numbering scheme); and Martin et al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272 (“AbM” numbering scheme).

[0029] The boundaries of a given CDR or FR can differ depending on the schema used for identification. For example, the Kabat schema is based on structural alignment, while the Chothia schema is based on structural information. Both the Kabat and Chothia schema numbering are based on the most common antibody region sequence lengths, with insertions provided by the insertion letter (e.g., “30a”) and deletions occurring in some antibodies. Both of these schemes place certain insertions and deletions (“indels”) in different positions, resulting in different numbering. The Contact schema is based on analysis of complex crystal structures, and is similar in many respects to the Chothia numbering schema. The AbM schema is a compromise between the Kabat and Chothia definitions, based on the scheme used by Oxford Molecular’s AbM antibody modeling software.

[0030] Accordingly, unless otherwise specified, it is to be understood that “CDRs” of a given antibody or region thereof (such as a variable region thereof) encompass CDRs as defined by any of the above-referenced schemes or other known schemes. For example, where a particular CDR (e.g., CDR3) is specified to contain a given amino acid sequence, it is to be understood that such CDR can also have the sequence of the corresponding CDR (e.g., CDR3) as defined by any of the above-referenced schemes or other known schemes. Likewise, unless otherwise specified, it is to be understood that FRs of a given antibody or region thereof (such as a variable region thereof) encompass FRs as defined by any of the above-referenced schemes or other known schemes.

[0031] As used herein, “humanized” antibodies refer to antibodies in which all or substantially all CDR amino acid residues are derived from a non-human CDR and all or substantially all FR amino acid residues are derived from human FRs. A “humanized form” of a non-human antibody, refers to a variant of the non-human antibody that has undergone humanization to typically reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), for example, to restore or improve antibody specificity or affinity.

[0032] Humanized antibodies and methods of making them are well known to those of skill in the art, see, e.g., Almagro and Fransson, Front. Biosci. 13:1619-1633 (2008). Human framework regions that can be used for humanization include, but are not limited to: framework regions selected using the “best-fit” method; framework regions derived from the consensus sequence of human antibodies of a particular subgroup of light or heavy chain variable regions; human mature (somatically mutated) framework regions or human germline framework regions; and framework regions derived from screening of FR libraries.

[0033] In some embodiments, the anti-Claudin 18.2 Nanobody is modified, e.g., humanized, without reducing its native affinity for the antigen, while reducing its immunogenicity against the heterologous species. For example, the amino acid residues of the antibody variable domains (V HH ) of the llama antibody can be determined, and, for example, one or more of the camelid amino acids in the framework regions are replaced with their human counterparts. Humanization does not significantly affect the antigen binding ability of the resulting polypeptide. Humanization of a camelid Nanobody requires mutagenesis of only a limited number of amino acids in a single polypeptide chain. This is in contrast to humanization of scFv, Fab', (Fab')2, and IgG, which requires introduction of amino acid changes in both chains, i.e., light and heavy chains, and ensuring the pairing ability of the two chains.

[0034] Thus, in one aspect, the present application provides a humanized Nanobody specifically binding to Claudin 18.2, consisting of three complementarity determining regions CDR1, CDR2 and CDR3 and four framework regions FR1, FR2, FR3 and FR4, wherein CDR1 is as set forth in SEQ ID NO: 1, CDR2 is as set forth in SEQ ID NO: 2, CDR3 is as set forth in SEQ ID NO: 3, FR1 is selected from the group consisting of SEQ ID NO: 4, 8 or a variant thereof, FR2 is selected from the group consisting of SEQ ID NO: 5, 9 or a variant thereof, FR 3 is selected from the group consisting of SEQ ID NO: 6, 11, 12, 13 or a variant thereof, FR4 is selected from the group consisting of SEQ ID NO: 7, 10 or a variant thereof, said variant comprising in said FR up to 3 conservative substitutions of amino acids.

[0035] In one embodiment, the humanized Nanobody of the present application comprises:

[0036] (1) FR1 as set forth in SEQ ID NO: 4, FR2 as set forth in SEQ ID NO: 5, FR3 as set forth in SEQ ID NO: 6, FR4 as set forth in SEQ ID NO: 7, or a variant thereof comprising in said FR up to 3 conservative substitutions of amino acids;

[0037] (2) FR1 as set forth in SEQ ID NO: 8, FR2 as set forth in SEQ ID NO: 9, FR3 as set forth in SEQ ID NO: 6, FR4 as set forth in SEQ ID NO: 10, or a variant thereof comprising in said FR up to 3 conservative substitutions of amino acids; or

[0038] (3) FR1 as depicted in SEQ ID NO: 4, FR2 as depicted in SEQ ID NO: 5, FR3 as depicted in SEQ ID NO: 11, 12 or 13, FR4 as depicted in SEQ ID NO: 10, or a variant thereof comprising up to 3 conservative substitutions in said FRs.

[0039] In one embodiment, the anti-Claudinl8.2 humanized Nanobody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 15-18, and is capable of specifically binding to a Claudinl8.2 antigen. Preferably, the amino acid sequence of the anti-Claudinl8.2 humanized Nanobody is as depicted in SEQ ID NOs: 15-18.

[0040] As used herein, the term "conservative substitution" refers to an amino acid substitution that does not significantly affect or alter the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. Amino acid substitutions can be introduced into an antibody of the application by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is a substitution of an amino acid residue for another that has similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Conservative modifications can be selected, for example, based on polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the involved residues.

[0041] As used herein, the term "sequence identity" denotes the extent to which two (nucleotide or amino acid) sequences have the same residues at a given position in an alignment, and is usually expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies having exactly the same sequence have 100% identity. Those skilled in the art know that sequence identity can be determined using several algorithms, such as Blast (Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul et al. (1990) J. Mol. Biol. 215:403-410), Smith-Waterman (Smith et al. (1981) J. Mol. Biol. 147:195-197), and ClustalW.

[0042] As used herein, the term "variant" or "functional fragment" has up to 10 (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) conservative substitutions of amino acids compared to a parent amino acid sequence, or has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a parent amino acid sequence, and retains a biological activity of the parent amino acid, such as a binding activity.

[0043] Examples of nanobodies include, but are not limited to, heavy chain variable domains from heavy chain antibodies, binding molecules naturally lacking light chains, single domains derived from conventional four-chain antibodies, such as V H or V L ), humanized heavy chain antibodies, human nanobodies produced from transgenic mice or rats expressing human heavy chain fragments, and the like. Nanobodies can be from any species, including but not limited to mouse, rat, human, camel, llama, lamprey, fish, shark, goat, rabbit, and bovine.

[0044] In one embodiment, the nanobody is a single domain antigen binding molecule derived from naturally occurring heavy chain antibodies (also known as HCAbs). For example, the nanobody can be derived from a camelid species, such as a camel, a llama, a vicuna, a dromedary, an alpaca, and a camllopus. Nanobodies derived from camelids are also known as V HH , which have a molecular weight of approximately 15 kD, are considered the smallest functional antigen binding fragments.

[0045] In some embodiments, the nanobody is derived from the variable region of an immunoglobulin found in cartilaginous fish. For example, the nanobody can be derived from an immunoglobulin isotype found in shark serum known as a new antigen receptor (NAR).

[0046] In some embodiments, the Nanobodies are human Nanobodies produced from transgenic mice or rats expressing human heavy chain fragments. See, e.g., US20090307787A1, US Patent No. 8,754,287, US20150289489A1, US20100122358A1, and WO2004049794.

[0047] In some embodiments, Nanobodies can also be obtained from Camelidae V HH Such methods include, for example, screening of such libraries by using the corresponding antigen or fragments thereof, antigenic determinants or epitopes, etc., by screening techniques known in the art. Alternatively, improved synthetic or semi-synthetic libraries can be obtained from natural V HH libraries by means of random mutagenesis and / or CDR shuffling, etc.

[0048] Multispecific antibodies

[0049] In one aspect, the present application also provides multispecific antibodies (preferably bispecific antibodies or trispecific antibodies) comprising a Claudin 18.2 humanized Nanobody as described above, which further comprises one or more second antibodies or antigen binding portions thereof that specifically bind to other antigens.

[0050] As used herein, the term "multispecific" refers to an antigen binding protein having polyepitopic specificity (i.e., capable of specifically binding two, three, or more different epitopes on one biological molecule or capable of specifically binding epitopes on two, three, or more different biological molecules). As used herein, the term "bispecific" denotes an antigen binding protein having two different antigen binding specificities.

[0051] In one embodiment, the second antibody or antigen binding portion thereof can have any antibody or antibody fragment format, such as a full-length antibody, Fab, Fab', (Fab')2, Fv, scFv, scFv-scFv, minibody, diabody, Nanobody, or sdAb.

[0052] Thus, in one embodiment, the second antibody or antigen-binding portion thereof targets an antigen selected from the group consisting of CD2, CD3, CD4, CD5, CD7, CD8, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD30, CD33, CD37, CD38, CD40, CD40L, CD44, CD46, CD47, CD52, CD54, CD56, CD70, CD73, CD80, CD97, CD123, CD126, CD138, CD171, CD 179a, DR4, DR5, TAC, TEM1 / CD248, VEGF, GUCY2C, EGP40, EGP-2, EGP-4, CD133, IFNAR1, DLL3, kappa light chain, TIM3, TSHR, CD19, BAFF-R, CLL-1, EGFRvIII, tEGFR, GD2, GD3, BCMA, Tn antigen, PSMA, ROR1, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, IL-llRa, IL-22Ra, IL-2, Mesothelin, PSCA, PRSS21, VEGFR2, LewisY, PDGFR-beta, SSEA-4, AFP, Folate receptor alpha, ErbB2 (Her2 / neu), ErbB3, ErbB4, MUC1, MUC16, EGFR, CS1, NCAM, Claudin 18.2, c-Met, Prostase, PAP, ELF2M, Ephrin B2, IGF-I receptor, CAIX, LMP2, gplOO, bcr-abl, tyrosinase, EphA2, Fucosyl GMl, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, Folate receptor beta, TEM7R, CLDN6, GPRC5D, CXORF61, ALK, Polysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-la, MAGE-A1, MAGE-A3, MAGE-A6, legumain, HPV E6, E7, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutant, PSA, survivin and telomerase, PCTA-l / Galectin 8, MelanA / MARTl, Ras mutant, hTERT, sarcoma translocation breakpoints, ML-IAP, TMPRSS2 ETS fusion gene, NA17, PAX3, Androgen receptor, Progesterone receptor, Cyclin Bl, MYCN, RhoC, TRP-2, CYP1B 1, BORIS, SART3, PAX5, OY-TES 1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxyl esterase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, PD1, PDL1, PDL2, TGFp, APRIL, NKG2D, NKG2D ligand, and / or pathogen specific antigens, biotinylated molecules, molecules expressed by HIV, HCV, HBV and / or other pathogens; and / or neoepitopes or neoantigens.

[0053] Nucleic acids, vectors, host cells

[0054] In another aspect, the present application relates to nucleic acid molecules encoding the Claudin 18.2 Nanobodies or multispecific antibodies of the present application. The nucleic acids of the present application can be RNA, DNA or cDNA. According to one embodiment of the present application, the nucleic acids of the present application are substantially isolated nucleic acids.

[0055] In one embodiment, the nucleic acid molecule encoding the Claudin 18.2 Nanobody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 20-23, and is capable of specifically binding to a Claudin 18.2 antigen. Preferably, the nucleic acid molecule encoding the Claudin 18.2 Nanobody is as set forth in SEQ ID NOs: 20-23.

[0056] The nucleic acid of the present application can also be in the form of, can be present in, and / or can be part of a vector, such as a plasmid, cosmid or YAC. The vector can be, inter alia, an expression vector, i.e. a vector that can provide for expression of the Claudin 18.2 Nanobody in vitro and / or in vivo, i.e. in a suitable host cell, host organism and / or expression system. Such an expression vector typically comprises at least one nucleic acid molecule of the present application operably linked to one or more suitable expression control elements (e.g. promoters, enhancers, terminators, etc.). The selection of the control elements and their sequences in order to express in a particular host is well known to the person skilled in the art. Particular examples of control elements and other elements useful or necessary for the expression of the Claudin 18.2 Nanobody of the present application include, but are not limited to, promoters, enhancers, terminators, integration factors, selection markers, leader sequences, reporter genes.

[0057] In another aspect, the present application also provides host cells expressing the Claudin 18.2 Nanobody, the multispecific antibody of the present application and / or containing the nucleic acid or vector of the present application. Preferred host cells of the present application are bacterial cells, fungal cells or mammalian cells.

[0058] Suitable bacterial cells include cells of Gram-negative bacterial strains (e.g. Escherichia coli strains, Proteus strains and Pseudomonas strains) and Gram-positive bacterial strains (e.g. Bacillus strains, Streptomyces strains, Staphylococcus strains and Lactococcus strains).

[0059] Suitable fungal cells include cells of species of Trichoderma, Neurospora, and Aspergillus; or of species of Saccharomyces (e.g., Saccharomyces cerevisiae), Schizosaccharomyces (e.g., Schizosaccharomyces pombe), Pichia (e.g., Pichia pastoris and Pichia methanolica), and Hansenula.

[0060] Suitable mammalian cells include, for example, HEK293 cells, CHO cells, BHK cells, HeLa cells, COS cells, and the like.

[0061] However, the present application can also use amphibian cells, insect cells, plant cells, and any other cells used in the art for expressing heterologous proteins.

[0062] Chimeric antigen receptors

[0063] In another aspect, the present application also provides a recombinant receptor, e.g., a recombinant TCR receptor or a chimeric antigen receptor, comprising a Claudin 18.2 Nanobody as described above. Preferably, the present application also provides a chimeric antigen receptor comprising a Claudin 18.2 Nanobody as described above.

[0064] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificially constructed hybrid polypeptide that generally includes a ligand binding domain (e.g., an antigen binding portion of an antibody), a transmembrane domain, an optional co-stimulatory domain, and an intracellular signaling domain, each connected by a linker. CARs are able to redirect the specificity and reactivity of T cells and other immune cells to a selected target in a non-MHC restricted manner, taking advantage of the antigen binding properties of antibodies.

[0065] In one embodiment, the present application provides a chimeric antigen receptor comprising a Claudin 18.2 humanized Nanobody as described above or a multi-specific antibody containing said Claudin 18.2 Nanobody, a transmembrane domain, and an intracellular signaling domain.

[0066] As used herein, the term "transmembrane domain" refers to a polypeptide structure that enables expression of a chimeric antigen receptor on the surface of an immune cell (e.g., a lymphocyte, NK cell, or NKT cell) and directs a cellular response of the immune cell against a target cell. The transmembrane domain can be natural or synthetic and can be derived from any membrane-bound or transmembrane protein. The transmembrane domain is capable of signaling when the chimeric antigen receptor binds to a target antigen. Particularly suitable transmembrane domains for use in the present application can be derived from, for example, TCRa chain, TCRP chain, TCRy chain, TCR5 chain, CD3y subunit, CD3e subunit, CD3y subunit, CD3d subunit, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, and functional fragments thereof. Alternatively, the transmembrane domain can be synthetic and can comprise predominantly hydrophobic residues such as leucine and valine. Preferably, the transmembrane domain is derived from CD8a or CD28 having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 24 or SEQ ID NO: 26, or a coding sequence thereof having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 25 or SEQ ID NO: 27.

[0067] In one embodiment, the chimeric antigen receptor of the application can further comprise a hinge region between the antibody and the transmembrane domain. As used herein, the term "hinge region" generally refers to any oligo- or polypeptide that functions to link the transmembrane domain to the ligand binding domain. In particular, the hinge region serves to provide greater flexibility and accessibility to the ligand binding domain. The hinge region can comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. The hinge region can be derived in whole or in part from a natural molecule, such as the extracellular region of CD8, CD4 or CD28 in whole or in part, or from an antibody constant region in whole or in part. Alternatively, the hinge region can be a synthetic sequence corresponding to a naturally occurring hinge sequence, or can be a completely synthetic hinge sequence. In preferred embodiments, the hinge region comprises a hinge region portion of CD8a, CD28, FcyRIIIa receptor, IgG4 or IgGl, more preferably a CD8a, CD28 or IgG4 hinge having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 40, 42 or 44, or a coding sequence having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 41, 43 or 45.

[0068] As used herein, the term "intracellular signaling domain" refers to the portion of a protein that transduces a signal for effector function and directs the cell to perform a specified function. In one embodiment, the intracellular signaling domain comprised by the chimeric antigen receptors of the present application can be the intracellular region sequences of T cell receptors and co-receptors that act in concert to initiate signaling upon antigen receptor engagement, as well as any derivative or variant of these sequences and any synthetic sequence with the same or similar function. The intracellular signaling domain can comprise a number of Immunoreceptor Tyrosine-based Activation Motifs (ITAMs). Non-limiting examples of intracellular signaling domains of the present application include, but are not limited to, the intracellular regions of FcRy, FcRP, CD3y, CD35, CD3s, CD3z, CD22, CD79a, CD79b, and CD66d, etc. In a preferred embodiment, the signaling domain of the CARs of the present application can comprise a CD3z intracellular region having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 32 or SEQ ID NO: 34, or a coding sequence having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 33 or SEQ ID NO: 35.

[0069] In one embodiment, the chimeric antigen receptor can further comprise one or more costimulatory domains. The costimulatory domain can be an intracellular functional signaling domain from a costimulatory molecule, which comprises the entire intracellular portion of the costimulatory molecule, or a functional fragment thereof. A "costimulatory molecule" refers to a cognate binding partner that specifically binds with a costimulatory ligand on a T cell, thereby mediating a costimulatory response (e.g., proliferation) of the T cell. Costimulatory molecules include, but are not limited to, MHC class 1 molecules, BTLA, and Toll ligand receptors. Non-limiting examples of costimulatory domains of the present application include, but are not limited to, costimulatory signaling domains derived from the following proteins: CD94, LTB, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD7, CD8, CD18, CD27, CD28, CD30, CD40, CD54, CD83, CD134 (OX40), CD137 (4-1BB), CD270 (HVEM), CD272 (BTLA), CD276 (B7-H3), CD278 (ICOS), CD357 (GITR), DAP10, LAT, NKG2C, SLP76, PD-1, LIGHT, TRIM, and ZAP70. Preferably, the costimulatory domain of the CAR of the present application is from 4-1BB, CD28, or 4-1BB + CD28. In one embodiment, the 4-1BB costimulatory domain has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 30, or a coding sequence thereof has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 31. In one embodiment, the CD28 costimulatory domain has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 28, or a coding sequence thereof has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 29.

[0070] In one embodiment, the CAR of the application can further comprise a signal peptide, such that when it is expressed in a cell, e.g., a T cell, the nascent protein is directed to the endoplasmic reticulum and subsequently to the cell surface. The core of the signal peptide can contain a long stretch of hydrophobic amino acids with a tendency to form a single a-helix. At the end of the signal peptide, there is usually a stretch of amino acids that is recognized and cleaved by a signal peptidase. The signal peptidase can cleave during or after translocation to produce a free signal peptide and a mature protein. The free signal peptide is then digested by specific proteases. Signal peptides useful in the present application are well known to the person skilled in the art, e.g., signal peptides derived from B2M, CD8a, IgGl, GM-CSFRa, etc. In one embodiment, the signal peptide useful in the present application is from CD8a or B2M having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 36 or SEQ ID NO: 38, or a coding sequence thereof having at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid molecule set forth in SEQ ID NO: 37 or SEQ ID NO: 39.

[0071] In one embodiment, the CAR contains a Claudin 18.2 humanized nanobody as provided herein or a multi-specific antibody containing the Claudin 18.2 nanobody, a CD8a transmembrane region, a CD28 and / or 4-1BB costimulatory domain, and a CD3z intracellular signaling domain. In this embodiment, the CAR can further comprise a signal peptide from B2M, CD8a, IgGl, or GM-CSFRa.

[0072] The present application also provides nucleic acid molecules encoding a Claudin 18.2 targeting chimeric antigen receptor as defined above, as well as vectors comprising said nucleic acid molecules.

[0073] As used herein, the term "vector" is a nucleic acid molecule that serves as a vehicle for the transfer of (exogenous) genetic material into a host cell, where it can, for example, replicate and / or be expressed. Vectors generally include targeting vectors and expression vectors. A "targeting vector" is a vehicle for delivery of an isolated nucleic acid to the interior of a cell, by, for example, homologous recombination or use of a hybrid recombinase enzyme that is specific for sequences at a target site. An "expression vector" is a vehicle for the transcription of a heterologous nucleic acid sequence (e.g., those sequences encoding the chimeric antigen receptor polypeptides of the application) in a suitable host cell, and the translation of their mRNA. Suitable vectors useful in the application are known in the art, and many are commercially available. In one embodiment, vectors of the application include, but are not limited to, plasmids, viruses (e.g., retroviruses, lentiviruses, adenoviruses, vaccinia viruses, Rous sarcoma virus (RSV, polyoma virus, and adeno-associated virus (AAV), etc.), bacteriophages, phagemids, cosmids, and artificial chromosomes (including BACs and YACs). Vectors themselves are typically nucleic acid molecules, usually DNA sequences comprising an insert (transgene) and a larger sequence that serves as the "backbone" of the vector. Engineered vectors often also contain an origin of replication for autonomous replication in the host cell (if stable expression of the polynucleotide is desired), a selection marker, and restriction enzyme cleavage sites (such as a multiple cloning site, MCS). Vectors can additionally contain elements such as promoters, polyadenylation tails (polyA), 3'UTRs, enhancers, terminators, insulators, operators, selection markers, reporter genes, targeting sequences, and / or protein purification tags. In a specific embodiment, the vector is an in vitro transcribed vector.

[0074] Engineered immune cells

[0075] In one aspect, the application also provides engineered immune cells expressing a CAR described herein.

[0076] As used herein, the term "immune cell" refers to any cell of the immune system having one or more effector functions (e.g., cytotoxic cell killing activity, secretion of cytokines, induction of ADCC and / or CDC). For example, the immune cell can be a T cell, a macrophage, a dendritic cell, a monocyte, an NK cell, and / or an NKT cell. In one embodiment, the immune cell is derived from a stem cell, such as an adult stem cell, an embryonic stem cell, a cord blood stem cell, a progenitor cell, a bone marrow stem cell, an induced pluripotent stem cell, a totipotent stem cell, or a hematopoietic stem cell, etc. Preferably, the immune cell is a T cell. The T cell can be any T cell, such as a T cell cultured in vitro, e.g., a primary T cell, or a T cell from a T cell line cultured in vitro, e.g., Jurkat, SupTl, etc., or a T cell obtained from a subject. Examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. The T cell can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. The T cell can also be concentrated or purified. The T cell can be at any stage of development, including but not limited to, CD4+ / CD8+ T cells, CD4+ helper T cells (e.g., Thl and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), tumor infiltrating cells, memory T cells, naive T cells, CD4-CD8- T cells, regulatory T cells, gamma delta-T cells, alpha beta-T cells, etc. In a preferred embodiment, the immune cell is a human T cell. The T cell can be obtained from the blood of a subject using a variety of techniques known to those skilled in the art, such as Ficoll separation.

[0077] In one embodiment, the engineered immune cell of the application further expresses a cytokine selected from the group consisting of IL7, XCL1, XCL2, or a combination thereof. In one embodiment, the engineered immune cell of the application further expresses XCL1 and / or XCL2, more preferably a combination thereof with IL7 (i.e., XCL1+IL7, XCL2+IL7, or XCL1+XCL2+IL7). In one embodiment, the cytokine used in the application is wild-type or a variant thereof having the same or similar, even more superior, function as the wild-type. In one embodiment, the IL7 used in the application has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 47 or 51, or the gene encoding IL7 has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97%, or 99% or 100% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 46 or 50.

[0078] XCL1 and XCL2 both belong to the C-type chemokine family and are mainly produced by CD8+ T cells and natural killer cells. XCL2 has 97% identity to XCL1 in nucleic acid sequence and only two residues different in amino acid sequence. Studies have found that XCL2 is very similar to XCL1 in expression profile, structure and function, for example, like XCL1, XCL2 also has two interconvertible protein spatial conformations of monomeric and dimeric forms, wherein the monomeric form binds and activates XCR1, and the dimeric form has higher affinity for the hairpin structure in glycosaminoglycans (GAG). The receptor XCR1 of XCL1 and XCL2 is selectively expressed on DC (cDC1) cells with antigen presentation ability. In one embodiment, the XCL1 used in the application has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 49 or 53, or the coding sequence of XCL1 has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the nucleic acid sequence shown in SEQ ID NO: 48 or 52. In one embodiment, the XCL2 used in the application has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 55, or the coding sequence of XCL2 has at least 70%, preferably at least 80%, more preferably at least 90%, 95%, 97% or 99% or 100% sequence identity to the nucleic acid sequence shown in SEQ ID NO: 54.

[0079] Nucleic acid sequences encoding chimeric antigen receptors can be introduced into immune cells using conventional methods known in the art (e.g., by transduction, transfection, transformation, etc.). “Transfection” is the process of introducing a nucleic acid molecule or polynucleotide (including a vector) into a target cell. One example is RNA transfection, i.e., the process of introducing RNA (such as in vitro transcribed RNA, ivtRNA) into a host cell. The term is used primarily for non-viral methods in eukaryotic cells. The term “transduction” is generally used to describe viral-mediated transfer of nucleic acid molecules or polynucleotides. Transfection of animal cells typically involves opening transient pores or “holes” in the cell membrane to allow uptake of material. Transfection can be performed using calcium phosphate, by electroporation, by cell squeezing, or by mixing cationic lipids with the material to produce liposomes that fuse with the cell membrane and deposit their cargo into the interior. Exemplary techniques for transfecting eukaryotic host cells include liposome vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA co-precipitation), microinjection, and electroporation. The term “transformation” is used to describe non-viral transfer of nucleic acid molecules or polynucleotides (including vectors) into bacteria, and also into non-animal eukaryotic cells, including plant cells. Thus, transformation is a genetic alteration of a bacterium or non-animal eukaryotic cell that results from direct uptake of exogenous genetic material (nucleic acid molecules) from its surroundings through the cell membrane and subsequent incorporation into the genome. Transformation can be achieved by artificial means. In order for transformation to occur, the cell or bacterium must be in a state of competence. For prokaryotic transformation, techniques can include heat shock-mediated uptake, fusion with intact cells of bacterial protoplasts, microinjection, and electroporation. After introducing nucleic acids or vectors into immune cells, the resulting immune cells can be expanded and activated by routine techniques by those of skill in the art.

[0080] In one embodiment, to reduce the risk of graft versus host disease, the engineered immune cell further comprises at least one gene selected from the group consisting of CD52, GR, dCK, TCR / CD3 genes (e.g. TRAC, TRBC, CD3y, CD35, CD3s, CD3z), MHC-related genes (HLA-A, HLA-B, HLA-C, B2M, HLA-DPA, HLA-DQ, HLA-DRA, TAP1, TAP2, LMP2, LMP7, RFX5, RFXAP, RFXANK, CIITA) and immune checkpoint genes such as PD1, LAG3, TIM3, CTLA4, PPP2CA, PPP2CB, PTPN6, PTPN22, PDCD1, HAVCR2, BTLA, CD160, TIGIT, CD96, CRTAM, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT, FOXP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2 and GUCY1B3. Preferably, the engineered immune cell further comprises at least one gene selected from the group consisting of TRAC, TRBC, HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA, PD1, LAG3, TIM3, CTLA4, more preferably TRAC, TRBC, HLA-A, HLA-B, HLA-C, B2M, RFX5, RFXAP, RFXANK, CIITA.

[0081] Methods to inhibit gene expression or to silence a gene are well known to the person skilled in the art. For example, antisense RNA, RNA decoy, RNA aptamer, siRNA, shRNA / miRNA, trans dominant negative protein (TNP), chimeric / antibody conjugate, chemokine ligand, anti-infectious cellular protein, intracellular antibody (sFv), nucleoside analog (NRTI), non-nucleoside analog (NNRTI), integrase inhibitor (oligonucleotide, dinucleotide and chemical agent) and protease inhibitor can be used to inhibit the expression of a gene. In addition, a gene can also be silenced by, for example, DNA breakage mediated by meganucleases, zinc finger nucleases, TALE nucleases or Cas enzymes in the CRISPR system.

[0082] In one embodiment, a plurality of immune cells is provided, each of which is engineered to express one or more chimeric antigen receptors. For example, in some embodiments, one immune cell is engineered to express a chimeric antigen receptor that binds and / or targets Claudin 18.2 (e.g., a CAR comprising a Claudin 18.2 nanobody described herein), and another cell is engineered to express a chimeric antigen receptor that binds and / or targets another antigen. In one embodiment, the immune cells can also express a multi-specific chimeric antigen receptor that targets one or more antigens, including Claudin 18.2. For example, such a multi-specific chimeric antigen receptor can comprise a multi-specific antibody that targets Claudin 18.2, or comprise both a Claudin 18.2 nanobody described herein and an antibody that targets another antigen. In such embodiments, the plurality of engineered immune cells can be administered together or separately. In one embodiment, the plurality of immune cells can be in the same composition or in different compositions. Exemplary compositions of cells include those described in the following sections of this application.

[0083] Antibody conjugates

[0084] In one aspect, the present application provides an antibody conjugate comprising a Claudin 18.2 nanobody as defined herein and a second functional structure, wherein the second functional structure is selected from the group consisting of an Fc, a radioisotope, a half-life extending moiety, a detectable label, and a drug.

[0085] In one embodiment, the present application provides an antibody conjugate comprising a Claudin 18.2 Nanobody as defined by the present application and an Fc. As used herein, the term "Fc" is used to define the C-terminal region of an immunoglobulin heavy chain, which includes native Fc and variant Fc. "Native Fc" refers to a molecule or sequence comprising a non-antigen binding fragment produced by digestion of an intact antibody, whether in monomeric form or in multimeric form. The immunoglobulin source from which the native Fc is produced is preferably derived from a human. The native Fc fragment is composed of monomeric polypeptides that can be connected as dimers or multimers by covalent (e.g., disulfide bonds) and non-covalent connections. Depending on the class (e.g., IgG, IgA, IgE, IgD, IgM) or the subtype (e.g., IgG1, IgG2, IgG3, IgA1, IgGA2) there are 1-4 intermolecular disulfide bonds between the monomeric subunits of the native Fc molecule. One example of a native Fc is a disulfide-linked dimer produced by digestion of IgG with papain (see Ellison et al. (1982), Nucleic Acids Res. 10:4071-9). The term "native Fc" as used herein refers to monomeric, dimeric and multimeric forms in general. "Variant Fc" refers to an amino acid sequence that differs from the amino acid sequence of a "native" or "wild type" Fc due to at least one "amino acid modification" as defined herein, also referred to as "Fc variant". Thus, "Fc" also includes single chain Fc (scFc), i.e., a single chain Fc composed of two Fc monomers connected by a polypeptide linker, which is capable of folding into a functional dimeric Fc region naturally. In one embodiment, the Fc is preferably the Fc of a human immunoglobulin, more preferably the Fc of human IgG1.

[0086] In one embodiment, the present application provides an antibody conjugate comprising a Claudin 18.2 Nanobody as defined by the present application and a radioisotope. Examples of radioisotopes useful in the present application include, but are not limited to, At 211 , I 131 , I 125 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 , 99m Tc, 123 I, 18 F and 68 Ga.

[0087] In one embodiment, the present application provides an antibody conjugate comprising a Claudin 18.2 Nanobody as defined in the present application and a half-life extending moiety selected from the group consisting of a binding structure of albumin, a binding structure of transferrin, a polyethylene glycol molecule, a recombinant polyethylene glycol molecule, human serum albumin, a fragment of human serum albumin and a white polypeptide (including an antibody) binding human serum albumin.

[0088] In one embodiment, the present application provides an antibody conjugate comprising a Claudin 18.2 Nanobody as defined in the present application and a detectable label. The term "detectable label" means herein a compound that generates a detectable signal. For example, the detectable label can be an MRI contrast agent, a scintigraphic contrast agent, an X-ray imaging contrast agent, an ultrasound contrast agent, an optical imaging contrast agent. Examples of detectable labels include fluorophores (such as fluorescein, Alexa or cyanine), chemiluminescent compounds (such as luminol), bioluminescent compounds (such as luciferase or alkaline phosphatase), enzymes (such as horseradish peroxidase, glucose-6-phosphatase, beta-galactosidase), antibiotic (e.g. kanamycin, ampicillin, chloramphenicol, tetracycline, etc.) resistance genes and contrast agents (such as nanoparticles or gadolinium). The skilled person can select a suitable detectable label depending on the detection system used.

[0089] In one embodiment, the present application provides an antibody conjugate comprising a Claudin 18.2 Nanobody as defined herein and a drug, e.g., a cytotoxin or an immunomodulatory agent, conjugated to the Claudin 18.2 Nanobody (i.e., an antibody drug conjugate). Typically the drug is linked to the antibody covalently, and often relies on a linker. In one embodiment, the drug is a cytotoxin. In another embodiment, the drug is an immunomodulatory agent. Examples of cytotoxins include, but are not limited to, methotrexate, aminopterin, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine, mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), 1-methyl- l-nitrosourea, cyclophosphamide, nitrogen mustard, busulfan, dibromomannitol, streptozotocin, mitomycin, cis-dichlorodiamine platinum (II) (DDP), cisplatin, carboplatin, zorubicin, doxorubicin, detorubicin, carminomycin, idarubicin, epirubicin, mitoxantrone, dactinomycin, bleomycin, calicheamicin, duocarmycin, anthramycin (AMC), vincristine, vinblastine, paclitaxel, ricin, pseudomonas exotoxin, gemcitabine, cytochalasin B, gramicidin D, ethidium bromide, emetine, etoposide, teniposide, colchicin, dihydroxy anthracin dione, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, procarbazine, hydroxyurea, asparaginase, corticosteroids, mitotane (O, P'-(DDD)), interferons, and combinations thereof. Examples of immunomodulatory agents include, but are not limited to, ganciclovir, etanercept, tacrolimus, sirolimus, voclosporin, cyclosporine, rapamycin, cyclophosphamide, azathioprine, mycophenolate mofetil, methotrexate, glucocorticoids and analogs thereof, cytokines, stem cell growth factors, lymphotoxin, tumor necrosis factor (TNF), hematopoietic factors, interleukins (e.g., IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, and IL-21), colony stimulating factors (e.g., G-CSF and (GM-CSF), interferons (e.g., interferon-alpha, interferon-beta, and interferon-gamma), stem cell growth factor named "S1 factor", erythropoietin, and thrombopoietin, or combinations thereof.

[0090] Kits and pharmaceutical compositions

[0091] In another aspect, the present application also provides a detection kit comprising a Nanobody, a multispecific antibody, an antibody conjugate, or a chimeric antigen receptor as described herein.

[0092] In another aspect, the present application also provides a pharmaceutical composition comprising a Nanobody, a chimeric antigen receptor, a multispecific antibody or an antibody conjugate according to the present application, and one or more pharmaceutically acceptable excipients.

[0093] As used herein, the term "pharmaceutically acceptable excipient" refers to a carrier and / or an excipient that is compatible, in pharmacology and / or physiology, with the subject and the active ingredient (i.e., capable of eliciting the desired therapeutic effect without causing any undesirable local or systemic effects) and is well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995). Examples of pharmaceutically acceptable excipients include, but are not limited to, fillers, binders, disintegrants, coating agents, adsorbents, anti-adherents, glidants, antioxidants, flavoring agents, coloring agents, sweetening agents, solvents, co-solvents, buffers, chelating agents, surfactants, diluents, wetting agents, preservatives, emulsifiers, encapsulating agents, isotonic agents, absorption delaying agents, stabilizers, and tonicity adjusting agents. The selection of a suitable excipient to prepare the desired pharmaceutical composition of the present application is known to the skilled person. Exemplary excipients for use in the pharmaceutical compositions of the present application include saline, buffered saline, dextrose, and water. Generally, the selection of a suitable excipient depends, inter alia, on the active agent used, the disease to be treated, and the desired dosage form of the pharmaceutical composition.

[0094] The pharmaceutical composition according to the present application can be suitable for administration via a variety of routes. Typically, administration is accomplished parenterally. Parenteral delivery methods include topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual, or intranasal administration.

[0095] The pharmaceutical composition according to the present application can also be prepared in various forms, such as solid, liquid, gaseous or lyophilized forms, in particular in the form of an ointment, a cream, a transdermal patch, a gel, a powder, a tablet, a solution, an aerosol, a granule, a pill, a suspension, an emulsion, a capsule, a syrup, an elixir, a decoction, a tincture or a fluid extract, or in a form that is particularly suitable for the desired method of administration. Processes known in the art for the production of medicaments can include, for example, conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. The pharmaceutical composition comprising, for example, the immune cells described herein is typically provided in the form of a solution, and preferably comprises a pharmaceutically acceptable buffer.

[0096] The pharmaceutical composition according to the present application can also be administered in combination with one or more other agents suitable for the treatment and / or prevention of the disease to be treated. Preferred examples of agents suitable for combination include known anticancer drugs such as cisplatin, maytansine derivatives, rachelmycin, calicheamicin, docetaxel, etoposide, gemcitabine, ifosfamide, irinotecan, melphalan, mitoxantrone, sorfimer sodium photofrin II, temozolomide, topotecan, trimetrate glucuronate, auristatin E, vincristine and doxorubicin; peptide cytotoxins such as ricin, diphtheria toxin, pseudomonas bacterial exotoxin A, DNases and RNases; radionuclides such as iodine 131, rhenium 186, indium 111, iridium 90, bismuth 210 and 213, actinium 225 and astatine 213; prodrugs such as antibody-directed enzyme prodrugs; immunostimulants such as platelet factor 4, melanoma growth stimulatory protein and the like; antibodies or fragments thereof such as anti-CD3 antibodies or fragments thereof, complement activators, heterologous protein domains, homologous protein domains, viral / bacterial protein domains and viral / bacterial peptides. In addition, the pharmaceutical composition of the present application can also be used in combination with other therapeutic method(s), e.g. chemotherapy, radiotherapy.

[0097] Therapeutic / prophylactic / diagnostic uses

[0098] In another aspect, the present application also provides a method of treating and / or preventing and / or diagnosing a disease associated with Claudin 18.2 expression, comprising administering to a subject a humanized Nanobody, a chimeric antigen receptor, a multispecific antibody, an antibody conjugate, an engineered immune cell or a pharmaceutical composition as described above.

[0099] In one embodiment, the disease associated with Claudin 18.2 expression includes, but is not limited to, esophageal cancer, gastrointestinal cancer, pancreatic cancer, thyroid cancer, colorectal cancer, kidney cancer, lung cancer (e.g. non-small cell lung cancer), liver cancer, gastric cancer, gastroesophageal junction (GEJ) adenocarcinoma, head and neck cancer, bladder cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, testicular cancer, germ cell cancer, bone cancer, skin cancer, thymus cancer, cholangiocarcinoma, gallbladder cancer, melanoma, mesothelioma, lymphoma, myeloma (e.g. multiple myeloma), sarcoma, glioblastoma, leukemia, teratocarcinoma, neuroblastoma, glioma, rectal cancer, endometrial cancer, adrenal cancer, brain cancer, colon cancer, head and neck cancer, lymph node cancer, ear-nose-throat (ENT) cancer, and metastatic, recurrent or refractory lesions of these cancers.

[0100] In a preferred embodiment, the disease associated with Claudin 18.2 expression is selected from gastric cancer, gastroesophageal junction (GEJ) adenocarcinoma, esophageal cancer, gastrointestinal cancer, pancreatic cancer, lung cancer. BRIEF DESCRIPTION OF DRAWINGS

[0101] Figure 1 : shows the expression level of Claudin 18.2 humanized nanobody in CAR-T cells.

[0102] Figure 2 : shows the killing effect of CAR-T cells on NUGC4-18.2 target cells at different effector-to-target ratios.

[0103] Figure 3 : shows the release level of cytokines IL-2 (A) and IFN-γ (B) after co-culturing CAR-T cells with target cells NUGC4-18.2 or non-target cells K562.

[0104] Figure 4 : killing effect of CAR-T cells expressing XCL1 on target cells.

[0105] Figure 5 : in vivo tumor inhibition effect of CAR-T cells expressing XCL1.

[0106] Figure 6 : killing effect of CAR-T cells expressing XCL1 and IL7 on target cells.

[0107] Figure 7 : in vivo tumor inhibition effect of CAR-T cells expressing XCL1 and IL7. DETAILED DESCRIPTION

[0108] Example 1. Preparation of Claudin 18.2 humanized nanobody

[0109] The humanized antibody was prepared based on the Claudin 18.2 camel-derived nanobody (SEQ ID NO: 14), and the specific method was as follows: using the VHH humanization general framework transplantation method established by Vincke C et al., the general humanization VHH framework designed according to sequence homology was used to replace the CDR region of the camel-derived Claudin 18.2 nanobody, and individual amino acid sites in the FR2 region were further optimized to obtain four humanized variants, and the amino acid sequences thereof were shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, respectively.

[0110] Example 2. Preparation of CAR-T cells containing Claudin 18.2 humanized nanobody

[0111] The sequence encoding the following protein was synthesized and cloned into the pLVX vector (Public Protein / Plasmid Library (PPL), Cat No: PPL00157-4a): CD8a signal peptide (SEQ ID NO: 38), claudin 18.2 humanized nanobody (selected from SEQ ID NO: 15-18), CD8a hinge region (SEQ ID NO: 40), CD8a transmembrane region (SEQ ID NO: 24), 4-1BB intracellular region (SEQ ID NO: 30), CD3 zeta intracellular signaling domain (SEQ ID NO: 32), and the correct insertion of the target sequence was confirmed by sequencing, obtaining 4 hCAR plasmids. Among them, the amino acid sequence of the anti-Claudin 18.2 humanized nanobody contained in the hCAR-1 plasmid is as shown in SEQ ID NO: 15; the amino acid sequence of the anti-Claudin 18.2 humanized nanobody contained in the hCAR-2 plasmid is as shown in SEQ ID NO: 16; the amino acid sequence of the anti-Claudin 18.2 humanized nanobody contained in the hCAR-3 plasmid is as shown in SEQ ID NO: 17; the amino acid sequence of the anti-Claudin 18.2 humanized nanobody contained in the hCAR-4 plasmid is as shown in SEQ ID NO: 18.

[0112] After diluting the above plasmid with 3ml Opti-MEM (Gibco, Cat No: 31985-070) in a sterile tube, add packaging vector psPAX2 (Addgene, Cat No: 12260) and envelope vector pMD2.G (Addgene, Cat No: 12259) according to the ratio of plasmid: virus packaging vector: virus envelope vector = 4:2:1. Then, add 120ul X-treme GENE HP DNA transfection reagent (Roche, Cat No: 06366236001), mix immediately, incubate at room temperature for 15min, then add the plasmid / vector / transfection reagent mixture dropwise to the culture bottle of 293T cells. Collect the virus at 24 hours and 48 hours, combine them, and obtain concentrated lentivirus by ultracentrifugation (25000g, 4°C, 2.5 hours).

[0113] DynaBeads CD3 / CD28 CTS TM(Gibco, Cat#40203D) to activate T cells, and continue to culture at 37℃ and 5% CO2 for 1 day. Then, concentrated lentivirus is added, and after 3 days of continuous culture, four CAR T cells expressing different claudin 18.2 humanized nanobodies are obtained, namely hCAR-1 T cells, hCAR-2 T cells, hCAR-3 T cells and hCAR-4 T cells. Unmodified wild-type T cells are used as negative controls (NT).

[0114] The expression levels of scFv on the four CAR T cells were detected by flow cytometry using Biotin-SP (long spacer) AffiniPure Goat Anti-human IgG, F(ab')2 Fragment Specific (min X Hu, Bov, Hrs Sr Prot) (jackson immunoresearch, Cat#109-065-097) as the primary antibody, APC Streptavidin (BD Pharmingen, Cat#554067) or PE Streptavidin (BD Pharmingen, Cat#554061) as the secondary antibody, and the results are shown in Figure 1

[0115] It can be seen that the claudin 18.2 humanized nanobodies in the CAR T cells prepared by the present application can be effectively expressed.

[0116] Example 3: Killing effect of CAR T cells on target cells and cytokine release

[0117] 3.1 Killing effect of CAR-T cells on target cells

[0118] When T cells kill target cells, the number of target cells will decrease. After co-culturing T cells and target cells with luciferase-expressing, the number of target cells decreases, and the secretion of luciferase also decreases. Luciferase can catalyze the conversion of luciferin to oxidized luciferin, and in this oxidation process, bioluminescence is produced, and the intensity of this luminescence will depend on the level of luciferase expressed by the target cells. Therefore, the detected fluorescence intensity can reflect the killing ability of T cells on target cells.

[0119] To detect the killing ability of CAR-T cells on target cells, first, 1x10 4 ​NUGC4-18.2 target cells carrying the luciferin gene were seeded into 96-well plates. CAR T cells and NT cells were then seeded into 96-well plates at effector-to-target ratios of 10:1, 5:1, and 2.5:1 for co-culture. Fluorescence values ​​were measured using a microplate reader after 16-18 hours. The killing efficiency was calculated using the formula: (mean fluorescence value of target cells - mean fluorescence value of sample cells) / mean fluorescence value of target cells × 100%. The results are shown below. Figure 2 As shown.

[0120] As can be seen, compared with NT, the CAR T cells of the present invention have specific killing effects on target cells.

[0121] 3.2 Cytokine release of CAR-T cells

[0122] When T cells kill target cells, the number of target cells decreases while cytokines are released. Following the steps outlined below, enzyme-linked immunosorbent assay (ELISA) was used to determine the release levels of cytokines IL2 and IFNγ during the killing of target cells by the CAR T cells of this invention.

[0123] (1) Collect cell co-culture supernatant

[0124] With 1x10 5 Target cells were seeded into 96-well plates, and then CAR T and NT cells (negative control) were co-cultured with target cells NUGC4-18.2 or non-target cells K562 at a ratio of 1:1. The cell co-culture supernatant was collected after 18-24 hours.

[0125] (2) ELISA was used to detect the secretion of IL-2 and IFN-γ in the supernatant.

[0126] Purified anti-human IL2 Antibody (Biolegend, Cat# 500302) or Purified anti-human IFN-γ Antibody (Biolegend, Cat# 506502) coated 96-well plates were incubated at 4°C overnight, then the antibody solution was removed, 250 μL of PBST (0.1% Tween in 1X PBS) containing 2% BSA (sigma, Cat# V900933-1kg) solution was added, and incubated at 37°C for 2 hours. Then the plate was washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. 50 μL of cell co-culture supernatant or standard was added to each well, and incubated at 37°C for 1 hour, then the plate was washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. Then 50 μL of detection antibody Anti-Interferon gamma antibody [MD-1] (Biotin) (abcam, Cat# ab25017) was added to each well, and incubated at 37°C for 1 hour, then the plate was washed with 250 μL of PBST (0.1% Tween in 1X PBS) for 3 times. HRP Streptavidin (Biolegend, Cat# 405210) was added, and incubated at 37°C for 30 minutes, then the supernatant was discarded, 250 μL of PBST (0.1% Tween in 1X PBS) was added, and washed for 5 times. 50 μL of TMB substrate solution was added to each well. The reaction was allowed to occur at room temperature in the dark for 30 minutes, then 50 μL of 1 mol / L H2SO4 was added to each well to stop the reaction. Within 30 minutes of stopping the reaction, the absorbance at 450 nm was detected using a microplate reader, and the content of the cytokine was calculated according to the standard curve (drawn according to the read value and concentration of the standard), and the results are shown in Figure 3

[0127] It can be seen that the CAR T cells of the present application hardly detect the release of cytokines after co-culturing with non-target cells K562, and the release level of cytokines after co-culturing with target cells NUGC4-18.2 is significantly higher than that of the control NT cells, indicating that the killing of target cells by the CAR T cells of the present application is specific.

[0128] Example 4. Preparation of CAR-T cells co-expressing cytokines and verification of their function

[0129] The CAR-T cells co-expressing cytokines were prepared according to the method described in Example 2, wherein XCL1 (SEQ ID NO: 48) connected by 2A peptide was further contained in the hCAR-3 plasmid, which was named 18.2-CAR-XCL1 T cells. The killing activity of the CAR-T cells on target cells was detected according to the method described in Example 3.1, and the results are shown in​Figure 4 As shown (where 18.2-CAR is hCAR-3). It can be seen that the killing activity of 18.2-CAR-XCL1T cells and 18.2-CAR T cells alone against target cells is comparable, and both are significantly higher than that of control NT cells.

[0130] In addition, the in vivo tumor-suppressing effect of CAR-T cells was detected using the following method: First, 5 × 10⁵ cells were subcutaneously injected into the left forelimb axilla of NCG mice at D0. 6 NUGC4-18.2 gastric cancer cells were injected into each mouse via the tail vein on day 3. 6 We obtained a gastric cancer NCG mouse model with a humanized immune system by using PBMC cells. After the tumors grew to day 10, each mouse was injected with 5 × 10⁵ PBMC cells via the tail vein. 5 NT cells, 18.2-CAR T cells, or 18.2-CAR-XCL1 T cells were used. Tumor volume changes in mice were monitored until the end of the experiment, and the results were as follows: Figure 5 As shown in the figure. It can be seen that in each mouse 5×10 5 At low doses of 18.2-CAR cells, compared to NT cells, 18.2-CAR T cells did not exhibit a significant tumor-suppressive effect. Unexpectedly, 18.2-CAR-XCL1 T cells maintained tumor volume at a low level from day 30 until the end of the experiment without recurrence, demonstrating a significant tumor-suppressive effect. This indicates that additional XCL1 expression can significantly enhance the tumor-suppressive effect of CAR-T cells.

[0131] Example 5. Preparation of CAR-T cells co-expressing cytokines and verification of their function.

[0132] CAR-T cells co-expressing cytokines were prepared according to the method described in Example 2, wherein the hCAR-3 plasmid further contained XCL1 (SEQ ID NO: 48) and IL7 (SEQ ID NO: 46) linked by a 2A peptide, and were named 18.2-CAR-XCL1-IL7 T cells. The cytotoxic activity of these CAR-T cells against target cells was detected according to the method described in Example 3.1, and the results are as follows. Figure 6 As shown (where 18.2-CAR is hCAR-3). It can be seen that the killing activity of 18.2-CAR-XCL1-IL7 T cells and 18.2-CAR T cells alone against target cells is comparable, and both are significantly higher than that of control NT cells.

[0133] Furthermore, the in vivo tumor-suppressing effect of CAR-T cells was detected according to the method described in Example 4, and the results are as follows: Figure 7As shown. It can be seen that 18.2-CAR XCL1-IL7 T cells exhibit a significant tumor inhibition effect compared with 18.2-CAR T cells. It can be seen that the additional expression of XCL1+IL7 combination can significantly enhance the tumor inhibition effect of CAR-T cells.

[0134] It should be noted that the above is only a preferred embodiment of the present application and is not intended to limit the present application. Those skilled in the art can make various modifications and changes to the present application. Those skilled in the art understand that any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Nanjing Beiheng Biotechnology Co., Ltd. <120> Nanobodies targeting Claudin 18.2 and uses thereof <130> BHCN39V1 <150> 2021105908018 <151> 05 / 28 / 2021 <160> 56 <170> SIPOSequenceListing 1.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CDR1 <400> 1 Gly Ser Ile Phe Leu Ile Asn 1 5 <210> 2 <211> 5 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CDR2 <400> 2 Thr Arg Gly Gly Ser 1 5 <210> 3 <211> 14 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CDR3 <400> 3 Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe 1 5 10 <210> 4 <211> 25 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR1 <400> 4 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 5 <211> 19 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR2 <400> 5 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 1 5 10 15 Ala Val Ile <210> 6 <211> 41 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR3 <400> 6 Ala Asn Tyr Thr Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 1 5 10 15 Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu 20 25 30 Asp Thr Ala Val Tyr Tyr Cys Asn Ala 35 40 <210> 7 <211> 11 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR4 <400> 7 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 1 5 10 <210> 8 <211> 25 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR1 <400> 8 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 9 <211> 19 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> FR2 <400> 9 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 1 5 10 15 Ala Val Ile <210> 10 <211> 11 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> FR4 <400> 10 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1 5 10 <210> 11 <211> 41 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> FR3 <400> 11 Ala Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 1 5 10 15 Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 20 25 30 Asp Thr Ala Val Tyr Tyr Cys Asn Ala 35 40 <210> 12 <211> 41 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR3 <400> 12 Ala Asn Tyr Thr Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 1 5 10 15 Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu 20 25 30 Asp Thr Ala Val Tyr Tyr Cys Asn Ala 35 40 <210> 13 <211> 41 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> FR3 <400> 13 Ala Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp 1 5 10 15 Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu 20 25 30 Asp Thr Ala Val Tyr Tyr Cys Asn Ala 35 40 <210> 14 <211> 122 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> Camelid Nanobody <400> 14 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Leu Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Val Ile Thr Arg Gly Gly Ser Ala Asn Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 15 <211> 122 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> Humanized Nanobody 1 <400> 15 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser He Phe Leu He Asn 20 25 30 Ala Met Gly Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Val He Thr Arg Gly Gly Ser Ala Asn Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe Trp 100 105 110 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 16 <211> 122 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 2 <400> 16 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Leu Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Val Ile Thr Arg Gly Gly Ser Ala Asn Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe Trp 100 105 110 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 17 <211> 122 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 3 <400> 17 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Leu Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Val Ile Thr Arg Gly Gly Ser Ala Asn Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe Trp 100 105 110 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 18 <211> 122 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 4 <400> 18 Gln Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Leu Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gin Ala Pro Gly Lys Gin Arg Glu Leu Val 35 40 45 Ala Val Ile Thr Arg Gly Gly Ser Ala Asn Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Leu Asn Leu Arg Ser Asp Pro Phe Lys Trp Tyr Thr Phe Trp 100 105 110 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 19 <211> 366 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> Camelid Nanobody <400> 19 caggtgcagc ttgtagagag cggaggagga ttggtacaac cgggggggtc tctcagactt 60 tcttgcgcag caagtggatc tatatttctc attaacgcaa tgggttggta cagacaggcc 120 cctggtaaac agagagagct tgtggcagta ataactagag gtgggagtgc taattatact 180 gattccgtca aaggtcggtt cacaatcagc agggacaacg ccaaaaatac agtttatttg 240 cagatgaaca gtctcaaacc cgaagatacc gccgtttact attgcaacgc tgatctgaat 300 ctgcggagtg acccattcaa gtggtacacc ttctggggcc agggcacaca agttactgta 360 tctagc 366 <210> 20 <211> 366 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> Humanized Nanobody 1 <400> 20 gaagttcaat tgctggagag tgggggcggc ctcgtccagc cggggggaag tttgaggctg 60 agctgtgccg caagtggctc tattttcctt ataaacgcca tgggttgggt ccggcaagcg 120 cctggaaaag gacttgagct cgtcgccgtt attacgcgag gaggttctgc aaactatacg 180 GATTCCGTTA AGGGAAGATT CACAATCAGT CGAGACAACT CCAAAAATACT TTGTATTTC 240 CAATGAACAG ATCCGAGCTG AAGATAAGCCGTCTATTATTGCAACGC GGATCTGAA 300 CTTAGATCCC ACCCATTCAA GTGGTACACC TTTTGGGGAC AGGGCACCTC TGTAACG 360 TCAAGC 366 <210> 21 <211> 366 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 2 <400> 21 CAGGTACAGC TCGTAGAGAG TGGAGGCAGC TTGTTACAAC CAGGCAGCTC ACTTCGACTT 60 AGTTGCAGGC TTTCAGGAGT ATATTTCCTC ATAAATGCAA TGGGCTGGTA TCAGCAAGCG 120 CCAGGAAAAC AACGAGAGCT CGTAGCAGTG ATCATTAGGG GTGGTAGCGC CAATTATGCC 180 GACAGTGTAA AGGAAGATTC ACCATTTCAC GCAGACAACG TAAGAATACA CTGTACCTT 240 CAGATGAACA TCATGAGGGC CGAAGACACC GCTGTCTACT ACTGTAATGC GGATCTCAA 300 TCTAGGTCTG ATCCATTCAA GTGGAACACA TTTTGGGGGC AAGGCACACT CGTAAC 360 TCAAGC 366 <210> 22 <211> 366 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 3 <400> 22 caggtccagc tcgttgaatc tggcggcggg ctcgtgcagc ctggagggtc acttcgcttg 60 tcttgtgctg catctggatc aatttttctt atcaacgcga tgggatggta tcggcaggca 120 ccaggtaaac agagagaact ggttgccgtg attacgaggg ggggtagtgc caactatacc 180 gatagcgtga agggaaggtt cacaatatcc agagacaacg ccaagaatac cgtatatttg 240 cagatgaact cactcagggc agaggataca gcggtctatt actgtaacgc agacctgaat 300 ttgcgctctg atcccttcaa atggtacaca ttttgggggc aggggactct tgtcactgtg 360 tctagc 366 <210> 23 <211> 366 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> Humanized Nanobody 4 <400> 23 caggttcaac ttgttgagag tggaggtggg ctggtacagc caggaggtag tctcaggttg 60 tcctgcgccg caagcggttc tatcttcctg attaatgcaa tgggatggta ccgccaggct 120 ccgggcaaac aacgcgagct ggtagcggtg atcacgcgag ggggatcagc aaactatgca 180 gattcagtca aaggcagatt cacaatctcc cgcgacaaca gcaaaaacac tctctatctt 240 caaatgaata gtcttaagcc cgaagatact gctgtgtatt attgtaacgc ggacctcaat 300 cttcgatcag atcctttcaa atggtacacc ttctggggcc aaggcaccct ggtcacggta 360 agtagc 366 <210> 24 <211> 25 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> CD8α <400> 24 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr Cys Lys 20 25 <210> 25 <211> 75 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> CD8α <400> 25 atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc 60 accctttact gcaaa 75 <210> 26 <211> 27 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 transmembrane domain <400> 26 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 1 5 10 15 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25 <210> 27 <211> 81 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 transmembrane domain <400> 27 ttttgggtcc tcgtcgtagt tggaggggta cttgcctgtt atagcctcct ggttaccgta 60 gcatttatta tattctgggt g 81 <210> 28 <211> 41 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 costimulatory domain <400> 28 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 29 <211> 123 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 costimulatory domain <400> 29 aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60 gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120 tcc 123 <210> 30 <211> 40 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> 4-1BB costimulatory domain <400> 30 Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg 1 5 10 15 Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro 20 25 30 Glu Glu Glu Glu Gly Gly Cys Glu 35 40 <210> 31 <211> 120 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> 4-1BB costimulatory domain <400> 31 cggggcagaa agaaactcct gtatatattc aaacaaccat ttatgagacc agtacaaact 60 actcaagagg aagatggctg tagctgccga tttccagaag aagaagaagg aggatgtgaa 120 <210> 32 <211> 113 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 32 Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 1 5 10 15 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 20 25 30 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 35 40 45 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 50 55 60 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 65 70 75 80 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 85 90 95 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 100 105 110 Arg <210> 33 <211> 339 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> CD3ζ signal transduction domain <400> 33 ctgagagtga agttcagcag gagcgcagac gcccccgcgt accagcaggg ccagaaccag 60 ctctataacg agctcaatct aggacgaaga gaggagtacg atgttttgga caagagacgt 120 ggccgggacc ctgagatggg gggaaagccg agaaggaaga accctcagga aggcctgtac 180 aatgaactgc agaaagataa gatggcggag gcctacagtg agattgggat gaaaggcgag 240 cgccggaggg gcaaggggca cgatggcctt taccagggtc tcagtacagc caccaaggac 300 acctacgacg cccttcacat gcaggccctg ccccctcgc 339 <210> 34 <211> 114 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 34 Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin 1 5 10 15 Gly Gin Asn Gin Leu Phe Asn Gin Leu Asn Leu Gly Arg Arg Gin Gin 20 25 30 Phe Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Gin Met Gly Gly 35 40 45 Lys Pro Gin Arg Arg Lys Asn Pro Gin Gin Gin Leu Tyr Asn Gin Leu 50 55 60 Gln Gin Asp Lys Met Ala Glu Ala Tyr Ser Gin Leu Gly Met Gin Gin 65 70 75 80 Glu Arg Arg Arg Gly Lys Gin His Asp Gly Leu Phe Gin Gin Leu Ser 85 90 95 Thr Ala Thr Lys Asp Thr Phe Asp Ala Leu His Met Gin Gin Leu Pro 100 105 110 Pro Arg <210> 35 <211> 342 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD3 zeta signaling domain <400> 35 ctgagagtga agttcagcag gagcgcagac gcccccgcgt accagcaggg ccagaaccag 60 ctctttaacg agctcaatct aggacgaaga gaggagttcg atgttttgga caagagacgt 120 ggccgggacc ctgagatggg gggaaagccg cagagaagga agaaccctca ggaaggcctg 180 tacaatgaac tgcagaaaga taagatggcg gaggcctaca gtgagattgg gatgaaaggc 240 gagcgccgga ggggcaaggg gcacgatggc cttttccagg gtctcagtac agccaccaag 300 gacacctttg acgcccttca catgcaggcc ctgccccctc gc 342 <210> 36 <211> 20 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> B2M signal peptide <400> 36 Met Ser Arg Ser Val Ala Leu Ala Val Leu Ala Leu Leu Ser Leu Ser 1 5 10 15 Gly Leu Glu Ala 20 <210> 37 <211> 60 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> B2M signal peptide <400> 37 atgtcccgct ctgttgcttt ggctgtgctg gcccttttgt cccttagcgg actggaggcc 60 <210> 38 <211> 21 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8a signal peptide <400> 38 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 39 <211> 63 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8a signal peptide <400> 39 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccg 63 <210> 40 <211> 45 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8a hinge region <400> 40 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr lie Ala 1 5 10 15 Ser Gin Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 41 <211> 135 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD8 alpha hinge region <400> 41 accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60 tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120 gacttcgcct gtgat 135 <210> 42 <211> 39 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 hinge region <400> 42 Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn 1 5 10 15 Gly Thr lie lie His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu 20 25 30 Phe Pro Gly Pro Ser Lys Pro 35 <210> 43 <211> 117 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> CD28 Hinge Region <400> 43 attgaagtta tgtatcctcc tccttaccta gacaatgaga agagcaatgg aaccattatc 60 catgtgaaag ggaaacacct ttgtccaagt cccctatttc ccggaccttc taagccc 117 <210> 44 <211> 12 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> IgG4 Hinge Region <400> 44 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro 1 5 10 <210> 45 <211> 36 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> IgG4 Hinge Region <400> 45 gaaagcaaat acgggccgcc gtgtccaccc tgtccg 36 <210> 46 <211> 402 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> hIL-7 <400> 46 atgttccatg tttcttttag gtatatcttt ggacttcctc ccctgatcct tgttctgttg 60 ccagtagcat catctgattg tgatattgaa ggtaaagatg gcaaacaata tgagagtgtt 120 ctaatggtca gcatcgatca attattggac agcatgaaag aaattggtag caattgcctg 180 aataatgaat ttaacttttt taaaagacat atctgtgatg ctaataaggt taaaggaaga 240 aaaccagctg ccctgggtga agcccaacca acaaagagtt tggaagaaaa taaatcttta 300 aaggaacaga aaaaactgaa tgacttgtgt ttcctaaaga gactattaca agagataaaa 360 acttgttgga ataaaatttt gatgggcact aaagaacact ga 402 <210> 47 <211> 133 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> hIL-7 <400> 47 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys 20 25 30 Asp Gly Lys Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu 35 40 45 Leu Asp Ser Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe 50 55 60 Asn Phe Phe Lys Arg His Ile Cys Asp Ala Asn Lys Val Lys Gly Arg 65 70 75 80 Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys Ser Leu Glu Glu 85 90 95 Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp Leu Cys Phe Leu 100 105 110 Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn Lys Ile Leu Met 115 120 125 Gly Thr Lys Glu His 130 <210> 48 <211> 345 <212> DNA <213> Artificial Sequence(Artificial Sequence) <220> <223> hXCL‑1 <400> 48 atgagacttc tcatcctggc cctccttggc atctgctctc tcactgcata cattgtggaa 60 ggtgtaggga gtgaagtctc agataagagg acctgtgtga gcctcactac ccagcgactg 120 ccggttagca gaatcaagac ctacaccatc acggaaggct ccttgagagc agtaattttt 180 attaccaaac gtggcctaaa agtctgtgct gatccacaag ccacgtgggt gagagacgtg 240 gtcaggagca tggacaggaa atccaacacc agaaataaca tgatccagac caagccaaca 300 ggaacccagc aatcgaccaa tacagctgtg accctgactg gctag 345 <210> 49 <211> 114 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> hXCL‑1 <400> 49 Met Arg Leu Leu Ile Leu Ala Leu Leu Gly Ile Cys Ser Leu Thr Ala 1 5 10 15 Tyr Ile Val Glu Gly Val Gly Ser Glu Val Ser Asp Lys Arg Thr Cys 20 25 30 Val Ser Leu Thr Thr Gln Arg Leu Pro Val Ser Arg Ile Lys Thr Tyr 35 40 45 Thr lie Thr Glu Gly Ser Leu Arg Ala Val lie Phe lie Thr Lys Arg 50 55 60 Gly Leu Lys Val Cys Ala Asp Pro Gin Ala Thr Trp Val Arg Asp Val 65 70 75 80 Val Arg Ser Met Asp Arg Lys Ser Asn Thr Arg Asn Asn Met lie Gin 85 90 95 Thr Lys Pro Thr Gly Thr Gin Gin Ser Thr Asn Thr Ala Val Thr Leu 100 105 110 Thr Gly <210> 50 <211> 465 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> mIL-7 <400> 50 atgttccatg tttcttttag atatatcttt ggaattcctc cactgatcct tgttctgctg 60 cctgtcacat catctgagtg ccacattaaa gacaaagaag gtaaagcata tgagagtgta 120 ctgatgatca gcatcgatga attggacaaa atgacaggaa ctgatagtaa ttgcccgaat 180 aatgaaccaa acttttttag aaaacatgta tgtgatgata caaaggaagc tgcttttcta 240 aatcgtgctg ctcgcaagtt gaagcaattt cttaaaatga atatcagtga agaattcaat 300 gtccacttac taacagtatc acaaggcaca caaacactgg tgaactgcac aagtaaggaa 360 gaaaaaaacg taaaggaaca gaaaaagaat gatgcatgtt tcctaaagag actactgaga 420 gaaataaaaa cttgttggaa taaaattttg aagggcagta tataa 465 <210> 51 <211> 154 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> mIL‑7 <400> 51 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Thr Ser Ser Glu Cys His Ile Lys Asp Lys 20 25 30 Glu Gly Lys Ala Tyr Glu Ser Val Leu Met Ile Ser Ile Asp Glu Leu 35 40 45 Asp Lys Met Thr Gly Thr Asp Ser Asn Cys Pro Asn Asn Glu Pro Asn 50 55 60 Phe Phe Arg Lys His Val Cys Asp Asp Thr Lys Glu Ala Ala Phe Leu 65 70 75 80 Asn Arg Ala Ala Arg Lys Leu Lys Gln Phe Leu Lys Met Asn Ile Ser 85 90 95 Glu Glu Phe Asn Val His Leu Leu Thr Val Ser Gin Gly Thr Gin Thr 100 105 110 Leu Val Asn Cys Thr Ser Lys Glu Glu Lys Asn Val Lys Glu Gin Lys 115 120 125 Lys Asn Asp Ala Cys Phe Leu Lys Arg Leu Leu Arg Glu He Lys Thr 130 135 140 Cys Trp Asn Lys He Leu Lys Gly Ser He 145 150 <210> 52 <211> 345 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> mXCL-1 <400> 52 atgagacttc tcctcctgac tttcctggga gtctgctgcc tcaccccatg ggttgtggaa 60 ggtgtgggga ctgaagtcct agaagagagt agctgtgtga acttacaaac ccagcggctg 120 ccagttcaaa aaatcaagac ctatatcatc tgggaggggg ccatgagagc tgtaattttt 180 gtcaccaaac gaggactaaa aatttgtgct gatccagaag ccaaatgggt gaaagcagcg 240 atcaagactg tggatggcag ggccagtacc agaaagaaca tggctgaaac tgttcccaca 300 ggagcccaga ggtccaccag cacagcagta accctgactg ggtaa 345 <210> 53 <211> 114 <212> PRT <213> Artificial Sequence(Artificial Sequence) <220> <223> mXCL‑1 <400> 53 Met Arg Leu Leu Leu Leu Thr Phe Leu Gly Val Cys Cys Leu Thr Pro 1 5 10 15 Trp Val Val Glu Gly Val Gly Thr Glu Val Leu Glu Glu Ser Ser Cys 20 25 30 Val Asn Leu Gln Thr Gln Arg Leu Pro Val Gln Lys Ile Lys Thr Tyr 35 40 45 Ile Ile Trp Glu Gly Ala Met Arg Ala Val Ile Phe Val Thr Lys Arg 50 55 60 Gly Leu Lys Ile Cys Ala Asp Pro Glu Ala Lys Trp Val Lys Ala Ala 65 70 75 80 Ile Lys Thr Val Asp Gly Arg Ala Ser Thr Arg Lys Asn Met Ala Glu 85 90 95 Thr Val Pro Thr Gly Ala Gln Arg Ser Thr Ser Thr Ala Val Thr Leu 100 105 110 Thr Gly <210> 54 <211> 345 <212> DNA <213> Artificial Sequence (Artificial Sequence) <220> <223> hXCL2 <400> 54 atgagacttc tcatcctggc cctccttggc atctgctctc tcactgcata cattgtggaa 60 ggtgtaggga gtgaagtctc acataggagg acctgtgtga gcctcactac ccagcgactg 120 ccagttagca gaatcaagac ctacaccatc acggaaggct ccttgagagc agtaattttt 180 attaccaaac gtggcctaaa agtctgtgct gatccacaag ccacgtgggt gagagacgtg 240 gtcaggagca tggacaggaa atccaacacc agaaataaca tgatccagac caagccaaca 300 ggaacccagc aatcgaccaa tacagctgtg accctgactg gctag 345 <210> 55 <211> 114 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> hXCL2 <400> 55 Met Arg Leu Leu Ile Leu Ala Leu Leu Gly Ile Cys Ser Leu Thr Ala 1 5 10 15 Tyr Ile Val Glu Gly Val Gly Ser Glu Val Ser His Arg Arg Thr Cys 20 25 30 Val Ser Leu Thr Thr Gin Arg Leu Pro Val Ser Arg lie Lys Thr Tyr 35 40 45 Thr He Thr Glu Gly Ser Leu Arg Ala Val He Phe He Thr Lys Arg 50 55 60 Gly Leu Lys Val Cys Ala Asp Pro Gin Ala Thr Trp Val Arg Asp Val 65 70 75 80 Val Arg Ser Met Asp Arg Lys Ser Asn Thr Arg Asn Asn Met He Gin 85 90 95 Thr Lys Pro Thr Gly Thr Gin Gin Ser Thr Asn Thr Ala Val Thr Leu 100 105 110 Thr Gly <210> 56 <211> 18 <212> PRT <213> Artificial Sequence (Artificial Sequence) <220> <223> T2A <400> 56 Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro 1 5 10 15 Gly Pro

Claims

1. A humanized nanobody conjugated with Claudin18.2, comprising three complementarity-determining regions CDR1, CDR2, and CDR3 and four framework regions FR1, FR2, FR3, and FR4, wherein CDR1 is shown in SEQ ID NO: 1, CDR2 is shown in SEQ ID NO: 2, and CDR3 is shown in SEQ ID NO: 3, and comprises: (1) The amino acid sequence shown in SEQ ID NO: 15; or (2) FR1 as shown in SEQ ID NO:4, FR2 as shown in SEQ ID NO:5, FR3 as shown in SEQ ID NO:12 or 13, and FR4 as shown in SEQ ID NO:

10.

2. The nanobody of claim 1, wherein the nanobody has 100% sequence identity with an amino acid sequence selected from SEQ ID NO: 15, 17 or 18, and is capable of specifically binding to the Claudin18.2 antigen.

3. A nucleic acid molecule encoding the nanobody of claim 1 or 2.

4. The nucleic acid molecule of claim 3, wherein it has at least 90% sequence identity with the nucleotide sequences selected from SEQ ID NO: 20-23.

5. A carrier comprising a nucleic acid molecule encoding the nanobody of claim 1 or 2.

6. A host cell expressing the nanobody of claim 1 or 2.

7. A chimeric antigen receptor comprising the nanobody of claim 1 or 2, the CD8α transmembrane domain, the 4-1BB co-stimulatory signal transduction domain, and the CD3ζ intracellular signal transduction domain.

8. An engineered immune cell comprising the chimeric antigen receptor of claim 7.

9. The engineered immune cells of claim 8 are selected from T cells, NK cells, NKT cells, macrophages, and dendritic cells.

10. The engineered immune cell of claim 9, wherein the T cell is selected from CD4+ / CD8+ T cells, CD4+ helper T cells, CD8+ T cells, tumor-infiltrating cells, memory T cells, naive T cells, CD4-CD8- T cells, regulatory T cells, γδ- T cells, and αβ- T cells.

11. The engineered immune cells according to any one of claims 8-10, further expressing cytokines, said cytokines being selected from XCL1, XCL2, or any combination of XCL1, XCL2 and IL7.

12. An antibody conjugate comprising the nanobody of claim 1 or 2 and a second functional structure, wherein the second functional structure is selected from Fc, radioisotopes, structural portions with extended half-life, and detectable markers.

13. The antibody conjugate of claim 12, wherein the extended half-life structural portion is selected from: albumin-binding structures, transferrin-binding structures, polyethylene glycol molecules, and human serum albumin; and the detectable marker is selected from chemiluminescent compounds, bioluminescent compounds, enzymes, antibiotic resistance genes, and contrast agents.

14. A diagnostic kit comprising the nanobody of claim 1 or 2, the chimeric antigen receptor of claim 7, the engineered immune cell of any one of claims 8-11, or the antibody-drug conjugate of claim 12 or 13.

15. A pharmaceutical composition comprising a nanobody of claim 1 or 2, a chimeric antigen receptor of claim 7, an engineered immune cell of any one of claims 8-11, or an antibody-drug conjugate of claim 12 or 13, and one or more pharmaceutically acceptable excipients.

16. Use of the nanobody of claim 1 or 2, the chimeric antigen receptor of claim 7, the engineered immune cell of any one of claims 8-11, the antibody-drug conjugate of claim 12 or 13, or the pharmaceutical composition of claim 15 in the preparation of a medicament for the treatment and / or prevention and / or diagnosis of gastric cancer.

Images